Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hewitt, S. M.
Right arrow Articles by Saunders, G. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hewitt, S. M.
Right arrow Articles by Saunders, G. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 30, Issue of July 28, pp. 17908-17912, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Transcriptional Silencer of the Wilms Tumor Gene WT1 Contains an Alu Repeat (*)

(Received for publication, April 17, 1995; and in revised form, June 1, 1995)

Stephen M. Hewitt (§) Gail C. Fraizer Grady F. Saunders (¶)

From the Department of Biochemistry and Molecular Biology, The University of Texas M. D. Anderson Cancer Center, Houston, Texas 77030

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Expression of the Wilms' tumor gene WT1 is tightly regulated throughout development. In constrast, the WT1 promoter is promiscuous, functioning in all cell lines tested. We have cloned a transcriptional silencer that is involved in regulation of the WT1 gene. The transcriptional silencer is located in the third intron of the WT1 gene, approximately 12 kilobases from the promoter, and functions to repress transcription from the WT1 promoter in cell lines of non-renal origin. The 460-base pair silencer region is unusual in that it contains a full-length Alu repeat. We have also cloned an enhancer like-element located 1.3 kilobases upstream of the WT1 promoter.


INTRODUCTION

Wilms' tumor is an embryonal tumor of the kidney affecting 1 in 10,000 live births worldwide(1) . Wilms' tumor has a number of genes associated with its pathogenesis, but only the WT1 gene, associated with the WAGR syndrome (Wilms' tumor, aniridia, genito-urinary abnormalities, and mental retardation)(2) , has been cloned. Other genes purported to be involved in Wilms' tumor pathogenesis include a gene (WT2) at 11p15 associated with Beckwith-Wiedemann syndrome (3) and a gene associated with familial Wilms' tumor(3) . The human WT1 gene maps to chromosomal band 11p13 and encodes a zinc finger transcription factor(4, 5) . The WT1 protein contains a proline-rich amino-terminal region that mediates transcriptional repression and has four Cys-Cys, His-His zinc fingers in the carboxyl terminus (exons 7-10) that bind DNA (Fig. 1A)(3) . WT1 binds a consensus sequence of GNGNGGGNG (6) and represses transcription from the promoters of the early growth response gene 1 (EGR1)(7) , platelet-derived growth factor a-chain (PDGF a-chain)(8) , insulin-like growth factor II (IGF II)(9) , insulin-like growth factor I receptor (IGF1R)(10) , transforming growth factor 1 (TGF1)(11) , colony-stimulating factor 1 (CSF-1) (12) genes and can repress its own promoter (13) in CAT reporter assays.


Figure 1: Map of WT1 gene. A, the exon/intron organization of the WT1 gene with alternative splice sites and encoded protein is depicted. The WT1 gene contains 10 exons (black bars) spread over 50 kb of DNA. Shown as vertical boxes are the WT1 5` enhancer (5` Enh), promoter (Pro), intronic silencer (Sil), and 3` enhancer (3` Enh). 5` and 3` untranslated regions are depicted as horizontal stippled boxes. At the top of the figure, partial restriction map of WT1 is depicted E = EcoRI, N = NotI box with the 3` end of the cosmid cB5-2 marked by a bent arrow. aa = amino acid residues. B, map of the 5` end of the WT1 locus. The upper portion of the diagram shows the partial restriction map of the WT1 region of exons 1-3 and the intronic silencer, relative to the NotI site. The 3` end of the silencer is flanked by the cosmid vector. The lower portion of the figure demonstrates in greater detail the organization of the Wit1 gene (spotted) and WT1 promoter (hatched), as well as the location of the 5` enhancer (stippled oval). A partial restriction map of the 5`-flanking region of both Wit1 and WT1 is depicted. B = BamHI, Bl = BglII, H = HindIII, M = MboI, N = NotI, P = PstI, and X = XbaI.



In previous work we have characterized the WT1 promoter region(14) . The human WT1 promoter consists of a 652-bp GC-rich region containing multiple transcription start sites. The promoter functions in a promiscuous fashion, with transcription detectable in all cell lines tested by transient CAT reporter assays. We have also previously described a 3` enhancer region within the 3`-flanking region of WT1, approximately 50 kb()downstream from the WT1 promoter (14) (Fig. 1A), which functions as an enhancer in leukemic cell lines and appears to mediate its enhancer function through GATA-binding factors(15) .

WT1 has a tightly restricted expression pattern; it is expressed during murine development within the mesonephric and metanephric kidneys, the lining of the heart, the mesothelial lining of the abdomen and thorax, and the spleen and testis(16) . After birth, WT1 expression is limited to the mesothelium, testis, podocytes of the glomerulus in the kidney, and bone marrow(17) . Expression of WT1 in human malignancy has been found in most acute leukemias(18, 19) , Wilms' tumors(20) , and mesotheliomas(16) . WT1 expression in Wilms' tumors is variable but correlates with histologic type(20) . Mesotheliomas often over-express WT1, with at least one mesothelioma containing a mutation in the WT1 gene that may be causative for the tumor(16) .

We have searched for additional regulatory elements that modulate transcription from the promiscuous WT1 promoter. We have cloned two regions from the WT1 locus that are capable of altering transcription. In this process we found an upstream enhancer-like element (Fig. 1B) that enhanced transcription from the SV40 promoter but did not function with the WT1 promoter. At the same time we found a transcriptional silencer located within the third intron of WT1 (Fig. 1B) that represses transcription from both the WT1 and SV40 promoters and functions in a cell type-restricted fashion only repressing transcription in cell lines of non-renal origin. This silencer element contains a full-length Alu repeat. Alu repeats are members of the SINE (Short Interspersed Element) family of human repetitive DNA sequences(21) . Alu repeats are approximately 300 bp long and interspersed throughout the human genome with an average spacing of 5 kb. The number of Alu repeats is estimated at >500,000 copies in the haploid human genome(22) . The function of Alu repeats is unclear(23) , but they have been frequently identified in the transcriptional regulatory regions of a number of genes(24) .


EXPERIMENTAL PROCEDURES

Cloning and Sequencing

The 5` enhancer fragment was generated by HindIII restriction digestion of the 3.1-kb XhoI genomic fragment cloned into pBlueScript, containing the 5` terminus of the longest WT1 cDNA, LK15 (Fig. 1B). The 0.15-kb enhancer fragment was cloned into the HindIII site of the vector pCAT Promoter (Promega) and the clone pWT1pro-CAT. pWT1pro-CAT contains a 652-bp fragment of the WT1 promoter linked to the CAT reporter gene(14) .

The 0.91-kb silencer fragment was isolated from the cosmid cB5-2 by HindIII digestion and cloned into the same vectors as the enhancer fragment as well as the pBlueScript vector in both orientations. For deletion analysis, the 0.91-kb fragment in pBlueScript was digested with BglII and BamHI (contained within the vector) and inserted into pWT1pro-CAT. Using this method, we generated the 0.46-kb (5`3S4) and 0.45-kb (3`3S4) subclones. PCR amplification was used to amplify the 96- and 64-bp fragments of the 5`3S4 silencer clone, and these fragments were cloned into the vector pWT1pro-CAT. The 96-bp element was generated by PCR amplification using the 0.91-kb silencer fragment as template with the primers BAM136 (GTGGATCCCCCGGGCTGCAGGATT) and BGL136 (GAAGATCTGACTGGGGAAAGAAAAAGTTT). The 64-bp element was generated with the primers BAM74 (AAGGATCCGGCCCAGTCAGCAGGCACAA) and BGL74 (ACAGATCTAATCCAACAATGTCAGTCT). Clones were sequenced using Sequenase (United States Biochemical Corp.) by the didoxynucleotide method, as described by the manufacturer.

Cell Culture and CAT Assays

All cell lines were maintained at 37 °C in a 5% CO environment. Cells were cultured in the medium specified containing 10% fetal bovine serum. Cell lines were obtained from the American Type Culture Collection unless stated otherwise. HeLa cells, a human cervical carcinoma cell line (ATCC CCL2), 293 cells, a human embryonic kidney cell line transformed with adenovirus type 5 (ATCC CRL 1573), and G401 cells, a human rhabdoid tumor of the kidney cell line (ATCC CRL 1441) were maintained in minimal essential media. The K562 cell line, a chronic myelogenous leukemia in blast crisis cell line (ATCC CCL 243) was maintained in RPMI. II-14 cells, a rat mesotheliomna cell line (25) were maintained in Dulbecco's minimal essential medium/F-12 supplemented with insulin, transferrin, selenium, and hydrocortisone. Transfections were performed by electroporation, and CAT assays were normalized with -galactosidase as an internal control by the method described in Fraizer et al.(14) , except that all cells were electroporated at 260 V, 960 microfarads in 200 µl of medium without serum(26) . Relative activities reported are the average of three transfection experiments.


RESULTS

Identification of Transcriptional Silencer

In an effort to locate elements that regulate expression of WT1, we prepared subclones of HindIII fragments of the genomic cosmid cB5-2, which had previously been mapped (14) into CAT reporter constructs containing the SV40 promoter (pCAT promoter). These clones were initially screened in K562 cells, a chronic myelogenous leukemia in blast crisis cell line, which expresses WT1 at high levels(4) . A 0.91-kb fragment located within the third intron of WT1 (Fig. 1B) repressed transcription from the SV40 promoter almost 4-fold (Fig. 2A).


Figure 2: Silencer activity. Relative CAT activity of the 0.91-kb silencer fragment. A, CAT activity of the 0.91-kb silencer fragment assayed in K562, 293, and G401 cells is expressed relative to the SV40 promoter control (pCAT promoter). Transcriptional repression is evident only in K562 cells. Activity is expressed relative to the SV40 promoter. B, relative activity of the 0.91-kb silencer fragment with the WT1 promoter. The 0.91-kb silencer fragment represses transcription from the WT1 promoter in K562 and HeLa cells, but not 293 cells. Activity is relative to the WT1 promoter alone. C, CAT assay demonstrating activity of the 0.91-kb silencer fragment with the WT1 promoter in K562 cells. Lane 1, the WT1 promoter (652 bp); lane 2, the WT1 promoter with the 0.91-kb silencer fragment.



Silencer Functions with Different Promoter and Is Cell Type-specific

Silencer activity of the 0.91-kb fragment from the third intron of WT1 was tested with the SV40 promoter in 293 cells, a human embryonic kidney cell line that expresses endogenous WT1(4) , and G401 cells, a rhabdoid tumor of the kidney cell line(27) . The silencer did not alter CAT expression from the SV40 promoter in either 293 or G401 cells (Fig. 2A). The silencer was also tested in HL60 cells, a promyelocytic leukemia cell line, and demonstrated the ability to repress transcription from the SV40 promoter 4-fold.

To determine the ability of the silencer to repress transcription from the full-length 652-bp WT1 promoter, a CAT reporter vector containing both the WT1 promoter and the 0.91-kb silencer was assayed in K562, 293, and HeLa cells. The silencer repressed transcription from the WT1 promoter more than 5-fold in the K562 cells (Fig. 2, B and C) and more than 10-fold in HeLa cells but failed to repress transcription in the 293 cell line (Fig. 2B). The silencer fragment was tested alternatively in a 5` position adjacent to the WT1 promoter or 3`, downstream of the CAT gene, and in its reverse orientation. It functioned equally well in all positions confirming the position and orientation independence of the silencer element.

Sequence of the 0.46-kb Silencer Region

The silencer fragment was sequenced and found to include a full-length Alu repeat (Fig. 3). The 308-bp Alu sequence is in reverse orientation with respect to the WT1 gene, with the poly(A) tail (poly T within the sequence) at the 5` end of the silencer region. The Alu repeat lacks the tandem repeats frequently found at the insertion sites of most Alu repeats(28) . The Alu sequence diverges from the consensus Alu sequence (28) by 16.2%, whereas the average divergence of Alu sequences in the human genome is 16.12%, with a standard deviation of 5.63%(29) . A search for potential transcription factor binding sites revealed several potential sites of interest (Fig. 3).


Figure 3: Sequence of the 460-bp silencer region. The Alu repeat is underlined. The ends of the 96- and 64-bp clones are marked with an asterisk and arrow. Transcription factors that have potential binding motifs present within the 460-bp silencer region are shaded. I, AP-2 (YCSCCMNSSS)(41) ; II, AP-2 (GSSWGSCC)(42) ; III, APRT-CHO US (GCCCCACCC)(43) ; IV, CF1 (ANATGG)(44) ; V, CTCF (CCCTC)(44) ; VI, GATA-1 (MYWATCWY)(45) ; VII, HC3 (CCACCA)(46) ; VIII, HiNF-A (ATTTNNNNATTT)(47) ; IX, HNF-5 (TRTTTGY)(48) ; X, INF.1 (AAGTGA)(49) ; XI, LyF-1 (TGGGAGR)(44) ; XII, MEP-1 (TGCRCNC)(44) ; XIII, NF-GM (GRGRTTKCAY)(51) ; XIV, NF-GM (TCAGRTA)(51) ; XV, NF (GGGRHTYHC)(52) ; XVI, TCF-1 (MAMAG)(44) ; XVII, WAP US5 (CCAAGT)(53) . K = G,T; M = A,C; R = A,G; S = C,G; W = A,T; T = C,T; H = A,C,T.



Deletion Analysis of the Silencer Region

A series of deletion constructs of the silencer fragment were made to define the essential silencer region. Initially the 0.91-kb silencer fragment was subdivided into two fragments (0.46 and 0.45 kb) by cleavage at an internal BglII restriction site. The presence of the internal BglII restriction enzyme site, flanked by the HindIII and MboI sites, confirmed that the 0.91-kb silencer fragment was in the third intron of WT1(30) . Sequence analysis demonstrated the silencer element was located at the junction with the cosmid vector(14) . The 0.46-kb 5` fragment and a 0.45-kb 3` fragment were cloned into a CAT reporter vector containing the 652-bp WT1 promoter. These regions were assayed for silencer activity in HeLa cells. The 5` 0.46-kb fragment contained all the silencer activity, repressing transcription 10-fold, whereas the 3` fragment had no effect on transcription from the WT1 promoter (Fig. 4).


Figure 4: Essential silencer region. Activity of the 0.91-kb silencer in HeLa cells. CAT activity is depicted relative to the WT1 promoter. The 460-bp 5`3S4 fragment contains all the silencer activity, whereas the 450-bp 3`3S4 fragment of and the 96- and 64-bp fragments contain no silencer activity. These results define a region of 300 bp that is essential for silencer activity and corresponds to the Alu repeat.



The 460-bp silencer fragment was also tested in K562 and 293 cells for silencing activity. In K562 cells, the silencer repressed transcription more than 10-fold, whereas in 293 cells, transcription from the WT1 promoter remained unaffected (1.15-fold of the WT1 promoter alone). In an effort to determine whether the silencer was species-specific, the 460-bp silencer element with the WT1 promoter construct was transfected into a rat mesotheliomna cell line, II-14. The silencer functioned to repress transcription from the WT1 promoter 10-fold in II-14 cells.

To determine whether the silencer was able to repress the WT1 promoter in the presence of the 3` hematopoietic specific enhancer, we tested a construct containing the 652-bp WT1 promoter with both the 460-bp silencer and the 1083-bp enhancer (14) in K562 cells. The silencer repressed transcription from the WT1 promoter more than 10-fold, nullifying the enhancer activity.

The Alu Repeat Is Required For Silencer Activity

In an effort to delineate the essential silencer region, two additional deletion constructs were made. PCR was used to generate both a 96-bp fragment containing the 5` end of the 460-bp fragment and a 64-bp fragment containing the 3` end of the 460-bp fragment. These PCR fragments were cloned into a construct containing the 652-bp WT1 promoter and assayed for silencer activity. The constructs excluded the Alu repeat and allowed analysis of the role the Alu sequence plays in silencer activity (Fig. 3). Neither the 3` nor 5` deletion constructs contained silencer activity in HeLa cells (Fig. 5), implying that some or all of the 300-bp Alu sequence is required for silencer activity or that the 3`- and 5`-flanking regions together function as a silencer.


Figure 5: Enhancer activity. Relative CAT activity of the 5` enhancer region. A, the 5` enhancer activates transcription from the SV40 promoter in K562 and 293 cells. CAT activity is expressed relative to the SV40 promoter control (pCAT promoter). B, the 5` enhancer fails to activate transcription from the WT1 promoter in K562 or G401 cells. CAT activity is expressed relative to the WT1 promoter construct without the enhancer. C, CAT assay demonstrating activity of the 5` enhancer with the SV40 promoter. Lane 1, pCAT-Promoter (SV40 promoter); lane 2, pCAT-Control (SV40 promoter and enhancer); lane 3, 5` enhancer with the SV40 promoter in K562 cells.



Identification of a Transcriptional Enhancer

A subsequent screening for additional regulatory elements identified a transcriptional enhancer. A 0.15-kb XhoI-HindIII fragment located 5` of LK15 (Fig. 1B) enhanced transcription from the SV40 promoter more than 7-fold in K562 cells (Fig. 5, A and C). To further characterize the 0.15-kb enhancer fragment, its activity was assayed in 293 cells. This fragment demonstrated greater than 3-fold enhancement of transcription from the SV40 promoter in the 293 cells (Fig. 5A). This fragment was then cloned into a vector containing the full-length 652-bp WT1 promoter linked to the CAT gene to test enhancer activity with the WT1 promoter. Transfection of this construct into either K562 or G401 cells failed to demonstrate enhancer activity from the 0.15-kb fragment using the WT1 promoter (Fig. 5B). The enhancer was tested with the full-length 652-bp WT1 promoter in 293 cells by calcium phosphate transfection (14) as well, and showed no enhancer activity (data not shown). The 0.15-kb enhancer was sequenced (Fig. 6) and found to be identical to a 148-bp region of the first intron of Wit1 (bases 2519-2666; GeneBank accession no. X69950)(31) . A search for potential transcriptional factor binding sites revealed multiple potential sites of interest (Fig. 6).


Figure 6: Sequence of the 148-bp 5` enhancer region. This sequence is identical to a portion of the sequence of Gessler and Bruns(31) . Transcription factors that have potential binding motifs present within the the 148-bp 5` enhancer region are shaded. I, AP-1(GAGAGGA)(54) ; II, AP-2 (YCSCCMNSSS)(41) ; III, AP-2 (GSSWGSCC)(42) ; IV, IF-SilB (TCMYTT)(55) ; V, CK-8-mer (AANCCAAA)(56) ; VI, E2F (TTTSSCGS)(44) ; VII, GCF (SCGSSSC)(44) ; VIII, LyF-1 (TGGGAGR)(44) ; IX, NF-IL6 (TKNNGNAAK)(44) ; X, myo spe fac (GTCGCC)(50) ; XI, WAP US6 (TTTAAA)(53) . K = G,T; M =A,C; R = A,G; S = C,G; W =A,T; Y = C,T; H = A,C,T.




DISCUSSION

Cell Type Specificity of the WT1 Silencer

We have previously demonstrated that transcription from the WT1 promoter is promiscuous (14) . In a search for tissue-specific regulatory elements involved in WT1 transcription, we cloned a silencer region from the third intron of WT1 at a distance of 12 kb downstream from the WT1 promoter. The silencer represses basal transcription from both the SV40 and WT1 promoters in constructs lacking enhancers, and the addition of the 3` hematopoietic specific enhancer has no effect on silencer function in K562 cells. This silencer represses transcription in all cell lines of non-renal origin that we have tested including leukemic cells (K562 and HL60) and cervical carcinoma cells (HeLa). Interestingly, this silencer does not repress transcription in cells of renal origin (293 or G401). The silencer activity correlates with cell type origin and not with WT1 mRNA expression (Table 1).



Although the silencer function in cells that express endogenous WT1, such as K562, HL60, and II-14 cells, expression probably results from alternative mechanisms of WT1 transcriptional activation that can override the silencer in these cell lines. Since the 3` enhancer cannot activate WT1 transcription in either HL60 or II-14 cells, clearly other regulatory elements must be responsible for WT1 expression in these cells. It is possible that these other cis-acting elements which control WT1 expression in hematopoietic and mesothelial cells may under certain circumstances overcome the repression by the silencer element.

Alu Sequences Are Required for Silencer Activity

Silencer deletion experiments indicate that an Alu repeat sequence is required for silencer activity or the silencer element is transected by an Alu repeat. Alu repeats have been associated with regulatory elements (in both silencers and enhancers) of a number of genes, including keratin 18(32) , erythropoietin(24) , CD8(33) , -globin(34) , and the chain Fc/T cell receptor (35) genes. The mechanisms by which Alu repeats are believed to modulate transcription are diverse. In some instances Alu repeat sequences mediate repression through transcriptional interference mechanisms, as demonstrated with -globin(36) . Transcriptional interference results from transcription initiated at an internal RNA polymerase III promoter that is contained in a subset of Alu sequences(36) . It is unlikely that the Alu repeat present within the 460-bp silencer region interferes with transcription of the WT1 mRNA, as the silencer functions in an orientation and position independent fashion. Transcriptional interference would require the silencer to be position dependent, generating transcripts that would read through the reporter gene. Neznanov et al. (32) have postulated that Alu repeats can function as ``insulators,'' defining transcriptionally active domains, and they have tested this hypothesis in transgenic animals. They found that an Alu repeat was capable of repressing transcription from the keratin 18 promoter(37) . Other workers reported silencer activity in Alu repeats as a result of the interaction of Alu-binding proteins with the Alu repeat in a sequence-specific manner(38) . Additionally, some reports have indicated that over time, the Alu repeat has evolved to ``gain'' function, that is, by the introduction of base substitutions within the Alu repeat, transcription factor-binding sites have been created, thus allowing Alu repeats to take on new roles as transcriptional enhancers or silencers(35) . Given that the silencer functions in an orientation and position independent manner, with both the SV40 and WT1 promoter, in both human and rodent cells, it appears that this Alu repeat has gained silencer function rather than functioning by virtue of containing an Alu repeat.

5`-Enhancer Fragment

We have identified a 148-bp region that is capable of enhancing transcription from the SV40 promoter. This region was unable to increase transcription from the full-length 652-bp WT1 promoter. However, this does not preclude the possibility that the 148-bp fragment is a functional enhancer in other cell types or that other flanking sequences are required for enhancer function with the WT1 promoter. This enhancer lies within an intron of the Wit1 gene (31) , a small gene whose transcription originates from the same region as WT1 in the opposite direction. Wit1 is not well characterized, with a very small open reading frame of 276 nucleotides which does not encode a known protein(39) . This enhancer fragment lies 877 bp from the closest Wit1 transcriptional start site (40) and perhaps may function as a enhancer for Wit1 transcription. Wit1 has also been demonstrated to initiate transcription from a second region within the first intron of WT1, generating an antisense transcript through exon 1 of WT1, but the start sites of this transcript remain unmapped(40) .

In summary, we have cloned a 460-bp silencer region that represses transcription from the WT1 promoter in a cell type-specific fashion. This silencer region requires some or all of an Alu repeat for activity. This silencer may be important in restricting WT1 expression to certain tissues during normal development.


FOOTNOTES

*
This work was supported by Grants CA34936 and CA 16672 from National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank®/EMBL Data Bank with accession number(s) U28481[GenBank Link].

§
M.D./Ph.D. Predoctoral Fellow at The University of Texas Graduate School of Biomedical Sciences supported by Grant T32 CA09299.

To whom correspondence should be addressed: Dept. of Biochemistry and Molecular Biology, Box 117, The University of Texas M. D. Anderson Cancer Center, 1515 Holcombe Blvd., Houston, TX, 77030. Tel.: 713-792-2690; Fax: 713-790-0329.

The abbreviations used are: kb, kilobase(s); bp, base pair(s); PCR, polymerase chain reaction; CAT, chloramphenicol acetyl transferase.


ACKNOWLEDGEMENTS

We thank Matthew Lewin, Tapati Maity, Ying-Ji Wu, and Ruby S. Desiderio for their assistance. We also thank Cheryl Walker for the gift of II-14 cells.


REFERENCES

  1. Young, J. L., Jr., and Miller, R. W.(1975)J. Pediatr. 86,254-258 [CrossRef][Medline] [Order article via Infotrieve]
  2. Riccardi, V. M., Sujansky, E., Smith, A. C., and Francke, U.(1978) Pediatrics 61, 604-610 [Abstract/Free Full Text]
  3. Huff, V., and Saunders, G. F.(1993)Biochim. Biophys. Acta 1155, 295-306 [Medline] [Order article via Infotrieve]
  4. Call, K. M., Glaser, T., Ito, C. Y., Buckler, A. J., Pelletier, J., Haber, D. A., Rose, E. A., Kral, A., Yeger, H., Lewis, W. H., Jones, C., and Housman, D. E. (1990)Cell 60, 509-520 [CrossRef][Medline] [Order article via Infotrieve]
  5. Gessler, M., Poustka, A., Cavenee, W., Neve, R. L., Orkin, S. H., and Bruns, G. A. P. (1990)Nature 343, 774-778 [CrossRef][Medline] [Order article via Infotrieve]
  6. Paveletich, N. P., and Pabo, C. O.(1991)Science 252, 809-817 [Abstract/Free Full Text]
  7. Madden, S. L., Cook, D. M., Morris, J. F., Gashler, A., Sukhatme, V. P., and Rauscher, F. J., III(1991)Science 253, 1550-1553 [Abstract/Free Full Text]
  8. Wang, Z. Y., Madden, S. L., Deuel, T. F., and Rauscher, F. J., III(1992)J. Biol. Chem. 267, 21999-22002 [Abstract/Free Full Text]
  9. Drummond, I. A., Madden, S. L., Rohwer-Nutter, P., Bell, G. I., Sukhatme, V. P., and Rauscher, F. J. III(1992)Science 257, 674-678 [Abstract/Free Full Text]
  10. Werner, H., Rauscher, F. J., III, Sukhatme, V. P., Drummond, I. A., Roberts, C. T., and LeRoith, D.(1994)J. Biol. Chem. 269, 12577-12582 [Abstract/Free Full Text]
  11. Dey, B. R., Sukhatme, V. P., Roberts, A. B., Sporn, M. B., Rauscher, F. J., III, and Kim, S.-J. (1994)Mol. Endocrinol. 8, 595-602 [Abstract/Free Full Text]
  12. Harrington, M. A., Konicek, B., Song, A., Xia, Z.-L., Fredricks, W. J., and Rauscher, F. J., III(1993)J. Biol. Chem. 268, 21271-21275 [Abstract/Free Full Text]
  13. Rupprecht, H. D., Drummond, I. A., Madden, S. L., Rauscher, F. J., III, and Sukhatme, V. P.(1994)J. Biol. Chem. 269, 6198-6206 [Abstract/Free Full Text]
  14. Fraizer, G. C., Wu, Y.-J., Hewitt, S. M., Maity, T., Ton, C. C. T., Huff, V., and Saunders, G. F.(1994)J. Biol. Chem. 269, 8892-8900 [Abstract/Free Full Text]
  15. Wu, Y. -J., Fraizer, G. C., and Saunders, G. F.(1995)J. Biol. Chem. 270, 5944-5949 [Abstract/Free Full Text]
  16. Park, S., Schalling, M., Bernard, A., Maheswaran, S., Shipley, G. C., Roberts, D., Fletcher, J., Shipman, R., Rheinwald, J., Demetri, G., Griffin, J., Minden, M., Housman, D. E., and Haber, D. A.(1993)Nat. Genet. 4, 415-420 [CrossRef][Medline] [Order article via Infotrieve]
  17. Buckler, A. J., Pelletier, J., Haber, D. A., Glaser, T., and Housman, D. E. (1991)Mol. Cell. Biol. 11, 1707-1712 [Abstract/Free Full Text]
  18. Miwa, H., Beran, M., and Saunders, G. F.(1992)Leukemia 6, 405-409 [Medline] [Order article via Infotrieve]
  19. Miyagi, T., Ahuja, H., Kubota, T., Kubonishi, I., Koeffler, H. P., and Miyoshi, I. (1993)Leukemia 7, 970-977 [Medline] [Order article via Infotrieve]
  20. Miwa, H., Tomlinson, G. E., Timmons, C. F., Huff, V., Cohn, S. L., Strong, L. C., and Saunders, G. F.(1992)J. Natl. Cancer Inst. 84, 181-187 [Abstract/Free Full Text]
  21. Shen, M. R., Batzer, M. A., and Deininger, P. L.(1991)J. Mol. Evol. 33, 311-320 [CrossRef][Medline] [Order article via Infotrieve]
  22. Kariya, Y., Kato, K., Hayashizaki, Y., Himeno, S., Tarui, S., and Matsubara, K.(1987) Gene (Amst.) 53,1-10 [CrossRef][Medline] [Order article via Infotrieve]
  23. Houck, C. M., Rinehart, F. P., and Schmid, C. W.(1979)J. Mol. Biol. 132, 289-306 [CrossRef][Medline] [Order article via Infotrieve]
  24. Maouche, L., Carston, J. P., and Chretien, S.(1994)Nucleic Acids Res. 22, 338-346 [Abstract/Free Full Text]
  25. Walker, C., Bermudez, E., Stewart, W., Bonner, J., Molloy, C. J., and Everitt, J. (1992)Cancer Res. 52, 301-306 [Abstract/Free Full Text]
  26. Oka, T., Rairkar, A., and Chen, J. H.(1991)Oncogene 6, 2077-2083 [Medline] [Order article via Infotrieve]
  27. Garvin, A. J., Re, G. G., Tarnowski, B. I., Hazen-Martin, D. J., and Sens, D. A.(1993) Am. J. Pathol. 142, 375-379 [Abstract]
  28. Kariya, Y., Kato, K., Hayashizaki, Y., Himeno, and S., Tarui(1987)Gene (Amst.) 53,1-10
  29. Jurka, J., and Smith, T. (1988)Proc. Natl. Acad. Sci. U. S. A. 85, 4775-4778 [Abstract/Free Full Text]
  30. Tadokoro, K., Oki, N., Fujii, H., Ohshima, A., Inoue, T., and Yamada, M.(1992) Jpn. J. Cancer Res. 83, 1198-1203 [CrossRef][Medline] [Order article via Infotrieve]
  31. Gessler, M., and Bruns, G. A. P.(1993)Genomics 17, 499-501 [CrossRef][Medline] [Order article via Infotrieve]
  32. Neznanov, N. S., and Oshima, R. G.(1993)Mol. Cell. Biol. 13, 1815-1823 [Abstract/Free Full Text]
  33. Hambor, J. E., Mennone, J., Coon, M. E., Hanke, J. H., and Kavathas, P.(1993) Mol. Cell. Biol. 13, 7056-7070 [Abstract/Free Full Text]
  34. Kim, J.-H., Yu, C.-Y., Bailey, A., Hardison, R., and Shen, C.-K.(1989) Nucleic Acids Res. 17, 5687-5700 [Abstract/Free Full Text]
  35. Brini, A. T., Lee, G. M., and Kinet, J.-P.(1993)J. Biol. Chem. 268, 1355-1361 [Abstract/Free Full Text]
  36. Wu, J., Grindlay, G. J., Bushel, P., Mendelsohn, L., and Allan, M. E.(1990) Mol. Cell. Biol. 10, 1209-1216 [Abstract/Free Full Text]
  37. Neznanov, N., Thorey, I. S., Cecena, G., and Oshima, R. G.(1993)Mol. Cell. Biol. 13, 2214-2223 [Abstract/Free Full Text]
  38. Perelygina, L. M., Tomilin, N. V., and Podgornaya, O. I.(1987)Mol. Biol. Rep. 12, 111-116 [CrossRef][Medline] [Order article via Infotrieve]
  39. Huang, A., Campbell, C. E., Bonetta, L., McAndrews-Hill, M. S., Chilton-MacNeill, S., Coppes, M. J., Law, D. J., Feinberg, A. P., Yeger, H., and Williams, B. R. G. (1990)Science 250, 991-994 [Abstract/Free Full Text]
  40. Campbell, C. E., Huang, A., Gurney, A. L., Kessler, P. M., Hewitt, J. A., and Williams, B. R. G.(1994)Oncogene 9, 583-595 [Medline] [Order article via Infotrieve]
  41. Imagawa, M., Chiu, R., and Karin, M.(1987)Cell 51, 251-260 [CrossRef][Medline] [Order article via Infotrieve]
  42. Mitchell, P. J., Wang, C., and Tjian, R.(1987)Cell 50, 847-861 [CrossRef][Medline] [Order article via Infotrieve]
  43. Park, J.-H., and Taylor, M. W.(1988)Mol. Cell. Biol. 8, 2536-2544 [Abstract/Free Full Text]
  44. Faisst, S., and Meyer, S.(1992)Nucleic Acids Res. 20, 3-26 [Free Full Text]
  45. Wall, L., deBoer, E., and Grosveld, F.(1988)Genes & Dev. 2, 1089-1100
  46. Augereau, P., and Chambon, P.(1986)EMBO J. 5, 1791-1797 [Medline] [Order article via Infotrieve]
  47. van Wijnen, A. J., Wright, K. L., Massung, R. F., Gerretsen, M., Stein, J. L., and Stein, L.(1988)Nucleic Acids Res. 16, 571-591 [Abstract/Free Full Text]
  48. Grange, T., Roux, J., Rigaud, G., and Pictet, R.(1990)Nucleic Acids Res. 19, 131-139 [Abstract/Free Full Text]
  49. Fujita, T., Shibuya, H., Hotta, H., Yamanishi, K., and Taniguchi, T.(1987) Cell 49, 357-367 [CrossRef][Medline] [Order article via Infotrieve]
  50. Walsh, K., and Schimmel, P.(1987)J. Biol. Chem. 262, 9429-9432 [Abstract/Free Full Text]
  51. Shannon, M. F., Gamble, J. R., and Vadas, M. A.(1988)Proc. Natl. Acad. Sci. U. S. A. 85, 674-678 [Abstract/Free Full Text]
  52. Lenardo, M. J., and Baltimore, D.(1989)Cell 58, 227-229 [CrossRef][Medline] [Order article via Infotrieve]
  53. Lubon, H. K., and Hennighausen, L.(1987)Nucleic Acids Res. 15, 2103-2121 [Abstract/Free Full Text]
  54. Distel, R. J., Ro, H.-Y., Rosen, B. S., Groves, D. L., and Spiegelman, B. M.(1987) Cell 49, 835-844 [CrossRef][Medline] [Order article via Infotrieve]
  55. Locker, J., and Buzard, G. J.(1990)J. DNA Sequencing Map. 1,3-11
  56. Blessing, M., Zentgraf, H., and Jorcano, J. L.(1987)EMBO J.6,567-575 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
S. Wang, Y. Zhao, C. Hu, and J. Zhu
Differential repression of human and mouse TERT genes during cell differentiation
Nucleic Acids Res., May 1, 2009; 37(8): 2618 - 2629.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. S. Makki, T. Heinzel, and C. Englert
TSA downregulates Wilms tumor gene 1 (Wt1) expression at multiple levels
Nucleic Acids Res., July 1, 2008; 36(12): 4067 - 4078.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. A. Trujillo, M. Sakagashira, and N. L. Eberhardt
The Human Growth Hormone Gene Contains a Silencer Embedded within an Alu Repeat in the 3'-Flanking Region
Mol. Endocrinol., October 1, 2006; 20(10): 2559 - 2575.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. K. Tripathi, S. Misra, S. V. Khedkar, N. Hamilton, C. Irvin-Wilson, C. Sharan, L. Sealy, and G. Chaudhuri
Regulation of BRCA2 Gene Expression by the SLUG Repressor Protein in Human Breast Cells
J. Biol. Chem., April 29, 2005; 280(17): 17163 - 17171.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Castronuevo, M. A. Thornton, L. E. McCarthy, J. Klimas, and B. P. Schick
DNase I Hypersensitivity Patterns of the Serglycin Proteoglycan Gene in Resting and Phorbol 12-Myristate 13-Acetate-stimulated Human Erythroleukemia (HEL), CHRF 288-11, and HL-60 Cells Compared with Neutrophils and Human Umbilical Vein Endothelial Cells
J. Biol. Chem., December 5, 2003; 278(49): 48704 - 48712.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
B. Zablewska, L. Bylund, S. A. Mandic, M. Fromaget, P. Gaudray, and G. Weber
Transcription Regulation of the Multiple Endocrine Neoplasia Type 1 Gene in Human and Mouse
J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3845 - 3851.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
W. Le Goff, M. Guerin, M. J. Chapman, and J. Thillet
A CYP7A promoter binding factor site and Alu repeat in the distal promoter region are implicated in regulation of human CETP gene expression
J. Lipid Res., May 1, 2003; 44(5): 902 - 910.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Y. Satoh, T. Nakagawachi, H. Nakadate, Y. Kaneko, Z. Masaki, T. Mukai, and H. Soejima
Significant Reduction of WT1 Gene Expression, Possibly Due to Epigenetic Alteration in Wilms' Tumor
J. Biochem., March 1, 2003; 133(3): 303 - 308.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. R. Wilund, M. Yi, F. Campagna, M. Arca, G. Zuliani, R. Fellin, Y.-K. Ho, J. V. Garcia, H. H. Hobbs, and J. C. Cohen
Molecular mechanisms of autosomal recessive hypercholesterolemia
Hum. Mol. Genet., November 15, 2002; 11(24): 3019 - 3030.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Krucken, O. Stamm, H.-P. Schmitt-Wrede, A. Mincheva, P. Lichter, and F. Wunderlich
Spleen-specific Expression of the Malaria-inducible Intronless Mouse Gene imap38
J. Biol. Chem., August 20, 1999; 274(34): 24383 - 24391.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
G. Ferbeyre, J. M. Smith, and R. Cedergren
Schistosome Satellite DNA Encodes Active Hammerhead Ribozymes
Mol. Cell. Biol., July 1, 1998; 18(7): 3880 - 3888.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
C.-Y. Zhang, S. Kim, J. W. Harney, and P. R. Larsen
Further Characterization of Thyroid Hormone Response Elements in the Human Type 1 Iodothyronine Deiodinase Gene
Endocrinology, March 1, 1998; 139(3): 1156 - 1163.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Scholz, S. A. Bossone, H. T. Cohen, U. Akella, W. M. Strauss, and V. P. Sukhatme
A Far Upstream Cis-element Is Required for Wilms' Tumor-1 (WT1) Gene Expression in Renal Cell Culture
J. Biol. Chem., December 26, 1997; 272(52): 32836 - 32846.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
J. Wang, S.-F. Su, M. J. Dresser, M. E. Schaner, C. B. Washington, and K. M. Giacomini
Na+-dependent purine nucleoside transporter from human kidney: cloning and functional characterization
Am J Physiol Renal Physiol, December 1, 1997; 273(6): F1058 - F1065.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Zhang, G. Xing, G. C. Fraizer, and G. F. Saunders
Transactivation of an Intronic Hematopoietic-specific Enhancer of the Human Wilms' Tumor 1 Gene by GATA-1 and c-Myb
J. Biol. Chem., November 14, 1997; 272(46): 29272 - 29280.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Huang and V. Gallo
Gene Structure of the Rat Kainate Receptor Subunit KA2 and Characterization of an Intronic Negative Regulatory Region
J. Biol. Chem., March 28, 1997; 272(13): 8618 - 8627.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. T. Cohen, S. A. Bossone, G. Zhu, G. A. McDonald, and V. P. Sukhatme
Sp1 Is a Critical Regulator of the Wilms' tumor-1 Gene
J. Biol. Chem., January 31, 1997; 272(5): 2901 - 2913.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. J. Piedrafita, R. B. Molander, G. Vansant, E. A. Orlova, M. Pfahl, and W. F. Reynolds
An Alu Element in the Myeloperoxidase Promoter Contains a Composite SP1-Thyroid Hormone-Retinoic Acid Response Element
J. Biol. Chem., June 14, 1996; 271(24): 14412 - 14420.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. M. Hewitt, G. C. Fraizer, Y.-J. Wu, F. J. Rauscher III, and G. F. Saunders
Differential Function of Wilms' Tumor Gene WT1 Splice Isoforms in Transcriptional Regulation
J. Biol. Chem., April 12, 1996; 271(15): 8588 - 8592.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Q. Gong, L. J. Brown, and M. J. MacDonald
Functional Analysis of Two Promoters for the Human Mitochondrial Glycerol Phosphate Dehydrogenase Gene
J. Biol. Chem., November 22, 2000; 275(48): 38012 - 38021.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Hewitt, S. M.
Right arrow Articles by Saunders, G. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Hewitt, S. M.
Right arrow Articles by Saunders, G. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement