![]()
|
|
||||||||
(Received for publication, February 28,
1995; and in revised form, May 9, 1995) From the
In mammalian cells, Various mammalian In earlier
studies, we had purified the Regions of identical
amino acid sequences between the yeast and the rabbit
In this study, it is shown that, in
contrast to the catalytic domain of clone 416, that of clone 4 is
poorly secreted when expressed as a secreted protein A fusion protein
and that a single point mutation, characteristic of clone 4, converting
Phe
PCR amplifications were
performed in 25-µl volumes containing 3 µl each of cDNA, 50
mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM
MgCl
Figure 1:
Schematic representation of
clone 4 and reconstituted clone 416 and their derived recombinants. The
sequence of the complete ORF (641 amino acids) is shown at the top, indicating the three positions that differ in the
catalytic domain of clones 4 and 416: the putative transmembrane domain (TMD), the putative calcium-binding EF-hand (EF
HAND), and the single concensus N-glycosylation site at
Asn
Figure 2:
SDS-PAGE analysis of the secreted protein
A mannosidase fusion proteins. COS7 cells were transfected with either
pPak (V), pPakman(4/106) (4, 106),
pPakman(4/171) (4, 171), pPakman(416/106) (416, 106), and pPakman(416/171) (416, 171) and metabolically labeled with
[
The individual
contribution of each point mutation to the differential secretion and
enzymatic activity of the fusion proteins derived from clone 4 and
clone 16 was assessed by testing the six recombinants corresponding to
the two possible sequence permutations (C or T) at nucleotides 1232
(amino acid 411), 1402 (amino acid 468), and 1775 (amino acid 592):
pPakman(CCT/106), pPakman(CTT/106), pPakman(CTC/106), pPakman(TCC/106),
pPakman(TTC/106), and pPakman(TCT/106) (Fig. 3A). The
fusion proteins that do not display any
Figure 3:
SDS-PAGE analysis of mutant secreted
fusion proteins. A, COS7 cells were transfected with 10 µg
of each of the following plasmids: lane 1, pPak (V); lane 2, pPakman(4/106) (C/C/C); lane 3,
pPakman(CCT/106) (C/C/T); lane 4, pPakman(CTT/106) (C/T/T); lane 5, pPakman(CTC/106) (C/T/C); lane 6, pPakman(TCC/106) (T/C/C); lane 7,
pPakman(TTC/106) (T/T/C); lane 8, pPakman(TCT/106) (T/C/T); lane 9, pPakman(416/106) (T/T/T). B, the fusion proteins following transfection with either
different amounts of construct or with different numbers of plates were
analyzed. Lane 1, 10 µg of pPak (V); lane
2, the combined medium of 4 plates following transfection with 10
µg of pPakman(TTC/106) (T/T/C); lane 3, 10 µg
of pPakman(416/106) (T/T/T); lane 4, 10 µg of
pPakman(TTC/106) (T/T/C); lane 5, 2.5 µg of
pPakman(416/106) (T/T/T). Cells were metabolically labeled
with [
This report describes a comparison between two cDNA clones
encoding Class 1 Even though clone 16 is incomplete, we showed
previously (14) that the missing N-terminal region is not
required for Note Added in Proof-The conserved sequence has also been found
in a Drosophila
Volume 270,
Number 30,
Issue of July 28, pp. 17736-17740, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
-1,2-Mannosidase IB cDNA Clones Differ
in Three Point Mutations
MUTATION OF Phe TO Ser
IS SUFFICIENT TO
ABOLISH ENZYME ACTIVITY (*)
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-1,2-mannosidases play an essential
role in the early steps of N-linked oligosaccharide
maturation. We previously reported (Herscovics, A., Schneikert, J.,
Athanassiadis, A., and Moremen, K. W.(1994) J. Biol. Chem. 269, 9864-9871) the isolation of mouse
-mannosidase IB
cDNA clones from a Balb/c 3T3 cDNA library. Clone 4 encodes a type II
membrane protein of 641 amino acids with a cytoplasmic tail of 35 amino
acids, followed by a transmembrane domain and a large C-terminal
catalytic domain, whereas clone 16 encodes only the last 471 amino
acids. Their overlapping sequences (from amino acid 152) are identical,
except for three point mutations that result in three amino acid
differences in the catalytic domain of the enzyme (Thr,
Leu
, and Ser
in clone 4 to
Met
, Phe
, and Phe
in clone
16, respectively). Both sequences could be amplified by polymerase
chain reaction using templates of cDNAs derived from colon and brain of
CD1 mice and from L cells derived from the C3H/An mouse, indicating
that both are natural isoforms found in two inbred and one outbred
mouse strains. When expressed in COS7 cells as a secreted protein A
fusion protein, the catalytic domain of clone 16 displays
-1,2-mannosidase activity using
[
H]mannose-labeled Man
GlcNAc as
substrate, but the corresponding region of clone 4 is poorly secreted
under identical conditions. The contribution of each point mutation to
this differential secretion and enzyme activity of the two fusion
proteins was assessed by testing the six recombinants corresponding to
all the possible sequence permutations. Mutation of Phe to Ser
, as found in clone 4, is sufficient to
abolish
-1,2-mannosidase activity, whereas mutation of Met to Thr
or of Phe
to Leu
affects secretion with relatively little effect on enzyme
activity. Phe
is part of a highly conserved region that
seems important for enzyme activity of class 1
-1,2-mannosidases.
-Mannosidases play an essential role in the maturation of N-linked oligosaccharides in mammalian cells (for reviews, see (1) and (2) ). Following removal of the three glucose
residues from the oligosaccharide precursor
Glc
Man
GlcNAc
,
-1,2-mannosidases in the endoplasmic reticulum and in the Golgi
remove up to four mannose residues to form
Man
GlcNAc
. Then, following the addition of one
residue of N-acetylglucosamine,
-mannosidase II removes
two additional mannose residues from
GlcNAcMan
GlcNAc
. The resulting
GlcNAcMan
GlcNAc
is the oligosaccharide
precursor for the elaboration by Golgi glycosyltransferases of the
variety of complex oligosaccharides found on mature glycoproteins.
-1,2-mannosidases with somewhat different
properties and subcellular localizations have been described, but the
number of these enzymes involved in the early stages of maturation of N-linked oligosaccharides is still not clearly established (2) . Recently, several mammalian
-1,2-mannosidases
capable of trimming Man
GlcNAc to Man
GlcNAc have
been cloned from different sources. Using amino acid sequence
information obtained from purified enzymes(3, 4) ,
closely related cDNAs encoding
-1,2-mannosidases of 71-73
kDa from rabbit liver and mouse 3T3 cells (5) and from human
kidney (6) have been isolated. Their deduced amino acid
sequences are about 90% identical, most likely representing species
variation. They have a similar type II transmembrane topology with a
cytoplasmic tail of 20-40 amino acids, a single transmembrane
domain, and a lumenally oriented C-terminal catalytic domain. The mouse
enzyme was called
-1,2-mannosidase IA because it cross-reacts with
antibodies previously raised against purified rat
-1,2-mannosidase
IA(2, 5, 7, 8) .
-1,2-mannosidase from Saccharomyces cerevisiae that removes a single specific
mannose residue from Man
GlcNAc (9, 10, 11) and isolated its gene (MNS1)(12) . This
-1,2-mannosidase is also a type
II membrane protein of 63 kDa with little cytoplasmic tail. Although it
has a different specificity because it only removes one specific
mannose from Man
GlcNAc, the yeast
-1,2-mannosidase
catalytic domain exhibits about 36% amino acid identity with the
catalytic domains of the above mammalian
-1,2-mannosidases.
Recently, we proposed a classification of
-mannosidases based on
sequence homology and common properties(2) . The above
mammalian and yeast
-1,2-mannosidases belong to Class 1
-mannosidases. These are all calcium-dependent enzymes that are
inhibited by 1-deoxymannojirimycin. In contrast, Class 2
-mannosidases that can remove
-1,2-,
-1,3-, and
-1,6-linked mannose residues are inhibited by swainsonine. Class 2
enzymes include Golgi
-mannosidase II, endoplasmic
reticulum/cytosolic
-mannosidase, and lysosomal and vacuolar
-mannosidases from different sources.
-1,2-mannosidase were used to design degenerate oligonucleotides
for PCR.
(
)Two distinct PCR products that are
65% identical in amino acid sequence were amplified from mouse liver
cDNA(13) . One of these PCR products was derived from the mouse
-1,2-mannosidase IA cDNA described above(5) , and the
other was used as a probe to screen a 3T3 cDNA library(13) .
The two largest cDNA clones isolated from the 3T3 library were
characterized. Clone 4 (2.6 kilobase pairs) contains a complete ORF
that encodes a 641-amino-acid putative type II transmembrane protein
and a long 5`-untranslated region (589 base pairs), whereas clone 16
(2.2 kilobase pairs) is a partial cDNA that encodes only the last 471
amino acids of the ORF, followed by 700 base pairs of 3`-untranslated
region(13) . The overlapping sequences between clone 4 and
clone 16, which begin at amino acid 152, are identical, except at
nucleotide positions 1232, 1402, and 1775, where, in each case, thymine
residues in clone 16 are replaced by cytosine in clone 4. These point
mutations are not conservative because they encode different amino
acids in the deduced protein sequences: Thr,
Leu
, and Ser
in clone 4 and
Met
, Phe
, and Phe
in clone 16
(using a clone 4-based numbering). Clone 416 was reconstituted by
combining the 5` coding sequences from clone 4 with the 3` coding
region of clone 16 to obtain a full-length ORF(13) . When
expressed as secreted protein A fusion proteins, truncated forms of
clone 416 encoding either amino acids 106-641 or amino acids
171-641 were shown to catalyze the removal of four mannose
residues from Man
GlcNAc in vitro(14) . We
have named this enzymatically active clone 416, mouse
-1,2-mannosidase IB(2, 13, 14) . Both
-1,2-mannosidases IA and IB (clone 4 and reconstituted clone 416)
localize to the Golgi following transfection of cells in
culture(5, 13) , but Northern blots show that they
have very distinct patterns of cell-specific expression (5, 13) . to Ser
is sufficient to abolish the
enzymatic activity of the protein.
Materials
Materials were obtained from the
following sources. Taq polymerase, bovine serum albumin, and
concanavalin A were from Boehringer Mannheim. Restriction enzymes, cell
culture media, and reagents were from Life Technologies, Inc. The
DEAE-dextran, T7 sequencing kit, Sephadex G-50 Nick columns, Sepharose
6B, and Sepharose 6FF were from Pharmacia Biotech Inc.
[S]Methionine and
I-labeled goat
anti-mouse IgG were from ICN Radiochemicals (Saint-Laurent,
Qubec). The Superscript reverse transcriptase
kit was from Life Technologies, Inc. The TA vector cloning kit was from
Stratagene (La Jolla, CA). Oligonucleotides were prepared at the
Sheldon Biotechnology Center (McGill University) on a Gene-Assembler
Plus from Pharmacia Biotech Inc. according to the manufacturer's
instructions.
Reverse Transcriptase PCR Experiments
cDNA
synthesis was performed from colon and brain of CD1 mice and from L
cells poly(A) RNA. 1 µg of poly(A)
RNA was added in a 20-µl final reaction volume containing 20
mM Tris-HCl, pH 8.4, 50 mM KCl, 2.5 mM MgCl
, 1 mg/ml bovine serum albumin, 10 mM dithiothreitol, 500 µM each dATP, dCTP, dGTP and
dTTP, 2.5 ng of random hexamers, and 200 units of Superscript reverse
transcriptase. cDNA synthesis was allowed to proceed at 42° C for
90 min. The volume was adjusted to 100 µl with 100 mM KCl
in 10 mM Tris-HCl, pH 8, and the cDNA was extracted twice with
phenol/chloroform (1:1) saturated with 10 mM Tris-HCl, pH 8,
and then desalted on a Sephadex G-50 Nick column using 100 mM KCl in 10 mM Tris-HCl, pH 8, for chromatography. The cDNA
was eluted in 400 µl of the buffer.
, 0.001% gelatin, 200 µM dNTP, 2.5 units
of Taq polymerase, and 12.5 pmol of two oligonucleotides that
bracket the ORF of the mannosidase cDNA: the sense oligonucleotide
CGGTTCGATGTGTTGTA the 3` end of which is located at position -54
relative to the mannosidase A(+1)TG and the antisense
oligonucleotide GCAGGTACCTCATCGGACAGCAGGATTACC that contains the stop
codon of the ORF. 35 cycles were conducted as follows on a Perkin-Elmer
DNA thermal cycler 480: 1 min at 94° C, 1 min at 45° C, and 5
min at 72° C. The PCR products were fractionated on a 1% (w/v)
agarose gel, and the expected band was subcloned into the TA vector.
Subclones were partially sequenced using specific oligonucleotides
located near the three mismatches.Protein A Fusion Proteins Expression Vectors
The
constructs pPakman(416/106) and pPakman(416/171) were prepared from
pPROTA as described previously(14) , and the plasmids
pPakman(4/106) and pPakman(4/171) were designed in the same way (see Fig. 1). The recombinants pPakman(CCT/171), pPakman(CTT/171),
pPakman(TTC/171), pPakman(TCT/171), pPakman(CTC/171), and
pPakman(TCC/171) were made by taking advantage of the single unique AvaI and NdeI restriction sites located between the
first and second polymorphisms and between the second and third
polymorphisms that differentiate clone 4 and clone 416. The desired
fragments from either pPakman(416/171) or pPakman(4/171) were combined
to construct the different mutants: KpnI-AvaI + AvaI-KpnI, KpnI-NdeI + NdeI-KpnI, KpnI-AvaI + AvaI-NdeI + NdeI-KpnI.
(CHO). The arrow (amino acid 152)
indicates the beginning of clone 16, which was isolated from the 3T3
cDNA library. The protein A fusion constructs are shown below and contain either amino acids 106-641 or 171-641 of
clones 4 and 416 (Pakman(416/106), Pakman(4/106), Pakman(416/171), and
Pakman(4/171)) downstream of the transin signal peptide and the protein
A sequence. The names of the recombinant proteins are indicated on the right. The numbers refer to mannosidase amino acid positions
of clone 4.
DNA Sequencing
Sequencing to check the constructs
was done using the dideoxy chain termination method (15) with
specific mannosidase-derived oligonucleotides as primers.Transfection of COS7 Cells
COS7 cells were
maintained in Dulbecco's modified Eagle's medium
supplemented with 10% fetal calf serum (v/v), 1% (w/v) glutamine, 1%
(w/v) streptomycin, and 1% (w/v) penicillin. The day before
transfection, the cells were collected by trypsin treatment and divided
to get 50-70% confluency on the next day. Cells were transfected
by the DEAE-dextran plus chloroquine method using 17 ng/µl of
plasmid (10 µg/plate). Expression was allowed to proceed for
36-48 h.[
Expression of the protein A fusion proteins was
monitored by labeling with [S]Methionine
Labeling
S]methionine. 24 h
after transfection, cells were transferred for 2 h in
methionine-depleted Dulbecco's modified Eagle's medium
containing glutamine, antibiotics, and 10% (w/v) dialyzed fetal calf
serum. 100 µCi of [
S]methionine (1181
Ci/mmol)/10 ml of medium were added, and the cells were incubated for
another 16-24 h. The medium from each plate was harvested on ice,
complemented with a mixture of protease inhibitors (2 µg/ml each of
pepstatin A, leupeptin, and chymostatin) and centrifuged to remove
debris (2000
g for 10 min). A preadsorption step was
carried out for 2 h at 4° C with gentle agitation by adding 100
µl of Sepharose 6B (50% (v/v) slurry in phosphate-buffered saline)
to the supernatants. Sepharose 6B was removed by brief centrifugation
and replaced by 100 µl of IgG-Sepharose 6FF. Samples were rocked
overnight in the cold, and the beads were washed sequentially as
follows: 3
10 bead volumes of 50 mM Tris buffer, pH
7.6, containing 150 mM NaCl and 0.05% Tween 20 and 2
10 volumes of 5 mM ammonium acetate buffer, pH 5. Proteins
bound to the matrix were eluted twice with 2 volumes of 0.5 M acetic acid adjusted to pH 3.4 with 0.5 M ammonium
acetate. Both eluates were pooled, lyophilized, and redissolved in 25
µl/plate of SDS-PAGE sample loading buffer before SDS-PAGE
analysis. Control experiments were performed to verify that the amount
of beads was not limiting. The dried gels were exposed overnight to
Kodak X-OMAT AR films.
For assay of
-Mannosidase Assays
-mannosidase activity of the fusion proteins, the medium was
harvested before metabolic labeling 24 h after transfection, cleared,
and adsorbed as described above. The beads were washed three times with
10 volumes of 50 mM Tris buffer, pH 7.6, containing 150 mM NaCl and 0.05% Tween 20 and then three times with 10 volumes of 50
mM potassium phosphate buffer, pH 6.5, containing 1 mM CaCl
and 0.02% NaN
. Then 100 µl of
Sepharose beads slurry (50% (v/v) in 50 mM potassium phosphate
buffer containing 1 mM CaCl
and 0.02%
NaN
) were mixed with 10 µl of
[
H]mannose-labeled Man
GlcNAc (5000
cpm) prepared as described previously (9) and 7 µl of
bovine serum albumin (56 µg). All incubations were done in
duplicate for 4 h at 37° C. The amount of
[
H]mannose released was measured using the
concanavalin A/polyethylene glycol precipitation method as described
previously(16) .
Clones 4 and 16 Are Natural Isoforms
Because the
cDNA clones 4 and 16 were obtained by reverse transcription of Balb/c
3T3 mice poly(A) RNA, it was important to establish
the fidelity of reverse transcriptase during the preparation of the
cDNA library to ensure that the three base differences between the two
clones at nucleotides 1232, 1402, and 1775 of the catalytic domain are
naturally occurring variations. For that purpose, oligonucleotides that
bracket the ORF were designed for reverse transcriptase PCR experiments
using Taq polymerase and poly(A)
RNA from
outbred CD1 mouse brain and colon and from an L cell line derived from
the inbred C3H/An mouse. PCR products were subcloned, and several
random clones from each source were partially sequenced with specific
oligonucleotides located near the three mismatches. For colon, two out
of three clones had a C at nucleotides 1232, 1402, and 1775, whereas
the third clone had a T at these three positions. For brain, two out of
five displayed a T, whereas the three other clones had a C. Similarly,
for L cells two out of three clones had a C and the third had a T.
Thus, both types of sequences are represented in each population of PCR
products, regardless of the origin of poly(A)
RNA.
Each individual PCR product either contained a C or a T at all three
positions. Because it is unlikely that misreading by Taq polymerase would give such reproducible mutations, we conclude
that clone 4 and clone 16 isolated from the cDNA library are true
natural isoforms found in at least three different mouse strains.
Comparison of
Because the level of intracellular endogenous
-Mannosidase Activity in
Vitro
-mannosidase activity is relatively high, it is difficult to
demonstrate increased intracellular
-mannosidase activity
resulting from transient expression of the membrane-bound form of the
-mannosidase. To facilitate the comparison between clone 4 and
clone 16
-mannosidase activity, the assay was performed on
secreted protein A fusion proteins following transient expression in
COS7 cells (Fig. 1). For this purpose, a segment containing
either amino acids 106-641 or 171-641 from both mannosidase
isoforms was fused to the IgG binding domain of Staphylococcus
aureus protein A to allow purification of the secreted hybrid
proteins upon binding to IgG-coated beads. The expression vector
contains the transin signal peptide upstream of the protein A to allow
secretion(17) . These recombinants were named pPakman(416/106),
pPakman(4/106), pPakman(416/171), and pPakman(4/171). Fig. 2shows the SDS-PAGE fractionation of labeled proteins
immunoprecipitated with IgG-Sepharose from the medium of COS7 cells
transiently transfected with the above constructs following metabolic
labeling with [S]methionine. It is evident that
both clone 16-derived recombinants are secreted at a reasonable level
compared with protein A in the first lane (V) of Fig. 2.
-Mannosidase activity using Man
GlcNAc
as substrate is specifically associated with these proteins. In
contrast, both clone 4-derived fusion proteins are poorly secreted, and
no
-mannosidase activity is detectable.
S]methionine followed by immunoprecipitation
using IgG-Sepharose as described under ``Experimental
Procedures.'' Activity,
-1,2-Mannosidase activity
(cpm) was assayed as described under ``Experimental
Procedures.'' The positions of molecular mass markers are
indicated on the left in kDa.
-mannosidase activity (lanes 2, 5, 6, and 7) all have a C
at position 1775 encoding Ser. The results for clone 4
and 416 are shown in Fig. 3A, lanes 2 and 9, respectively. The mutant that has both Ser
and Thr
(Fig. 3A, lane 5),
as found in clone 4, is also poorly secreted. However, mutants with
Ser
alone or in combination with Leu
have
reasonable levels of secretion but no enzyme activity (Fig. 3A, lanes 6 and 7). To ensure
that the lack of enzyme activity is not due to differences in the
amount of protein being assayed, enzyme assays were performed on the
fusion proteins comparing their enzyme activity following transfection
with either different amounts of pPakman(416/106) and pPakman(TTC/106)
expression vectors or of different numbers of plates (Fig. 3B). It can be seen that there is a direct
relationship between the amount of protein and enzyme activity
following transfection with pPakman(416/106) (Fig. 3B,
compare lanes 3 and 5) but that, at similar levels of
protein expression, there is no
-mannosidase activity following
transfection with pPakman(TTC/106). Comparison of lanes 2 and 4 with lane 5 in Fig. 3B shows that
the lack of activity when Phe is mutated to Ser
is not due to protein level. Similar results were obtained when
the products of pPakman(TCT/106) and pPakman(TCC/106) were compared at
different levels of expression (data not shown). These results
demonstrate that mutating Phe
to Ser
is
sufficient to abolish
-mannosidase activity in vitro using Man
GlcNAc as substrate. Similarly, no activity
was observed with pPakman(TTC/106) using Man
GlcNAc,
Man
GlcNAc, or Glc
Man
GlcNAc as
substrates although activity with these substrates was observed with
pPakman(416/106)(14) . In contrast, mutating Met to Thr
or Phe
to Leu
has much less effect on
-mannosidase activity, and the
decrease observed may be primarily due to the lower level of secretion
caused by each of these mutations (Fig. 3A). Northern
blot analyses indicated that similar amounts of RNA were produced for
each mutant (data not shown).
S]methionine, and the secreted fusion
proteins were isolated using IgG-Sepharose. The amino acids at
positions 411, 468, and 592 are shown. Activity,
-1,2-mannosidase activity (cpm) was assayed as described under
``Experimental Procedures.'' The positions of the molecular
mass markers are indicated on the left in
kDa.
-1,2-mannosidases according to a recent
classification based on sequence homology(2) . Clones 4 and 16
differ in amino acid sequence at only three positions sparsed in the
catalytic domain of the proteins: Thr, Leu
,
and Ser
found in clone 4 are replaced by
Met
, Phe
, and Phe
in clone
16. Clone 4, which was isolated from a Balb/c 3T3 cDNA library,
contains a complete ORF, whereas clone 16 was a partial cDNA lacking
the 5` end of its coding region isolated from the same library. It was
important to exclude the possibility that the sequence differences
observed between the two isolated cDNAs were created during the
preparation of the cDNA library. The results show that the same
polymorphism occurs in three other RNA preparations following reverse
transcriptase PCR and strongly support the view that clones 4 and 16
represent two naturally occurring mannosidase isoforms. The tissue RNAs
were obtained from outbred CD1 mice, but the 3T3 cDNA library came from
inbred Balb/C mice and the L cell RNA came from inbred CH3/An mice. The
fact that both variants were observed in two different inbred strains
of mice would suggest that clone 4 and clone 16 do not represent
allelic variants of the same gene. They could be the products of two
different genes or two different products of an alternatively spliced
gene. On the other hand, the possibility of two alleles cannot be ruled
out because the reduction to homozygocity of all loci may not be
complete in inbred mice(18) . A complete characterization of
the gene is necessary to distinguish between these possible
explanations
-mannosidase activity because protein A fusion
chimeras lacking the N-terminal region catalyze the formation of
Man
GlcNAc from Man
GlcNAc following secretion
from COS cells. However, we demonstrate here that the equivalent clone
4-derived fusion protein is very poorly secreted under the same
conditions and that a single mutation of the clone 16-specific residue
Phe to the clone 4-specific residue Ser
is
sufficient to abolish
-mannosidase activity using
Man
GlcNAc as substrate in vitro. This lack of
enzyme activity was dissociated from effects of the mutation on
secretion and was demonstrated at comparable levels of expression.
Residue 592 (indicated with a bold letter) is included in one of the
motifs that is highly conserved in
-1,2-mannosidases from
yeast(12) , mammals(5, 6, 13) , and
plants,(
)
namely the sequence,
SFFLAETLKYLY, although the enzymatically active yeast
-1,2-mannosidase has a tryptophan residue rather than a
phenylalanine in that position. It seems, therefore, that the
replacement of a hydrophobic residue by a hydrophilic amino acid in
this highly conserved region is detrimental to enzyme activity,
suggesting that this motif plays an important role in
-mannosidase
activity. The other two mutations have much less effect on enzyme
activity, the decrease observed being largely due to a decreased level
of secretion of the corresponding fusion proteins. From these studies
it is evident that a transcript (clone 4) encoding an inactive
-mannosidase exists in mouse tissues, perhaps as the consequence
of mutational events. It is not known, however, whether this transcript
is translated and whether the corresponding inactive protein is
actually expressed in cells under normal conditions. If the protein is
expressed, this isoform may have other functions that are not detected
in the
-mannosidase assay. Single point mutations in lysosomal
glycosidases are known to cause lysosomal storage
disorders(19, 20) , and such mutations in
glycosyltransferases are responsible for variations in the occurrence
of human blood group antigens(21, 22) . The present
report is the first demonstration of naturally occurring single point
mutations causing a defect in processing glycosidases. It will be
interesting to determine whether such mutations exist in human genetic
disorders.
We thank Barry Sleno for preparation of the labeled
oligosaccharides and Drs. Brent Weston and John Lowe for providing the
vector pPROTA.
-1,2-mannosidase(23) .
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
T.-l. L. Chen, C. Chen, N. Q. Bergeron, B. E. Close, T. J. Bohrer, B. M. Vertel, and K. J. Colley The two rat {alpha}2,6-sialyltransferase (ST6Gal I) isoforms: evaluation of catalytic activity and intra-Golgi localization Glycobiology, February 1, 2003; 13(2): 109 - 117. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. S. Gonzalez, K. Karaveg, A. S. Vandersall-Nairn, A. Lal, and K. W. Moremen Identification, Expression, and Characterization of a cDNA Encoding Human Endoplasmic Reticulum Mannosidase I, the Enzyme That Catalyzes the First Mannose Trimming Step in Mammalian Asn-linked Oligosaccharide Biosynthesis J. Biol. Chem., July 23, 1999; 274(30): 21375 - 21386. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Ma, R. Qian, F. M. Rausa III, and K. J. Colley Two Naturally Occurring alpha 2,6-Sialyltransferase Forms with a Single Amino Acid Change in the Catalytic Domain Differ in Their Catalytic Activity and Proteolytic Processing J. Biol. Chem., January 3, 1997; 272(1): 672 - 679. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |