|
Volume 270,
Number 30,
Issue of July 28, pp. 17962-17969, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CCAAT/Enhancer-binding
Protein Isoforms and Are Expressed in Mammary Epithelial
Cells and Bind to Multiple Sites in the -Casein Gene Promoter (*)
(Received for publication, March 22, 1995; and in revised form, May 12, 1995)
Wolfgang
Doppler (§)
,
Thomas
Welte
,
Sonja
Philipp
From the Institut fr Medizinische Chemie und Biochemie,
Universitt Innsbruck, A-6020 Innsbruck, Austria
ABSTRACT
INTRODUCTION MATERIALS AND METHODS RESULTS DISCUSSION FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Lactogenic hormone-dependent expression of the rat -casein
gene in mammary epithelial cells is controlled via a complex regulatory
region in the promoter. The sequence between -176 and -82
is the minimal region to confer the response to glucocorticoid hormone
and prolactin on a heterologous promoter. The response is further
enhanced by the region between -282 and -176. DNase I
footprinting experiments and electromobility shift assays revealed the
presence of four binding sites for CCAAT/enhancer-binding protein
(C/EBP) isoforms in the hormone response region between -220 and
-132. In nuclear extracts from mammary epithelial cells, the
prevalent C/EBP isoform binding to these sites is (C/EBP- ).
C/EBP- is also present in mammary epithelial cells, whereas
C/EBP- is not detectable. The C/EBP sites are located in close
proximity to the previously characterized binding sites for the
prolactin-inducible mammary gland factor/signal transducer and
activator of transcription-5, the nuclear factor YY1, and the
glucocorticoid receptor. The importance of the two proximal C/EBP
binding sites at the 5` border of the minimal region was tested by
mutational analysis. Mutations of each site were found to inhibit
strongly both the basal and the lactogenic hormone-induced
transcription of a -casein gene promoter chloramphenicol
acetyltransferase construct. The results implicate C/EBPs as important
regulators of -casein gene expression in the mammary epithelium.
INTRODUCTION
Multiple cis-acting elements are involved in ensuring
the correct stage and tissue-specific expression of the -casein
gene. They have been identified in the promoter region and 5`-flanking
sequence(1, 2, 3) . The characterization of
the nuclear factors binding to these elements has led to the discovery
of both positively and negatively acting factors. Positively acting are
two hormone-inducible factors, namely the mammary gland factor
MGF ( )(4) , and the glucocorticoid
receptor (5) . MGF is induced in its DNA binding by prolactin (6, 7) and was shown to be a novel member of the STAT
family (STAT5(8) ). It binds to an essential site in the
promoter which is crucial for the response to
prolactin(4, 7) . The significance of the
glucocorticoid receptor binding sites in the promoter is presently not
clear, since glucocorticoid hormones appear to act indirectly on the
transcription of the -casein gene(9) . Three factors have
been described to be involved in the repression of transcription:
pregnancy-specific mammary nuclear factor(10) , single-stranded
DNA-binding factor(11, 12) , and the nuclear factor
YY1(13, 14) . Whereas YY1 is constitutively expressed
in mammary epithelial cells, both pregnancy-specific mammary nuclear
factor and single-stranded DNA-binding factor are regulated in their
activity. Pregnancy-specific mammary nuclear factor is down-regulated
in the absence of progesterone and is thus considered as a mediator of
the repression of -casein gene transcription during pregnancy.
Single-stranded DNA-binding factor is sequestered by -casein mRNA.
It is discussed as a component of a positive feedback loop that is
initiated after the induction of -casein gene transcription. Although several trans-acting factors have been described
to be important for the regulation of the -casein gene, the
factors mediating the minimal response of the promoter to lactogenic
hormones, and the minimal cis-acting sequence in the
lactogenic hormone response region (LHRR) required for this response
have not been defined so far. Single copies or multimers of the
MGF/STAT5 binding site were not sufficient for conferring the response
to lactogenic hormones in mammary epithelial cells(6) . With
heterologous promoter constructs we show here that the minimal response
region of the rat -casein gene extends from -176 to
-82 and includes in addition to the proximal MGF/STAT5 and YY1
sites a functional element located in the 5` half, which has not been
characterized so far. To identify nuclear factors that bind to this
critical 5` region, DNase I footprinting experiments and
electromobility shift assays (EMSAs) were performed with extracts of
mammary epithelial cells. The studies revealed the presence of four
C/EBP binding sites in the LHRR. The binding sites were localized in
the region of the 5` border of the minimal element and at the positions
-220 and -142. The functional significance of the sites at
the 5` border was confirmed by mutational analysis. C/EBPs comprise
a family of isoforms encoded by separate genes(15, 16) which share a highly similar carboxyl-terminal DNA binding
domain and leucine zipper dimerization domain but have different
amino-terminal effector domains. The genes of the individual C/EBP
isoforms are expressed differentially in a restricted set of tissues.
The C/EBP isoforms , , and (C/EBP- , - , and
- , respectively) have been implicated previously as important
determinants for the specific expression of genes in various terminal
differentiated tissues other than the mammary gland. They were
discovered to be important regulatory factors in the induction of
differentiation-specific genes in myelomonocytic
cells(17, 18, 19) ,
hepatocytes(16, 20, 21, 22, 23, 24, 25, 26) ,
adipocytes (15, 27, 28) and have also been
implicated in the differentiation of ovarian follicles (29) and
of the intestinal epithelium(30) . To find out which of these
C/EBP isoforms is expressed in mouse mammary epithelial cells, EMSAs
and immunoblotting experiments were performed with isoform-specific
antibodies. The obtained data point to an important role of C/EBP-
in the mediation of stage-specific expression in the mammary gland.
MATERIALS AND METHODS
Cell Culture and Hormone InductionHC11
cells were grown in RPMI 1640 medium (Biochrom; Berlin, Germany)
supplemented with 10% heat-inactivated fetal calf serum (Biochrom), 5
µg/ml insulin (Sigma, St. Louis, Mo. U. S. A.), 10 ng/ml epidermal
growth factor (Sigma), and 50 µg/ml gentamycin. Prior to hormone
treatment, the confluent cultures were kept for 2 days in an epidermal
growth factor-free RPMI 1640 medium containing 2% fetal calf serum and
5 µg/ml insulin. 5 µg/ml ovine prolactin (31 units/mg, Sigma)
and 0.1 µM dexamethasone (Sigma) were added to this
medium, and cells were cultured for an additional 4 days. Control
cultures were cultivated in the absence of prolactin and dexamethasone.
Transfection and CAT AssayThe cells were
stably transfected by the calcium phosphate precipitation technique as
described (31, 32) with 10 µg of plasmid DNA and 1
µg of pSV2neo (33) per 10-cm culture dish. One hundred to
1,000 colonies resistant to the antibiotic G418 (200 µg/ml) were
pooled and cultured further in G418-containing medium. The preparation
of cell extracts and determination of CAT activity were as described in (31) .
PlasmidsThe heterologous -casein
gene thymidine kinase (tk) promoter CAT constructs were
prepared by inserting PCR-generated -casein gene fragments of the
indicated promoter regions into the 5` polylinker of the -105 tk CAT expression vector pBLCAT2(34) .
Oligonucleotides with engineered restriction sites at their 5` ends
were employed as primers for the PCR. The sense primer used to create
fragments with a 5` border at -344 was
5`ATCGGATCCTCTCTAAAGCTTGTGAAT3`.Fragments with 5` end points at
-282, -175, -157, and -105 were amplified with
the sense primer 5`TTGGTCGACGACTCACTTTAGGGCGAAT3`, and plasmid
templates of the 5` deletion series
pbs c(X/+487)CAT(9) . The primer binds to the
invariant vector sequence of the plasmids next to the variable 5`
deletion end point of the -casein gene promoter. Antisense primers
for creating fragments with a defined 3` border of the -casein
gene fragment were: 5`AAGGGATCCTGGGGGACATTAAACAAGGC3` (border at
-147), 5`TAGGGATCCGTTTCTTTCTATTTTCTTTC3`(-117),
5`CTTGGATCCAAGAAGTTCCACATGATT3`(-89),
5`AAAGGATCCTTAATTCCAAGAAGTTC3` (-82), and
5`ATGGGATCCTAATTTGTGGTTCGTAAGA3`(-51). Mutations creating a
novel HindIII site were introduced into the -casein gene
promoter construct p c(-344/-1)CAT (9) by
site-directed mutagenesis using the protocol of Deng and Nickoloff (35) . The selection primer was 5`CCCCGGGTACAGATCTCGAATTCGT3`,
which destroys the unique SacI and KpnI cutting
sites, replacing them with a BglII site. The primers used for
mutation of the promoter with the novel HindIII sites were:
5`CCTTCACCAGAAGCTTAATTGCTGCC3` (-181, Bm1),
5`AGCTTCTGAAGCTTTGCCTTGTTT3` (-175, Bm3),
5`ACCAGCTTCTGAATTGCTGAAGCTTTTAATGTC3` (-167, Bm4), and
5`CCTTGTTTAAGCTTCCCCAGAATT3` (-159, Bm5). The position of the
introduced HindIII site in the -casein gene promoter and
the name of the corresponding mutated oligonucleotides employed in EMSA
(see Fig. 4) are shown in parentheses. Mutations were verified
by sequencing.
Figure 4:
Sequence of the oligonucleotides employed
in EMSA experiments. Only the upper strand of the double-stranded
oligonucleotides is shown. Lowercase letters indicate mutated
nucleotides. HindIII sites introduced into mutated
oligonucleotides are underlined. The numbers in parentheses represent the positions of the 5` and 3` borders.
The C/EBP palindrome is a oligonucleotide containing a high affinity
C/EBP- binding site(28) .
Cell ExtractsPreparation of nuclear
extracts for EMSA, DNase I footprinting, and immunoblotting experiments
were carried out as described(32) . Extracts were stored in
aliquots at -70 °C and only thawed once before use.
DNase I FootprintingDNA-templates were
generated by PCR amplification of the relevant region using end-labeled
oligonucleotides as primers. The PCR product was isolated from a 1.5%
agarose gel with the glassmilk-based Mermaid Kit (Bio 101). The
purified DNA-template (13,000 cpm in 1.5 µl) was added to 10 µl
of nuclear extract diluted with 2.5 µl of 50 mM Hepes, pH
7.6, 240 mM KCl, 0.2 mM EDTA, 40 mM
MgCl , and 1 µl of poly(dI-dC) (1 µg/µl) at 4
°C. The samples were then kept for 15 min at 21 °C and 15 min
at 4 °C. Two microliters of DNase I diluted in 10 mM Hepes, pH 7.6, 25 mM CaCl , 100 µg/ml
bovine serum albumin was added (7-60 ng of DNase I, depending on
the amount of extract); after 2 min at 4 °C the reaction was
stopped with 50 µl of freshly prepared stop solution (50 mM EDTA, 0.2% SDS, 100 µg/ml yeast tRNA, 500 µg/ml proteinase
K). The samples were kept at 50 °C for 30 min, extracted with
phenol-chloroform (1:1) mixture and chloroform, precipitated with
ethanol, and analyzed on a 6% urea-polyacrylamide gel in 1 TBE
electrophoresis buffer (0.089 M Tris, 0.089 M boric
acid, 0.2 mM EDTA, pH 8.0). A Maxam-Gilbert sequencing
reaction of the DNA-templates (the G-lane) was included as a position
marker.
EMSAsOligonucleotides were radioactively
labeled with [ - P]ATP (>6,000 Ci/mmol)
and T4 polynucleotide kinase and purified by phenol extraction and
Sephadex G-50 chromatography. After a treatment for 5 min at 95 °C,
complementary oligonucleotides were annealed in 250 mM Tris-HCl, pH 7.6, 2 mM MgCl by a slow
temperature decrease from 70 °C to room temperature. Ten-µg
nuclear extracts or whole cell extracts and 50,000 cpm of labeled
double-stranded oligonucleotide (30-50 fmol) were incubated on
ice for 30 min prior to electrophoresis in a 20-µl reaction volume
containing 10 mM Hepes, pH 7.9, 6 mM sodium
phosphate, 52.5 mM KCl, 0.2 mM EDTA, 0.1 mM EGTA, 1.35 mM dithiothreitol, 5 mM MgCl , 3.5% glycerol, 2 µg of poly(dI-dC), and 0.50
nM unlabeled single-stranded oligonucleotide. The
single-stranded oligonucleotide was included to compete for the binding
of unspecific proteins binding to single-stranded DNA. Where indicated,
the C/EBP isoform-specific polyclonal antibodies sc-61, sc-150, and
sc-151 (Santa Cruz Biotechnology), the corresponding blocking peptides,
or double-stranded oligonucleotides were added to the extracts prior to
the addition of the labeled oligonucleotide and incubated on ice for 30
min. Probes were mixed with 2 µl of loading buffer (25% Ficoll 400,
0.25% bromphenol blue) and loaded on a 4% polyacrylamide gel in 0.25
TBE electrophoresis buffer (0.022 M Tris, 0.022 M boric acid, 0.05 mM EDTA, pH 8.0). Prerun and
electrophoresis of 3 h each were performed at room temperature at 10
V/cm with recirculation of electrophoresis buffer. The gel was fixed,
dried, and autoradiographed.
Immunoblotting ExperimentsNuclear
extracts were subjected to electrophoresis on 14% SDS-polyacrylamide
gels, and the separated proteins were transferred to polyvinylidine
difluoride membranes (Immobilon-P, Millipore). Membranes were incubated
with 0.25 µg/ml polyclonal C/EBP- antiserum sc-150 directed
against a carboxyl-terminal peptide (Santa Cruz Biotechnology). The
immunoreactive proteins were visualized by use of a secondary
horseradish peroxidase-linked anti-rabbit antibody (Amersham Corp.) and
the Amersham Enhanced Chemiluminescence system.
RESULTS
The -344/-1 fragment of the rat -casein gene
promoter was shown to mediate the synergistic effects of prolactin and
glucocorticoid hormones on the transcription of a linked
chloramphenicol reporter gene in the stably transfected mouse mammary
epithelial cell line HC11(9) . We searched for the minimal
sequence element within this fragment which confers hormone
responsiveness to a heterologous promoter. -Casein gene promoter
sequences with defined 5` and 3` ends were amplified with PCR. The
basic promoter fragments extending from -344 to -51 and
from -344 to -82 lacked the octamer site between -55
and -48 (36) but contained the sites for MGF between
-97 and -87 (4) and the nuclear factor YY1 between
-118 and -112 (13) . These fragments were ligated
in front of the -105 tk promoter, which has in addition
to the TATA box two sites for the transcription factor Sp1 and one site
for CCAAT transcription factor/nuclear factor 1 (CTF/NF1)(37) .
The insertion of the -casein gene sequences conferred the response
to lactogenic hormones on the heterologous promoter (Fig. 1A). The induction ratios were lower than
observed with the -344/-1 -casein gene promoter
constructs (see (9) and Table 1 of this study), indicating
that the octamer site and/or other sequence elements between position
-51 and -1 of the -casein gene facilitate the response
to lactogenic hormones.
Figure 1:
Delimitation analysis of the LHRR in
the rat -casein gene promoter. Fragments of the rat -casein
gene promoter were generated by PCR and inserted in front of a CAT
expression vector with the -105 tk promoter. The
structure of the resulting promoters with the 5` and 3` borders of the
-casein gene fragments is shown in the left part of each panel. The constructs were stably transfected into HC11 cells.
Lactogenic hormone-dependent expression was determined by measuring the
CAT activity in confluent cells treated with 0.1 µM dexamethasone and 5 µg/ml prolactin (hatched bars)
for 4 days and in untreated cells (open bars). Results are
expressed as the mean ± S.E. of two or three experiments
performed in triplicate with independent transfectants. The induction
ratio was calculated as the ratio of CAT activities in cells treated
with or without hormones.
The Minimal LHRR of the Rat -Casein Gene Promoter
Contains at Least Three Different Functional ElementsThe
location of the minimal lactogenic hormone response element was mapped
by further removal of 5` and 3` sequence. Removal of the sequence
between -344 and -282 did not alter the function of the
LHRR significantly (Fig. 1A, compare third and fourth constructs). This was expected since the deletion did
not extend beyond the limit of the first 5` border of the hormone
response element identified in previous experiments(1) .
Elimination of the MGF recognition site between -89 and -82
led to a complete loss of the lactogenic hormone-dependent activity (Fig. 1A, fifth construct). This is in
accordance with the results of -casein gene promoter constructs,
where the MGF site was inactivated by point
mutations(4, 7) . Removal of both the YY1 and MGF
sites by deletion of the sequence between -117 and -82
resulted in a construct that did not respond to lactogenic hormones but
had in comparison with the -105 tk promoter alone a
7-fold increase of the hormone-independent promoter activity (Fig. 1A, compare first construct with sixth construct). A similar observation was made with a
construct in which the sequence between -147 and -82 was
deleted (seventh construct of Fig. 1A). Our
data indicate the presence of a hormone-independent enhancer element in
the region between -282 and -147, which is repressed in the
intact -casein gene promoter by the region comprising the YY1
site(13) . The major factor mediating the repression is
probably the factor YY1 itself, as described previously(13) . In Fig. 1B, the role of the region between
-176 and -157 for the response to lactogenic hormones was
investigated. The 95-bp sequence extending from -176 to -82
was found to be sufficient to confer the lactogenic hormone response to
the -105 tk promoter (Fig. 1B, second construct), whereas the shortened promoter fragment
spanning the sequence between -157 and -82 had lost this
property (third construct). Thus the sequence between
-176 and -157 is important for the minimal response to
lactogenic hormones. The sequence did not function per se as a
lactogenic hormone response element (fourth construct of Fig. 1B). Its function required the presence of both
the repressor region and the MGF site. Taken together, the data define
a minimal LHRR between -176 and -82, which can be
subdivided into at least three functional domains: the novel cis-acting element at the 5` border defined in the present
study; the MGF/STAT5 site at 3` border; and a repressor region in
between, which harbors a YY1 site.
C/EBP Sites in the 5` Half of the LHRRA
systematic investigation on the nuclear factors binding to the 3`
region of the LHRR employing DNase I footprinting and oligonucleotide
competition experiments was performed previously by Schmitt-Ney et
al.(4) . Two of the factors binding to that region were
identified later at the molecular level as MGF/STAT5 (8) and
YY1(13) . The proteins binding to the 5` region of the LHRR
have not been examined in greater detail. To localize binding sites
within this region, we performed DNase I footprinting experiments with
a PCR-generated mouse -casein gene fragment which extends into the
5` half of the LHRR. Four major regions were found to be protected by
nuclear extracts prepared from the mammary gland of pregnant animals,
lactogenic hormone-induced HC11 cells, and uninduced HC11 cells
(footprints fp1-fp4 of Fig. 2). The protection in
footprint fp2 was weaker than in the other footprinted regions. In the
experiment of Fig. 2and other experiments (not shown), there
was no significant difference in the protection pattern obtained with
extracts derived from cells induced with hormones or untreated
controls. Fp1 was outside the minimal LHRR and covered the sequence
between -237 and -202, whereas footprints fp2 to fp4 were
within the minimal LHRR. The position of footprint fp2, which extended
from -182 to -151, was most interesting, since it is in the
region of the critical cis-acting sequence at the 5` border of
the minimal LHRR (Fig. 1B). The mouse promoter sequence
was aligned with the rat sequence (Fig. 3) and the conserved
regions inspected for transcription factor binding sites. Thereby, four
putative sites for C/EBP were found (Fig. 3). They are all
contained within the regions protected in the DNase I footprint
experiment. The sites in footprints fp1 and fp3 closely fit the
consensus sequence for the C/EBP binding
sites(15, 16, 38) . In footprint fp2 two more
divergent motifs for C/EBP were present.
Figure 2:
DNase I footprinting experiment with a
380-bp fragment of the mouse -casein gene promoter and nuclear
extracts prepared from mammary epithelial cells. The noncoding strand
was 5` end labeled at position -10 by
[ - P]ATP. Protections obtained with extracts
prepared from glands of pregnant mice (lane 2), confluent HC11
cells treated with 0.1 µM dexamethasone and 5 µg/ml
prolactin for 4 days (lane 4), and untreated HC11 cells (lane 6) are shown together with the DNase I digestion of the
probe without added protein (lanes 3 and 5). Lane
1, chemical sequencing reaction (cleavage at G residues). The
positions of three major protected regions (fp1, fp3, and fp4) are
indicated by solid lines at the right margin. The
position of the weak footprint fp2 is shown by a dashed line.
The coordinate numbers at the left margin show the
distance to the transcription initiation
site.
Figure 3:
C/EBP
binding sites in the murine -casein gene promoters. The sequences
extending from -241 to -80 of the mouse gene (66) and rat gene (4) were aligned. The position of the
DNase I footprints fp1-fp3 (Fig. 2) are shown by bars above the mouse sequence. Sequences related to the consensus
sequence for C/EBP binding sites are indicated by rectangular
boxes. The positions of the binding sites for YY1 and MGF are also
shown by boxes. Solid bars below the rat sequence
indicate the size and position of oligonucleotides A, B, and C employed
for the EMSA experiments.
To investigate whether the
nuclear proteins binding to the three footprinted regions contain
C/EBPs, EMSAs were performed with double-stranded oligonucleotides A,
B, and C. They include the four putative C/EBP binding sites of the
-casein gene promoter (Fig. 3). The sequences of the
oligonucleotides and of the mutated versions employed in
oligonucleotide competition experiments are shown in Fig. 4.
Nuclear extracts prepared from HC11 cells contained factors that bind
to oligonucleotide A and form several complexes with different mobility
in the EMSA (Fig. 5A, lane 1). Formation of
all complexes was competed with the parental oligonucleotide but not
with an oligonucleotide mutated in the C/EBP consensus region (Fig. 5A, lanes 2-5). The results
indicate that the nuclear proteins bound to oligonucleotide A have the
sequence specificity characteristic for C/EBPs. Additional evidence for
the presence of C/EBPs in the complexes formed with oligonucleotide A
was obtained by the reactivity of an antibody specific for the
C/EBP- . The antibody reacted with most of the complexes and
induced a strong supershift (Fig. 5A, lane 7).
A palindromic high affinity C/EBP site (28) and the
oligonucleotides B and C, which contain the other putative C/EBP sites
in the -casein gene promoter, were also able to compete for the
binding of the C/EBPs to oligonucleotide A (Fig. 5A, lanes 8, 10, and 11). However, the
efficiency of oligonucleotide B to compete was lower, indicating that
the sites on B have a reduced affinity for C/EBPs.
Figure 5:
EMSAs with oligonucleotides comprising the
sequences of fp1 (panel A), fp2 (panel B), and fp3 (panels C and D) and nuclear extracts of HC11 mammary
epithelial cells. Complexes reacting with an antiserum specific for
C/EBP- are labeled with 1, 2, 3, and 4; the
complex reacting with a C/EBP- antiserum is labeled with . Panel A, labeled probe: oligonucleotide A. Various competitor
oligonucleotides (competitor, specified in Fig. 4) were added to
the reaction mixture in 60-fold (lanes 2 and 4),
20-fold (lanes 3 and 5), or 75-fold (lanes
8-11) molar excess. In lane 7 a
C/EBP- -specific antibody (0.2 µg) was included in the reaction
mixture. Panel B, labeled probe: oligonucleotide B. A 60-fold (lanes 2-8) or a 75-fold (lanes 12-15)
molar excess of various competitors was added to the reaction mixture.
The sequence of the competitor DNA is shown in Fig. 4. Lane
11, 0.2 µg of antibody against C/EBP- present in reaction
mixture. Panel C, labeled probe: oligonucleotide C.
Experimental conditions were as described for the assay with
oligonucleotide A in panel A. Panel D, labeled probe:
oligonucleotide C. Reaction mixtures applied on lanes 2-6 contained as indicated (Antibody) 0.2 µg of
anti-C/EBP- ( ) or a mixture of antibodies specific
for C/EBP- (0.5 µg), C/EBP- (0.25 µg), and
C/EBP- (1.0 µg) ( + + ).
0.1 µg of block peptides for the C/EBP- -, -, and
-specific antibodies were added as indicated at the top of each lane. All reactions were performed with 10 µg
of nuclear proteins.
When the assay
was performed with labeled oligonucleotide B, a similar pattern of
complexes was observed. Again, the majority of complexes reacted with
the C/EBP- -specific antibody (Fig. 5B, lane
11), and their formation was competed specifically with
oligonucleotides containing C/EBP sites (Fig. 5B, lanes 12, 13, and 15). The amount of
complexes formed with oligonucleotide B was smaller than with A. This
is in accordance with the lower affinity of oligonucleotide B for
C/EBPs (Fig. 5A, lane 10) and the weaker
footprint fp2 in the DNase I protection assay shown in Fig. 3.
Competition experiments were performed with B oligonucleotides mutated
in one or both C/EBP sites (Fig. 5B, lanes
3-7). When only one of the two C/EBP sites was mutated
(oligonucleotides Bm1, Bm3, and Bm4), the oligonucleotides still were
able to compete the binding of C/EBPs to the unmutated oligonucleotide,
indicating that one intact C/EBP site was sufficient for binding. In
Bm2, mutations were introduced into both C/EBP sites. This abolished
the binding activity for the C/EBP complexes (Fig. 5B, lane 6). The result of the EMSA obtained with
oligonucleotide C (Fig. 5C) was very similar to the
result obtained with oligonucleotide A (Fig. 5A),
indicating that the A and C oligonucleotides contain C/EBP binding
sites that bind the same set of C/EBPs with similar affinity but do not
specifically recognize other nuclear factors contained in mammary
epithelial cells.
C/EBP- Is the Major Isoform in Mammary
Epithelial CellsThe antibody directed against C/EBP-
reacted with four complexes, which can be most clearly resolved due to
their different mobility in experiments performed with oligonucleotide
C (Fig. 5C). These complexes were labeled 1 to
4. The different mobility of the complexes might be due to the
presence of C/EBP- proteins with different size, as has been
reported(39) , and/or might be the result of the formation of
heterodimers with other C/EBP proteins. An additional complex (labeled
with ) reacted with a mixture of antibodies specific for
C/EBP- , - , and - (Fig. 5D, lane
3). Selective inclusion of blocking peptides specific for the
three isoforms revealed that the -specific peptide was selectively
able to block the reaction of the antibody mixture with the band shift
complex (Fig. 5D, lane 6), indicating
that this complex contains C/EBP- . C/EBP- antibody did not
react with any of the complexes formed by nuclear extracts from mammary
epithelial cells but recognized the most abundant complex formed with
oligonucleotide A and nuclear extracts from liver cells (not shown). In
conclusion, the C/EBPs contained in nuclear extracts of mammary
epithelial cells belong predominantly to the isoform. The
isoform was present at lower abundance, and the C/EBP- binding
activity was undetectably low.
The C/EBP Sites within the Minimal LHRR Are Important
for the Function of the -Casein Gene PromoterTo
assess the importance of the C/EBP sites for the function of the
-casein gene promoter, we analyzed the effect of mutations in the
C/EBP sites within oligonucleotide B on the lactogenic
hormone-dependent expression of a CAT constructs with 344 bp of
5`-flanking sequence of the rat -casein gene. The mutations
changed the sequence of the -casein gene promoter into a HindIII site. They were the same as the one employed in the
oligonucleotide competition experiments shown in the previous section
(mutations in oligonucleotides Bm1, Bm3, Bm4, and Bm5 (Fig. 4).
In the constructs Bm1, Bm3, and Bm4 4-6 bp in the 10-bp C/EBP
recognition motif were changed by the introduction of the novel HindIII site, whereas in Bm5 only 1 bp was changed. In
comparison with the expression of the wild type promoter construct, the
constructs with the extensive mutations were all severely impaired in
their response to lactogenic hormones and also showed a reduced basal
promoter activity (Table 1), indicating the functional importance
of the three promoter proximal C/EBP sites for hormone-induced and
basal activity of the -casein gene promoter. The mutation of the
single bp within the C/EBP (B2) recognition in construct Bm5 was not
sufficient to impair the response to hormones.
In HC11 Cells C/EBP- Expression Is Not Regulated
by Lactogenic HormonesIn adipocytes, hepatocytes, and
hematopoetic cells, changes in the expression pattern of the C/EBP
proteins have been described during development and differentiation
(for review see (15) and (16) ). They were discussed
as important for the regulation of differentiation-specific genes. We
were interested to see how the expression of C/EBP- , the major
isoform in the mammary gland, is regulated by hormones in mammary
epithelial cells. The amount of C/EBP- protein was analyzed in
immunoblotting experiments with the same C/EBP- -specific antibody
used in the supershift experiments described in Fig. 5. The
antibody recognized proteins of different size. The two immunoreactive
forms found in nuclear extracts prepared from liver, mammary gland, and
HC11 cells migrating at the position 20 kDa and 32 kDa (Fig. 6)
appear to be identical to the C/EBP- proteins LIP (liver
inhibitory protein) and LAP (liver activator protein)(40) .
Nuclear extracts derived from mammary epithelial cells contained in
addition two immunoreactive proteins with an apparent molecular mass of
38 and 45 kDa (upper two bands in lanes 3 and 5). Only the 38-kDa form was present in extracts prepared from
lactating mammary glands (lane 2). It is presently unclear
whether these proteins represent modified forms of C/EBP- forms as
has been described in NIH 3T3 fibroblasts(39) .
Figure 6:
Immunoblotting experiments with a
C/EBP- -specific antibody. 25 µg of nuclear extracts was
prepared from mouse organs and HC11 cells, subjected to
SDS-polyacrylamide gel electrophoresis, and immunoblotted. The position
and size (in kDa) of molecular mass marker proteins are shown at the left margin. Extracts: lane 1, liver; lane
2, mammary gland (MG) of late pregnant mice; lane
3, logarithmically growing HC11 cells (log); lane
4, confluent HC11 cells (-DP); lane 5,
confluent HC11 cells treated with 0.1 µM dexamethasone and
5 µg/ml prolactin for 4 days (+DP).
The effect
of lactogenic hormones on the expression of C/EBP- was studied by
analyzing nuclear extracts of HC11 cells. The amount of C/EBP-
present in these cells was found to be already high in growing or
confluent cells in the absence of hormones and was not further induced
or reduced by the action of lactogenic hormones (Fig. 6, lanes 3-5, and data not shown). Similarly, in EMSA
experiments no significant difference in the DNA binding activity was
observed between uninduced and hormone-treated extracts (not shown).
The findings are in accordance with the result obtained in the DNase I
footprinting experiment (Fig. 2), where a similar degree of
protection of C/EBP binding sites was observed with extracts from
hormone-treated cells and untreated controls.
DISCUSSION
In this study we have localized four C/EBP binding sites in
the region between -220 and -132 of the rat -casein
gene promoter. Mutational and deletion analysis demonstrated the
functional importance of these sites for the hormone-regulated
transcription of the -casein gene. Three of the sites were located
in the 5` half of the minimal lactogenic hormone response element, and
an additional one was localized within a region of the -casein
gene promoter required for the efficient response to lactogenic
hormones. The sequence of the four C/EBP sites in the -casein gene
promoter was identical in the mouse and rat genes (Fig. 3). In
the bovine gene, where the C/EBP sites in the promoter region are not
conserved, the hormonal regulation was highly dependent on the presence
of enhancer elements in the upstream region(41) . This enhancer
contains a C/EBP site at -1650, which is important for the
function of the enhancer. ( )A recent report
defines a distal LHRR in the rabbit S1-casein gene(42) .
As indicated by the authors of this study, a sequence with homology to
the C/EBP consensus is also present in this region. These observations
point to a general role of C/EBPs in the regulation of casein genes of
different species. It is presently unclear whether C/EBPs are of
general importance for the expression of other milk protein genes, such
as the whey acidic protein gene and the -lactoglobulin gene. In
the response regions of these genes, the binding sites for other
transcription factors such as CTF/NF1 (43) and ETS family
members (32) were identified, which were absent in the LHRR of
the -casein gene promoter. Such factors might substitute in their
function for C/EBPs. Mammary epithelial cells exhibited a
characteristic expression pattern of C/EBP isoforms: the prevalent
isoforms were C/EBP- and C/EBP- , whereas C/EBP- levels
were undetectably low. The same pattern of isoform expression was
observed in differentiated macrophages (17) and in hepatocytes
reprogrammed by the acute phase response (for review see (16) ). By contrast, in terminal differentiated adipocytes and
in hepatocytes not challenged by acute inflammatory reactions, the
C/EBP- gene was expressed, and the C/EBP- and C/EBP-
isoforms were down-regulated(16, 28, 44) .
These differences likely reflect different functions of individual
members of the C/EBP family in the differentiation of tissues, possibly
mediated by their diverse amino-terminal effector domains. The
predominant isoform in mammary epithelial cells, C/EBP- , has been
studied extensively in tissues other than the mammary gland. It was
isolated by several independent groups under the names
NF-IL6(45) , AGP/EBP(46) , LAP(40) , IL-6DBP (47) , rNFIL-6(48) , CRP2(49) ,
NF-M(50) , and C/EBP- (28) . Targeted disruption of
C/EBP- in mice disclosed the essential role of this factor in
bacterial killing and tumor cytotoxicity by macrophages(19) ,
which could not be compensated by the expression of other C/EBP
isoforms such as C/EBP- . Whether these mice have also a defect in
the terminal differentiation of the mammary epithelium was not
investigated in this study. Ectopic expression of C/EBP- in
undifferentiated cell lines led to the induction of differentiation.
The direction of differentiation was dependent on the recipient cell
line. In NIH 3T3 fibroblasts expression of C/EBP- confers
competence to undergo hormone-induced phenotypic conversion to
adipocytes(44) , whereas undifferentiated hematopoetic cell
lines were reprogrammed to express myeloid-specific
genes(51, 52) . The findings posed the intriguing
question as to how the same factor can have such diverse functions
depending on the cell type. A current hypothesis for explaining the
diverse but cell type-specific function of C/EBP- in different
tissues is the selective interplay of C/EBP with other transcription
factors, depending on the cell type and promoter organization. Indeed,
C/EBP- has frequently been found to synergize with other
transcription factors binding to vicinal sites in the promoter regions
of genes specifically expressed in macrophages, hepatocytes, and
adipocytes. Examples are SP-1(24, 53) ,
v-myb, and c-myb(51) , rel factors (54) , and the glucocorticoid receptor(55) .
C/EBP- also undergoes direct protein-protein interactions, which
are supposed to change the activity of the factor. It readily forms
heterodimers with other members of the C/EBP family (28, 49) including the dominant negative factor C/EBP
homologous protein (CHOP)(56) , and with the basic leucine
zipper protein C/EBP-related activating transcription factor (C/ATF) (57) . C/EBP- was even described to undergo direct
protein-protein interactions with unrelated trans-activating
factors, such as members of the rel family(58) , and
the glucocorticoid receptor(59) . A similar combinatorial
interplay of C/EBP with other factors might contribute to the mammary
cell-specific expression of the -casein gene. It is especially
noteworthy that in the -casein gene promoter, the C/EBP sites are
in tight proximity to previously mapped sites for the glucocorticoid
receptor(5) . Such vicinal sites of C/EBP and the
glucocorticoid receptor have been described in the response elements of
liver-specific genes(26, 55, 60) . A response
element with C/EBP binding sites mediating the delayed response of
glucocorticoid hormones on transcription has been found in the rat
arginase gene(25) . The factor mediating the delayed response
was not identified in this study. Remarkably, the response of the
-casein gene to glucocorticoids in mammary epithelial cells was
also delayed (9) . C/EBP might also synergize with the STAT
factor MGF, which is essential for the function of the LHRR in the
-casein gene promoter. Similar combinations of binding sites for
STAT factors and C/EBPs were observed previously in the response
elements of tissue-specific expressed genes induced by growth hormone (61) and interleukin-4(62) . An intriguing question
only partially resolved by the present study is how C/EBP-
contributes to the stage-specific expression of the -casein gene
during lactation. An important determinant in the specific expression
of the -casein gene is the level of the lactogenic hormones
prolactin and glucocorticoids. However, these hormones did not appear
to change the concentration of C/EBP- in mammary epithelial cells (Fig. 6). C/EBP- was already high in nuclear extracts of
cells not treated with lactogenic hormones. These findings raise the
possibility that C/EBP- is not the direct target of signaling
cascades induced by prolactin and glucocorticoids but serves as an
essential, constitutively expressed factor in conjunction with
hormone-inducible factors such as MGF/STAT5 and the glucocorticoid
receptor. Alternatively, lactogenic hormones might directly induce
post-translational modifications of C/EBP- and thereby change its
activity as a transcription factor without affecting DNA binding.
Previous work in cellular systems other than the mammary epithelium
provides extensive evidence that extracellular signals can modulate
C/EBP- activity by triggering the phosphorylation of different
domains of the molecule via different protein kinases. Cyclic
AMP-dependent protein kinase(48) , calcium/calmodulin-dependent
kinases(63) , protein kinase C isoforms(50) , and
mitogen-activated protein kinases (64) have been reported to be
involved in the activation process. The activation mechanism by
mitogen-activated protein kinase kinases is particularly interesting
since it involves the phosphorylation of a conserved site within a
repressor region of the molecule which contacts and thereby probably
masks the transactivation domain of C/EBP- (65) . The
possibility that the activity of C/EBP- is regulated in a similar
fashion in mammary epithelial cells in response to lactogenic hormones
is currently under investigation in our laboratory.
FOOTNOTES
- *
- This work was supported by Fonds zur
Frderung der Wissenschaftlichen Forschung Projects
P9346 and F209. The costs of publication of this article were defrayed
in part by the payment of page charges. This article must therefore by
hereby marked ``advertisement'' in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
Institut fr Medizinische Chemie und Biochemie,
Fritz-Pregl-Strasse 3, A-6020 Innsbruck, Austria. Tel.:
43-512-507-3505; Fax: 43-512-507-2872.
- The
abbreviations used are: MGF, mammary gland factor; STAT, signal
transducer and activator of transcription; LHRR, lactogenic hormone
response region; EMSA, electromobility shift assay; C/EBP,
CCAAT/enhancer-binding protein; CAT, chloramphenicol acetyltransferase;
PCR, polymerase chain reaction; bp, base pair(s); fp, footprint.
- C. Schmidhauser, personal communication.
ACKNOWLEDGEMENTS
We thank Christian Schmidhauser, Jim DeWille, and
Jeffrey Rosen for stimulating discussions and Judith Lechner for a
critical reading of the manuscript.
REFERENCES
- Doppler, W., Groner, B., and Ball, R. K.(1989)Proc. Natl. Acad. Sci. U. S. A. 86, 104-108
[Abstract/Free Full Text]
- Yoshimura, M., and Oka, T.(1990)Proc. Natl. Acad. Sci. U. S. A. 87, 3670-3674
[Abstract/Free Full Text]
- Schmidhauser, C., Bissell, M. J., Myers, C. A., and Casperson, G. F.(1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9118-9122
[Abstract/Free Full Text]
- Schmitt-Ney, M., Doppler, W., Ball, R. K., and Groner, B.(1991)Mol. Cell. Biol. 11, 3745-3755
[Abstract/Free Full Text]
- Welte, T., Philipp, S., Cairns, C., Gustafsson, J.-A., and Doppler, W.(1993) J. Steroid Biochem. Mol. Biol. 47, 75-81
[CrossRef][Medline]
[Order article via Infotrieve]
- Standke, G. J. R., Meier, V. S., and Groner, B.(1994)Mol. Endocrinol. 8, 469-477
[Abstract/Free Full Text]
- Welte, T., Garimorth, K., Philipp, S., and Doppler, W.(1994)Mol. Endocrinol. 8, 1091-1102
[Abstract/Free Full Text]
- Wakao, H., Gouilleux, F., and Groner, B.(1994)EMBO J. 13, 2182-2191
[Medline]
[Order article via Infotrieve]
- Doppler, W., Hck, W., Hofer, P., Groner, B., and Ball, R. K. (1990)Mol. Endocrinol. 4, 912-919
[Abstract/Free Full Text]
- Lee, C. S., and Oka, T. (1992)Endocrinology131,2257-2262
[Abstract/Free Full Text]
- Altiok, S., and Groner, B.(1993)Mol. Cell. Biol. 13, 7303-7310
[Abstract/Free Full Text]
- Altiok, S., and Groner, B.(1994)Mol. Cell. Biol. 14, 6004-6012
[Abstract/Free Full Text]
- Meier, V. S., and Groner, B.(1994)Mol. Cell. Biol. 14, 128-137
[Abstract/Free Full Text]
- Raught, B., Khursheed, B., Kazanasky, A., and Rosen, J.(1994)Mol. Cell. Biol. 14, 1752-1763
[Abstract/Free Full Text]
- McKnight, S. L. (1992) in Transcriptional Regulation (McKnight, S. L., and Yamamoto, K. R., eds) pp. 771-795, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Akira, S., and Kishimoto, T.(1994)Immunol. Rev. 127, 25-50
- Scott, L. M., Civin, C. I., Rorth, P., and Friedman, A. D.(1992)Blood 80, 1725-1735
[Abstract/Free Full Text]
- Pope, R. M., Leutz, A., and Ness, S. A.(1994)J. Clin. Invest. 94, 1449-1455
- Tanaka, T., Akira, S., Yoshida, K., Umemoto, M., Yoneda, Y., Shirafuji, N., Fujiwara, H., Suematsu, S., Yoshida, N., and Kishimoto, T.(1995) Cell 80, 353-361
[CrossRef][Medline]
[Order article via Infotrieve]
- Cereghini, S., Raymondjean, M., Carranca, A. G., Herbomel, P., and Yaniv, M. (1987)Cell 50, 627-638
[CrossRef][Medline]
[Order article via Infotrieve]
- Theisen, M., Behringer, R. R., Cadd, G. G., Brinster, R. L., and McKnight, G. S.(1993) Mol. Cell. Biol. 13, 7666-7676
[Abstract/Free Full Text]
- Ray, B. K., and Ray, A. (1994)Eur. J. Biochem.222,891-900
[Medline]
[Order article via Infotrieve]
- Ray, A., and Ray, B. K. (1994)Mol. Cell. Biol.14,4324-4332
[Abstract/Free Full Text]
- Lee, Y.-H., Yano, M., Liu, S.-Y., Matsunaga, E., Johnson, P. F., and Gonzalez, F. J. (1994)Mol. Cell. Biol. 14, 1383-1394
[Abstract/Free Full Text]
- Gotoh, T., Haraguchi, Y., Takiguchi, M., and Mori, M.(1994)J. Biochem. 115, 778-788
[Abstract/Free Full Text]
- Baumann, H., Morella, K. K., Campos, S. P., Cao, Z., and Jahreis, G. P.(1992) J. Biol. Chem. 267, 19744-19751
[Abstract/Free Full Text]
- Lin, F.-T., and Lane, M. D.(1992)Genes & Dev. 6, 533-544
[CrossRef]
- Cao, Z. C., Umek, R. M., and McKnight, S. L.(1991)Genes & Dev. 5, 1538-1552
[CrossRef]
- Piontkewitz, Y., Enerback, S., and Hedin, L.(1993)Endocrinology 133, 2327-2333
[Abstract/Free Full Text]
- Chandrasekaran, C., and Gordon, J. I.(1993)Proc. Natl. Acad. Sci. U. S. A. 90, 8871-8875
[Abstract/Free Full Text]
- Doppler, W., Villunger, A., Jennewein, P., Brduscha, A., Groner, B., and Ball, R. K. (1991)Mol. Endocrinol. 5, 1624-1632
[Abstract/Free Full Text]
- Welte, T., Garimorth, K., Philipp, S., Jennewein, P., Huck, C., Cato, A. C. B., and Doppler, W.(1994)Eur. J. Biochem. 223, 997-1006
[Medline]
[Order article via Infotrieve]
- Southern, P. J., and Berg, P.(1982)J. Mol. Appl. Genet. 1, 327-341
[Medline]
[Order article via Infotrieve]
- Luckow, B., and Schtz, G.(1987)Nucleic Acids Res.15,5490
[Free Full Text]
- Deng, W. P., and Nickoloff, J. A.(1992)Anal. Biochem. 200, 81-88
[CrossRef][Medline]
[Order article via Infotrieve]
- Groenen, M. A. M., Dijkhof, R. J. M., van der Poel, J. J., van Diggelen, R., and Verstege, E.(1992)Nucleic Acids Res. 20, 4311-4318
[Abstract/Free Full Text]
- Jones, K. A., Yamamoto, K. R., and Tjian, R.(1985)Cell 42, 559-572
[CrossRef][Medline]
[Order article via Infotrieve]
- Chen, H.-M., and Liao, W. S. L.(1993)J. Biol. Chem. 268, 25311-25319
[Abstract/Free Full Text]
- Sears, R. C., and Sealy, L.(1994)Mol. Cell. Biol. 14, 4855-4871
[Abstract/Free Full Text]
- Descombes, P., and Schibler, U.(1991)Cell 67, 569-579
[CrossRef][Medline]
[Order article via Infotrieve]
- Schmidhauser, C., Casperson, G. F., Myers, C. A., Sanzo, K. T., Bolten, S., and Bissell, M. J.(1992)Mol. Biol. Cell 3, 699-709
[Abstract]
- Pierre, S., Jolivet, G., Devinoy, E., and Houdebine, L. M.(1994)Mol. Endocrinol. 8, 1720-1730
[Abstract/Free Full Text]
- Li, S., and Rosen, J. M. (1994)J. Biol. Chem.269,14235-14243
[Abstract/Free Full Text]
- Yeh, W.-C., Cao, Z., Classon, M., and McKnight, S. L.(1995)Genes & Dev. 9, 168-181
[CrossRef]
- Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T.(1990)EMBO J. 9, 1897-1906
[Medline]
[Order article via Infotrieve]
- Chang, C. J., Chen, T. T., Lei, H. Y., Chen, D. S., and Lee, S. C.(1990) Mol. Cell. Biol. 10, 6642-6653
[Abstract/Free Full Text]
- Poli, V., Mancini, F. P., and Cortese, R.(1990)Cell 63, 643-653
[CrossRef][Medline]
[Order article via Infotrieve]
- Metz, R., and Ziff, E. (1991)Genes & Dev.5,1754-1766
[CrossRef]
- Williams, S. C., Cantwell, C. A., and Johnson, P. F.(1991)Genes & Dev. 5, 1553-1567
[CrossRef]
- Katz, S., Kowenz-Leutz, E., Mller, C., Meese, K., Ness, S. A., and Leutz, A.(1993)EMBO J. 12, 1321-1332
[Medline]
[Order article via Infotrieve]
- Burk, O., Mink, S., Ringwald, M., and Klempnauer, K.-H.(1993)EMBO J. 12, 2027-2038
[Medline]
[Order article via Infotrieve]
- Ness, S. A., Kowenz-Leutz, E., Casini, T., Graf, T., and Leutz, A.(1993) Genes & Dev. 7, 749-759
[CrossRef]
- Ray, B. K., and Ray, A. (1994)Gene (Amst.)147,253-258
[CrossRef][Medline]
[Order article via Infotrieve]
- Diehl, J. A., and Hannink, M.(1994)Mol. Cell. Biol. 14, 6635-6646
[Abstract/Free Full Text]
- Alam, T., An, M. R., Mifflin, R. C., Hsieh, C.-C., Ge, X., and Papaconstantinou, J. (1993)J. Biol. Chem. 268, 15681-15688
[Abstract/Free Full Text]
- Ron, D., and Habener, J. F.(1992)Genes & Dev. 6, 439-453
- Vallejo, M., Ron, D., Miller, C. P., and Habener, J. F.(1993)Proc. Natl. Acad. Sci. U. S. A. 90, 4679-4683
[Abstract/Free Full Text]
- LeClair, K. P., Blanar, M. A., and Sharp, P. A.(1992)Proc. Natl. Acad. Sci. U. S. A. 89, 8145-8149
[Abstract/Free Full Text]
- Nishio, Y., Isshiki, H., Kishimoto, T., and Akira, S.(1993)Mol. Cell. Biol. 13, 1854-1862
[Abstract/Free Full Text]
- Ingrassia, R., Savoldi, G. F., Caraffini, A., Tironi, M., Poiesi, C., Williams, P., Albertini, A., and Dilorenzo, D.(1994)DNA Cell Biol. 13, 615-627
[Medline]
[Order article via Infotrieve]
- Le Cam, A., Pantescu, V., Paquereau, L., Legraverend, C., Fauconnier, G., and Asins, G. (1994)J. Biol. Chem. 269, 21532-21539
[Abstract/Free Full Text]
- Delphin, S., and Stavnezer, J.(1995)J. Exp. Med. 181, 181-192
[Abstract/Free Full Text]
- Trautwein, C. C., Caelles, P., van der Greer, P., Hunter, T., Karin, M., and Chojkier, M. (1993)Nature 364, 544-547
[CrossRef][Medline]
[Order article via Infotrieve]
- Nakajima, T., Kinoshita, S., Sasagawa, T., Sasaki, K., Naruto, M., Kishimoto, T., and Akira, S. (1993)Proc. Natl. Acad. Sci. U. S. A. 90, 2207-2211
[Abstract/Free Full Text]
- Kowenz-Leutz, E., Twamley, G., Ansieau, S., and Leutz, A.(1994)Genes & Dev. 8, 2781-2791
[CrossRef]
- Kanai, A., Nonomura, N., Yoshimura, M., and Oka, T.(1993)Gene (Amst.)126,195-201
[CrossRef][Medline]
[Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
E. Cocolakis, M. Dai, L. Drevet, J. Ho, E. Haines, S. Ali, and J.-J. Lebrun
Smad Signaling Antagonizes STAT5-mediated Gene Transcription and Mammary Epithelial Cell Differentiation
J. Biol. Chem.,
January 18, 2008;
283(3):
1293 - 1307.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. K. Inman, N. Li, and P. Shore
Oct-1 Counteracts Autoinhibition of Runx2 DNA Binding To Form a Novel Runx2/Oct-1 Complex on the Promoter of the Mammary Gland-Specific Gene {beta}-casein
Mol. Cell. Biol.,
April 15, 2005;
25(8):
3182 - 3193.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Zhu, U. Maitra, D. Johnston, M. Lozano, and J. P. Dudley
The Homeodomain Protein CDP Regulates Mammary-Specific Gene Transcription and Tumorigenesis
Mol. Cell. Biol.,
June 1, 2004;
24(11):
4810 - 4823.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Zhang, H. Zhang, L. Lee, and M. M. Ip
The Liver-Enriched Inhibitory Protein Isoform of CCAAT/Enhancer-Binding Protein {beta}, But Not Nuclear Factor-{kappa}B, Mediates the Transcriptional Inhibition of {beta}-Casein by Tumor Necrosis Factor-{alpha}
Endocrinology,
June 1, 2004;
145(6):
2833 - 2844.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Paukku, J. Yang, and O. Silvennoinen
Tudor and Nuclease-Like Domains Containing Protein p100 Function as Coactivators for Signal Transducer and Activator of Transcription 5
Mol. Endocrinol.,
September 1, 2003;
17(9):
1805 - 1814.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. R. Dearth and J. DeWille
Posttranscriptional and Posttranslational Regulation of C/EBPdelta in G0 Growth-arrested Mammary Epithelial Cells
J. Biol. Chem.,
March 21, 2003;
278(13):
11246 - 11255.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. R. Kappeler, Z. Farah, and Z. Puhan
5'-Flanking Regions of Camel Milk Genes Are Highly Similar to Homologue Regions of Other Species and Can be Divided into Two Distinct Groups
J Dairy Sci,
February 1, 2003;
86(2):
498 - 508.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Buitenhuis, B. Baltus, J.-W. J. Lammers, P. J. Coffer, and L. Koenderman
Signal transducer and activator of transcription 5a (STAT5a) is required for eosinophil differentiation of human cord blood-derived CD34+ cells
Blood,
January 1, 2003;
101(1):
134 - 142.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Hutt and J. W. DeWille
Oncostatin M Induces Growth Arrest of Mammary Epithelium via a CCAAT/enhancer-binding Protein {delta}-dependent Pathway
Mol. Cancer Ther.,
June 1, 2002;
1(8):
601 - 610.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Kannius-Janson, E. M. Johansson, G. Bjursell, and J. Nilsson
Nuclear Factor 1-C2 Contributes to the Tissue-specific Activation of a Milk Protein Gene in the Differentiating Mammary Gland
J. Biol. Chem.,
May 10, 2002;
277(20):
17589 - 17596.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Kim, M.-J. Yoon, J. Lee, J. M. Penninger, and Y.-Y. Kong
Osteoprotegerin Ligand Induces beta -Casein Gene Expression through the Transcription Factor CCAAT/Enhancer-binding Protein beta
J. Biol. Chem.,
February 8, 2002;
277(7):
5339 - 5344.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. H. Faulds, K. Pettersson, J.-A. Gustafsson, and L.-A. Haldosen
Cross-Talk Between ERs and Signal Transducer and Activator of Transcription 5 Is E2 Dependent and Involves Two Functionally Separate Mechanisms
Mol. Endocrinol.,
November 1, 2001;
15(11):
1929 - 1940.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. L. Wyszomierski and J. M. Rosen
Cooperative Effects of STAT5 (Signal Transducer and Activator of Transcription 5) and C/EBP {beta} (CCAAT/Enhancer-Binding Protein-{beta}) on {beta}-Casein Gene Transcription Are Mediated by the Glucocorticoid Receptor
Mol. Endocrinol.,
February 1, 2001;
15(2):
228 - 240.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
W. Ai, J. Narahari, and A. Roman
Yin Yang 1 Negatively Regulates the Differentiation-Specific E1 Promoter of Human Papillomavirus Type 6
J. Virol.,
June 1, 2000;
74(11):
5198 - 5205.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. L. Grimm and S. K. Nordeen
A Composite Enhancer Element Directing Tissue-specific Expression of Mouse Mammary Tumor Virus Requires both Ubiquitous and Tissue-restricted Factors
J. Biol. Chem.,
April 30, 1999;
274(18):
12790 - 12796.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. M. Grønning, M. K. Dahle, K. A. Taskén, S. Enerbäck, L. Hedin, K. Taskén, and H. K. Knutsen
Isoform-Specific Regulation of the CCAAT/Enhancer-Binding Protein Family of Transcription Factors by 3',5'-Cyclic Adenosine Monophosphate in Sertoli Cells
Endocrinology,
February 1, 1999;
140(2):
835 - 843.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
D. Chida, H. Wakao, A. Yoshimura, and A. Miyajima
Transcriptional Regulation of the {beta}-Casein Gene by Cytokines: Cross-Talk between STAT5 and Other Signaling Molecules
Mol. Endocrinol.,
November 1, 1998;
12(11):
1792 - 1806.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. W. Robinson, P. F. Johnson, L. Hennighausen, and E. Sterneck
The C/EBPbeta transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland
Genes & Dev.,
June 15, 1998;
12(12):
1907 - 1916.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
C. A. Myers, C. Schmidhauser, J. Mellentin-Michelotti, G. Fragoso, C. D. Roskelley, G. Casperson, R. Mossi, P. Pujuguet, G. Hager, and M. J. Bissell
Characterization of BCE-1, a Transcriptional Enhancer Regulated by Prolactin and Extracellular Matrix and Modulated by the State of Histone Acetylation
Mol. Cell. Biol.,
April 1, 1998;
18(4):
2184 - 2195.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Lechner, T. Welte, J. K. Tomasi, P. Bruno, C. Cairns, J.-A. Gustafsson, and W. Doppler
Promoter-dependent Synergy between Glucocorticoid Receptor and Stat5 in the Activation of beta -Casein Gene Transcription
J. Biol. Chem.,
August 15, 1997;
272(33):
20954 - 20960.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. O'Rourke, R. Yuan, and J. DeWille
CCAAT/Enhancer-binding Protein-delta (C/EBP-delta ) Is Induced in Growth-arrested Mouse Mammary Epithelial Cells
J. Biol. Chem.,
March 7, 1997;
272(10):
6291 - 6296.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Hutt, J. P. O'Rourke, and J. DeWille
Signal Transducer and Activator of Transcription 3 Activates CCAAT Enhancer-binding Protein delta Gene Transcription in G0 Growth-arrested Mouse Mammary Epithelial Cells and in Involuting Mouse Mammary Gland
J. Biol. Chem.,
September 8, 2000;
275(37):
29123 - 29131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Jiang and E. Zacksenhaus
Activation of retinoblastoma protein in mammary gland leads to ductal growth suppression, precocious differentiation, and adenocarcinoma
J. Cell Biol.,
January 7, 2002;
156(1):
185 - 198.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|