|
|
|
|||||||
|
|||||||||
(Received for publication, April 17, 1995; and in revised form, June 1, 1995) From the
Expression of the Wilms' tumor gene WT1 is tightly
regulated throughout development. In constrast, the WT1 promoter is
promiscuous, functioning in all cell lines tested. We have cloned a
transcriptional silencer that is involved in regulation of the WT1
gene. The transcriptional silencer is located in the third intron of
the WT1 gene, approximately 12 kilobases from the promoter, and
functions to repress transcription from the WT1 promoter in cell lines
of non-renal origin. The 460-base pair silencer region is unusual in
that it contains a full-length Alu repeat. We have also cloned an
enhancer like-element located 1.3 kilobases upstream of the WT1
promoter. Wilms' tumor is an embryonal tumor of the kidney affecting
1 in 10,000 live births worldwide(1) . Wilms' tumor has a
number of genes associated with its pathogenesis, but only the WT1
gene, associated with the WAGR syndrome (Wilms' tumor, aniridia,
genito-urinary abnormalities, and mental
retardation)(2) , has been cloned. Other genes purported to be
involved in Wilms' tumor pathogenesis include a gene (WT2) at
11p15 associated with Beckwith-Wiedemann syndrome (3) and a
gene associated with familial Wilms' tumor(3) . The human
WT1 gene maps to chromosomal band 11p13 and encodes a zinc finger
transcription factor(4, 5) . The WT1 protein contains
a proline-rich amino-terminal region that mediates transcriptional
repression and has four Cys-Cys, His-His zinc fingers in the carboxyl
terminus (exons 7-10) that bind DNA (Fig. 1A)(3) . WT1 binds a consensus sequence
of GNGNGGGNG (6) and represses transcription from the promoters
of the early growth response gene 1 (EGR1)(7) ,
platelet-derived growth factor a-chain (PDGF a-chain)(8) ,
insulin-like growth factor II (IGF II)(9) , insulin-like growth
factor I receptor (IGF1R)(10) , transforming growth factor
Figure 1:
Map of WT1 gene. A, the
exon/intron organization of the WT1 gene with alternative splice sites
and encoded protein is depicted. The WT1 gene contains 10 exons (black bars) spread over 50 kb of DNA. Shown as vertical
boxes are the WT1 5` enhancer (5` Enh), promoter (Pro), intronic silencer (Sil), and 3` enhancer (3` Enh). 5` and 3` untranslated regions are depicted as horizontal stippled boxes. At the top of the figure, partial
restriction map of WT1 is depicted E = EcoRI, N = NotI box with the 3` end of the cosmid
cB5-2 marked by a bent arrow. aa = amino acid
residues. B, map of the 5` end of the WT1 locus. The upper
portion of the diagram shows the partial restriction map of the WT1
region of exons 1-3 and the intronic silencer, relative to the NotI site. The 3` end of the silencer is flanked by the cosmid
vector. The lower portion of the figure demonstrates in greater detail
the organization of the Wit1 gene (spotted) and WT1 promoter (hatched), as well as the location of the 5` enhancer (stippled oval). A partial restriction map of the 5`-flanking
region of both Wit1 and WT1 is depicted. B = BamHI, Bl = BglII, H = HindIII, M = MboI, N = NotI, P = PstI,
and X = XbaI.
In previous work we have characterized the WT1
promoter region(14) . The human WT1 promoter consists of a
652-bp GC-rich region containing multiple transcription start sites.
The promoter functions in a promiscuous fashion, with transcription
detectable in all cell lines tested by transient CAT reporter assays.
We have also previously described a 3` enhancer region within the
3`-flanking region of WT1, approximately 50 kb WT1 has a tightly
restricted expression pattern; it is expressed during murine
development within the mesonephric and metanephric kidneys, the lining
of the heart, the mesothelial lining of the abdomen and thorax, and the
spleen and testis(16) . After birth, WT1 expression is limited
to the mesothelium, testis, podocytes of the glomerulus in the kidney,
and bone marrow(17) . Expression of WT1 in human malignancy has
been found in most acute leukemias(18, 19) ,
Wilms' tumors(20) , and mesotheliomas(16) . WT1
expression in Wilms' tumors is variable but correlates with
histologic type(20) . Mesotheliomas often over-express WT1,
with at least one mesothelioma containing a mutation in the WT1 gene
that may be causative for the tumor(16) . We have searched
for additional regulatory elements that modulate transcription from the
promiscuous WT1 promoter. We have cloned two regions from the WT1 locus
that are capable of altering transcription. In this process we found an
upstream enhancer-like element (Fig. 1B) that enhanced
transcription from the SV40 promoter but did not function with the WT1
promoter. At the same time we found a transcriptional silencer located
within the third intron of WT1 (Fig. 1B) that represses
transcription from both the WT1 and SV40 promoters and functions in a
cell type-restricted fashion only repressing transcription in cell
lines of non-renal origin. This silencer element contains a full-length
Alu repeat. Alu repeats are members of the SINE (Short Interspersed
Element) family of human repetitive DNA sequences(21) . Alu
repeats are approximately 300 bp long and interspersed throughout the
human genome with an average spacing of 5 kb. The number of Alu repeats
is estimated at >500,000 copies in the haploid human
genome(22) . The function of Alu repeats is
unclear(23) , but they have been frequently identified in the
transcriptional regulatory regions of a number of genes(24) .
The 0.91-kb silencer fragment
was isolated from the cosmid cB5-2 by HindIII digestion
and cloned into the same vectors as the enhancer fragment as well as
the pBlueScript vector in both orientations. For deletion analysis, the
0.91-kb fragment in pBlueScript was digested with BglII and BamHI (contained within the vector) and inserted into
pWT1pro-CAT. Using this method, we generated the 0.46-kb (5`
Figure 2:
Silencer activity. Relative CAT activity
of the 0.91-kb silencer fragment. A, CAT activity of the
0.91-kb silencer fragment assayed in K562, 293, and G401 cells is
expressed relative to the SV40 promoter control (pCAT promoter).
Transcriptional repression is evident only in K562 cells. Activity is
expressed relative to the SV40 promoter. B, relative activity
of the 0.91-kb silencer fragment with the WT1 promoter. The 0.91-kb
silencer fragment represses transcription from the WT1 promoter in K562
and HeLa cells, but not 293 cells. Activity is relative to the WT1
promoter alone. C, CAT assay demonstrating activity of the
0.91-kb silencer fragment with the WT1 promoter in K562 cells. Lane
1, the WT1 promoter (652 bp); lane 2, the WT1 promoter
with the 0.91-kb silencer fragment.
To determine the ability of the silencer
to repress transcription from the full-length 652-bp WT1 promoter, a
CAT reporter vector containing both the WT1 promoter and the 0.91-kb
silencer was assayed in K562, 293, and HeLa cells. The silencer
repressed transcription from the WT1 promoter more than 5-fold in the
K562 cells (Fig. 2, B and C) and more than
10-fold in HeLa cells but failed to repress transcription in the 293
cell line (Fig. 2B). The silencer fragment was tested
alternatively in a 5` position adjacent to the WT1 promoter or 3`,
downstream of the CAT gene, and in its reverse orientation. It
functioned equally well in all positions confirming the position and
orientation independence of the silencer element.
Figure 3:
Sequence of the 460-bp silencer region.
The Alu repeat is underlined. The ends of the 96- and 64-bp
clones are marked with an asterisk and arrow.
Transcription factors that have potential binding motifs present within
the 460-bp silencer region are shaded. I, AP-2
(YCSCCMNSSS)(41) ; II, AP-2 (GSSWGSCC)(42) ; III, APRT-CHO US (GCCCCACCC)(43) ; IV, CF1
(ANATGG)(44) ; V, CTCF (CCCTC)(44) ; VI, GATA-1 (MYWATCWY)(45) ; VII, HC3
(CCACCA)(46) ; VIII, HiNF-A
(ATTTNNNNATTT)(47) ; IX, HNF-5 (TRTTTGY)(48) ; X, INF.1 (AAGTGA)(49) ; XI, LyF-1
(TGGGAGR)(44) ; XII, MEP-1 (TGCRCNC)(44) ; XIII, NF-GM
Figure 4:
Essential silencer region. Activity of the
0.91-kb silencer in HeLa cells. CAT activity is depicted relative to
the WT1 promoter. The 460-bp 5`
The 460-bp
silencer fragment was also tested in K562 and 293 cells for silencing
activity. In K562 cells, the silencer repressed transcription more than
10-fold, whereas in 293 cells, transcription from the WT1 promoter
remained unaffected (1.15-fold of the WT1 promoter alone). In an effort
to determine whether the silencer was species-specific, the 460-bp
silencer element with the WT1 promoter construct was transfected into a
rat mesotheliomna cell line, II-14. The silencer functioned to repress
transcription from the WT1 promoter 10-fold in II-14 cells. To
determine whether the silencer was able to repress the WT1 promoter in
the presence of the 3` hematopoietic specific enhancer, we tested a
construct containing the 652-bp WT1 promoter with both the 460-bp
silencer and the 1083-bp enhancer (14) in K562 cells. The
silencer repressed transcription from the WT1 promoter more than
10-fold, nullifying the enhancer activity.
Figure 5:
Enhancer activity. Relative CAT activity
of the 5` enhancer region. A, the 5` enhancer activates
transcription from the SV40 promoter in K562 and 293 cells. CAT
activity is expressed relative to the SV40 promoter control (pCAT
promoter). B, the 5` enhancer fails to activate transcription
from the WT1 promoter in K562 or G401 cells. CAT activity is expressed
relative to the WT1 promoter construct without the enhancer. C, CAT assay demonstrating activity of the 5` enhancer with
the SV40 promoter. Lane 1, pCAT-Promoter (SV40 promoter); lane 2, pCAT-Control (SV40 promoter and enhancer); lane
3, 5` enhancer with the SV40 promoter in K562
cells.
Figure 6:
Sequence of the 148-bp 5` enhancer region.
This sequence is identical to a portion of the sequence of Gessler and
Bruns(31) . Transcription factors that have potential binding
motifs present within the the 148-bp 5` enhancer region are shaded. I, AP-1(GAGAGGA)(54) ; II,
AP-2 (YCSCCMNSSS)(41) ; III, AP-2
(GSSWGSCC)(42) ; IV,
Although the silencer function in cells that express endogenous WT1,
such as K562, HL60, and II-14 cells, expression probably results from
alternative mechanisms of WT1 transcriptional activation that can
override the silencer in these cell lines. Since the 3` enhancer cannot
activate WT1 transcription in either HL60 or II-14 cells, clearly other
regulatory elements must be responsible for WT1 expression in these
cells. It is possible that these other cis-acting elements
which control WT1 expression in hematopoietic and mesothelial cells may
under certain circumstances overcome the repression by the silencer
element.
In summary,
we have cloned a 460-bp silencer region that represses transcription
from the WT1 promoter in a cell type-specific fashion. This silencer
region requires some or all of an Alu repeat for activity. This
silencer may be important in restricting WT1 expression to certain
tissues during normal development. The nucleotide sequence(s) reported in this paper has been
submitted to the GenBank®/EMBL Data Bank with accession
number(s) U28481[GenBank Link].
Volume 270,
Number 30,
Issue of July 28, pp. 17908-17912, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Tumor Gene WT1 Contains an Alu Repeat (*)
ABSTRACT
INTRODUCTION EXPERIMENTAL PROCEDURES RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
1 (TGF1)(11) , colony-stimulating factor 1 (CSF-1) (12) genes and can repress its own promoter (13) in CAT
reporter assays.
()downstream from the WT1 promoter (14) (Fig. 1A), which functions as an enhancer
in leukemic cell lines and appears to mediate its enhancer function
through GATA-binding factors(15) .
Cloning and Sequencing
The 5` enhancer fragment
was generated by HindIII restriction digestion of the 3.1-kb XhoI genomic fragment cloned into pBlueScript, containing the
5` terminus of the longest WT1 cDNA, LK15 (Fig. 1B).
The 0.15-kb enhancer fragment was cloned into the HindIII site
of the vector pCAT Promoter (Promega) and the clone pWT1pro-CAT.
pWT1pro-CAT contains a 652-bp fragment of the WT1 promoter linked to
the CAT reporter gene(14) .
3S4)
and 0.45-kb (3`3S4) subclones. PCR amplification was used to
amplify the 96- and 64-bp fragments of the 5`3S4 silencer clone,
and these fragments were cloned into the vector pWT1pro-CAT. The 96-bp
element was generated by PCR amplification using the 0.91-kb silencer
fragment as template with the primers BAM136 (GTGGATCCCCCGGGCTGCAGGATT)
and BGL136 (GAAGATCTGACTGGGGAAAGAAAAAGTTT). The 64-bp element was
generated with the primers BAM74 (AAGGATCCGGCCCAGTCAGCAGGCACAA) and
BGL74 (ACAGATCTAATCCAACAATGTCAGTCT). Clones were sequenced using
Sequenase (United States Biochemical Corp.) by the didoxynucleotide
method, as described by the manufacturer.Cell Culture and CAT Assays
All cell lines were
maintained at 37 °C in a 5% CO
environment. Cells were
cultured in the medium specified containing 10% fetal bovine serum.
Cell lines were obtained from the American Type Culture Collection
unless stated otherwise. HeLa cells, a human cervical carcinoma cell
line (ATCC CCL2), 293 cells, a human embryonic kidney cell line
transformed with adenovirus type 5 (ATCC CRL 1573), and G401 cells, a
human rhabdoid tumor of the kidney cell line (ATCC CRL 1441) were
maintained in minimal essential media. The K562 cell line, a chronic
myelogenous leukemia in blast crisis cell line (ATCC CCL 243) was
maintained in RPMI. II-14 cells, a rat mesotheliomna cell line (25) were maintained in Dulbecco's minimal essential
medium/F-12 supplemented with insulin, transferrin, selenium, and
hydrocortisone. Transfections were performed by electroporation, and
CAT assays were normalized with -galactosidase as an internal
control by the method described in Fraizer et
al.(14) , except that all cells were electroporated at 260
V, 960 microfarads in 200 µl of medium without serum(26) .
Relative activities reported are the average of three transfection
experiments.
Identification of Transcriptional Silencer
In an
effort to locate elements that regulate expression of WT1, we prepared
subclones of HindIII fragments of the genomic cosmid
cB5-2, which had previously been mapped (14) into CAT
reporter constructs containing the SV40 promoter (pCAT promoter). These
clones were initially screened in K562 cells, a chronic myelogenous
leukemia in blast crisis cell line, which expresses WT1 at high
levels(4) . A 0.91-kb fragment located within the third intron
of WT1 (Fig. 1B) repressed transcription from the SV40
promoter almost 4-fold (Fig. 2A).
Silencer Functions with Different Promoter and Is Cell
Type-specific
Silencer activity of the 0.91-kb fragment from the
third intron of WT1 was tested with the SV40 promoter in 293 cells, a
human embryonic kidney cell line that expresses endogenous
WT1(4) , and G401 cells, a rhabdoid tumor of the kidney cell
line(27) . The silencer did not alter CAT expression from the
SV40 promoter in either 293 or G401 cells (Fig. 2A).
The silencer was also tested in HL60 cells, a promyelocytic leukemia
cell line, and demonstrated the ability to repress transcription from
the SV40 promoter 4-fold.Sequence of the 0.46-kb Silencer Region
The
silencer fragment was sequenced and found to include a full-length Alu
repeat (Fig. 3). The 308-bp Alu sequence is in reverse
orientation with respect to the WT1 gene, with the poly(A) tail (poly T
within the sequence) at the 5` end of the silencer region. The Alu
repeat lacks the tandem repeats frequently found at the insertion sites
of most Alu repeats(28) . The Alu sequence diverges from the
consensus Alu sequence (28) by 16.2%, whereas the average
divergence of Alu sequences in the human genome is 16.12%, with a
standard deviation of 5.63%(29) . A search for potential
transcription factor binding sites revealed several potential sites of
interest (Fig. 3).
(GRGRTTKCAY)(51) ; XIV,
NF-GM (TCAGRTA)(51) ; XV, NF
(GGGRHTYHC)(52) ; XVI, TCF-1
(MAMAG)(44) ; XVII, WAP US5 (CCAAGT)(53) . K = G,T; M = A,C; R =
A,G; S = C,G; W = A,T; T = C,T; H =
A,C,T.
Deletion Analysis of the Silencer Region
A series
of deletion constructs of the silencer fragment were made to define the
essential silencer region. Initially the 0.91-kb silencer fragment was
subdivided into two fragments (0.46 and 0.45 kb) by cleavage at an
internal BglII restriction site. The presence of the internal BglII restriction enzyme site, flanked by the HindIII
and MboI sites, confirmed that the 0.91-kb silencer fragment
was in the third intron of WT1(30) . Sequence analysis
demonstrated the silencer element was located at the junction with the
cosmid vector(14) . The 0.46-kb 5` fragment and a 0.45-kb 3`
fragment were cloned into a CAT reporter vector containing the 652-bp
WT1 promoter. These regions were assayed for silencer activity in HeLa
cells. The 5` 0.46-kb fragment contained all the silencer activity,
repressing transcription 10-fold, whereas the 3` fragment had no effect
on transcription from the WT1 promoter (Fig. 4).
3S4 fragment contains all the
silencer activity, whereas the 450-bp 3`3S4 fragment of and the
96- and 64-bp fragments contain no silencer activity. These results
define a region of 300 bp that is essential for silencer activity and
corresponds to the Alu repeat.
The Alu Repeat Is Required For Silencer
Activity
In an effort to delineate the essential silencer
region, two additional deletion constructs were made. PCR was used to
generate both a 96-bp fragment containing the 5` end of the 460-bp
fragment and a 64-bp fragment containing the 3` end of the 460-bp
fragment. These PCR fragments were cloned into a construct containing
the 652-bp WT1 promoter and assayed for silencer activity. The
constructs excluded the Alu repeat and allowed analysis of the role the
Alu sequence plays in silencer activity (Fig. 3). Neither the 3`
nor 5` deletion constructs contained silencer activity in HeLa cells (Fig. 5), implying that some or all of the 300-bp Alu sequence
is required for silencer activity or that the 3`- and 5`-flanking
regions together function as a silencer.
Identification of a Transcriptional Enhancer
A
subsequent screening for additional regulatory elements identified a
transcriptional enhancer. A 0.15-kb XhoI-HindIII
fragment located 5` of LK15 (Fig. 1B) enhanced
transcription from the SV40 promoter more than 7-fold in K562 cells (Fig. 5, A and C). To further characterize the
0.15-kb enhancer fragment, its activity was assayed in 293 cells. This
fragment demonstrated greater than 3-fold enhancement of transcription
from the SV40 promoter in the 293 cells (Fig. 5A). This
fragment was then cloned into a vector containing the full-length
652-bp WT1 promoter linked to the CAT gene to test enhancer activity
with the WT1 promoter. Transfection of this construct into either K562
or G401 cells failed to demonstrate enhancer activity from the 0.15-kb
fragment using the WT1 promoter (Fig. 5B). The enhancer
was tested with the full-length 652-bp WT1 promoter in 293 cells by
calcium phosphate transfection (14) as well, and showed no
enhancer activity (data not shown). The 0.15-kb enhancer was sequenced (Fig. 6) and found to be identical to a 148-bp region of the
first intron of Wit1 (bases 2519-2666; GeneBank accession no.
X69950)(31) . A search for potential transcriptional factor
binding sites revealed multiple potential sites of interest (Fig. 6).
IF-SilB
(TCMYTT)(55) ; V, CK-8-mer (AANCCAAA)(56) ; VI, E2F (TTTSSCGS)(44) ; VII, GCF
(SCGSSSC)(44) ; VIII, LyF-1 (TGGGAGR)(44) ; IX, NF-IL6 (TKNNGNAAK)(44) ; X, myo spe fac
(GTCGCC)(50) ; XI, WAP US6 (TTTAAA)(53) . K = G,T; M =A,C; R =
A,G; S = C,G; W =A,T; Y = C,T; H =
A,C,T.
Cell Type Specificity of the WT1 Silencer
We
have previously demonstrated that transcription from the WT1 promoter
is promiscuous (14) . In a search for tissue-specific
regulatory elements involved in WT1 transcription, we cloned a silencer
region from the third intron of WT1 at a distance of 12 kb downstream
from the WT1 promoter. The silencer represses basal transcription from
both the SV40 and WT1 promoters in constructs lacking enhancers, and
the addition of the 3` hematopoietic specific enhancer has no effect on
silencer function in K562 cells. This silencer represses transcription
in all cell lines of non-renal origin that we have tested including
leukemic cells (K562 and HL60) and cervical carcinoma cells (HeLa).
Interestingly, this silencer does not repress transcription in cells of
renal origin (293 or G401). The silencer activity correlates with cell
type origin and not with WT1 mRNA expression (Table 1).
Alu Sequences Are Required for Silencer
Activity
Silencer deletion experiments indicate that an Alu
repeat sequence is required for silencer activity or the silencer
element is transected by an Alu repeat. Alu repeats have been
associated with regulatory elements (in both silencers and enhancers)
of a number of genes, including keratin 18(32) ,
erythropoietin(24) , CD8(33) ,
-globin(34) , and the
chain Fc/T cell receptor (35) genes. The mechanisms by which Alu repeats are believed to
modulate transcription are diverse. In some instances Alu repeat
sequences mediate repression through transcriptional interference
mechanisms, as demonstrated with
-globin(36) .
Transcriptional interference results from transcription initiated at an
internal RNA polymerase III promoter that is contained in a subset of
Alu sequences(36) . It is unlikely that the Alu repeat present
within the 460-bp silencer region interferes with transcription of the
WT1 mRNA, as the silencer functions in an orientation and position
independent fashion. Transcriptional interference would require the
silencer to be position dependent, generating transcripts that would
read through the reporter gene. Neznanov et al. (32) have postulated that Alu repeats can function as
``insulators,'' defining transcriptionally active domains,
and they have tested this hypothesis in transgenic animals. They found
that an Alu repeat was capable of repressing transcription from the
keratin 18 promoter(37) . Other workers reported silencer
activity in Alu repeats as a result of the interaction of Alu-binding
proteins with the Alu repeat in a sequence-specific
manner(38) . Additionally, some reports have indicated that
over time, the Alu repeat has evolved to ``gain'' function,
that is, by the introduction of base substitutions within the Alu
repeat, transcription factor-binding sites have been created, thus
allowing Alu repeats to take on new roles as transcriptional enhancers
or silencers(35) . Given that the silencer functions in an
orientation and position independent manner, with both the SV40 and WT1
promoter, in both human and rodent cells, it appears that this Alu
repeat has gained silencer function rather than functioning by virtue
of containing an Alu repeat.
5`-Enhancer Fragment
We have identified a 148-bp
region that is capable of enhancing transcription from the SV40
promoter. This region was unable to increase transcription from the
full-length 652-bp WT1 promoter. However, this does not preclude the
possibility that the 148-bp fragment is a functional enhancer in other
cell types or that other flanking sequences are required for enhancer
function with the WT1 promoter. This enhancer lies within an intron of
the Wit1 gene (31) , a small gene whose transcription
originates from the same region as WT1 in the opposite direction. Wit1
is not well characterized, with a very small open reading frame of 276
nucleotides which does not encode a known protein(39) . This
enhancer fragment lies 877 bp from the closest Wit1 transcriptional
start site (40) and perhaps may function as a enhancer for Wit1
transcription. Wit1 has also been demonstrated to initiate
transcription from a second region within the first intron of WT1,
generating an antisense transcript through exon 1 of WT1, but the start
sites of this transcript remain unmapped(40) .
We thank Matthew Lewin, Tapati Maity, Ying-Ji Wu, and
Ruby S. Desiderio for their assistance. We also thank Cheryl Walker for
the gift of II-14 cells.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. Wang, Y. Zhao, C. Hu, and J. Zhu Differential repression of human and mouse TERT genes during cell differentiation Nucleic Acids Res., May 1, 2009; 37(8): 2618 - 2629. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. S. Makki, T. Heinzel, and C. Englert TSA downregulates Wilms tumor gene 1 (Wt1) expression at multiple levels Nucleic Acids Res., July 1, 2008; 36(12): 4067 - 4078. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. A. Trujillo, M. Sakagashira, and N. L. Eberhardt The Human Growth Hormone Gene Contains a Silencer Embedded within an Alu Repeat in the 3'-Flanking Region Mol. Endocrinol., October 1, 2006; 20(10): 2559 - 2575. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. K. Tripathi, S. Misra, S. V. Khedkar, N. Hamilton, C. Irvin-Wilson, C. Sharan, L. Sealy, and G. Chaudhuri Regulation of BRCA2 Gene Expression by the SLUG Repressor Protein in Human Breast Cells J. Biol. Chem., April 29, 2005; 280(17): 17163 - 17171. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Castronuevo, M. A. Thornton, L. E. McCarthy, J. Klimas, and B. P. Schick DNase I Hypersensitivity Patterns of the Serglycin Proteoglycan Gene in Resting and Phorbol 12-Myristate 13-Acetate-stimulated Human Erythroleukemia (HEL), CHRF 288-11, and HL-60 Cells Compared with Neutrophils and Human Umbilical Vein Endothelial Cells J. Biol. Chem., December 5, 2003; 278(49): 48704 - 48712. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Zablewska, L. Bylund, S. A. Mandic, M. Fromaget, P. Gaudray, and G. Weber Transcription Regulation of the Multiple Endocrine Neoplasia Type 1 Gene in Human and Mouse J. Clin. Endocrinol. Metab., August 1, 2003; 88(8): 3845 - 3851. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 W. Le Goff, M. Guerin, M. J. Chapman, and J. Thillet A CYP7A promoter binding factor site and Alu repeat in the distal promoter region are implicated in regulation of human CETP gene expression J. Lipid Res., May 1, 2003; 44(5): 902 - 910. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Satoh, T. Nakagawachi, H. Nakadate, Y. Kaneko, Z. Masaki, T. Mukai, and H. Soejima Significant Reduction of WT1 Gene Expression, Possibly Due to Epigenetic Alteration in Wilms' Tumor J. Biochem., March 1, 2003; 133(3): 303 - 308. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. R. Wilund, M. Yi, F. Campagna, M. Arca, G. Zuliani, R. Fellin, Y.-K. Ho, J. V. Garcia, H. H. Hobbs, and J. C. Cohen Molecular mechanisms of autosomal recessive hypercholesterolemia Hum. Mol. Genet., November 15, 2002; 11(24): 3019 - 3030. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Krucken, O. Stamm, H.-P. Schmitt-Wrede, A. Mincheva, P. Lichter, and F. Wunderlich Spleen-specific Expression of the Malaria-inducible Intronless Mouse Gene imap38 J. Biol. Chem., August 20, 1999; 274(34): 24383 - 24391. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. Ferbeyre, J. M. Smith, and R. Cedergren Schistosome Satellite DNA Encodes Active Hammerhead Ribozymes Mol. Cell. Biol., July 1, 1998; 18(7): 3880 - 3888. [Abstract] [Full Text]
|
|
|
|
 |
|
 C.-Y. Zhang, S. Kim, J. W. Harney, and P. R. Larsen Further Characterization of Thyroid Hormone Response Elements in the Human Type 1 Iodothyronine Deiodinase Gene Endocrinology, March 1, 1998; 139(3): 1156 - 1163. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Scholz, S. A. Bossone, H. T. Cohen, U. Akella, W. M. Strauss, and V. P. Sukhatme A Far Upstream Cis-element Is Required for Wilms' Tumor-1 (WT1) Gene Expression in Renal Cell Culture J. Biol. Chem., December 26, 1997; 272(52): 32836 - 32846. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, S.-F. Su, M. J. Dresser, M. E. Schaner, C. B. Washington, and K. M. Giacomini Na+-dependent purine nucleoside transporter from human kidney: cloning and functional characterization Am J Physiol Renal Physiol, December 1, 1997; 273(6): F1058 - F1065. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
X. Zhang, G. Xing, G. C. Fraizer, and G. F. Saunders Transactivation of an Intronic Hematopoietic-specific Enhancer of the Human Wilms' Tumor 1 Gene by GATA-1 and c-Myb J. Biol. Chem., November 14, 1997; 272(46): 29272 - 29280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Huang and V. Gallo Gene Structure of the Rat Kainate Receptor Subunit KA2 and Characterization of an Intronic Negative Regulatory Region J. Biol. Chem., March 28, 1997; 272(13): 8618 - 8627. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. T. Cohen, S. A. Bossone, G. Zhu, G. A. McDonald, and V. P. Sukhatme Sp1 Is a Critical Regulator of the Wilms' tumor-1 Gene J. Biol. Chem., January 31, 1997; 272(5): 2901 - 2913. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. J. Piedrafita, R. B. Molander, G. Vansant, E. A. Orlova, M. Pfahl, and W. F. Reynolds An Alu Element in the Myeloperoxidase Promoter Contains a Composite SP1-Thyroid Hormone-Retinoic Acid Response Element J. Biol. Chem., June 14, 1996; 271(24): 14412 - 14420. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. M. Hewitt, G. C. Fraizer, Y.-J. Wu, F. J. Rauscher III, and G. F. Saunders Differential Function of Wilms' Tumor Gene WT1 Splice Isoforms in Transcriptional Regulation J. Biol. Chem., April 12, 1996; 271(15): 8588 - 8592. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Q. Gong, L. J. Brown, and M. J. MacDonald Functional Analysis of Two Promoters for the Human Mitochondrial Glycerol Phosphate Dehydrogenase Gene J. Biol. Chem., November 22, 2000; 275(48): 38012 - 38021. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |