Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doppler, W.
Right arrow Articles by Philipp, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doppler, W.
Right arrow Articles by Philipp, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 30, Issue of July 28, pp. 17962-17969, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CCAAT/Enhancer-binding Protein Isoforms and Are Expressed in Mammary Epithelial Cells and Bind to Multiple Sites in the -Casein Gene Promoter (*)

(Received for publication, March 22, 1995; and in revised form, May 12, 1995)

Wolfgang Doppler (§) Thomas Welte Sonja Philipp

From the Institut fr Medizinische Chemie und Biochemie, Universitt Innsbruck, A-6020 Innsbruck, Austria

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Lactogenic hormone-dependent expression of the rat -casein gene in mammary epithelial cells is controlled via a complex regulatory region in the promoter. The sequence between -176 and -82 is the minimal region to confer the response to glucocorticoid hormone and prolactin on a heterologous promoter. The response is further enhanced by the region between -282 and -176. DNase I footprinting experiments and electromobility shift assays revealed the presence of four binding sites for CCAAT/enhancer-binding protein (C/EBP) isoforms in the hormone response region between -220 and -132. In nuclear extracts from mammary epithelial cells, the prevalent C/EBP isoform binding to these sites is (C/EBP-). C/EBP- is also present in mammary epithelial cells, whereas C/EBP- is not detectable. The C/EBP sites are located in close proximity to the previously characterized binding sites for the prolactin-inducible mammary gland factor/signal transducer and activator of transcription-5, the nuclear factor YY1, and the glucocorticoid receptor. The importance of the two proximal C/EBP binding sites at the 5` border of the minimal region was tested by mutational analysis. Mutations of each site were found to inhibit strongly both the basal and the lactogenic hormone-induced transcription of a -casein gene promoter chloramphenicol acetyltransferase construct. The results implicate C/EBPs as important regulators of -casein gene expression in the mammary epithelium.


INTRODUCTION

Multiple cis-acting elements are involved in ensuring the correct stage and tissue-specific expression of the -casein gene. They have been identified in the promoter region and 5`-flanking sequence(1, 2, 3) . The characterization of the nuclear factors binding to these elements has led to the discovery of both positively and negatively acting factors. Positively acting are two hormone-inducible factors, namely the mammary gland factor MGF()(4) , and the glucocorticoid receptor (5) . MGF is induced in its DNA binding by prolactin (6, 7) and was shown to be a novel member of the STAT family (STAT5(8) ). It binds to an essential site in the promoter which is crucial for the response to prolactin(4, 7) . The significance of the glucocorticoid receptor binding sites in the promoter is presently not clear, since glucocorticoid hormones appear to act indirectly on the transcription of the -casein gene(9) . Three factors have been described to be involved in the repression of transcription: pregnancy-specific mammary nuclear factor(10) , single-stranded DNA-binding factor(11, 12) , and the nuclear factor YY1(13, 14) . Whereas YY1 is constitutively expressed in mammary epithelial cells, both pregnancy-specific mammary nuclear factor and single-stranded DNA-binding factor are regulated in their activity. Pregnancy-specific mammary nuclear factor is down-regulated in the absence of progesterone and is thus considered as a mediator of the repression of -casein gene transcription during pregnancy. Single-stranded DNA-binding factor is sequestered by -casein mRNA. It is discussed as a component of a positive feedback loop that is initiated after the induction of -casein gene transcription.

Although several trans-acting factors have been described to be important for the regulation of the -casein gene, the factors mediating the minimal response of the promoter to lactogenic hormones, and the minimal cis-acting sequence in the lactogenic hormone response region (LHRR) required for this response have not been defined so far. Single copies or multimers of the MGF/STAT5 binding site were not sufficient for conferring the response to lactogenic hormones in mammary epithelial cells(6) . With heterologous promoter constructs we show here that the minimal response region of the rat -casein gene extends from -176 to -82 and includes in addition to the proximal MGF/STAT5 and YY1 sites a functional element located in the 5` half, which has not been characterized so far. To identify nuclear factors that bind to this critical 5` region, DNase I footprinting experiments and electromobility shift assays (EMSAs) were performed with extracts of mammary epithelial cells. The studies revealed the presence of four C/EBP binding sites in the LHRR. The binding sites were localized in the region of the 5` border of the minimal element and at the positions -220 and -142. The functional significance of the sites at the 5` border was confirmed by mutational analysis.

C/EBPs comprise a family of isoforms encoded by separate genes(15, 16) which share a highly similar carboxyl-terminal DNA binding domain and leucine zipper dimerization domain but have different amino-terminal effector domains. The genes of the individual C/EBP isoforms are expressed differentially in a restricted set of tissues. The C/EBP isoforms , , and (C/EBP-, -, and -, respectively) have been implicated previously as important determinants for the specific expression of genes in various terminal differentiated tissues other than the mammary gland. They were discovered to be important regulatory factors in the induction of differentiation-specific genes in myelomonocytic cells(17, 18, 19) , hepatocytes(16, 20, 21, 22, 23, 24, 25, 26) , adipocytes (15, 27, 28) and have also been implicated in the differentiation of ovarian follicles (29) and of the intestinal epithelium(30) . To find out which of these C/EBP isoforms is expressed in mouse mammary epithelial cells, EMSAs and immunoblotting experiments were performed with isoform-specific antibodies. The obtained data point to an important role of C/EBP- in the mediation of stage-specific expression in the mammary gland.


MATERIALS AND METHODS

Cell Culture and Hormone Induction

HC11 cells were grown in RPMI 1640 medium (Biochrom; Berlin, Germany) supplemented with 10% heat-inactivated fetal calf serum (Biochrom), 5 µg/ml insulin (Sigma, St. Louis, Mo. U. S. A.), 10 ng/ml epidermal growth factor (Sigma), and 50 µg/ml gentamycin. Prior to hormone treatment, the confluent cultures were kept for 2 days in an epidermal growth factor-free RPMI 1640 medium containing 2% fetal calf serum and 5 µg/ml insulin. 5 µg/ml ovine prolactin (31 units/mg, Sigma) and 0.1 µM dexamethasone (Sigma) were added to this medium, and cells were cultured for an additional 4 days. Control cultures were cultivated in the absence of prolactin and dexamethasone.

Transfection and CAT Assay

The cells were stably transfected by the calcium phosphate precipitation technique as described (31, 32) with 10 µg of plasmid DNA and 1 µg of pSV2neo (33) per 10-cm culture dish. One hundred to 1,000 colonies resistant to the antibiotic G418 (200 µg/ml) were pooled and cultured further in G418-containing medium. The preparation of cell extracts and determination of CAT activity were as described in (31) .

Plasmids

The heterologous -casein gene thymidine kinase (tk) promoter CAT constructs were prepared by inserting PCR-generated -casein gene fragments of the indicated promoter regions into the 5` polylinker of the -105 tk CAT expression vector pBLCAT2(34) . Oligonucleotides with engineered restriction sites at their 5` ends were employed as primers for the PCR. The sense primer used to create fragments with a 5` border at -344 was 5`ATCGGATCCTCTCTAAAGCTTGTGAAT3`.

Fragments with 5` end points at -282, -175, -157, and -105 were amplified with the sense primer 5`TTGGTCGACGACTCACTTTAGGGCGAAT3`, and plasmid templates of the 5` deletion series pbsc(X/+487)CAT(9) . The primer binds to the invariant vector sequence of the plasmids next to the variable 5` deletion end point of the -casein gene promoter. Antisense primers for creating fragments with a defined 3` border of the -casein gene fragment were: 5`AAGGGATCCTGGGGGACATTAAACAAGGC3` (border at -147), 5`TAGGGATCCGTTTCTTTCTATTTTCTTTC3`(-117), 5`CTTGGATCCAAGAAGTTCCACATGATT3`(-89), 5`AAAGGATCCTTAATTCCAAGAAGTTC3` (-82), and 5`ATGGGATCCTAATTTGTGGTTCGTAAGA3`(-51).

Mutations creating a novel HindIII site were introduced into the -casein gene promoter construct pc(-344/-1)CAT (9) by site-directed mutagenesis using the protocol of Deng and Nickoloff (35) . The selection primer was 5`CCCCGGGTACAGATCTCGAATTCGT3`, which destroys the unique SacI and KpnI cutting sites, replacing them with a BglII site. The primers used for mutation of the promoter with the novel HindIII sites were: 5`CCTTCACCAGAAGCTTAATTGCTGCC3` (-181, Bm1), 5`AGCTTCTGAAGCTTTGCCTTGTTT3` (-175, Bm3), 5`ACCAGCTTCTGAATTGCTGAAGCTTTTAATGTC3` (-167, Bm4), and 5`CCTTGTTTAAGCTTCCCCAGAATT3` (-159, Bm5).

The position of the introduced HindIII site in the -casein gene promoter and the name of the corresponding mutated oligonucleotides employed in EMSA (see Fig. 4) are shown in parentheses. Mutations were verified by sequencing.


Figure 4: Sequence of the oligonucleotides employed in EMSA experiments. Only the upper strand of the double-stranded oligonucleotides is shown. Lowercase letters indicate mutated nucleotides. HindIII sites introduced into mutated oligonucleotides are underlined. The numbers in parentheses represent the positions of the 5` and 3` borders. The C/EBP palindrome is a oligonucleotide containing a high affinity C/EBP- binding site(28) .



Cell Extracts

Preparation of nuclear extracts for EMSA, DNase I footprinting, and immunoblotting experiments were carried out as described(32) . Extracts were stored in aliquots at -70 °C and only thawed once before use.

DNase I Footprinting

DNA-templates were generated by PCR amplification of the relevant region using end-labeled oligonucleotides as primers. The PCR product was isolated from a 1.5% agarose gel with the glassmilk-based Mermaid Kit (Bio 101). The purified DNA-template (13,000 cpm in 1.5 µl) was added to 10 µl of nuclear extract diluted with 2.5 µl of 50 mM Hepes, pH 7.6, 240 mM KCl, 0.2 mM EDTA, 40 mM MgCl, and 1 µl of poly(dI-dC) (1 µg/µl) at 4 °C. The samples were then kept for 15 min at 21 °C and 15 min at 4 °C. Two microliters of DNase I diluted in 10 mM Hepes, pH 7.6, 25 mM CaCl, 100 µg/ml bovine serum albumin was added (7-60 ng of DNase I, depending on the amount of extract); after 2 min at 4 °C the reaction was stopped with 50 µl of freshly prepared stop solution (50 mM EDTA, 0.2% SDS, 100 µg/ml yeast tRNA, 500 µg/ml proteinase K). The samples were kept at 50 °C for 30 min, extracted with phenol-chloroform (1:1) mixture and chloroform, precipitated with ethanol, and analyzed on a 6% urea-polyacrylamide gel in 1 TBE electrophoresis buffer (0.089 M Tris, 0.089 M boric acid, 0.2 mM EDTA, pH 8.0). A Maxam-Gilbert sequencing reaction of the DNA-templates (the G-lane) was included as a position marker.

EMSAs

Oligonucleotides were radioactively labeled with [-P]ATP (>6,000 Ci/mmol) and T4 polynucleotide kinase and purified by phenol extraction and Sephadex G-50 chromatography. After a treatment for 5 min at 95 °C, complementary oligonucleotides were annealed in 250 mM Tris-HCl, pH 7.6, 2 mM MgCl by a slow temperature decrease from 70 °C to room temperature. Ten-µg nuclear extracts or whole cell extracts and 50,000 cpm of labeled double-stranded oligonucleotide (30-50 fmol) were incubated on ice for 30 min prior to electrophoresis in a 20-µl reaction volume containing 10 mM Hepes, pH 7.9, 6 mM sodium phosphate, 52.5 mM KCl, 0.2 mM EDTA, 0.1 mM EGTA, 1.35 mM dithiothreitol, 5 mM MgCl, 3.5% glycerol, 2 µg of poly(dI-dC), and 0.50 nM unlabeled single-stranded oligonucleotide. The single-stranded oligonucleotide was included to compete for the binding of unspecific proteins binding to single-stranded DNA. Where indicated, the C/EBP isoform-specific polyclonal antibodies sc-61, sc-150, and sc-151 (Santa Cruz Biotechnology), the corresponding blocking peptides, or double-stranded oligonucleotides were added to the extracts prior to the addition of the labeled oligonucleotide and incubated on ice for 30 min. Probes were mixed with 2 µl of loading buffer (25% Ficoll 400, 0.25% bromphenol blue) and loaded on a 4% polyacrylamide gel in 0.25 TBE electrophoresis buffer (0.022 M Tris, 0.022 M boric acid, 0.05 mM EDTA, pH 8.0). Prerun and electrophoresis of 3 h each were performed at room temperature at 10 V/cm with recirculation of electrophoresis buffer. The gel was fixed, dried, and autoradiographed.

Immunoblotting Experiments

Nuclear extracts were subjected to electrophoresis on 14% SDS-polyacrylamide gels, and the separated proteins were transferred to polyvinylidine difluoride membranes (Immobilon-P, Millipore). Membranes were incubated with 0.25 µg/ml polyclonal C/EBP- antiserum sc-150 directed against a carboxyl-terminal peptide (Santa Cruz Biotechnology). The immunoreactive proteins were visualized by use of a secondary horseradish peroxidase-linked anti-rabbit antibody (Amersham Corp.) and the Amersham Enhanced Chemiluminescence system.


RESULTS

The -344/-1 fragment of the rat -casein gene promoter was shown to mediate the synergistic effects of prolactin and glucocorticoid hormones on the transcription of a linked chloramphenicol reporter gene in the stably transfected mouse mammary epithelial cell line HC11(9) . We searched for the minimal sequence element within this fragment which confers hormone responsiveness to a heterologous promoter. -Casein gene promoter sequences with defined 5` and 3` ends were amplified with PCR. The basic promoter fragments extending from -344 to -51 and from -344 to -82 lacked the octamer site between -55 and -48 (36) but contained the sites for MGF between -97 and -87 (4) and the nuclear factor YY1 between -118 and -112 (13) . These fragments were ligated in front of the -105 tk promoter, which has in addition to the TATA box two sites for the transcription factor Sp1 and one site for CCAAT transcription factor/nuclear factor 1 (CTF/NF1)(37) . The insertion of the -casein gene sequences conferred the response to lactogenic hormones on the heterologous promoter (Fig. 1A). The induction ratios were lower than observed with the -344/-1 -casein gene promoter constructs (see (9) and Table 1 of this study), indicating that the octamer site and/or other sequence elements between position -51 and -1 of the -casein gene facilitate the response to lactogenic hormones.


Figure 1: Delimitation analysis of the LHRR in the rat -casein gene promoter. Fragments of the rat -casein gene promoter were generated by PCR and inserted in front of a CAT expression vector with the -105 tk promoter. The structure of the resulting promoters with the 5` and 3` borders of the -casein gene fragments is shown in the left part of each panel. The constructs were stably transfected into HC11 cells. Lactogenic hormone-dependent expression was determined by measuring the CAT activity in confluent cells treated with 0.1 µM dexamethasone and 5 µg/ml prolactin (hatched bars) for 4 days and in untreated cells (open bars). Results are expressed as the mean ± S.E. of two or three experiments performed in triplicate with independent transfectants. The induction ratio was calculated as the ratio of CAT activities in cells treated with or without hormones.



The Minimal LHRR of the Rat -Casein Gene Promoter Contains at Least Three Different Functional Elements

The location of the minimal lactogenic hormone response element was mapped by further removal of 5` and 3` sequence. Removal of the sequence between -344 and -282 did not alter the function of the LHRR significantly (Fig. 1A, compare third and fourth constructs). This was expected since the deletion did not extend beyond the limit of the first 5` border of the hormone response element identified in previous experiments(1) . Elimination of the MGF recognition site between -89 and -82 led to a complete loss of the lactogenic hormone-dependent activity (Fig. 1A, fifth construct). This is in accordance with the results of -casein gene promoter constructs, where the MGF site was inactivated by point mutations(4, 7) . Removal of both the YY1 and MGF sites by deletion of the sequence between -117 and -82 resulted in a construct that did not respond to lactogenic hormones but had in comparison with the -105 tk promoter alone a 7-fold increase of the hormone-independent promoter activity (Fig. 1A, compare first construct with sixth construct). A similar observation was made with a construct in which the sequence between -147 and -82 was deleted (seventh construct of Fig. 1A). Our data indicate the presence of a hormone-independent enhancer element in the region between -282 and -147, which is repressed in the intact -casein gene promoter by the region comprising the YY1 site(13) . The major factor mediating the repression is probably the factor YY1 itself, as described previously(13) .

In Fig. 1B, the role of the region between -176 and -157 for the response to lactogenic hormones was investigated. The 95-bp sequence extending from -176 to -82 was found to be sufficient to confer the lactogenic hormone response to the -105 tk promoter (Fig. 1B, second construct), whereas the shortened promoter fragment spanning the sequence between -157 and -82 had lost this property (third construct). Thus the sequence between -176 and -157 is important for the minimal response to lactogenic hormones. The sequence did not function per se as a lactogenic hormone response element (fourth construct of Fig. 1B). Its function required the presence of both the repressor region and the MGF site. Taken together, the data define a minimal LHRR between -176 and -82, which can be subdivided into at least three functional domains: the novel cis-acting element at the 5` border defined in the present study; the MGF/STAT5 site at 3` border; and a repressor region in between, which harbors a YY1 site.

C/EBP Sites in the 5` Half of the LHRR

A systematic investigation on the nuclear factors binding to the 3` region of the LHRR employing DNase I footprinting and oligonucleotide competition experiments was performed previously by Schmitt-Ney et al.(4) . Two of the factors binding to that region were identified later at the molecular level as MGF/STAT5 (8) and YY1(13) . The proteins binding to the 5` region of the LHRR have not been examined in greater detail. To localize binding sites within this region, we performed DNase I footprinting experiments with a PCR-generated mouse -casein gene fragment which extends into the 5` half of the LHRR. Four major regions were found to be protected by nuclear extracts prepared from the mammary gland of pregnant animals, lactogenic hormone-induced HC11 cells, and uninduced HC11 cells (footprints fp1-fp4 of Fig. 2). The protection in footprint fp2 was weaker than in the other footprinted regions. In the experiment of Fig. 2and other experiments (not shown), there was no significant difference in the protection pattern obtained with extracts derived from cells induced with hormones or untreated controls. Fp1 was outside the minimal LHRR and covered the sequence between -237 and -202, whereas footprints fp2 to fp4 were within the minimal LHRR. The position of footprint fp2, which extended from -182 to -151, was most interesting, since it is in the region of the critical cis-acting sequence at the 5` border of the minimal LHRR (Fig. 1B). The mouse promoter sequence was aligned with the rat sequence (Fig. 3) and the conserved regions inspected for transcription factor binding sites. Thereby, four putative sites for C/EBP were found (Fig. 3). They are all contained within the regions protected in the DNase I footprint experiment. The sites in footprints fp1 and fp3 closely fit the consensus sequence for the C/EBP binding sites(15, 16, 38) . In footprint fp2 two more divergent motifs for C/EBP were present.


Figure 2: DNase I footprinting experiment with a 380-bp fragment of the mouse -casein gene promoter and nuclear extracts prepared from mammary epithelial cells. The noncoding strand was 5` end labeled at position -10 by [-P]ATP. Protections obtained with extracts prepared from glands of pregnant mice (lane 2), confluent HC11 cells treated with 0.1 µM dexamethasone and 5 µg/ml prolactin for 4 days (lane 4), and untreated HC11 cells (lane 6) are shown together with the DNase I digestion of the probe without added protein (lanes 3 and 5). Lane 1, chemical sequencing reaction (cleavage at G residues). The positions of three major protected regions (fp1, fp3, and fp4) are indicated by solid lines at the right margin. The position of the weak footprint fp2 is shown by a dashed line. The coordinate numbers at the left margin show the distance to the transcription initiation site.




Figure 3: C/EBP binding sites in the murine -casein gene promoters. The sequences extending from -241 to -80 of the mouse gene (66) and rat gene (4) were aligned. The position of the DNase I footprints fp1-fp3 (Fig. 2) are shown by bars above the mouse sequence. Sequences related to the consensus sequence for C/EBP binding sites are indicated by rectangular boxes. The positions of the binding sites for YY1 and MGF are also shown by boxes. Solid bars below the rat sequence indicate the size and position of oligonucleotides A, B, and C employed for the EMSA experiments.



To investigate whether the nuclear proteins binding to the three footprinted regions contain C/EBPs, EMSAs were performed with double-stranded oligonucleotides A, B, and C. They include the four putative C/EBP binding sites of the -casein gene promoter (Fig. 3). The sequences of the oligonucleotides and of the mutated versions employed in oligonucleotide competition experiments are shown in Fig. 4. Nuclear extracts prepared from HC11 cells contained factors that bind to oligonucleotide A and form several complexes with different mobility in the EMSA (Fig. 5A, lane 1). Formation of all complexes was competed with the parental oligonucleotide but not with an oligonucleotide mutated in the C/EBP consensus region (Fig. 5A, lanes 2-5). The results indicate that the nuclear proteins bound to oligonucleotide A have the sequence specificity characteristic for C/EBPs. Additional evidence for the presence of C/EBPs in the complexes formed with oligonucleotide A was obtained by the reactivity of an antibody specific for the C/EBP-. The antibody reacted with most of the complexes and induced a strong supershift (Fig. 5A, lane 7). A palindromic high affinity C/EBP site (28) and the oligonucleotides B and C, which contain the other putative C/EBP sites in the -casein gene promoter, were also able to compete for the binding of the C/EBPs to oligonucleotide A (Fig. 5A, lanes 8, 10, and 11). However, the efficiency of oligonucleotide B to compete was lower, indicating that the sites on B have a reduced affinity for C/EBPs.


Figure 5: EMSAs with oligonucleotides comprising the sequences of fp1 (panel A), fp2 (panel B), and fp3 (panels C and D) and nuclear extracts of HC11 mammary epithelial cells. Complexes reacting with an antiserum specific for C/EBP- are labeled with 1, 2, 3, and 4; the complex reacting with a C/EBP- antiserum is labeled with . Panel A, labeled probe: oligonucleotide A. Various competitor oligonucleotides (competitor, specified in Fig. 4) were added to the reaction mixture in 60-fold (lanes 2 and 4), 20-fold (lanes 3 and 5), or 75-fold (lanes 8-11) molar excess. In lane 7 a C/EBP--specific antibody (0.2 µg) was included in the reaction mixture. Panel B, labeled probe: oligonucleotide B. A 60-fold (lanes 2-8) or a 75-fold (lanes 12-15) molar excess of various competitors was added to the reaction mixture. The sequence of the competitor DNA is shown in Fig. 4. Lane 11, 0.2 µg of antibody against C/EBP- present in reaction mixture. Panel C, labeled probe: oligonucleotide C. Experimental conditions were as described for the assay with oligonucleotide A in panel A. Panel D, labeled probe: oligonucleotide C. Reaction mixtures applied on lanes 2-6 contained as indicated (Antibody) 0.2 µg of anti-C/EBP- () or a mixture of antibodies specific for C/EBP- (0.5 µg), C/EBP- (0.25 µg), and C/EBP- (1.0 µg) ( + + ). 0.1 µg of block peptides for the C/EBP--, -, and -specific antibodies were added as indicated at the top of each lane. All reactions were performed with 10 µg of nuclear proteins.



When the assay was performed with labeled oligonucleotide B, a similar pattern of complexes was observed. Again, the majority of complexes reacted with the C/EBP--specific antibody (Fig. 5B, lane 11), and their formation was competed specifically with oligonucleotides containing C/EBP sites (Fig. 5B, lanes 12, 13, and 15). The amount of complexes formed with oligonucleotide B was smaller than with A. This is in accordance with the lower affinity of oligonucleotide B for C/EBPs (Fig. 5A, lane 10) and the weaker footprint fp2 in the DNase I protection assay shown in Fig. 3. Competition experiments were performed with B oligonucleotides mutated in one or both C/EBP sites (Fig. 5B, lanes 3-7). When only one of the two C/EBP sites was mutated (oligonucleotides Bm1, Bm3, and Bm4), the oligonucleotides still were able to compete the binding of C/EBPs to the unmutated oligonucleotide, indicating that one intact C/EBP site was sufficient for binding. In Bm2, mutations were introduced into both C/EBP sites. This abolished the binding activity for the C/EBP complexes (Fig. 5B, lane 6).

The result of the EMSA obtained with oligonucleotide C (Fig. 5C) was very similar to the result obtained with oligonucleotide A (Fig. 5A), indicating that the A and C oligonucleotides contain C/EBP binding sites that bind the same set of C/EBPs with similar affinity but do not specifically recognize other nuclear factors contained in mammary epithelial cells.

C/EBP- Is the Major Isoform in Mammary Epithelial Cells

The antibody directed against C/EBP- reacted with four complexes, which can be most clearly resolved due to their different mobility in experiments performed with oligonucleotide C (Fig. 5C). These complexes were labeled 1 to 4. The different mobility of the complexes might be due to the presence of C/EBP- proteins with different size, as has been reported(39) , and/or might be the result of the formation of heterodimers with other C/EBP proteins. An additional complex (labeled with ) reacted with a mixture of antibodies specific for C/EBP-, -, and - (Fig. 5D, lane 3). Selective inclusion of blocking peptides specific for the three isoforms revealed that the -specific peptide was selectively able to block the reaction of the antibody mixture with the band shift complex (Fig. 5D, lane 6), indicating that this complex contains C/EBP-. C/EBP- antibody did not react with any of the complexes formed by nuclear extracts from mammary epithelial cells but recognized the most abundant complex formed with oligonucleotide A and nuclear extracts from liver cells (not shown). In conclusion, the C/EBPs contained in nuclear extracts of mammary epithelial cells belong predominantly to the isoform. The isoform was present at lower abundance, and the C/EBP- binding activity was undetectably low.

The C/EBP Sites within the Minimal LHRR Are Important for the Function of the -Casein Gene Promoter

To assess the importance of the C/EBP sites for the function of the -casein gene promoter, we analyzed the effect of mutations in the C/EBP sites within oligonucleotide B on the lactogenic hormone-dependent expression of a CAT constructs with 344 bp of 5`-flanking sequence of the rat -casein gene. The mutations changed the sequence of the -casein gene promoter into a HindIII site. They were the same as the one employed in the oligonucleotide competition experiments shown in the previous section (mutations in oligonucleotides Bm1, Bm3, Bm4, and Bm5 (Fig. 4). In the constructs Bm1, Bm3, and Bm4 4-6 bp in the 10-bp C/EBP recognition motif were changed by the introduction of the novel HindIII site, whereas in Bm5 only 1 bp was changed. In comparison with the expression of the wild type promoter construct, the constructs with the extensive mutations were all severely impaired in their response to lactogenic hormones and also showed a reduced basal promoter activity (Table 1), indicating the functional importance of the three promoter proximal C/EBP sites for hormone-induced and basal activity of the -casein gene promoter. The mutation of the single bp within the C/EBP (B2) recognition in construct Bm5 was not sufficient to impair the response to hormones.



In HC11 Cells C/EBP- Expression Is Not Regulated by Lactogenic Hormones

In adipocytes, hepatocytes, and hematopoetic cells, changes in the expression pattern of the C/EBP proteins have been described during development and differentiation (for review see (15) and (16) ). They were discussed as important for the regulation of differentiation-specific genes. We were interested to see how the expression of C/EBP-, the major isoform in the mammary gland, is regulated by hormones in mammary epithelial cells. The amount of C/EBP- protein was analyzed in immunoblotting experiments with the same C/EBP--specific antibody used in the supershift experiments described in Fig. 5. The antibody recognized proteins of different size. The two immunoreactive forms found in nuclear extracts prepared from liver, mammary gland, and HC11 cells migrating at the position 20 kDa and 32 kDa (Fig. 6) appear to be identical to the C/EBP- proteins LIP (liver inhibitory protein) and LAP (liver activator protein)(40) . Nuclear extracts derived from mammary epithelial cells contained in addition two immunoreactive proteins with an apparent molecular mass of 38 and 45 kDa (upper two bands in lanes 3 and 5). Only the 38-kDa form was present in extracts prepared from lactating mammary glands (lane 2). It is presently unclear whether these proteins represent modified forms of C/EBP- forms as has been described in NIH 3T3 fibroblasts(39) .


Figure 6: Immunoblotting experiments with a C/EBP--specific antibody. 25 µg of nuclear extracts was prepared from mouse organs and HC11 cells, subjected to SDS-polyacrylamide gel electrophoresis, and immunoblotted. The position and size (in kDa) of molecular mass marker proteins are shown at the left margin. Extracts: lane 1, liver; lane 2, mammary gland (MG) of late pregnant mice; lane 3, logarithmically growing HC11 cells (log); lane 4, confluent HC11 cells (-DP); lane 5, confluent HC11 cells treated with 0.1 µM dexamethasone and 5 µg/ml prolactin for 4 days (+DP).



The effect of lactogenic hormones on the expression of C/EBP- was studied by analyzing nuclear extracts of HC11 cells. The amount of C/EBP- present in these cells was found to be already high in growing or confluent cells in the absence of hormones and was not further induced or reduced by the action of lactogenic hormones (Fig. 6, lanes 3-5, and data not shown). Similarly, in EMSA experiments no significant difference in the DNA binding activity was observed between uninduced and hormone-treated extracts (not shown). The findings are in accordance with the result obtained in the DNase I footprinting experiment (Fig. 2), where a similar degree of protection of C/EBP binding sites was observed with extracts from hormone-treated cells and untreated controls.


DISCUSSION

In this study we have localized four C/EBP binding sites in the region between -220 and -132 of the rat -casein gene promoter. Mutational and deletion analysis demonstrated the functional importance of these sites for the hormone-regulated transcription of the -casein gene. Three of the sites were located in the 5` half of the minimal lactogenic hormone response element, and an additional one was localized within a region of the -casein gene promoter required for the efficient response to lactogenic hormones. The sequence of the four C/EBP sites in the -casein gene promoter was identical in the mouse and rat genes (Fig. 3). In the bovine gene, where the C/EBP sites in the promoter region are not conserved, the hormonal regulation was highly dependent on the presence of enhancer elements in the upstream region(41) . This enhancer contains a C/EBP site at -1650, which is important for the function of the enhancer.()A recent report defines a distal LHRR in the rabbit S1-casein gene(42) . As indicated by the authors of this study, a sequence with homology to the C/EBP consensus is also present in this region. These observations point to a general role of C/EBPs in the regulation of casein genes of different species. It is presently unclear whether C/EBPs are of general importance for the expression of other milk protein genes, such as the whey acidic protein gene and the -lactoglobulin gene. In the response regions of these genes, the binding sites for other transcription factors such as CTF/NF1 (43) and ETS family members (32) were identified, which were absent in the LHRR of the -casein gene promoter. Such factors might substitute in their function for C/EBPs.

Mammary epithelial cells exhibited a characteristic expression pattern of C/EBP isoforms: the prevalent isoforms were C/EBP- and C/EBP-, whereas C/EBP- levels were undetectably low. The same pattern of isoform expression was observed in differentiated macrophages (17) and in hepatocytes reprogrammed by the acute phase response (for review see (16) ). By contrast, in terminal differentiated adipocytes and in hepatocytes not challenged by acute inflammatory reactions, the C/EBP- gene was expressed, and the C/EBP- and C/EBP- isoforms were down-regulated(16, 28, 44) . These differences likely reflect different functions of individual members of the C/EBP family in the differentiation of tissues, possibly mediated by their diverse amino-terminal effector domains. The predominant isoform in mammary epithelial cells, C/EBP-, has been studied extensively in tissues other than the mammary gland. It was isolated by several independent groups under the names NF-IL6(45) , AGP/EBP(46) , LAP(40) , IL-6DBP (47) , rNFIL-6(48) , CRP2(49) , NF-M(50) , and C/EBP-(28) . Targeted disruption of C/EBP- in mice disclosed the essential role of this factor in bacterial killing and tumor cytotoxicity by macrophages(19) , which could not be compensated by the expression of other C/EBP isoforms such as C/EBP-. Whether these mice have also a defect in the terminal differentiation of the mammary epithelium was not investigated in this study. Ectopic expression of C/EBP- in undifferentiated cell lines led to the induction of differentiation. The direction of differentiation was dependent on the recipient cell line. In NIH 3T3 fibroblasts expression of C/EBP- confers competence to undergo hormone-induced phenotypic conversion to adipocytes(44) , whereas undifferentiated hematopoetic cell lines were reprogrammed to express myeloid-specific genes(51, 52) . The findings posed the intriguing question as to how the same factor can have such diverse functions depending on the cell type. A current hypothesis for explaining the diverse but cell type-specific function of C/EBP- in different tissues is the selective interplay of C/EBP with other transcription factors, depending on the cell type and promoter organization. Indeed, C/EBP- has frequently been found to synergize with other transcription factors binding to vicinal sites in the promoter regions of genes specifically expressed in macrophages, hepatocytes, and adipocytes. Examples are SP-1(24, 53) , v-myb, and c-myb(51) , rel factors (54) , and the glucocorticoid receptor(55) . C/EBP- also undergoes direct protein-protein interactions, which are supposed to change the activity of the factor. It readily forms heterodimers with other members of the C/EBP family (28, 49) including the dominant negative factor C/EBP homologous protein (CHOP)(56) , and with the basic leucine zipper protein C/EBP-related activating transcription factor (C/ATF) (57) . C/EBP- was even described to undergo direct protein-protein interactions with unrelated trans-activating factors, such as members of the rel family(58) , and the glucocorticoid receptor(59) . A similar combinatorial interplay of C/EBP with other factors might contribute to the mammary cell-specific expression of the -casein gene. It is especially noteworthy that in the -casein gene promoter, the C/EBP sites are in tight proximity to previously mapped sites for the glucocorticoid receptor(5) . Such vicinal sites of C/EBP and the glucocorticoid receptor have been described in the response elements of liver-specific genes(26, 55, 60) . A response element with C/EBP binding sites mediating the delayed response of glucocorticoid hormones on transcription has been found in the rat arginase gene(25) . The factor mediating the delayed response was not identified in this study. Remarkably, the response of the -casein gene to glucocorticoids in mammary epithelial cells was also delayed (9) . C/EBP might also synergize with the STAT factor MGF, which is essential for the function of the LHRR in the -casein gene promoter. Similar combinations of binding sites for STAT factors and C/EBPs were observed previously in the response elements of tissue-specific expressed genes induced by growth hormone (61) and interleukin-4(62) .

An intriguing question only partially resolved by the present study is how C/EBP- contributes to the stage-specific expression of the -casein gene during lactation. An important determinant in the specific expression of the -casein gene is the level of the lactogenic hormones prolactin and glucocorticoids. However, these hormones did not appear to change the concentration of C/EBP- in mammary epithelial cells (Fig. 6). C/EBP- was already high in nuclear extracts of cells not treated with lactogenic hormones. These findings raise the possibility that C/EBP- is not the direct target of signaling cascades induced by prolactin and glucocorticoids but serves as an essential, constitutively expressed factor in conjunction with hormone-inducible factors such as MGF/STAT5 and the glucocorticoid receptor. Alternatively, lactogenic hormones might directly induce post-translational modifications of C/EBP- and thereby change its activity as a transcription factor without affecting DNA binding. Previous work in cellular systems other than the mammary epithelium provides extensive evidence that extracellular signals can modulate C/EBP- activity by triggering the phosphorylation of different domains of the molecule via different protein kinases. Cyclic AMP-dependent protein kinase(48) , calcium/calmodulin-dependent kinases(63) , protein kinase C isoforms(50) , and mitogen-activated protein kinases (64) have been reported to be involved in the activation process. The activation mechanism by mitogen-activated protein kinase kinases is particularly interesting since it involves the phosphorylation of a conserved site within a repressor region of the molecule which contacts and thereby probably masks the transactivation domain of C/EBP-(65) . The possibility that the activity of C/EBP- is regulated in a similar fashion in mammary epithelial cells in response to lactogenic hormones is currently under investigation in our laboratory.


FOOTNOTES

*
This work was supported by Fonds zur Frderung der Wissenschaftlichen Forschung Projects P9346 and F209. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Institut fr Medizinische Chemie und Biochemie, Fritz-Pregl-Strasse 3, A-6020 Innsbruck, Austria. Tel.: 43-512-507-3505; Fax: 43-512-507-2872.

The abbreviations used are: MGF, mammary gland factor; STAT, signal transducer and activator of transcription; LHRR, lactogenic hormone response region; EMSA, electromobility shift assay; C/EBP, CCAAT/enhancer-binding protein; CAT, chloramphenicol acetyltransferase; PCR, polymerase chain reaction; bp, base pair(s); fp, footprint.

C. Schmidhauser, personal communication.


ACKNOWLEDGEMENTS

We thank Christian Schmidhauser, Jim DeWille, and Jeffrey Rosen for stimulating discussions and Judith Lechner for a critical reading of the manuscript.


REFERENCES

  1. Doppler, W., Groner, B., and Ball, R. K.(1989)Proc. Natl. Acad. Sci. U. S. A. 86, 104-108 [Abstract/Free Full Text]
  2. Yoshimura, M., and Oka, T.(1990)Proc. Natl. Acad. Sci. U. S. A. 87, 3670-3674 [Abstract/Free Full Text]
  3. Schmidhauser, C., Bissell, M. J., Myers, C. A., and Casperson, G. F.(1990) Proc. Natl. Acad. Sci. U. S. A. 87, 9118-9122 [Abstract/Free Full Text]
  4. Schmitt-Ney, M., Doppler, W., Ball, R. K., and Groner, B.(1991)Mol. Cell. Biol. 11, 3745-3755 [Abstract/Free Full Text]
  5. Welte, T., Philipp, S., Cairns, C., Gustafsson, J.-A., and Doppler, W.(1993) J. Steroid Biochem. Mol. Biol. 47, 75-81 [CrossRef][Medline] [Order article via Infotrieve]
  6. Standke, G. J. R., Meier, V. S., and Groner, B.(1994)Mol. Endocrinol. 8, 469-477 [Abstract/Free Full Text]
  7. Welte, T., Garimorth, K., Philipp, S., and Doppler, W.(1994)Mol. Endocrinol. 8, 1091-1102 [Abstract/Free Full Text]
  8. Wakao, H., Gouilleux, F., and Groner, B.(1994)EMBO J. 13, 2182-2191 [Medline] [Order article via Infotrieve]
  9. Doppler, W., Hck, W., Hofer, P., Groner, B., and Ball, R. K. (1990)Mol. Endocrinol. 4, 912-919 [Abstract/Free Full Text]
  10. Lee, C. S., and Oka, T. (1992)Endocrinology131,2257-2262 [Abstract/Free Full Text]
  11. Altiok, S., and Groner, B.(1993)Mol. Cell. Biol. 13, 7303-7310 [Abstract/Free Full Text]
  12. Altiok, S., and Groner, B.(1994)Mol. Cell. Biol. 14, 6004-6012 [Abstract/Free Full Text]
  13. Meier, V. S., and Groner, B.(1994)Mol. Cell. Biol. 14, 128-137 [Abstract/Free Full Text]
  14. Raught, B., Khursheed, B., Kazanasky, A., and Rosen, J.(1994)Mol. Cell. Biol. 14, 1752-1763 [Abstract/Free Full Text]
  15. McKnight, S. L. (1992) in Transcriptional Regulation (McKnight, S. L., and Yamamoto, K. R., eds) pp. 771-795, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  16. Akira, S., and Kishimoto, T.(1994)Immunol. Rev. 127, 25-50
  17. Scott, L. M., Civin, C. I., Rorth, P., and Friedman, A. D.(1992)Blood 80, 1725-1735 [Abstract/Free Full Text]
  18. Pope, R. M., Leutz, A., and Ness, S. A.(1994)J. Clin. Invest. 94, 1449-1455
  19. Tanaka, T., Akira, S., Yoshida, K., Umemoto, M., Yoneda, Y., Shirafuji, N., Fujiwara, H., Suematsu, S., Yoshida, N., and Kishimoto, T.(1995) Cell 80, 353-361 [CrossRef][Medline] [Order article via Infotrieve]
  20. Cereghini, S., Raymondjean, M., Carranca, A. G., Herbomel, P., and Yaniv, M. (1987)Cell 50, 627-638 [CrossRef][Medline] [Order article via Infotrieve]
  21. Theisen, M., Behringer, R. R., Cadd, G. G., Brinster, R. L., and McKnight, G. S.(1993) Mol. Cell. Biol. 13, 7666-7676 [Abstract/Free Full Text]
  22. Ray, B. K., and Ray, A. (1994)Eur. J. Biochem.222,891-900 [Medline] [Order article via Infotrieve]
  23. Ray, A., and Ray, B. K. (1994)Mol. Cell. Biol.14,4324-4332 [Abstract/Free Full Text]
  24. Lee, Y.-H., Yano, M., Liu, S.-Y., Matsunaga, E., Johnson, P. F., and Gonzalez, F. J. (1994)Mol. Cell. Biol. 14, 1383-1394 [Abstract/Free Full Text]
  25. Gotoh, T., Haraguchi, Y., Takiguchi, M., and Mori, M.(1994)J. Biochem. 115, 778-788 [Abstract/Free Full Text]
  26. Baumann, H., Morella, K. K., Campos, S. P., Cao, Z., and Jahreis, G. P.(1992) J. Biol. Chem. 267, 19744-19751 [Abstract/Free Full Text]
  27. Lin, F.-T., and Lane, M. D.(1992)Genes & Dev. 6, 533-544 [CrossRef]
  28. Cao, Z. C., Umek, R. M., and McKnight, S. L.(1991)Genes & Dev. 5, 1538-1552 [CrossRef]
  29. Piontkewitz, Y., Enerback, S., and Hedin, L.(1993)Endocrinology 133, 2327-2333 [Abstract/Free Full Text]
  30. Chandrasekaran, C., and Gordon, J. I.(1993)Proc. Natl. Acad. Sci. U. S. A. 90, 8871-8875 [Abstract/Free Full Text]
  31. Doppler, W., Villunger, A., Jennewein, P., Brduscha, A., Groner, B., and Ball, R. K. (1991)Mol. Endocrinol. 5, 1624-1632 [Abstract/Free Full Text]
  32. Welte, T., Garimorth, K., Philipp, S., Jennewein, P., Huck, C., Cato, A. C. B., and Doppler, W.(1994)Eur. J. Biochem. 223, 997-1006 [Medline] [Order article via Infotrieve]
  33. Southern, P. J., and Berg, P.(1982)J. Mol. Appl. Genet. 1, 327-341 [Medline] [Order article via Infotrieve]
  34. Luckow, B., and Schtz, G.(1987)Nucleic Acids Res.15,5490 [Free Full Text]
  35. Deng, W. P., and Nickoloff, J. A.(1992)Anal. Biochem. 200, 81-88 [CrossRef][Medline] [Order article via Infotrieve]
  36. Groenen, M. A. M., Dijkhof, R. J. M., van der Poel, J. J., van Diggelen, R., and Verstege, E.(1992)Nucleic Acids Res. 20, 4311-4318 [Abstract/Free Full Text]
  37. Jones, K. A., Yamamoto, K. R., and Tjian, R.(1985)Cell 42, 559-572 [CrossRef][Medline] [Order article via Infotrieve]
  38. Chen, H.-M., and Liao, W. S. L.(1993)J. Biol. Chem. 268, 25311-25319 [Abstract/Free Full Text]
  39. Sears, R. C., and Sealy, L.(1994)Mol. Cell. Biol. 14, 4855-4871 [Abstract/Free Full Text]
  40. Descombes, P., and Schibler, U.(1991)Cell 67, 569-579 [CrossRef][Medline] [Order article via Infotrieve]
  41. Schmidhauser, C., Casperson, G. F., Myers, C. A., Sanzo, K. T., Bolten, S., and Bissell, M. J.(1992)Mol. Biol. Cell 3, 699-709 [Abstract]
  42. Pierre, S., Jolivet, G., Devinoy, E., and Houdebine, L. M.(1994)Mol. Endocrinol. 8, 1720-1730 [Abstract/Free Full Text]
  43. Li, S., and Rosen, J. M. (1994)J. Biol. Chem.269,14235-14243 [Abstract/Free Full Text]
  44. Yeh, W.-C., Cao, Z., Classon, M., and McKnight, S. L.(1995)Genes & Dev. 9, 168-181 [CrossRef]
  45. Akira, S., Isshiki, H., Sugita, T., Tanabe, O., Kinoshita, S., Nishio, Y., Nakajima, T., Hirano, T., and Kishimoto, T.(1990)EMBO J. 9, 1897-1906 [Medline] [Order article via Infotrieve]
  46. Chang, C. J., Chen, T. T., Lei, H. Y., Chen, D. S., and Lee, S. C.(1990) Mol. Cell. Biol. 10, 6642-6653 [Abstract/Free Full Text]
  47. Poli, V., Mancini, F. P., and Cortese, R.(1990)Cell 63, 643-653 [CrossRef][Medline] [Order article via Infotrieve]
  48. Metz, R., and Ziff, E. (1991)Genes & Dev.5,1754-1766 [CrossRef]
  49. Williams, S. C., Cantwell, C. A., and Johnson, P. F.(1991)Genes & Dev. 5, 1553-1567 [CrossRef]
  50. Katz, S., Kowenz-Leutz, E., Mller, C., Meese, K., Ness, S. A., and Leutz, A.(1993)EMBO J. 12, 1321-1332 [Medline] [Order article via Infotrieve]
  51. Burk, O., Mink, S., Ringwald, M., and Klempnauer, K.-H.(1993)EMBO J. 12, 2027-2038 [Medline] [Order article via Infotrieve]
  52. Ness, S. A., Kowenz-Leutz, E., Casini, T., Graf, T., and Leutz, A.(1993) Genes & Dev. 7, 749-759 [CrossRef]
  53. Ray, B. K., and Ray, A. (1994)Gene (Amst.)147,253-258 [CrossRef][Medline] [Order article via Infotrieve]
  54. Diehl, J. A., and Hannink, M.(1994)Mol. Cell. Biol. 14, 6635-6646 [Abstract/Free Full Text]
  55. Alam, T., An, M. R., Mifflin, R. C., Hsieh, C.-C., Ge, X., and Papaconstantinou, J. (1993)J. Biol. Chem. 268, 15681-15688 [Abstract/Free Full Text]
  56. Ron, D., and Habener, J. F.(1992)Genes & Dev. 6, 439-453
  57. Vallejo, M., Ron, D., Miller, C. P., and Habener, J. F.(1993)Proc. Natl. Acad. Sci. U. S. A. 90, 4679-4683 [Abstract/Free Full Text]
  58. LeClair, K. P., Blanar, M. A., and Sharp, P. A.(1992)Proc. Natl. Acad. Sci. U. S. A. 89, 8145-8149 [Abstract/Free Full Text]
  59. Nishio, Y., Isshiki, H., Kishimoto, T., and Akira, S.(1993)Mol. Cell. Biol. 13, 1854-1862 [Abstract/Free Full Text]
  60. Ingrassia, R., Savoldi, G. F., Caraffini, A., Tironi, M., Poiesi, C., Williams, P., Albertini, A., and Dilorenzo, D.(1994)DNA Cell Biol. 13, 615-627 [Medline] [Order article via Infotrieve]
  61. Le Cam, A., Pantescu, V., Paquereau, L., Legraverend, C., Fauconnier, G., and Asins, G. (1994)J. Biol. Chem. 269, 21532-21539 [Abstract/Free Full Text]
  62. Delphin, S., and Stavnezer, J.(1995)J. Exp. Med. 181, 181-192 [Abstract/Free Full Text]
  63. Trautwein, C. C., Caelles, P., van der Greer, P., Hunter, T., Karin, M., and Chojkier, M. (1993)Nature 364, 544-547 [CrossRef][Medline] [Order article via Infotrieve]
  64. Nakajima, T., Kinoshita, S., Sasagawa, T., Sasaki, K., Naruto, M., Kishimoto, T., and Akira, S. (1993)Proc. Natl. Acad. Sci. U. S. A. 90, 2207-2211 [Abstract/Free Full Text]
  65. Kowenz-Leutz, E., Twamley, G., Ansieau, S., and Leutz, A.(1994)Genes & Dev. 8, 2781-2791 [CrossRef]
  66. Kanai, A., Nonomura, N., Yoshimura, M., and Oka, T.(1993)Gene (Amst.)126,195-201 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
E. Cocolakis, M. Dai, L. Drevet, J. Ho, E. Haines, S. Ali, and J.-J. Lebrun
Smad Signaling Antagonizes STAT5-mediated Gene Transcription and Mammary Epithelial Cell Differentiation
J. Biol. Chem., January 18, 2008; 283(3): 1293 - 1307.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. K. Inman, N. Li, and P. Shore
Oct-1 Counteracts Autoinhibition of Runx2 DNA Binding To Form a Novel Runx2/Oct-1 Complex on the Promoter of the Mammary Gland-Specific Gene {beta}-casein
Mol. Cell. Biol., April 15, 2005; 25(8): 3182 - 3193.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Q. Zhu, U. Maitra, D. Johnston, M. Lozano, and J. P. Dudley
The Homeodomain Protein CDP Regulates Mammary-Specific Gene Transcription and Tumorigenesis
Mol. Cell. Biol., June 1, 2004; 24(11): 4810 - 4823.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
H. Zhang, H. Zhang, L. Lee, and M. M. Ip
The Liver-Enriched Inhibitory Protein Isoform of CCAAT/Enhancer-Binding Protein {beta}, But Not Nuclear Factor-{kappa}B, Mediates the Transcriptional Inhibition of {beta}-Casein by Tumor Necrosis Factor-{alpha}
Endocrinology, June 1, 2004; 145(6): 2833 - 2844.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
K. Paukku, J. Yang, and O. Silvennoinen
Tudor and Nuclease-Like Domains Containing Protein p100 Function as Coactivators for Signal Transducer and Activator of Transcription 5
Mol. Endocrinol., September 1, 2003; 17(9): 1805 - 1814.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. R. Dearth and J. DeWille
Posttranscriptional and Posttranslational Regulation of C/EBPdelta in G0 Growth-arrested Mammary Epithelial Cells
J. Biol. Chem., March 21, 2003; 278(13): 11246 - 11255.
[Abstract] [Full Text] [PDF]


Home page
J DAIRY SCIHome page
S. R. Kappeler, Z. Farah, and Z. Puhan
5'-Flanking Regions of Camel Milk Genes Are Highly Similar to Homologue Regions of Other Species and Can be Divided into Two Distinct Groups
J Dairy Sci, February 1, 2003; 86(2): 498 - 508.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
M. Buitenhuis, B. Baltus, J.-W. J. Lammers, P. J. Coffer, and L. Koenderman
Signal transducer and activator of transcription 5a (STAT5a) is required for eosinophil differentiation of human cord blood-derived CD34+ cells
Blood, January 1, 2003; 101(1): 134 - 142.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
J. A. Hutt and J. W. DeWille
Oncostatin M Induces Growth Arrest of Mammary Epithelium via a CCAAT/enhancer-binding Protein {delta}-dependent Pathway
Mol. Cancer Ther., June 1, 2002; 1(8): 601 - 610.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Kannius-Janson, E. M. Johansson, G. Bjursell, and J. Nilsson
Nuclear Factor 1-C2 Contributes to the Tissue-specific Activation of a Milk Protein Gene in the Differentiating Mammary Gland
J. Biol. Chem., May 10, 2002; 277(20): 17589 - 17596.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-J. Kim, M.-J. Yoon, J. Lee, J. M. Penninger, and Y.-Y. Kong
Osteoprotegerin Ligand Induces beta -Casein Gene Expression through the Transcription Factor CCAAT/Enhancer-binding Protein beta
J. Biol. Chem., February 8, 2002; 277(7): 5339 - 5344.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
M. H. Faulds, K. Pettersson, J.-A. Gustafsson, and L.-A. Haldosen
Cross-Talk Between ERs and Signal Transducer and Activator of Transcription 5 Is E2 Dependent and Involves Two Functionally Separate Mechanisms
Mol. Endocrinol., November 1, 2001; 15(11): 1929 - 1940.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
S. L. Wyszomierski and J. M. Rosen
Cooperative Effects of STAT5 (Signal Transducer and Activator of Transcription 5) and C/EBP {beta} (CCAAT/Enhancer-Binding Protein-{beta}) on {beta}-Casein Gene Transcription Are Mediated by the Glucocorticoid Receptor
Mol. Endocrinol., February 1, 2001; 15(2): 228 - 240.
[Abstract] [Full Text]


Home page
J. Virol.Home page
W. Ai, J. Narahari, and A. Roman
Yin Yang 1 Negatively Regulates the Differentiation-Specific E1 Promoter of Human Papillomavirus Type 6
J. Virol., June 1, 2000; 74(11): 5198 - 5205.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. L. Grimm and S. K. Nordeen
A Composite Enhancer Element Directing Tissue-specific Expression of Mouse Mammary Tumor Virus Requires both Ubiquitous and Tissue-restricted Factors
J. Biol. Chem., April 30, 1999; 274(18): 12790 - 12796.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
L. M. Grønning, M. K. Dahle, K. A. Taskén, S. Enerbäck, L. Hedin, K. Taskén, and H. K. Knutsen
Isoform-Specific Regulation of the CCAAT/Enhancer-Binding Protein Family of Transcription Factors by 3',5'-Cyclic Adenosine Monophosphate in Sertoli Cells
Endocrinology, February 1, 1999; 140(2): 835 - 843.
[Abstract] [Full Text]


Home page
Mol. Endocrinol.Home page
D. Chida, H. Wakao, A. Yoshimura, and A. Miyajima
Transcriptional Regulation of the {beta}-Casein Gene by Cytokines: Cross-Talk between STAT5 and Other Signaling Molecules
Mol. Endocrinol., November 1, 1998; 12(11): 1792 - 1806.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
G. W. Robinson, P. F. Johnson, L. Hennighausen, and E. Sterneck
The C/EBPbeta transcription factor regulates epithelial cell proliferation and differentiation in the mammary gland
Genes & Dev., June 15, 1998; 12(12): 1907 - 1916.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
C. A. Myers, C. Schmidhauser, J. Mellentin-Michelotti, G. Fragoso, C. D. Roskelley, G. Casperson, R. Mossi, P. Pujuguet, G. Hager, and M. J. Bissell
Characterization of BCE-1, a Transcriptional Enhancer Regulated by Prolactin and Extracellular Matrix and Modulated by the State of Histone Acetylation
Mol. Cell. Biol., April 1, 1998; 18(4): 2184 - 2195.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
J. Lechner, T. Welte, J. K. Tomasi, P. Bruno, C. Cairns, J.-A. Gustafsson, and W. Doppler
Promoter-dependent Synergy between Glucocorticoid Receptor and Stat5 in the Activation of beta -Casein Gene Transcription
J. Biol. Chem., August 15, 1997; 272(33): 20954 - 20960.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. O'Rourke, R. Yuan, and J. DeWille
CCAAT/Enhancer-binding Protein-delta (C/EBP-delta ) Is Induced in Growth-arrested Mouse Mammary Epithelial Cells
J. Biol. Chem., March 7, 1997; 272(10): 6291 - 6296.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. A. Hutt, J. P. O'Rourke, and J. DeWille
Signal Transducer and Activator of Transcription 3 Activates CCAAT Enhancer-binding Protein delta Gene Transcription in G0 Growth-arrested Mouse Mammary Epithelial Cells and in Involuting Mouse Mammary Gland
J. Biol. Chem., September 8, 2000; 275(37): 29123 - 29131.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
Z. Jiang and E. Zacksenhaus
Activation of retinoblastoma protein in mammary gland leads to ductal growth suppression, precocious differentiation, and adenocarcinoma
J. Cell Biol., January 7, 2002; 156(1): 185 - 198.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Doppler, W.
Right arrow Articles by Philipp, S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Doppler, W.
Right arrow Articles by Philipp, S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement