|
|
|
|||||||
|
|||||||||
(Received for publication, March 14, 1995; and in revised form, May 15, 1995) From the
Approximately 50% of Helicobacter pylori strains
produce a cytotoxin, encoded by vacA, that induces vacuolation
of eukaryotic cells. Analysis of a clinically isolated tox Helicobacter pylori is the causative agent of chronic
superficial gastritis in humans, and infection with this organism is a
significant risk factor for the development of peptic ulcer disease and
gastric
cancer(1, 2, 3, 4, 5) . An
important virulence determinant of H. pylori is the
vacuolating cytotoxin(6, 7, 8) . The H.
pylori cytotoxin induces cytoplasmic vacuolation in a variety of
mammalian cell lines in vitro(9) , and produces
epithelial cell damage and mucosal ulceration when administered
intragastrically to mice(10) . Encoded by vacA, the
cytotoxin is translated as a 1287-1296-amino acid precursor,
which then undergoes both N-terminal and C-terminal processing to yield
a mature The
genetic basis for the absence of detectable cytotoxin activity in
supernatants from 50% of H. pylori strains is not yet well
understood, but in a previous study we demonstrated that several
tox
vacA from strain Tx30a encoded a deduced polypeptide with a calculated
molecular mass of 141,902 daltons, which is similar to the size
(139-140 kDa) of vacA products encoded by tox
Figure 1:
Alignment between the deduced
VacA amino acid sequence of tox
A
comparison of the entire vacA sequence from strain Tx30a with
that of tox
Figure 2:
Comparison of the deduced VacA amino acid (aa) sequence from tox
Figure 3:
Detection of vacA products in H. pylori culture supernatants. H. pylori strains
were cultured in Brucella broth containing 0.5% charcoal, and
supernatant proteins were concentrated by precipitation with a 50%
saturated solution of ammonium sulfate. Concentrated supernatants (4
µg of protein/lane) were immunoblotted with a 1:20,000
dilution of antiserum to the purified cytotoxin of H. pylori 60190(6) . Lanea, strain 60190; laneb, strain Tx30a. Immunoreactive bands were
present in supernatants from both strains.
Western blotting of culture
supernatants from 13 other tox
Figure 4:
Nucleotide sequences encoding putative vacA signal sequences for 12 H. pylori strains (A) and deduced amino acid sequences for three representative vacA types (B). Dots indicate nucleotide or
amino acid identity compared with the sequence listed above. Stars indicate nucleotide differences between type s1a and s1b
signal sequences. Positions of primers used for subsequent PCR typing
of strains are underlined. Arrows denote the
experimentally determined sites of putative signal peptide cleavage for
strains 60190 and Tx30a. vacA sequence data have been reported
previously in (6) and (8) (1), (10) and (12) (2), and (11) (3).
Figure 5:
PCR typing of vacA from three H. pylori strains. a, using primers VA3-F and VA3-R; b, using primers VA4-F and VA4-R; c, using primers
SS1-F and VA1-R; d, using primers SS3-F and VA1-R; e,
using primers SS2-F and VA1-R; f, using primers VA1-F and
VA1-R; g, strains typed as s1 or s2 on the basis of the size
of the PCR product.
As expected(29, 30, 31, 32) , H. pylori isolates from patients with ulcers produced
cytotoxin activity in vitro more frequently than isolates from
patients without ulcers; 14 (61%) of 23 patients with ulcers harbored
tox As described in this study, the vacA homolog in H. pylori strain Tx30a encodes a deduced protein of 142 kDa,
which is similar to the size of vacA products from three
previously characterized tox Based upon divergence among H. pylori strains within the vacA signal sequence (s1a, s1b, and
s2) and mid-region (m1 and m2), we have developed methodology for
typing vacA genes; five of the six possible signal
sequence/mid-region combinations were found among the strains examined.
Several bacterial genes with similar mosaic structures have been
described, including IgA proteases from Neisseria gonorrhoeae and Haemophilus influenzae and penicillin binding
proteins from Neisseria meningitidis and Streptococcus
pneumoniae(33, 34, 35, 36, 37) .
These genes are characterized by regions that are highly conserved
interspersed with regions that are markedly divergent, entirely
analogous to the structure of vacA in H. pylori. In N. meningitidis, highly divergent regions within the
penicillin binding protein genes of different strains appear to have
arisen by horizontal transfer of DNA from the corresponding genes of Neisseria flavescens or Neisseria cinerea(35) . Most bacterial species in which mosaic genes have been
described are competent for natural transformation, a property shared
by H. pylori(38, 39) . We speculate that DNA
transfer from a non-H. pylori species originally may have
given rise to divergence within H. pylori vacA genes.
Simultaneous infection of humans with multiple H. pylori strains occurs (40, 41) , and therefore the
opportunity for subsequent DNA transfer between H. pylori strains exists. That this occurs is suggested by the existence of
four different gene structures in strains possessing a type s1 signal
sequence (s1a/m1, s1b/m1, s1a/m2, and s1b/m2). A striking finding of
this study was that the vacA genotype s2/m1 was not
identified. A possible explanation is that the recombinant event
required to produce this genotype simply never occurred, but we
consider it more likely either that strains with the s2/m1 genotype are
non-viable, or that this genotype confers a selective disadvantage. Several previous studies have demonstrated an association between
expression of CagA and production of vacuolating cytotoxin activity in vitro by H. pylori strains(14, 15) . This study demonstrates a
strong genetic association between the presence of cagA and vacA signal sequence type s1. Why two genetic elements without
any physical linkage on the H. pylori chromosome (42) should be so closely associated is not clear. One
hypothesis is that there are two clonal H. pylori populations (vacA s1/cagA One of the striking findings of this
study was that strains containing a type s2 vacA signal
sequence consistently failed to produce detectable vacuolating
cytotoxin activity in vitro; only strains with type s1 vacA produced such activity. In addition, the type of vacA middle region was independently associated with the level of
cytotoxin activity produced by strains. The divergent middle region of vacA comprises a sizable portion of the gene, and thus
structural differences between type m1 and type m2 gene products could
easily give rise to differences in cytotoxin phenotypes. However, the
basis for the highly significant differences in phenotype between
strains with type s1 and type s2 signal sequences is less clear. One
hypothesis is that strains with type s2 signal sequences export the
VacA protoxin less efficiently across the cytoplasmic membrane.
Alternatively, differences in the N-terminal residues of the mature
secreted vacA products, arising from different signal sequence
cleavage sites in type s1 and type s2 VacA proteins, may account for
differences in protein function. Finally, it may be that vacA signal sequence types are markers for other unidentified
structural, regulatory, or secretory elements that influence cytotoxin
activity. A potentially important aspect of the vacA typing
system presented here is its clinical relevance. In this and several
previous studies(29, 30, 31, 32) , H. pylori isolates from patients with peptic ulcer disease
expressed cytotoxin activity in vitro more commonly than
isolates from patients with gastritis alone. The present investigation
demonstrates an even stronger link between the clinical status of
patients and the vacA genotype of infecting strains. Why might
the vacA genotype be a better predictor of a strain's
ulcerogenic properties than direct testing of cytotoxin production in vitro? One possible explanation is that cytotoxin
expression may occur at significantly higher levels in vivo than in vitro. Alternatively, induction of vacuolation in
transformed cell lines by the cytotoxin may be only an imperfect marker
for production of epithelial damage in vivo. The strong
association between peptic ulcer disease and vacA type s1
strains is complemented by the equally important finding that vacA type s2 strains are rarely associated with peptic ulceration. The
identification of H. pylori strains associated with different
risks of ulcerogenicity may have clinical implications.
Volume 270,
Number 30,
Issue of July 28, pp. 17771-17777, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ASSOCIATION OF SPECIFIC vacA TYPES WITH CYTOTOXIN
PRODUCTION AND PEPTIC ULCERATION (*)
strain (Tx30a) indicated secretion of a 93-kDa product from a
3933-base pair vacA open reading frame. Characterization of 59
different H. pylori isolates indicated the existence of three
different families of vacA signal sequences (s1a, s1b, and s2)
and two different families of middle-region alleles (m1 and m2). All
possible combinations of these vacA regions were identified,
with the exception of s2/m1 (p < 0.001); this mosaic
organization implies that recombination has occurred in vivo between vacA alleles. Type s1/m1 strains produced a
higher level of cytotoxin activity in vitro than type s1/m2
strains; none of 19 type s2/m2 strains produced detectable cytotoxin
activity. The presence of cagA (cytotoxin-associated gene A)
was closely associated with the presence of vacA signal
sequence type s1 (p < 0.001). Among patients with past or
present peptic ulceration, 21 (91%) of 23 harbored type s1 strains
compared with 16 (48%) of 33 patients without peptic ulcers; only 2
(10%) of 19 subjects harboring type s2 strains had past or present
peptic ulcers (p < 0.005). Thus, specific vacA genotypes of H. pylori strains are associated with the
level of in vitro cytotoxin activity as well as clinical
consequences.
87-kDa secreted
product(6, 8, 10, 11, 12) .
Although only about 50% of H. pylori strains induce
vacuolation of epithelial cells in
vitro(9, 13) , nearly all strains hybridize with vacA probes(8, 10, 11, 12) . A
second putative virulence determinant is the high molecular weight
protein encoded by the cytotoxin-associated gene, cagA. About
60% of strains possess cagA, and nearly all of these express
the cagA gene product(14, 15) . Production of
vacuolating cytotoxin activity in vitro and the presence of cagA are closely associated characteristics (14, 15) . However, insertional mutagenesis of cagA fails to ablate cytotoxin activity(16) .
and tox
strains differed
substantially within the middle region of vacA(8) .
Therefore, the objectives of this study were (i) to characterize
further the vacA alleles that are present in different strains
of H. pylori, (ii) to correlate vacA genotypic
differences with levels of cytotoxin production in vitro,
(iii) to determine whether there is a correlation between particular vacA genotypes and presence of cagA, and (iv) to
determine whether the vacA genotype of infecting H. pylori strains is related to the occurrence of peptic ulceration. We
describe here the molecular cloning of a 3933-bp
()vacA open reading frame from a
toxH. pylori strain and show that clinical H. pylori isolates contain one of five different mosaic vacA structures. In addition, we show that the vacA genotype of a strain is strongly associated with its cytotoxin
phenotype and its capacity to induce peptic ulceration.
Cloning of vacA from H. pylori Tx30a
Chromosomal
DNA from toxH. pylori strain Tx30a, which
fails to produce detectable cytotoxin activity in vitro(8, 9) and which lacks cagA(14) , was partially digested with SauIIIa and ligated to BamHI-digested
GEM11 arms
(Promega). After packaging (Promega), the library was titered and
screened in E. coli ER1793 cells, using a
P-labeled 0.7-kb XbaI fragment of vacA
from strain 60190 as a probe(8) . Bacteriophage DNA was
isolated from a purified, reactive clone (
Tx30a-10), and vacA-containing restriction fragments were identified by
Southern hybridization. A 2.0-kb HindIII fragment was
subcloned into pBluescript (Stratagene, La Jolla, CA) to create pA153,
and a 2.3-kb SacI fragment was subcloned to create pA145
(which contained nucleotides 1-762 and 2285-4350,
respectively, of GenBank
sequence U29401). A 1.5-kb vacA fragment bridging pA145 and pA153 was PCR-amplified from
Tx30a chromosomal DNA, using primers (5` GATGGAGGTTGGGATTGG 3`) and (5`
TAGGGTTAGGTTATTAAACATAAG 3`) (nucleotides 699-717 and
2317-2340), and subcloned into pT7Blue (Novagen) to create pA147.
Nucleotide sequences were determined on both strands by primer walking,
using the dideoxy chain termination procedure. The 1.5-kb vacA fragment contained in pA147 was PCR-amplified from Tx30a
chromosomal DNA on two different occasions, and sequencing of the two
products yielded identical results. A search of data bases for
homologous proteins was accomplished using the BLAST network service of
the National Center for Biotechnology Information, FastA, and
Wordsearch programs.
Colony Hybridization of H. pylori Isolates
Colony
hybridizations were performed as described previously(8) ,
except that washes were with 0.1 SSC at 68 °C. pCTB4 is a
458-bp probe, derived from the middle region of vacA in
tox
strain 60190(8) . A second probe (VA6) was
PCR-amplified from the corresponding vacA region of
tox
H. pylori strain
87-203(8) , using primers (5`GCAATATTTATCTGGGAAAATC 3`)
and (5` GCTATATCCCGTTTGCAAAC 3`). The cagA probe was a 2334-bp BamHI/EcoRI restriction fragment of pMC3 (14) .
PCR Amplification and Sequencing of vacA
Fragments
vacA fragments 1.5 or 1.3 kb in size
were PCR-amplified from the middle region of vacA from
tox strain 84-183 and tox
strain 86-313, using primers derived from the vacA sequence of H. pylori 60190(8) . Primers (5`
ATGGAAATACAACAAACACAC 3`) and (5`GAGCTTGTTGATATTGAC 3`) were used to
amplify a 1.5-kb fragment from the 5` end of vacA from strain
93-68. Primers (5` ATTTTACCTTTTTACACATTCTAGCC 3`) and (5`
AGAAGCCCTGAGACCG 3`) were used to amplify 0.5-kb fragments encoding the vacA signal sequences of multiple H. pylori strains.
PCR products to be sequenced were subcloned into the pT7 Blue vector
(Novagen), and nucleotide sequences of plasmid DNA then were determined
on both strands by the dideoxy chain termination procedure.
PCR-based Methodology for Typing vacA Homologs and
Detecting cagA
Primers for PCR-based typing of vacA homologs are shown in Table 1. Thermal cycling for each set
of primers (0.5 µM each) was at 95 °C for 1 min, 52
°C for 1 min, and 72 °C for 1 min, for a total of 35 cycles.
PCR amplification of cagA used previously described primers F1
(5` GATAACAGGCAAGCTTTTGAGG 3`) and B1 (5` CTGCAAAAGATTGTTTGGCAGA 3`),
with annealing at 55 °C, to amplify a 349-bp product from the
middle of cagA(14) .
Detection of Vacuolating Cytotoxin Activity by HeLa Cell
Assay
H. pylori cells were grown for 64 h in brucella
broth (17) containing 5% fetal bovine serum at 37 °C in 6%
carbon dioxide, and culture supernatants were concentrated 40-fold by
ultrafiltration(13) . Concentrated culture supernatants were
tested for vacuolating cytotoxin activity using a HeLa cell assay, as
described previously(13) . For the final 29 consecutive
isolates, the concentrated culture supernatants were serially diluted,
using doubling dilutions, such that the final concentration applied to
cells ranged from 8-fold concentrated to 4-fold diluted (arbitrarily
assigned dilution units of 1, 2, 4, 8, 16, and 32). All supernatants
were tested on at least two occasions, and cytotoxin activity is
expressed as the mean maximum dilution unit score yielding >80% HeLa
cell vacuolation. We define high grade cytotoxin activity as a dilution
unit score 
8, low grade cytotoxin activity as a score between 1 and
8, and tox as a score <1.
Detection of Vacuolating Cytotoxin by Antigen Detection
Enzyme-linked Immunosorbent Assay (ELISA)
Separate aliquots of
the same 29 supernatants used in the quantitative HeLa cell culture
assay were tested for reactivity with rabbit antiserum to the purified
cytotoxin of H. pylori strain 60190, as described previously (6) . ELISA values were calculated as log (optical density
100).
Immunoblotting and RNA Dot Blot Analysis
Western
blotting of H. pylori culture supernatants with antiserum
prepared against the purified cytotoxin of strain 60190 was
accomplished as described previously(6) . For RNA dot blot
analysis, RNA was isolated from H. pylori strains and
transferred to nylon membranes (18) . The RNA then was
hybridized with a P-labeled 0.7-kb XbaI fragment
of vacA(8) at 42 °C in the presence of 50%
formamide(18) .
Human Subjects and Bacterial Strains
H. pylori isolates were obtained from 59 U.S. subjects, median age 58 (range
23-80), who underwent routine upper gastrointestinal endoscopy
for a variety of indications. Of the 59 subjects studied, endoscopic
information was available for 56, of whom 23 (41%) had past or present
peptic ulcers (20 duodenal, two gastric, and one both). Of these, 12
had at least one ulcer present at the time of the study endoscopy, four
had duodenal erosions only (all these had past duodenal ulceration),
and seven had no ulcer or duodenal erosions but had active ulceration
diagnosed at a previous endoscopy. An active peptic ulcer was defined
as a circumscribed break in the mucosa, with apparent depth, measuring
more than 1 cm in any dimension; an erosion was defined as a definite
circumscribed break in the mucosa not fulfilling the criteria for an
active ulcer; and a previous ulcer was defined as an unequivocal
diagnosis of peptic ulceration in a previous endoscopy or upper GI
series report.Statistical Methods
The 
test
with Yates' continuity correction or Fisher's exact test
was used for analysis of categorical data. The continuous data obtained
from the ELISA results were compared across groups using
Student's t test. Data on cytotoxin activity were
compared using Wilcoxon's rank sum test.
Characterization of the vacA Homolog from
tox
As
described under ``Experimental Procedures,'' the entire vacA homolog from toxH. pylori Strain Tx30a
strain Tx30a was
cloned and sequenced. A 3933-bp open reading frame was present, which
encoded 1310 amino acids. A potential ribosomal binding site (AGGAA)
and an inverted repeat sequence capable of forming a stem-loop
structure in the mRNA (
G = -11.7 kcal) were
each identified. A second open reading frame, homologous to the
cysteinyl tRNA synthetase gene of E. coli, was identified
upstream from vacA, as has been shown previously in
tox strains(8, 12) .
H. pylori strains(8, 10, 11, 12) . The
experimentally determined N-terminal amino acid sequence of the
secreted cytotoxin from a tox
strain (6) was
identified within the deduced VacA sequence from strain Tx30a (95.7%
identity) (Fig. 1). In addition, vacA from strain Tx30a
encoded a potential signal sequence that was highly homologous within
the first 25 residues to the signal sequences of several different
tox
strains(8, 10, 11, 12) .
However, the remainder of the vacA signal sequence encoded by
strain Tx30a was markedly divergent from the corresponding region in
tox
strains (Fig. 1). In addition, compared
with the vacA product from strain 60190, VacA from strain
Tx30a contained a 20-amino acid deletion (corresponding to residues
342-361 of the H. pylori 60190 vacA product, Fig. 1). The deletion corresponds to a hydrophilic,
repeat-containing region in which the vacA product of
tox
strain CCUG 17874 undergoes proteolytic
cleavage(10) . VacA from strain Tx30a also contained a 23-amino
acid insertion (Tx30a residues 501-523, Fig. 1) that was
absent from the vacA product of strain 60190. The nucleotide
sequence encoding most of the insertion (bp 1846-1905) is an
imperfect repeat of the immediately preceding sequence (bp
1783-1842) (81.7% identity). The insertion encoded a potential
ATP/GTP binding site motif (GNIYLGKS, residues 500-507, Fig. 1), corresponding to a Walker A consensus sequence or
phosphate-binding loop(19, 20, 21) . No such
potential ATP/GTP binding sites were predicted by translation of vacA sequences from tox
H. pylori strains(8, 10, 11, 12) .
strain Tx30a with
that of tox
strain 60190. Verticallines denote identity, and colons indicate conservative
substitutions.
strain 60190 indicated that there was
86.6% nucleotide identity between the two homologs. A comparison of the
two deduced VacA amino acid sequences indicated 82.2% identity and
88.8% similarity. However, the level of relatedness between these
proteins varied markedly in different regions. The C-terminal cleaved
portion of the VacA protoxin was highly conserved, whereas there was
only 59.0% amino acid identity within a 244-amino acid region in the
middle of VacA (strain 60190, residues 509-752), and 70-90%
amino acid identity within N-terminal regions ( Fig. 1and Fig. 2). A search of protein data bases indicated that the Tx30a vacA product, as well as the vacA products of
tox
strains, possessed low level homology with the
major ring-forming surface protein (Hsr) of Helicobacter mustelae(22) and rickettsial surface layer
proteins(23, 24, 25, 26) . For
example, there was 25.0% amino acid identity (37.9% similarity) between
Tx30a vacA residues 809-932 and the corresponding
portion of H. mustelae Hsr (alignment with one gap).
strain Tx30a with
that of tox
strain 60190. The highest level of
relatedness was in the C-terminal cleaved portion of the VacA protoxin,
and the greatest diversity was in the middle region of the gene. The
locations of a 20-amino acid insertion in strain 60190 (
), a
23-amino-acid insertion in strain Tx30a (), and paired cysteine
residues (CC) are indicated. Levels of homology (percentage of
amino acid identity) are denoted as follows: open bar,
>90%; barwithhorizontalline,
80-90%; barwithverticallines, 70-80%; barwithdiagonalstripes,
<70%.
Expression of vacA in H. pylori Tx30a
To determine
whether a vacA product was expressed by tox strain Tx30a, broth culture supernatant from this strain was
immunoblotted with antiserum to the purified H. pylori cytotoxin from tox
strain 60190(6) , and
an immunoreactive protein of approximately 93 kDa was recognized (Fig. 3). To determine the site of signal peptide cleavage, the
immunoreactive protein was purified from Tx30a broth culture
supernatant, using previously described methods(6) , and the
N-terminal amino acid sequence was determined. The N-terminal sequence XTPXD corresponded to residues 31-35 (Fig. 1), which suggested that a signal sequence was cleaved at
an Ala-Asn site. The putative signal sequence (residues 1-30)
contained four positive N-terminal charges, a central hydrophobic
region, and a six-amino acid cleavage region corresponding to residues
25-30(27, 28) .
strains, using
antiserum prepared against the purified cytotoxin of strain
60190(6) , indicated that immunoreactive 87-94-kDa bands
were clearly detectable in seven, and faint bands were visualized in
three of the strains. However, in a dot blot assay, a 0.7-kb vacA probe from strain 60190 (derived from a region with 91% nucleotide
identity to vacA from strain Tx30a) hybridized with RNA from
all 13 tox
strains but not Campylobacter fetus 23D or Escherichia coli DH5
(not shown). Thus, vacA transcription occurred in each of the tox strains tested.
Analysis of the Middle Region of vacA from Multiple H.
pylori Strains
To study further the highly divergent middle
region of vacA, PCR products spanning this region
were amplified from an additional tox and
tox
strain (strains 84-183 and 86-313,
respectively)(8) , as described under ``Experimental
Procedures.'' Sequence analysis indicated that each of these
1.5-kb PCR products encoded a partial vacA open reading frame.
We then examined a 0.73-kb region in which there was maximum divergence
(corresponding to amino acid residues 509-752 of the 60190 vacA product, Fig. 1), by aligning and comparing the vacA sequences of strains 84-183, 86-313, Tx30a,
and four previously published vacA sequences. For all four
tox
strains, the vacA sequences were closely
related to each other in this region; similarly, the vacA sequences of all 3 tox
strains were closely
related to each other (Table 2). However, this region was
markedly different between tox
strains and
tox
strains (70.4% mean nucleotide identity and 58.7%
mean amino acid identity). Thus, two different families of vacA alleles could be differentiated at this locus. We hereafter
designate the family of vacA middle region sequences
exemplified by H. pylori strain 60190 as type m1 alleles and
the vacA middle region sequences exemplified by strain Tx30a
as type m2 alleles. All three of the type m2 vacA alleles
encoded an identical 23-amino acid insertion containing a potential
ATP/GTP binding site motif (GXXXXGKS), whereas this insertion
was absent from all four of the type m1 vacA alleles; whether
this site is functionally relevant is not known. Similarly, the
previously described 20-amino acid region, present in strain 60190 but
absent from strain Tx30a, was deleted from each of the three type m2
alleles but was present in each of the type m1 vacA alleles.
vacA Typing Based on Mid-region Nucleotide
Sequences
We next sought to determine the distribution of vacA m1 and m2 allelic types within a collection of 59 H.
pylori clinical isolates. Colony hybridizations of these strains
were performed with probes pCTB4 (8) and VA6, derived from the vacA mid-regions of tox and tox
H. pylori strains, respectively, as described under
``Experimental Procedures.'' Twenty-two (37%) of the strains
hybridized selectively with pCTB4 (indicating a type m1 genotype), and
the remaining 37 (63%) hybridized selectively with VA6 (indicating a
type m2 genotype). Thus, each strain hybridized selectively with only
one of the two probes. To type vacA mid-regions by an
alternate approach, PCR primers (VA3-F, VA3-R, VA4-F, and VA4-R) were
designed to amplify specifically either type m1 or type m2 vacA sequences (Table 1). Of the 59 H. pylori strains
tested, all had DNA amplified by one of the two primer sets, and none
had DNA amplified by both. PCR typing and colony hybridizations
produced identical results for each of the 59 strains tested. Thus,
there were two different families of vacA alleles (m1 and m2)
that could be differentiated at the mid-region locus.
Characterization of vacA Signal Sequences
To study
the vacA signal sequences in H. pylori isolates, a
0.5-kb fragment encoding this region was PCR-amplified from eight
additional H. pylori strains, as described under
``Experimental Procedures,'' and the relevant regions were
sequenced. Two basic families of putative signal sequences were
identified (Fig. 4): 33-amino acid signal sequences closely
related to those present in previously characterized tox strains (designated type s1), and sequences closely related to
the 30-amino acid signal sequence of strain Tx30a (designated type s2).
In comparison with the signal sequences described previously in
tox
strains(8, 10, 11, 12) ,
(which we designate as type s1a), four strains possessed variant signal
sequences (designated type s1b) containing 12 consistent base pair
differences, encoding six consistent amino acid substitutions (Fig. 4).
vacA Typing Based on Signal Sequences
We next
designed PCR primers (VA1-F and VA1-R) to amplify and differentiate
type s1 and s2 vacA signal sequences ( Table 1and Fig. 5). Using these primers, it was predicted that 259- and
286-bp products would be PCR-amplified from type s1 and type s2
strains, respectively. Forty (68%) of 59 strains yielded products of
the former size and 19 (32%) yielded products of the latter size, as
assessed on a 2% agarose gel (Fig. 5). All 59 strains yielded a
PCR product of one of the two sizes; none gave a product of any other
size. To differentiate type s1a and s1b signal sequences and to confirm
the presence of type s2 sequences, new forward primers (SS1-F, SS2-F,
and SS3-F) were designed based on the region encoding the variable
second half of the signal sequence (Table 1, Fig. 4), and
these were used for separate PCR amplifications with the conserved
reverse primer (VA1-R). The designation of all 19 type s2 strains was
confirmed by this approach. Of the 40 type s1 strains, 20 were
classified as type s1a (DNA amplified by primers SS1-F and VA1-R) and
20 as type s1b (DNA amplified by primers SS3-F and VA1-R). For each of
the 59 strains tested, DNA was amplified by only one of the three
primer sets, indicating the specificity of this method.
Naturally Occurring Chimeric vacA Gene
Structures
Among the 59 strains studied, vacA homologs
containing five of the six possible combinations of signal sequence and
mid-region types (s1a/m1, s1a/m2, s1b/m1, s1b/m2, and s2/m2) were
found, but the s2/m1 combination was not, a highly significant finding (p < 0.001) (Table 3). To further validate the
unexpected combination of a type s1 signal sequence with a type m2
mid-region, a 1.5-kb vacA fragment, extending from the ATG
start codon to the mid-region of the gene, was PCR-amplified from
strain 93-68, as described under ``Experimental
Procedures.'' Sequence analysis confirmed the existence of a type
s1a/m2 vacA homolog.
Relationship between cagA Genotype of H. pylori Strains
and vacA Subtypes
To determine whether the presence of cagA was associated with particular vacA genotypes, the
presence of cagA was determined for the 59 H. pylori isolates; 35 (59%) hybridized with a cagA probe. When the vacA signal sequence type was compared with cagA status, 35 (87.5%) of 40 type s1 strains were cagA (17 of 20 s1a and 18 of 20 s1b) compared
with none of 19 type s2 strains (p < 0.001) (Table 4). A significant association also was found between vacA mid-region typing and cagA status (p < 0.001) (Table 4), but subgroup analysis showed that
only the association between signal sequence type and cagA status was independently significant. Thus, there was a highly
significant association between the presence of cagA and the
presence of a type s1 vacA signal sequence.
Production of Vacuolating Cytotoxin Activity in Vitro and
Relationship to vacA Genotype
Of the 59 H. pylori strains tested, supernatants from 25 (42%) induced detectable
vacuolation of HeLa cells (tox). Of 22 strains with
the type s1/m1 vacA genotype, 19 (86%) were
tox
, significantly more than six (33%) of 18 type
s1/m2 strains (p < 0.002), which were in turn more likely
to be tox
than type s2/m2 strains (0 of 19; p < 0.02). In an analysis of the strains from the final 29
consecutive subjects, the vacA genotype also was highly
associated with the level of cytotoxin activity. Among tox
s1/m1 strains the median cytotoxin activity was 16 units (range
8-32), compared with a median cytotoxin activity of 4 units
(range 2-8) for tox
s1/m2 strains (p < 0.01). Thus, all tox
s1/m1 strains were high
grade cytotoxin producers, and all s1/m2 strains producing measurable
activity were low grade producers (Table 5). To assess in
vitro cytotoxin production by a second method, the same 29
concentrated broth culture supernatants were analyzed by an antigen
detection cytotoxin ELISA. ELISA values (mean ± S.E.) for s1/m1
strains (1.93 ± 0.10) were higher than those for s1/m2 strains
(1.28 ± 0.09) (p < 0.001, Student's t test), which in turn were higher than those for s2/m2 strains
(0.91 ± 0.10) (p < 0.02). These data suggest that
there may be different levels of vacA products expressed or
secreted by different vacA genotypes. Thus, the vacA genotype of a strain was a strong predictor of the level of
vacuolating cytotoxin activity produced by the strain in
vitro.
Relationship of vacA Subtype to Occurrence of Peptic
Ulceration
Finally, we sought to determine whether particular vacA genotypes were associated with the occurrence of peptic
ulceration. Infection with a type s1 strain was found in 21 (91%) of
the 23 subjects with past or present peptic ulceration compared with 16
(48%) of the 33 subjects with no documented ulcers (p <
0.005). Three of the patients with peptic ulcer disease were infected
with type s1/cagA strains. Thus, only two
(11%) of 19 patients harboring type s2 strains had past or present
peptic ulcers. Of these, one was a 69-year-old male smoker taking
enteric coated aspirin (325 mg/day), and the other was a 32-year-old
male nonsmoker with no other significant medical problems, who did not
report taking aspirin or other nonsteroidal anti-inflammatory agents.
Twelve (63%) of 19 subjects infected with strains possessing a type m1 vacA mid-region had peptic ulcer disease compared with 11
(30%) of 37 subjects infected with type m2 strains (<0.05). However,
subgroup analysis showed that the vacA mid-region type was not
independently associated with occurrence of peptic ulcer disease.
Twelve (67%) of the 18 persons infected with type s1a strains had
peptic ulcer disease compared with nine (47%) of 19 infected with type
s1b strains, a nonsignificant difference (p = 0.3).
strains compared with nine (27%) of 33 patients
without ulcers (p < 0.05). Subgroup analysis of the 33
tox
strains (nine from ulcer patients and 24 from
non-ulcer patients) indicated that seven (50%) of 14 type s1 strains
were associated with ulcers compared with two (11%) of 19 type s2
strains (p < 0.05). Thus, the vacA signal sequence
type was associated with occurrence of ulceration independent of the in vitro cytotoxin phenotype.
H. pylori strains (8, 10, 11, 12) . The
presence of an immunoreactive
93-kDa protein in culture
supernatant from strain Tx30a suggests that this vacA product
undergoes C-terminal cleavage and secretion through the outer membrane,
probably via a mechanism analogous to that described for tox
strains(8, 10, 11) . Despite these
similarities, vacA from strain Tx30a differed markedly from
previously characterized vacA homologs in two regions: the
mid-region of the gene and the signal sequence. That a large proportion
of H. pylori strains contain vacA alleles resembling
that of strain Tx30a suggests that this type of vacA product
may have functional properties, probably independent of the capacity to
induce cell vacuolation.
and vacA s2/cagA
), but evidence from analysis of
other H. pylori genes fails to support this (43) .
Another possibility is that there may be a functional linkage, whereby
a selective advantage conferred by each gene product is manifested only
in the presence of the other.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
ABSTRACT
This article has been cited by other articles:
|
|
 |
|
  S. Talarico, B. D. Gold, J. Fero, D. T. Thompson, J. Guarner, S. Czinn, and N. R. Salama Pediatric Helicobacter pylori Isolates Display Distinct Gene Coding Capacities and Virulence Gene Marker Profiles J. Clin. Microbiol., June 1, 2009; 47(6): 1680 - 1688. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-R. KI, I.-H. HONG, J.-K. PARK, K.-S. HONG, O.-K. HWANG, J.-Y. HAN, A.-R. JI, S.-I. PARK, S.-K. LEE, S.-E. YOO, et al. Potent Neutralization of Vacuolating Cytotoxin (VacA) of Helicobacter pylori by Immunoglobulins Against the Soluble Recombinant VacA Anticancer Res, June 1, 2009; 29(6): 2393 - 2402. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Romo-Gonzalez, N. R. Salama, J. Burgeno-Ferreira, V. Ponce-Castaneda, E. Lazcano-Ponce, M. Camorlinga-Ponce, and J. Torres Differences in Genome Content among Helicobacter pylori Isolates from Patients with Gastritis, Duodenal Ulcer, or Gastric Cancer Reveal Novel Disease-Associated Genes Infect. Immun., May 1, 2009; 77(5): 2201 - 2211. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Oshio, T. Osaki, T. Hanawa, H. Yonezawa, C. Zaman, S. Kurata, and S. Kamiya Vertical Helicobacter pylori transmission from Mongolian gerbil mothers to pups J. Med. Microbiol., May 1, 2009; 58(5): 656 - 662. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S.-M. Sheu, K.-H. Hung, B.-S. Sheu, H.-B. Yang, and J.-J. Wu Association of Nonsynonymous Substitutions in the Intermediate Region of the vacA Gene of Helicobacter pylori with Gastric Diseases in Taiwan J. Clin. Microbiol., January 1, 2009; 47(1): 249 - 251. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. T. Nguyen, T. Uchida, K. Murakami, T. Fujioka, and M. Moriyama Helicobacter pylori virulence and the diversity of gastric cancer in Asia J. Med. Microbiol., December 1, 2008; 57(12): 1445 - 1453. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. Chitcholtan, M. B. Hampton, and J. I. Keenan Outer membrane vesicles enhance the carcinogenic potential of Helicobacter pylori Carcinogenesis, December 1, 2008; 29(12): 2400 - 2405. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. I. Keenan, K. A. Davis, C. R. Beaugie, J. J. McGovern, and A. P. Moran Alterations in Helicobacter pylori outer membrane and outer membrane vesicle-associated lipopolysaccharides under iron-limiting growth conditions Innate Immunity, October 1, 2008; 14(5): 279 - 290. [Abstract] [PDF]
|
|
|
|
 |
|
 L. S. Ronald, O. Yakovenko, N. Yazvenko, S. Chattopadhyay, P. Aprikian, W. E. Thomas, and E. V. Sokurenko From the Cover: Adaptive mutations in the signal peptide of the type 1 fimbrial adhesin of uropathogenic Escherichia coli PNAS, August 5, 2008; 105(31): 10937 - 10942. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. M. Peek Jr Review: Prevention of gastric cancer: When is treatment of Helicobacter pylori warranted? Therapeutic Advances in Gastroenterology, July 1, 2008; 1(1): 19 - 31. [Abstract] [PDF]
|
|
|
|
|
|
S. E. Ivie, M. S. McClain, V. J. Torres, H. M. S. Algood, D. B. Lacy, R. Yang, S. R. Blanke, and T. L. Cover Helicobacter pylori VacA Subdomain Required for Intracellular Toxin Activity and Assembly of Functional Oligomeric Complexes Infect. Immun., July 1, 2008; 76(7): 2843 - 2851. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. L. Snider, C. Allison, B. H. Bellaire, R. L. Ferrero, and J. A. Cardelli The {beta}1 Integrin Activates JNK Independent of CagA, and JNK Activation Is Required for Helicobacter pylori CagA+-induced Motility of Gastric Cancer Cells J. Biol. Chem., May 16, 2008; 283(20): 13952 - 13963. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. R. Hussein, M. Mohammadi, Y. Talebkhan, M. Doraghi, D. P. Letley, M. K. Muhammad, R. H. Argent, and J. C. Atherton Differences in Virulence Markers between Helicobacter pylori Strains from Iraq and Those from Iran: Potential Importance of Regional Differences in H. pylori-Associated Disease J. Clin. Microbiol., May 1, 2008; 46(5): 1774 - 1779. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Yamaoka Roles of the plasticity regions of Helicobacter pylori in gastroduodenal pathogenesis J. Med. Microbiol., May 1, 2008; 57(5): 545 - 553. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Douraghi, M. Mohammadi, A. Oghalaie, A. Abdirad, M. A. Mohagheghi, M. E. Hosseini, H. Zeraati, A. Ghasemi, M. Esmaieli, and N. Mohajerani dupA as a risk determinant in Helicobacter pylori infection J. Med. Microbiol., May 1, 2008; 57(5): 554 - 562. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. H. Argent, R. J. Thomas, F. Aviles-Jimenez, D. P. Letley, M. C. Limb, E. M. El-Omar, and J. C. Atherton Toxigenic Helicobacter pylori Infection Precedes Gastric Hypochlorhydria in Cancer Relatives, and H. pylori Virulence Evolves in These Families Clin. Cancer Res., April 1, 2008; 14(7): 2227 - 2235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S.-B. Lee, J.-W. Yang, and C.-S. Kim The association between conjunctival MALT lymphoma and Helicobacter pylori Br. J. Ophthalmol., April 1, 2008; 92(4): 534 - 536. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-R. Ki, H.-R. Lee, M.-J. Goo, I.-H. Hong, S.-H. Do, D.-H. Jeong, H.-J. Yang, D.-W. Yuan, J.-K. Park, and K.-S. Jeong Differential regulation of ERK1/2 and p38 MAP kinases in VacA-induced apoptosis of gastric epithelial cells Am J Physiol Gastrointest Liver Physiol, March 1, 2008; 294(3): G635 - G647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. H. Argent, R. J. Thomas, D. P. Letley, M. G. Rittig, K. R. Hardie, and J. C. Atherton Functional association between the Helicobacter pylori virulence factors VacA and CagA J. Med. Microbiol., February 1, 2008; 57(2): 145 - 150. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. T. Franco, E. Johnston, U. Krishna, Y. Yamaoka, D. A. Israel, T. A. Nagy, L. E. Wroblewski, M. B. Piazuelo, P. Correa, and R. M. Peek Jr. Regulation of Gastric Carcinogenesis by Helicobacter pylori Virulence Factors Cancer Res., January 15, 2008; 68(2): 379 - 387. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Skoglund, B. Bjorkholm, C. Nilsson, A. F. Andersson, C. Jernberg, K. Schirwitz, C. Enroth, M. Krabbe, and L. Engstrand Functional Analysis of the M.HpyAIV DNA Methyltransferase of Helicobacter pylori J. Bacteriol., December 15, 2007; 189(24): 8914 - 8921. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Emilia, M. Luppi, P. Zucchini, M. Morselli, L. Potenza, F. Forghieri, F. Volzone, G. Jovic, G. Leonardi, A. Donelli, et al. Helicobacter pylori infection and chronic immune thrombocytopenic purpura: long-term results of bacterium eradication and association with bacterium virulence profiles Blood, December 1, 2007; 110(12): 3833 - 3841. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. A. Gangwer, D. J. Mushrush, D. L. Stauff, B. Spiller, M. S. McClain, T. L. Cover, and D. B. Lacy Crystal structure of the Helicobacter pylori vacuolating toxin p55 domain PNAS, October 9, 2007; 104(41): 16293 - 16298. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Reyes-Leon, J. C. Atherton, R. H. Argent, J. L. Puente, and J. Torres Heterogeneity in the Activity of Mexican Helicobacter pylori Strains in Gastric Epithelial Cells and Its Association with Diversity in the cagA Gene Infect. Immun., July 1, 2007; 75(7): 3445 - 3454. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. H. Pillinger, N. Marjanovic, S.-Y. Kim, Y.-C. Lee, J. U. Scher, J. Roper, A. M. Abeles, P. I. Izmirly, M. Axelrod, M. Y. Pillinger, et al. Helicobacter pylori Stimulates Gastric Epithelial Cell MMP-1 Secretion via CagA-dependent and -independent ERK Activation J. Biol. Chem., June 29, 2007; 282(26): 18722 - 18731. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. R. Salama, G. Gonzalez-Valencia, B. Deatherage, F. Aviles-Jimenez, J. C. Atherton, D. Y. Graham, and J. Torres Genetic Analysis of Helicobacter pylori Strain Populations Colonizing the Stomach at Different Times Postinfection J. Bacteriol., May 15, 2007; 189(10): 3834 - 3845. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Megraud and P. Lehours Helicobacter pylori Detection and Antimicrobial Susceptibility Testing Clin. Microbiol. Rev., April 1, 2007; 20(2): 280 - 322. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. J. Owen and J. Xerry Geographical conservation of short inserts in the signal and middle regions of the Helicobacter pylori vacuolating cytotoxin gene Microbiology, April 1, 2007; 153(4): 1176 - 1186. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Ghose, G. I. Perez-Perez, V. J. Torres, M. Crosatti, A. Nomura, R. M. Peek Jr., T. L. Cover, F. Francois, and M. J. Blaser Serological Assays for Identification of Human Gastric Colonization by Helicobacter pylori Strains Expressing VacA m1 or m2 Clin. Vaccine Immunol., April 1, 2007; 14(4): 442 - 450. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Izzotti, S. De Flora, C. Cartiglia, B. M. Are, M. Longobardi, A. Camoirano, I. Mura, M. P. Dore, A. M. Scanu, P. C. Rocca, et al. Interplay between Helicobacter pylori and host gene polymorphisms in inducing oxidative DNA damage in the gastric mucosa Carcinogenesis, April 1, 2007; 28(4): 892 - 898. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. J. Windle, D. Kelleher, and J. E. Crabtree Childhood Helicobacter pylori Infection and Growth Impairment in Developing Countries: A Vicious Cycle? Pediatrics, March 1, 2007; 119(3): e754 - e759. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. M. S. Algood, V. J. Torres, D. Unutmaz, and T. L. Cover Resistance of Primary Murine CD4+ T Cells to Helicobacter pylori Vacuolating Cytotoxin Infect. Immun., January 1, 2007; 75(1): 334 - 341. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. M. Kang, N. M. Iovine, and M. J. Blaser A paradigm for direct stress-induced mutation in prokaryotes FASEB J, December 1, 2006; 20(14): 2476 - 2485. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Kusters, A. H. M. van Vliet, and E. J. Kuipers Pathogenesis of Helicobacter pylori Infection Clin. Microbiol. Rev., July 1, 2006; 19(3): 449 - 490. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Oleastro, L. Monteiro, P. Lehours, F. Megraud, and A. Menard Identification of Markers for Helicobacter pylori Strains Isolated from Children with Peptic Ulcer Disease by Suppressive Subtractive Hybridization Infect. Immun., July 1, 2006; 74(7): 4064 - 4074. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. K. Boughan, R. H. Argent, M. Body-Malapel, J.-H. Park, K. E. Ewings, A. G. Bowie, S. J. Ong, S. J. Cook, O. E. Sorensen, B. A. Manzo, et al. Nucleotide-binding Oligomerization Domain-1 and Epidermal Growth Factor Receptor: CRITICAL REGULATORS OF beta-DEFENSINS DURING HELICOBACTER PYLORI INFECTION J. Biol. Chem., April 28, 2006; 281(17): 11637 - 11648. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. J. Torres, M. S. McClain, and T. L. Cover Mapping of a Domain Required for Protein-Protein Interactions and Inhibitory Activity of a Helicobacter pylori Dominant-Negative VacA Mutant Protein Infect. Immun., April 1, 2006; 74(4): 2093 - 2101. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Hirata, T. Ohmae, W. Shibata, S. Maeda, K. Ogura, H. Yoshida, T. Kawabe, and M. Omata MyD88 and TNF Receptor-Associated Factor 6 Are Critical Signal Transducers in Helicobacter pylori-Infected Human Epithelial Cells J. Immunol., March 15, 2006; 176(6): 3796 - 3803. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Genisset, C. L. Galeotti, P. Lupetti, D. Mercati, D. A. G. Skibinski, S. Barone, R. Battistutta, M. de Bernard, and J. L. Telford A Helicobacter pylori Vacuolating Toxin Mutant That Fails To Oligomerize Has a Dominant Negative Phenotype Infect. Immun., March 1, 2006; 74(3): 1786 - 1794. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. A. G. Skibinski, C. Genisset, S. Barone, and J. L. Telford The Cell-Specific Phenotype of the Polymorphic vacA Midregion Is Independent of the Appearance of the Cell Surface Receptor Protein Tyrosine Phosphatase {beta} Infect. Immun., January 1, 2006; 74(1): 49 - 55. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Lu, J. Y. Wu, T. Kudo, T. Ohno, D. Y. Graham, and Y. Yamaoka Regulation of Interleukin-6 Promoter Activation in Gastric Epithelial Cells Infected with Helicobacter pylori Mol. Biol. Cell, October 1, 2005; 16(10): 4954 - 4966. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Yamazaki, A. Yamakawa, T. Okuda, M. Ohtani, H. Suto, Y. Ito, Y. Yamazaki, Y. Keida, H. Higashi, M. Hatakeyama, et al. Distinct Diversity of vacA, cagA, and cagE Genes of Helicobacter pylori Associated with Peptic Ulcer in Japan J. Clin. Microbiol., August 1, 2005; 43(8): 3906 - 3916. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Yokoyama, H. Higashi, S. Ishikawa, Y. Fujii, S. Kondo, H. Kato, T. Azuma, A. Wada, T. Hirayama, H. Aburatani, et al. Functional antagonism between Helicobacter pylori CagA and vacuolating toxin VacA in control of the NFAT signaling pathway in gastric epithelial cells PNAS, July 5, 2005; 102(27): 9661 - 9666. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Kranzer, L. Sollner, M. Aigner, N. Lehn, L. Deml, M. Rehli, and W. Schneider-Brachert Impact of Helicobacter pylori Virulence Factors and Compounds on Activation and Maturation of Human Dendritic Cells Infect. Immun., July 1, 2005; 73(7): 4180 - 4189. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Fitchen, D. P Letley, P. O'Shea, J. C Atherton, P. Williams, and K. R Hardie All subtypes of the cytotoxin VacA adsorb to the surface of Helicobacter pylori post-secretion J. Med. Microbiol., July 1, 2005; 54(7): 621 - 630. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. J. Torres, S. E. Ivie, M. S. McClain, and T. L. Cover Functional Properties of the p33 and p55 Domains of the Helicobacter pylori Vacuolating Cytotoxin J. Biol. Chem., June 3, 2005; 280(22): 21107 - 21114. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ghose, G. I. Perez-Perez, L. J. van Doorn, M. G. Dominguez-Bello, and M. J. Blaser High Frequency of Gastric Colonization with Multiple Helicobacter pylori Strains in Venezuelan Subjects J. Clin. Microbiol., June 1, 2005; 43(6): 2635 - 2641. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-C. Wu, P.-Y. Chou, C.-T. Hu, Z.-C. Liu, C.-Y. Lin, Y.-H. Tseng, and N.-T. Lin Clinical Relevance of the vacA, iceA, cagA, and flaA Genes of Helicobacter pylori Strains Isolated in Eastern Taiwan J. Clin. Microbiol., June 1, 2005; 43(6): 2913 - 2915. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Kauser, M. A. Hussain, I. Ahmed, N. Ahmad, A. Habeeb, A. A. Khan, and N. Ahmed Comparing Genomes of Helicobacter pylori Strains from the High-Altitude Desert of Ladakh, India J. Clin. Microbiol., April 1, 2005; 43(4): 1538 - 1545. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Nakagawa, T. Osaki, Y. Fujioka, H. Yamaguchi, and S. Kamiya Long-Term Infection of Mongolian Gerbils with Helicobacter pylori: Microbiological, Histopathological, and Serological Analyses Clin. Vaccine Immunol., February 1, 2005; 12(2): 347 - 353. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. R. Henderson, F. Navarro-Garcia, M. Desvaux, R. C. Fernandez, and D. Ala'Aldeen Type V Protein Secretion Pathway: the Autotransporter Story Microbiol. Mol. Biol. Rev., December 1, 2004; 68(4): 692 - 744. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. Wada, E. Yamasaki, and T. Hirayama Helicobacter pylori Vacuolating Cytotoxin, VacA, Is Responsible for Gastric Ulceration J. Biochem., December 1, 2004; 136(6): 741 - 746. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y Huang, X-G Fan, Z-M Wang, J-H Zhou, X-F Tian, and N Li Identification of helicobacter species in human liver samples from patients with primary hepatocellular carcinoma J. Clin. Pathol., December 1, 2004; 57(12): 1273 - 1277. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Aviles-Jimenez, D. P. Letley, G. Gonzalez-Valencia, N. Salama, J. Torres, and J. C. Atherton Evolution of the Helicobacter pylori Vacuolating Cytotoxin in a Human Stomach J. Bacteriol., August 1, 2004; 186(15): 5182 - 5185. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R Rad, A Dossumbekova, B Neu, R Lang, S Bauer, D Saur, M Gerhard, and C Prinz Cytokine gene polymorphisms influence mucosal cytokine expression, gastric inflammation, and host specific colonisation during Helicobacter pylori infection Gut, August 1, 2004; 53(8): 1082 - 1089. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. M. Carroll, N. Ahmed, S. M. Beesley, A. A. Khan, S. Ghousunnissa, C. A.O Morain, C. M. Habibullah, and C. J. Smyth Microevolution between paired antral and paired antrum and corpus Helicobacter pylori isolates recovered from individual patients J. Med. Microbiol., July 1, 2004; 53(7): 669 - 677. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. V. Bland, S. Ismail, J. A. Heinemann, and J. I. Keenan The Action of Bismuth against Helicobacter pylori Mimics but Is Not Caused by Intracellular Iron Deprivation Antimicrob. Agents Chemother., June 1, 2004; 48(6): 1983 - 1988. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. E. Hennig, R. Mernaugh, J. Edl, P. Cao, and T. L. Cover Heterogeneity among Helicobacter pylori Strains in Expression of the Outer Membrane Protein BabA Infect. Immun., June 1, 2004; 72(6): 3429 - 3435. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Azuma, A. Yamakawa, S. Yamazaki, M. Ohtani, Y. Ito, A. Muramatsu, H. Suto, Y. Yamazaki, Y. Keida, H. Higashi, et al. Distinct Diversity of the cag Pathogenicity Island among Helicobacter pylori Strains in Japan J. Clin. Microbiol., June 1, 2004; 42(6): 2508 - 2517. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. Asrat, I. Nilsson, Y. Mengistu, E. Kassa, S. Ashenafi, K. Ayenew, T. Wadstrom, and W. Abu-Al-Soud Prevalence of Helicobacter pylori vacA and cagA Genotypes in Ethiopian Dyspeptic Patients J. Clin. Microbiol., June 1, 2004; 42(6): 2682 - 2684. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Chattopadhyay, R. Patra, T. Ramamurthy, A. Chowdhury, A. Santra, G. K. Dhali, S. K. Bhattacharya, D. E. Berg, G. B. Nair, and A. K. Mukhopadhyay Multiplex PCR Assay for Rapid Detection and Genotyping of Helicobacter pylori Directly from Biopsy Specimens J. Clin. Microbiol., June 1, 2004; 42(6): 2821 - 2824. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Sundrud, V. J. Torres, D. Unutmaz, and T. L. Cover Inhibition of primary human T cell proliferation by Helicobacter pylori vacuolating toxin (VacA) is independent of VacA effects on IL-2 secretion PNAS, May 18, 2004; 101(20): 7727 - 7732. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Saribasak, B. A. Salih, Y. Yamaoka, and E. Sander Analysis of Helicobacter pylori Genotypes and Correlation with Clinical Outcome in Turkey J. Clin. Microbiol., April 1, 2004; 42(4): 1648 - 1651. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Li, A. Wandinger-Ness, J. R. Goldenring, and T. L. Cover Clustering and Redistribution of Late Endocytic Compartments in Response to Helicobacter pylori Vacuolating Toxin Mol. Biol. Cell, April 1, 2004; 15(4): 1946 - 1959. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Wen, C. P. Felley, H. Bouzourene, M. Reimers, P. Michetti, and Q. Pan-Hammarstrom Inflammatory Gene Profiles in Gastric Mucosa during Helicobacter pylori Infection in Humans J. Immunol., February 15, 2004; 172(4): 2595 - 2606. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Lehours, A. Menard, S. Dupouy, B. Bergey, F. Richy, F. Zerbib, A. Ruskone-Fourmestraux, J. C. Delchier, and F. Megraud Evaluation of the Association of Nine Helicobacter pylori Virulence Factors with Strains Involved in Low-Grade Gastric Mucosa-Associated Lymphoid Tissue Lymphoma Infect. Immun., February 1, 2004; 72(2): 880 - 888. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. J. Torres, M. S. McClain, and T. L. Cover Interactions between p-33 and p-55 Domains of the Helicobacter pylori Vacuolating Cytotoxin (VacA) J. Biol. Chem., January 16, 2004; 279(3): 2324 - 2331. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. M. Carroll, N. Ahmed, S. M. Beesley, A. A. Khan, S. Ghousunnissa, C. A. O Morain, and C. J. Smyth Fine-Structure Molecular Typing of Irish Helicobacter pylori Isolates and Their Genetic Relatedness to Strains from Four Different Continents J. Clin. Microbiol., December 1, 2003; 41(12): 5755 - 5759. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ismail, M. B. Hampton, and J. I. Keenan Helicobacter pylori Outer Membrane Vesicles Modulate Proliferation and Interleukin-8 Production by Gastric Epithelial Cells Infect. Immun., October 1, 2003; 71(10): 5670 - 5675. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J R Bebb, D P Letley, R J Thomas, F Aviles, H M Collins, S A Watson, N M Hand, A Zaitoun, and J C Atherton Helicobacter pylori upregulates matrilysin (MMP-7) in epithelial cells in vivo and in vitro in a Cag dependent manner Gut, October 1, 2003; 52(10): 1408 - 1413. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Panthel, P. Dietz, R. Haas, and D. Beier Two-Component Systems of Helicobacter pylori Contribute to Virulence in a Mouse Infection Model Infect. Immun., September 1, 2003; 71(9): 5381 - 5385. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M Gooz, M Shaker, P Gooz, and A J Smolka Interleukin 1{beta} induces gastric epithelial cell matrix metalloproteinase secretion and activation during Helicobacter pylori infection Gut, September 1, 2003; 52(9): 1250 - 1256. [Abstract] [Full Text]
|
|
|
|
 |
|
 B. Gebert, W. Fischer, E. Weiss, R. Hoffmann, and R. Haas Helicobacter pylori Vacuolating Cytotoxin Inhibits T Lymphocyte Activation Science, August 22, 2003; 301(5636): 1099 - 1102. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Letley, J. L. Rhead, R. J. Twells, B. Dove, and J. C. Atherton Determinants of Non-toxicity in the Gastric Pathogen Helicobacter pylori J. Biol. Chem., July 11, 2003; 278(29): 26734 - 26741. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-Y. Park, M. Kwak, O. Gutierrez, D. Y. Graham, and Y. Yamaoka Comparison of Genotyping Helicobacter pylori Directly from Biopsy Specimens and Genotyping from Bacterial Cultures J. Clin. Microbiol., July 1, 2003; 41(7): 3336 - 3338. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Akada, K. Ogura, D. Dailidiene, G. Dailide, J. M. Cheverud, and D. E. Berg Helicobacter pylori tissue tropism: mouse-colonizing strains can target different gastric niches Microbiology, July 1, 2003; 149(7): 1901 - 1909. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Bebb, D. P. Letley, J. L. Rhead, and J. C. Atherton Helicobacter pylori Supernatants Cause Epithelial Cytoskeletal Disruption That Is Bacterial Strain and Epithelial Cell Line Dependent but Not Toxin VacA Dependent Infect. Immun., June 1, 2003; 71(6): 3623 - 3627. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Wang, L.-J. van Doorn, P. A. Robinson, X. Ji, D. Wang, Y. Wang, L. Ge, J. L. Telford, and J. E. Crabtree Regional Variation among vacA Alleles of Helicobacter pylori in China J. Clin. Microbiol., May 1, 2003; 41(5): 1942 - 1945. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Ayraud, B. Janvier, L. Salaun, and J.-L. Fauchere Modification in the ppk Gene of Helicobacterpylori during Single and Multiple Experimental Murine Infections Infect. Immun., April 1, 2003; 71(4): 1733 - 1739. [Abstract] [Full Text]
|
|
|
|
|
|
A. Santos, D. M. M. Queiroz, A. Menard, A. Marais, G. A. Rocha, C. A. Oliveira, A. M. M. F. Nogueira, M. Uzeda, and F. Megraud New Pathogenicity Marker Found in the Plasticity Region of the Helicobacter pylori Genome J. Clin. Microbiol., April 1, 2003; 41(4): 1651 - 1655. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C-F Zambon, F Navaglia, D Basso, M Rugge, and M Plebani Helicobacter pylori babA2, cagA, and s1 vacA genes work synergistically in causing intestinal metaplasia J. Clin. Pathol., April 1, 2003; 56(4): 287 - 291. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. G. Boneca, H. d. Reuse, J.-C. Epinat, M. Pupin, A. Labigne, and I. Moszer A revised annotation and comparative analysis of Helicobacter pylori genomes Nucleic Acids Res., March 15, 2003; 31(6): 1704 - 1714. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. L. Cover, U. S. Krishna, D. A. Israel, and R. M. Peek Jr. Induction of Gastric Epithelial Cell Apoptosis by Helicobacter pylori Vacuolating Cytotoxin Cancer Res., March 1, 2003; 63(5): 951 - 957. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C I Koehler, M B Mues, H P Dienes, J Kriegsmann, P Schirmacher, and M Odenthal Helicobacter pylori genotyping in gastric adenocarcinoma and MALT lymphoma by multiplex PCR analyses of paraffin wax embedded tissues Mol. Pathol., February 1, 2003; 56(1): 36 - 42. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. J. Debets-Ossenkopp, G. Reyes, J. Mulder, B. M. aan de Stegge, J. T. A. M. Peters, P. H. M. Savelkoul, J. Tanca, A. S. Pena, and C. M. J. E. Vandenbroucke-Grauls Characteristics of clinical Helicobacter pylori strains from Ecuador J. Antimicrob. Chemother., January 1, 2003; 51(1): 141 - 145. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. A. Aras, A. J. Small, T. Ando, and M. J. Blaser Helicobacter pylori interstrain restriction-modification diversity prevents genome subversion by chromosomal DNA from competing strains Nucleic Acids Res., December 15, 2002; 30(24): 5391 - 5397. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Cao and T. L. Cover Two Different Families of hopQ Alleles in Helicobacter pylori J. Clin. Microbiol., December 1, 2002; 40(12): 4504 - 4511. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. J. Blaser Polymorphic Bacteria Persisting in Polymorphic Hosts: Assessing Helicobacter pylori-Related Risks for Gastric Cancer J Natl Cancer Inst, November 20, 2002; 94(22): 1662 - 1663. [Full Text] [PDF]
|
|
|
|
|
|
C. Figueiredo, J. C. Machado, P. Pharoah, R. Seruca, S. Sousa, R. Carvalho, A. F. Capelinha, W. Quint, C. Caldas, L.-J. van Doorn, et al. Helicobacter pylori and Interleukin 1 Genotyping: An Opportunity to Identify High-Risk Individuals for Gastric Carcinoma J Natl Cancer Inst, November 20, 2002; 94(22): 1680 - 1687. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Ghose, G. I. Perez-Perez, M.-G. Dominguez-Bello, D. T. Pride, C. M. Bravi, and M. J. Blaser East Asian genotypes of Helicobacter pylori strains in Amerindians provide evidence for its ancient human carriage PNAS, November 12, 2002; 99(23): 15107 - 15111. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N Kalia, K D Bardhan, J C Atherton, and N J Brown Toxigenic Helicobacter pylori induces changes in the gastric mucosal microcirculation in rats Gut, November 1, 2002; 51(5): 641 - 647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Chanto, A. Occhialini, N. Gras, R. A. Alm, F. Megraud, and A. Marais Identification of strain-specific genes located outside the plasticity zone in nine clinical isolates of Helicobacter pylori Microbiology, November 1, 2002; 148(11): 3671 - 3680. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C.-H. Lai, C.-H. Kuo, Y.-C. Chen, F.-Y. Chao, S.-K. Poon, C.-S. Chang, and W.-C. Wang High Prevalence of cagA- and babA2-Positive Helicobacter pylori Clinical Isolates in Taiwan J. Clin. Microbiol., October 1, 2002; 40(10): 3860 - 3862. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J Yu, W K Leung, M Y Y Go, M C W Chan, K F To, E K W Ng, F K L Chan, T K W Ling, S C S Chung, and J J Y Sung Relationship between Helicobacter pylori babA2 status with gastric epithelial cell turnover and premalignant gastric lesions Gut, October 1, 2002; 51(4): 480 - 484. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. I. SMITH, C. KIRSCH, K. S. OYEDEJI, A. O. ARIGBABU, A. O. COKER, E. BAYERDOFFER, and S. MIEHLKE Prevalence of Helicobacter pylori vacA, cagA and iceA genotypes in Nigerian patients with duodenal ulcer disease J. Med. Microbiol., October 1, 2002; 51(10): 851 - 854. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Schraw, Y. Li, M. S. McClain, F. G. van der Goot, and T. L. Cover Association of Helicobacter pylori Vacuolating Toxin (VacA) with Lipid Rafts J. Biol. Chem., September 6, 2002; 277(37): 34642 - 34650. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Xu, R. D. Morgan, R. J. Roberts, S. Y. Xu, L. J. van Doorn, J. P. Donahue, G. G. Miller, and M. J. Blaser Functional analysis of iceA1, a CATG-recognizing restriction endonuclease gene in Helicobacter pylori Nucleic Acids Res., September 1, 2002; 30(17): 3839 - 3847. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. SALGADO, A. GARCIA, A. ONATE, C. GONZALEZ, and F. KAWAGUCHI Increased in-vitro and in-vivo biological activity of lipopolysaccharide extracted from clinical low virulence vacA genotype Helicobacter pylori strains J. Med. Microbiol., September 1, 2002; 51(9): 771 - 776. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |