JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schneikert, J.
Right arrow Articles by Herscovics, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schneikert, J.
Right arrow Articles by Herscovics, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 30, Issue of July 28, pp. 17736-17740, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Two Naturally Occurring Mouse -1,2-Mannosidase IB cDNA Clones Differ in Three Point Mutations
MUTATION OF Phe TO Ser IS SUFFICIENT TO ABOLISH ENZYME ACTIVITY (*)

(Received for publication, February 28, 1995; and in revised form, May 9, 1995)

Jean Schneikert (§) Annette Herscovics (¶)

From the McGill Cancer Centre, McGill University, 3655 Drummond Street, Montral, Qubec H3G 1Y6, Canada

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

In mammalian cells, -1,2-mannosidases play an essential role in the early steps of N-linked oligosaccharide maturation. We previously reported (Herscovics, A., Schneikert, J., Athanassiadis, A., and Moremen, K. W.(1994) J. Biol. Chem. 269, 9864-9871) the isolation of mouse -mannosidase IB cDNA clones from a Balb/c 3T3 cDNA library. Clone 4 encodes a type II membrane protein of 641 amino acids with a cytoplasmic tail of 35 amino acids, followed by a transmembrane domain and a large C-terminal catalytic domain, whereas clone 16 encodes only the last 471 amino acids. Their overlapping sequences (from amino acid 152) are identical, except for three point mutations that result in three amino acid differences in the catalytic domain of the enzyme (Thr, Leu, and Ser in clone 4 to Met, Phe, and Phe in clone 16, respectively). Both sequences could be amplified by polymerase chain reaction using templates of cDNAs derived from colon and brain of CD1 mice and from L cells derived from the C3H/An mouse, indicating that both are natural isoforms found in two inbred and one outbred mouse strains. When expressed in COS7 cells as a secreted protein A fusion protein, the catalytic domain of clone 16 displays -1,2-mannosidase activity using [H]mannose-labeled ManGlcNAc as substrate, but the corresponding region of clone 4 is poorly secreted under identical conditions. The contribution of each point mutation to this differential secretion and enzyme activity of the two fusion proteins was assessed by testing the six recombinants corresponding to all the possible sequence permutations. Mutation of Phe to Ser, as found in clone 4, is sufficient to abolish -1,2-mannosidase activity, whereas mutation of Met to Thr or of Phe to Leu affects secretion with relatively little effect on enzyme activity. Phe is part of a highly conserved region that seems important for enzyme activity of class 1 -1,2-mannosidases.


INTRODUCTION

-Mannosidases play an essential role in the maturation of N-linked oligosaccharides in mammalian cells (for reviews, see (1) and (2) ). Following removal of the three glucose residues from the oligosaccharide precursor GlcManGlcNAc, -1,2-mannosidases in the endoplasmic reticulum and in the Golgi remove up to four mannose residues to form ManGlcNAc. Then, following the addition of one residue of N-acetylglucosamine, -mannosidase II removes two additional mannose residues from GlcNAcManGlcNAc. The resulting GlcNAcManGlcNAc is the oligosaccharide precursor for the elaboration by Golgi glycosyltransferases of the variety of complex oligosaccharides found on mature glycoproteins.

Various mammalian -1,2-mannosidases with somewhat different properties and subcellular localizations have been described, but the number of these enzymes involved in the early stages of maturation of N-linked oligosaccharides is still not clearly established (2) . Recently, several mammalian -1,2-mannosidases capable of trimming ManGlcNAc to ManGlcNAc have been cloned from different sources. Using amino acid sequence information obtained from purified enzymes(3, 4) , closely related cDNAs encoding -1,2-mannosidases of 71-73 kDa from rabbit liver and mouse 3T3 cells (5) and from human kidney (6) have been isolated. Their deduced amino acid sequences are about 90% identical, most likely representing species variation. They have a similar type II transmembrane topology with a cytoplasmic tail of 20-40 amino acids, a single transmembrane domain, and a lumenally oriented C-terminal catalytic domain. The mouse enzyme was called -1,2-mannosidase IA because it cross-reacts with antibodies previously raised against purified rat -1,2-mannosidase IA(2, 5, 7, 8) .

In earlier studies, we had purified the -1,2-mannosidase from Saccharomyces cerevisiae that removes a single specific mannose residue from ManGlcNAc (9, 10, 11) and isolated its gene (MNS1)(12) . This -1,2-mannosidase is also a type II membrane protein of 63 kDa with little cytoplasmic tail. Although it has a different specificity because it only removes one specific mannose from ManGlcNAc, the yeast -1,2-mannosidase catalytic domain exhibits about 36% amino acid identity with the catalytic domains of the above mammalian -1,2-mannosidases. Recently, we proposed a classification of -mannosidases based on sequence homology and common properties(2) . The above mammalian and yeast -1,2-mannosidases belong to Class 1 -mannosidases. These are all calcium-dependent enzymes that are inhibited by 1-deoxymannojirimycin. In contrast, Class 2 -mannosidases that can remove -1,2-, -1,3-, and -1,6-linked mannose residues are inhibited by swainsonine. Class 2 enzymes include Golgi -mannosidase II, endoplasmic reticulum/cytosolic -mannosidase, and lysosomal and vacuolar -mannosidases from different sources.

Regions of identical amino acid sequences between the yeast and the rabbit -1,2-mannosidase were used to design degenerate oligonucleotides for PCR.()Two distinct PCR products that are 65% identical in amino acid sequence were amplified from mouse liver cDNA(13) . One of these PCR products was derived from the mouse -1,2-mannosidase IA cDNA described above(5) , and the other was used as a probe to screen a 3T3 cDNA library(13) . The two largest cDNA clones isolated from the 3T3 library were characterized. Clone 4 (2.6 kilobase pairs) contains a complete ORF that encodes a 641-amino-acid putative type II transmembrane protein and a long 5`-untranslated region (589 base pairs), whereas clone 16 (2.2 kilobase pairs) is a partial cDNA that encodes only the last 471 amino acids of the ORF, followed by 700 base pairs of 3`-untranslated region(13) . The overlapping sequences between clone 4 and clone 16, which begin at amino acid 152, are identical, except at nucleotide positions 1232, 1402, and 1775, where, in each case, thymine residues in clone 16 are replaced by cytosine in clone 4. These point mutations are not conservative because they encode different amino acids in the deduced protein sequences: Thr, Leu, and Ser in clone 4 and Met, Phe, and Phe in clone 16 (using a clone 4-based numbering). Clone 416 was reconstituted by combining the 5` coding sequences from clone 4 with the 3` coding region of clone 16 to obtain a full-length ORF(13) . When expressed as secreted protein A fusion proteins, truncated forms of clone 416 encoding either amino acids 106-641 or amino acids 171-641 were shown to catalyze the removal of four mannose residues from ManGlcNAc in vitro(14) . We have named this enzymatically active clone 416, mouse -1,2-mannosidase IB(2, 13, 14) . Both -1,2-mannosidases IA and IB (clone 4 and reconstituted clone 416) localize to the Golgi following transfection of cells in culture(5, 13) , but Northern blots show that they have very distinct patterns of cell-specific expression (5, 13) .

In this study, it is shown that, in contrast to the catalytic domain of clone 416, that of clone 4 is poorly secreted when expressed as a secreted protein A fusion protein and that a single point mutation, characteristic of clone 4, converting Phe to Ser is sufficient to abolish the enzymatic activity of the protein.


EXPERIMENTAL PROCEDURES

Materials

Materials were obtained from the following sources. Taq polymerase, bovine serum albumin, and concanavalin A were from Boehringer Mannheim. Restriction enzymes, cell culture media, and reagents were from Life Technologies, Inc. The DEAE-dextran, T7 sequencing kit, Sephadex G-50 Nick columns, Sepharose 6B, and Sepharose 6FF were from Pharmacia Biotech Inc. [S]Methionine and I-labeled goat anti-mouse IgG were from ICN Radiochemicals (Saint-Laurent, Qubec). The Superscript reverse transcriptase kit was from Life Technologies, Inc. The TA vector cloning kit was from Stratagene (La Jolla, CA). Oligonucleotides were prepared at the Sheldon Biotechnology Center (McGill University) on a Gene-Assembler Plus from Pharmacia Biotech Inc. according to the manufacturer's instructions.

Reverse Transcriptase PCR Experiments

cDNA synthesis was performed from colon and brain of CD1 mice and from L cells poly(A) RNA. 1 µg of poly(A) RNA was added in a 20-µl final reaction volume containing 20 mM Tris-HCl, pH 8.4, 50 mM KCl, 2.5 mM MgCl, 1 mg/ml bovine serum albumin, 10 mM dithiothreitol, 500 µM each dATP, dCTP, dGTP and dTTP, 2.5 ng of random hexamers, and 200 units of Superscript reverse transcriptase. cDNA synthesis was allowed to proceed at 42° C for 90 min. The volume was adjusted to 100 µl with 100 mM KCl in 10 mM Tris-HCl, pH 8, and the cDNA was extracted twice with phenol/chloroform (1:1) saturated with 10 mM Tris-HCl, pH 8, and then desalted on a Sephadex G-50 Nick column using 100 mM KCl in 10 mM Tris-HCl, pH 8, for chromatography. The cDNA was eluted in 400 µl of the buffer.

PCR amplifications were performed in 25-µl volumes containing 3 µl each of cDNA, 50 mM Tris-HCl, pH 8.3, 50 mM KCl, 1.5 mM MgCl, 0.001% gelatin, 200 µM dNTP, 2.5 units of Taq polymerase, and 12.5 pmol of two oligonucleotides that bracket the ORF of the mannosidase cDNA: the sense oligonucleotide CGGTTCGATGTGTTGTA the 3` end of which is located at position -54 relative to the mannosidase A(+1)TG and the antisense oligonucleotide GCAGGTACCTCATCGGACAGCAGGATTACC that contains the stop codon of the ORF. 35 cycles were conducted as follows on a Perkin-Elmer DNA thermal cycler 480: 1 min at 94° C, 1 min at 45° C, and 5 min at 72° C. The PCR products were fractionated on a 1% (w/v) agarose gel, and the expected band was subcloned into the TA vector. Subclones were partially sequenced using specific oligonucleotides located near the three mismatches.

Protein A Fusion Proteins Expression Vectors

The constructs pPakman(416/106) and pPakman(416/171) were prepared from pPROTA as described previously(14) , and the plasmids pPakman(4/106) and pPakman(4/171) were designed in the same way (see Fig. 1). The recombinants pPakman(CCT/171), pPakman(CTT/171), pPakman(TTC/171), pPakman(TCT/171), pPakman(CTC/171), and pPakman(TCC/171) were made by taking advantage of the single unique AvaI and NdeI restriction sites located between the first and second polymorphisms and between the second and third polymorphisms that differentiate clone 4 and clone 416. The desired fragments from either pPakman(416/171) or pPakman(4/171) were combined to construct the different mutants: KpnI-AvaI + AvaI-KpnI, KpnI-NdeI + NdeI-KpnI, KpnI-AvaI + AvaI-NdeI + NdeI-KpnI.


Figure 1: Schematic representation of clone 4 and reconstituted clone 416 and their derived recombinants. The sequence of the complete ORF (641 amino acids) is shown at the top, indicating the three positions that differ in the catalytic domain of clones 4 and 416: the putative transmembrane domain (TMD), the putative calcium-binding EF-hand (EF HAND), and the single concensus N-glycosylation site at Asn (CHO). The arrow (amino acid 152) indicates the beginning of clone 16, which was isolated from the 3T3 cDNA library. The protein A fusion constructs are shown below and contain either amino acids 106-641 or 171-641 of clones 4 and 416 (Pakman(416/106), Pakman(4/106), Pakman(416/171), and Pakman(4/171)) downstream of the transin signal peptide and the protein A sequence. The names of the recombinant proteins are indicated on the right. The numbers refer to mannosidase amino acid positions of clone 4.



DNA Sequencing

Sequencing to check the constructs was done using the dideoxy chain termination method (15) with specific mannosidase-derived oligonucleotides as primers.

Transfection of COS7 Cells

COS7 cells were maintained in Dulbecco's modified Eagle's medium supplemented with 10% fetal calf serum (v/v), 1% (w/v) glutamine, 1% (w/v) streptomycin, and 1% (w/v) penicillin. The day before transfection, the cells were collected by trypsin treatment and divided to get 50-70% confluency on the next day. Cells were transfected by the DEAE-dextran plus chloroquine method using 17 ng/µl of plasmid (10 µg/plate). Expression was allowed to proceed for 36-48 h.

[S]Methionine Labeling

Expression of the protein A fusion proteins was monitored by labeling with [S]methionine. 24 h after transfection, cells were transferred for 2 h in methionine-depleted Dulbecco's modified Eagle's medium containing glutamine, antibiotics, and 10% (w/v) dialyzed fetal calf serum. 100 µCi of [S]methionine (1181 Ci/mmol)/10 ml of medium were added, and the cells were incubated for another 16-24 h. The medium from each plate was harvested on ice, complemented with a mixture of protease inhibitors (2 µg/ml each of pepstatin A, leupeptin, and chymostatin) and centrifuged to remove debris (2000 g for 10 min). A preadsorption step was carried out for 2 h at 4° C with gentle agitation by adding 100 µl of Sepharose 6B (50% (v/v) slurry in phosphate-buffered saline) to the supernatants. Sepharose 6B was removed by brief centrifugation and replaced by 100 µl of IgG-Sepharose 6FF. Samples were rocked overnight in the cold, and the beads were washed sequentially as follows: 3 10 bead volumes of 50 mM Tris buffer, pH 7.6, containing 150 mM NaCl and 0.05% Tween 20 and 2 10 volumes of 5 mM ammonium acetate buffer, pH 5. Proteins bound to the matrix were eluted twice with 2 volumes of 0.5 M acetic acid adjusted to pH 3.4 with 0.5 M ammonium acetate. Both eluates were pooled, lyophilized, and redissolved in 25 µl/plate of SDS-PAGE sample loading buffer before SDS-PAGE analysis. Control experiments were performed to verify that the amount of beads was not limiting. The dried gels were exposed overnight to Kodak X-OMAT AR films.

-Mannosidase Assays

For assay of -mannosidase activity of the fusion proteins, the medium was harvested before metabolic labeling 24 h after transfection, cleared, and adsorbed as described above. The beads were washed three times with 10 volumes of 50 mM Tris buffer, pH 7.6, containing 150 mM NaCl and 0.05% Tween 20 and then three times with 10 volumes of 50 mM potassium phosphate buffer, pH 6.5, containing 1 mM CaCl and 0.02% NaN. Then 100 µl of Sepharose beads slurry (50% (v/v) in 50 mM potassium phosphate buffer containing 1 mM CaCl and 0.02% NaN) were mixed with 10 µl of [H]mannose-labeled ManGlcNAc (5000 cpm) prepared as described previously (9) and 7 µl of bovine serum albumin (56 µg). All incubations were done in duplicate for 4 h at 37° C. The amount of [H]mannose released was measured using the concanavalin A/polyethylene glycol precipitation method as described previously(16) .


RESULTS

Clones 4 and 16 Are Natural Isoforms

Because the cDNA clones 4 and 16 were obtained by reverse transcription of Balb/c 3T3 mice poly(A) RNA, it was important to establish the fidelity of reverse transcriptase during the preparation of the cDNA library to ensure that the three base differences between the two clones at nucleotides 1232, 1402, and 1775 of the catalytic domain are naturally occurring variations. For that purpose, oligonucleotides that bracket the ORF were designed for reverse transcriptase PCR experiments using Taq polymerase and poly(A) RNA from outbred CD1 mouse brain and colon and from an L cell line derived from the inbred C3H/An mouse. PCR products were subcloned, and several random clones from each source were partially sequenced with specific oligonucleotides located near the three mismatches. For colon, two out of three clones had a C at nucleotides 1232, 1402, and 1775, whereas the third clone had a T at these three positions. For brain, two out of five displayed a T, whereas the three other clones had a C. Similarly, for L cells two out of three clones had a C and the third had a T. Thus, both types of sequences are represented in each population of PCR products, regardless of the origin of poly(A) RNA. Each individual PCR product either contained a C or a T at all three positions. Because it is unlikely that misreading by Taq polymerase would give such reproducible mutations, we conclude that clone 4 and clone 16 isolated from the cDNA library are true natural isoforms found in at least three different mouse strains.

Comparison of -Mannosidase Activity in Vitro

Because the level of intracellular endogenous -mannosidase activity is relatively high, it is difficult to demonstrate increased intracellular -mannosidase activity resulting from transient expression of the membrane-bound form of the -mannosidase. To facilitate the comparison between clone 4 and clone 16 -mannosidase activity, the assay was performed on secreted protein A fusion proteins following transient expression in COS7 cells (Fig. 1). For this purpose, a segment containing either amino acids 106-641 or 171-641 from both mannosidase isoforms was fused to the IgG binding domain of Staphylococcus aureus protein A to allow purification of the secreted hybrid proteins upon binding to IgG-coated beads. The expression vector contains the transin signal peptide upstream of the protein A to allow secretion(17) . These recombinants were named pPakman(416/106), pPakman(4/106), pPakman(416/171), and pPakman(4/171). Fig. 2shows the SDS-PAGE fractionation of labeled proteins immunoprecipitated with IgG-Sepharose from the medium of COS7 cells transiently transfected with the above constructs following metabolic labeling with [S]methionine. It is evident that both clone 16-derived recombinants are secreted at a reasonable level compared with protein A in the first lane (V) of Fig. 2. -Mannosidase activity using ManGlcNAc as substrate is specifically associated with these proteins. In contrast, both clone 4-derived fusion proteins are poorly secreted, and no -mannosidase activity is detectable.


Figure 2: SDS-PAGE analysis of the secreted protein A mannosidase fusion proteins. COS7 cells were transfected with either pPak (V), pPakman(4/106) (4, 106), pPakman(4/171) (4, 171), pPakman(416/106) (416, 106), and pPakman(416/171) (416, 171) and metabolically labeled with [S]methionine followed by immunoprecipitation using IgG-Sepharose as described under ``Experimental Procedures.'' Activity, -1,2-Mannosidase activity (cpm) was assayed as described under ``Experimental Procedures.'' The positions of molecular mass markers are indicated on the left in kDa.



The individual contribution of each point mutation to the differential secretion and enzymatic activity of the fusion proteins derived from clone 4 and clone 16 was assessed by testing the six recombinants corresponding to the two possible sequence permutations (C or T) at nucleotides 1232 (amino acid 411), 1402 (amino acid 468), and 1775 (amino acid 592): pPakman(CCT/106), pPakman(CTT/106), pPakman(CTC/106), pPakman(TCC/106), pPakman(TTC/106), and pPakman(TCT/106) (Fig. 3A). The fusion proteins that do not display any -mannosidase activity (lanes 2, 5, 6, and 7) all have a C at position 1775 encoding Ser. The results for clone 4 and 416 are shown in Fig. 3A, lanes 2 and 9, respectively. The mutant that has both Ser and Thr (Fig. 3A, lane 5), as found in clone 4, is also poorly secreted. However, mutants with Ser alone or in combination with Leu have reasonable levels of secretion but no enzyme activity (Fig. 3A, lanes 6 and 7). To ensure that the lack of enzyme activity is not due to differences in the amount of protein being assayed, enzyme assays were performed on the fusion proteins comparing their enzyme activity following transfection with either different amounts of pPakman(416/106) and pPakman(TTC/106) expression vectors or of different numbers of plates (Fig. 3B). It can be seen that there is a direct relationship between the amount of protein and enzyme activity following transfection with pPakman(416/106) (Fig. 3B, compare lanes 3 and 5) but that, at similar levels of protein expression, there is no -mannosidase activity following transfection with pPakman(TTC/106). Comparison of lanes 2 and 4 with lane 5 in Fig. 3B shows that the lack of activity when Phe is mutated to Ser is not due to protein level. Similar results were obtained when the products of pPakman(TCT/106) and pPakman(TCC/106) were compared at different levels of expression (data not shown). These results demonstrate that mutating Phe to Ser is sufficient to abolish -mannosidase activity in vitro using ManGlcNAc as substrate. Similarly, no activity was observed with pPakman(TTC/106) using ManGlcNAc, ManGlcNAc, or GlcManGlcNAc as substrates although activity with these substrates was observed with pPakman(416/106)(14) . In contrast, mutating Met to Thr or Phe to Leu has much less effect on -mannosidase activity, and the decrease observed may be primarily due to the lower level of secretion caused by each of these mutations (Fig. 3A). Northern blot analyses indicated that similar amounts of RNA were produced for each mutant (data not shown).


Figure 3: SDS-PAGE analysis of mutant secreted fusion proteins. A, COS7 cells were transfected with 10 µg of each of the following plasmids: lane 1, pPak (V); lane 2, pPakman(4/106) (C/C/C); lane 3, pPakman(CCT/106) (C/C/T); lane 4, pPakman(CTT/106) (C/T/T); lane 5, pPakman(CTC/106) (C/T/C); lane 6, pPakman(TCC/106) (T/C/C); lane 7, pPakman(TTC/106) (T/T/C); lane 8, pPakman(TCT/106) (T/C/T); lane 9, pPakman(416/106) (T/T/T). B, the fusion proteins following transfection with either different amounts of construct or with different numbers of plates were analyzed. Lane 1, 10 µg of pPak (V); lane 2, the combined medium of 4 plates following transfection with 10 µg of pPakman(TTC/106) (T/T/C); lane 3, 10 µg of pPakman(416/106) (T/T/T); lane 4, 10 µg of pPakman(TTC/106) (T/T/C); lane 5, 2.5 µg of pPakman(416/106) (T/T/T). Cells were metabolically labeled with [S]methionine, and the secreted fusion proteins were isolated using IgG-Sepharose. The amino acids at positions 411, 468, and 592 are shown. Activity, -1,2-mannosidase activity (cpm) was assayed as described under ``Experimental Procedures.'' The positions of the molecular mass markers are indicated on the left in kDa.




DISCUSSION

This report describes a comparison between two cDNA clones encoding Class 1 -1,2-mannosidases according to a recent classification based on sequence homology(2) . Clones 4 and 16 differ in amino acid sequence at only three positions sparsed in the catalytic domain of the proteins: Thr, Leu, and Ser found in clone 4 are replaced by Met, Phe, and Phe in clone 16. Clone 4, which was isolated from a Balb/c 3T3 cDNA library, contains a complete ORF, whereas clone 16 was a partial cDNA lacking the 5` end of its coding region isolated from the same library. It was important to exclude the possibility that the sequence differences observed between the two isolated cDNAs were created during the preparation of the cDNA library. The results show that the same polymorphism occurs in three other RNA preparations following reverse transcriptase PCR and strongly support the view that clones 4 and 16 represent two naturally occurring mannosidase isoforms. The tissue RNAs were obtained from outbred CD1 mice, but the 3T3 cDNA library came from inbred Balb/C mice and the L cell RNA came from inbred CH3/An mice. The fact that both variants were observed in two different inbred strains of mice would suggest that clone 4 and clone 16 do not represent allelic variants of the same gene. They could be the products of two different genes or two different products of an alternatively spliced gene. On the other hand, the possibility of two alleles cannot be ruled out because the reduction to homozygocity of all loci may not be complete in inbred mice(18) . A complete characterization of the gene is necessary to distinguish between these possible explanations

Even though clone 16 is incomplete, we showed previously (14) that the missing N-terminal region is not required for -mannosidase activity because protein A fusion chimeras lacking the N-terminal region catalyze the formation of ManGlcNAc from ManGlcNAc following secretion from COS cells. However, we demonstrate here that the equivalent clone 4-derived fusion protein is very poorly secreted under the same conditions and that a single mutation of the clone 16-specific residue Phe to the clone 4-specific residue Ser is sufficient to abolish -mannosidase activity using ManGlcNAc as substrate in vitro. This lack of enzyme activity was dissociated from effects of the mutation on secretion and was demonstrated at comparable levels of expression. Residue 592 (indicated with a bold letter) is included in one of the motifs that is highly conserved in -1,2-mannosidases from yeast(12) , mammals(5, 6, 13) , and plants,() namely the sequence, SFFLAETLKYLY, although the enzymatically active yeast -1,2-mannosidase has a tryptophan residue rather than a phenylalanine in that position. It seems, therefore, that the replacement of a hydrophobic residue by a hydrophilic amino acid in this highly conserved region is detrimental to enzyme activity, suggesting that this motif plays an important role in -mannosidase activity. The other two mutations have much less effect on enzyme activity, the decrease observed being largely due to a decreased level of secretion of the corresponding fusion proteins. From these studies it is evident that a transcript (clone 4) encoding an inactive -mannosidase exists in mouse tissues, perhaps as the consequence of mutational events. It is not known, however, whether this transcript is translated and whether the corresponding inactive protein is actually expressed in cells under normal conditions. If the protein is expressed, this isoform may have other functions that are not detected in the -mannosidase assay. Single point mutations in lysosomal glycosidases are known to cause lysosomal storage disorders(19, 20) , and such mutations in glycosyltransferases are responsible for variations in the occurrence of human blood group antigens(21, 22) . The present report is the first demonstration of naturally occurring single point mutations causing a defect in processing glycosidases. It will be interesting to determine whether such mutations exist in human genetic disorders.


FOOTNOTES

*
This work was supported by a research grant from the Medical Research Council of Canada. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Postdoctoral fellow of the International Human Frontier Science Program Organization.

To whom correspondence should be addressed: McGill Cancer Centre, 3655 Drummond Street, Montreal, Quebec, Canada, H3G 1Y6. Fax: 514-398-6769; annette{at}medcor.mcgill.ca

The abbreviations used are: PCR, polymerase chain reaction; ORF, open reading frame; PAGE, polyacrylamide gel electrophoresis.

A. Herscovics, unpublished results.


ACKNOWLEDGEMENTS

We thank Barry Sleno for preparation of the labeled oligosaccharides and Drs. Brent Weston and John Lowe for providing the vector pPROTA.

Note Added in Proof-The conserved sequence has also been found in a Drosophila -1,2-mannosidase(23) .


REFERENCES

  1. Kornfeld, R., and Kornfeld, S.(1985)Annu. Rev. Biochem. 54, 631-664 [CrossRef][Medline] [Order article via Infotrieve]
  2. Moremen, K. W., Trimble, R. B., and Herscovics, A.(1994)Glycobiology 4, 113-125 [Free Full Text]
  3. Forsee, W. T., Palmer, C. F., and Schutzbach, J. S.(1989)J. Biol. Chem. 264, 3869-3876 [Abstract/Free Full Text]
  4. Schweden, J., Legler, G., and Bause, E.(1986)Eur. J. Biochem. 157, 563-570 [Medline] [Order article via Infotrieve]
  5. Lal, A., Schutzbach, J. S., Forsee, W. T., Neame, P. J., and Moremen, K. W.(1994) J. Biol. Chem. 269, 9872-9881 [Abstract/Free Full Text]
  6. Bause, E., Bieberich, E., Rolfs, A., Volker, C., and Schmidt, B.(1993)Eur. J. Biochem. 217, 535-540 [Medline] [Order article via Infotrieve]
  7. Tulsiani, D. R. P., Hubbard, S. C., Robbins, P. W., and Touster, O.(1982) J. Biol. Chem. 257, 3660-3668 [Abstract/Free Full Text]
  8. Tulsiani, D. R. P., and Touster, O.(1988)J. Biol. Chem. 263, 5408-5417 [Abstract/Free Full Text]
  9. Jelinek-Kelly, S., Akiyama, T., Saunier, B., Tkacz, J. S., and Herscovics, A.(1985) J. Biol. Chem. 260, 2253-2257 [Abstract/Free Full Text]
  10. Jelinek-Kelly, S., and Herscovics, A.(1988)J. Biol. Chem. 263, 14757-14763 [Abstract/Free Full Text]
  11. Ziegler, F. D., and Trimble, R. B.(1991)Glycobiology 1, 605-614 [Abstract/Free Full Text]
  12. Camirand, A., Heysen, A., Grondin, B., and Herscovics, A.(1991)J. Biol. Chem. 266, 15120-15127 [Abstract/Free Full Text]
  13. Herscovics, A., Schneikert, J., Athanassiadis, A., and Moremen, K. W.(1994) J. Biol. Chem. 269, 9864-9871 [Abstract/Free Full Text]
  14. Schneikert, J., and Herscovics, A.(1994)Glycobiology 4, 445-450 [Abstract/Free Full Text]
  15. Sanger, F., Nicklen, S., and Coulson, A. R.(1977)Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  16. Herscovics, A., and Jelinek-Kelly, S.(1987)Anal. Biochem. 166, 85-89 [CrossRef][Medline] [Order article via Infotrieve]
  17. Sanchez-Lopez, R., Nicholson, R., Gesnel, M.-C., Matrisian, L. M., and Breathnach, R. (1988)J. Biol. Chem. 263, 11892-11899 [Abstract/Free Full Text]
  18. Ponder, B. A., Festing, M. F., and Wilkinson, M. M.(1985)J. Embryol. Exp. Morphol. 87, 229-239 [Medline] [Order article via Infotrieve]
  19. Yang, M., Allen, H., and DiCioccio, R. A.(1992)Biochem. Biophys. Res. Commun. 189, 1063-1068 [CrossRef][Medline] [Order article via Infotrieve]
  20. Banerjee, P., Boyers, M. J., Berry-Kravis, E., and Dawson, G.(1994)J. Biol. Chem. 269, 4819-4826 [Abstract/Free Full Text]
  21. Mollicone, R., Reguigne, I., Kelly, R. J., Fletcher, A., Watt, J., Chatfield, S., Aziz, A., Cameron, H. S., Weston, B. W., Lowe, J. B., and Oriol, R.(1994) J. Biol. Chem. 269, 20987-20994 [Abstract/Free Full Text]
  22. Yamamoto, F., Clausen, H., White, T., Marken, J., and Hakomori, S.(1990) Nature 345, 229-233 [CrossRef][Medline] [Order article via Infotrieve]
  23. Kerscher, S. A., Albert, S., Wucherpfennig, D., Heinsenberg, M., and Schneuwly, S.(1995) Dev. Biol.168,613-626 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
GlycobiologyHome page
T.-l. L. Chen, C. Chen, N. Q. Bergeron, B. E. Close, T. J. Bohrer, B. M. Vertel, and K. J. Colley
The two rat {alpha}2,6-sialyltransferase (ST6Gal I) isoforms: evaluation of catalytic activity and intra-Golgi localization
Glycobiology, February 1, 2003; 13(2): 109 - 117.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. S. Gonzalez, K. Karaveg, A. S. Vandersall-Nairn, A. Lal, and K. W. Moremen
Identification, Expression, and Characterization of a cDNA Encoding Human Endoplasmic Reticulum Mannosidase I, the Enzyme That Catalyzes the First Mannose Trimming Step in Mammalian Asn-linked Oligosaccharide Biosynthesis
J. Biol. Chem., July 23, 1999; 274(30): 21375 - 21386.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Ma, R. Qian, F. M. Rausa III, and K. J. Colley
Two Naturally Occurring alpha 2,6-Sialyltransferase Forms with a Single Amino Acid Change in the Catalytic Domain Differ in Their Catalytic Activity and Proteolytic Processing
J. Biol. Chem., January 3, 1997; 272(1): 672 - 679.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Schneikert, J.
Right arrow Articles by Herscovics, A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Schneikert, J.
Right arrow Articles by Herscovics, A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.