![]()
|
|
||||||||
(Received for publication, May 10, 1995) From the
Ferrochelatase, the terminal enzyme of the heme biosynthetic
pathway, is a nuclear encoded protein that is synthesized in the
cytoplasm in a precursor form and then is translocated to the matrix
side of the inner mitochondrial membrane. Since the product of the
enzymatic reaction, protoheme IX, is utilized almost exclusively in the
cytoplasmic compartment or on the cytoplasmic side of the inner
mitochondrial membrane, it was of interest to determine if the
intracellular location of ferrochelatase is crucial for its effective
functioning. In a ferrochelatase-deficient strain of the yeast Saccharomyces cerevisiae vectors that coded for full-length
ferrochelatase and a truncated form of the enzyme that lacked the
mitochondrial targeting sequence were expressed. Both of these
transformed cells produce approximately equal total amounts of
ferrochelatase, as determined by enzyme assays and Western blot
analysis, but only with the full-length construct was ferrochelatase
properly localized. In cells containing the truncated construct,
ferrochelatase activity was found in all membrane fractions but was not
located on the matrix side of the inner mitochondrial membrane. Cells
containing either construct produced heme, although the amount of heme
synthesized by cells with the truncated construct was significantly
less. Interestingly in cells with improperly localized ferrochelatase
the amount of b-type cytochrome decreased by 80% as opposed to c- and a-type cytochromes where the decreases were
only 60 and 40%, respectively.
In animal cells the heme biosynthetic pathway is organized such
that the first and last of the pathway enzymes are located inside the
mitochondrion (see (1, 2, 3) ).
Aminolevulinate synthase (EC 2.3.1.37), the first committed pathway
enzyme that catalyzes the condensation of glycine and succinyl CoA to
form 5-aminolevulinate, is a soluble matrix enzyme while the terminal
enzyme, ferrochelatase (EC 4.99.1.1), which catalyzes the insertion of
ferrous iron into protoporphyrin IX, is bound to the matrix side of the
inner mitochondrial membrane. Aminolevulinate synthase (4, 5, 6) and ferrochelatase (7, 8) are nuclear encoded and synthesized in the
cytoplasm and are then translocated into the mitochondrion and
proteolytically processed into their mature and active form. While the
location of aminolevulinate synthase in the matrix space may be
explained by the presence of one of its substrates, succinyl-CoA, in
this compartment, the localization of ferrochelatase to this area has
been a curiosity since its product, protoheme IX (heme), is utilized
mainly in either the cytoplasmic compartment in cytochromes b In the work
described below we have approached the question of intracellular
topology versus cellular function in the yeast Saccharomyces cerevisiae. In particular we have used a strain
of yeast in which ferrochelatase is not present and have transformed
this mutant with a plasmid that will code for ferrochelatase that will
not be targeted to its usual inner membrane orientation. We then
determined if improper topology of the enzyme has an effect on cellular
heme biosynthesis. The data presented show that while heme synthesis is
possible under these conditions, the amount of heme synthesized is
markedly reduced and the cellular distribution of the heme is different
from what is found in normal cells.
Ferrochelatase in eukaryotic cells is initially synthesized
with a mitochondrial targeting sequence that is proteolytically removed
as part of the energy-requiring translocation
process(7, 8) . For most proteins that have been
examined, complete removal of a targeting sequence from the precursor
form of the protein results in improper cellular targeting of the
modified protein (see (17) ). In the current work we have taken
advantage of a ferrochelatase minus strain of S. cerevisiae to
study the effect of altered cellular location of ferrochelatase on the
ability of the cell to carry out normal heme biosynthesis. To
accomplish this two plasmids were constructed. In one, the complete
cDNA sequence for yeast ferrochelatase and its promoter was placed into
the yeast vector pRS-425, and in the second the mitochondrial targeting
sequence was removed leaving an engineered ATG start site spaced at the
same distance from the yeast promoter as was found in the original
yeast ferrochelatase cDNA. Both of these plasmids were transformed into
the ferrochelatase-deficient (Hem-15) strain GG231-4A. While
growth of this strain without a ferrochelatase-coding plasmid results
in petite cells, the presence of either the normal or leader minus
ferrochelatase cDNA allowed for growth indistinguishable from wild type
yeast. This observation alone suggested that either the altered
ferrochelatase was somehow still targeted to its proper position on the
matrix side of the inner mitochondrial membrane or that improperly
targeted ferrochelatase could still carry out its physiological
function at levels sufficient to support apparently normal growth. Examination of the cellular distribution of normal versus truncated ferrochelatase clearly demonstrated that the
plasmid-encoded normal enzyme was synthesized and properly targeted to
the inner mitochondrial membrane (Table 1). The amino-terminal
truncated enzyme, however, was found scattered throughout all cellular
membrane fractions. No soluble ferrochelatase was detected in the
isolated cytoplasmic fraction (data not shown). Although truncated
ferrochelatase was found in all membrane fractions, the highest
specific activity was found in isolated inner mitochondrial membranes.
The explanation for this is not currently obvious but may be due to
secondary, internal targeting signals. Western blot analysis of crude
cell extracts showed that the amount of immunoreactive ferrochelatase
protein is approximately equal in both yeast constructs (data not
shown).
The orientation of normal and truncated ferrochelatases was
examined with the membrane-impermeant sulfhydryl reagent
DMSD(15) . By using this reagent on isolated intact and
disrupted mitochondria and mitoplasts it is possible to determine if
the ferrochelatase activity found associated with mitochondria is due
to outward (cytoplasmic) or inward (matrix) facing ferrochelatase. A
24% drop in ferrochelatase activity was found in DMSD-treated normal
mitochondria due to mechanical damage that occurred during organelle
isolation. In DMSD-treated intact mitochondria from cells with
truncated ferrochelatase, however, there was a 94% drop in
ferrochelatase activity. Treatment of mitochondria with 1.0% Tween 20
to disrupt membrane integrity and DMSD resulted in a 98% drop in
activity for both normal and truncated ferrochelatase. Similar data
were found with mitoplasts. These data as presented in Table 2demonstrate that while the plasmid-encoded, full-length
ferrochelatase is properly translocated to the matrix side of the inner
membrane, the truncated form of ferrochelatase remains on the external
side of the inner membrane.
Since it was observed that the cells
containing improperly targeted ferrochelatase were capable of
apparently normal, aerobic growth, it was of interest to determine
cellular cytochrome levels. Data presented in Table 3compare the
levels of three classes of yeast cytochromes from mutant cells
containing a plasmid-encoded full-length ferrochelatase and cells
containing a plasmid-encoded truncated ferrochelatase. For all classes
of cytochromes the amount of cytochrome formed in cells with the
truncated ferrochelatase was significantly lower than the levels in
cells with normal ferrochelatase. Interestingly, however, the decreases
observed were not uniform. While microsomal b-type cytochromes (e.g. cytochrome b
In conclusion, we have
demonstrated that the putative targeting, or leader, sequence of yeast
ferrochelatase is necessary for proper topological distribution of
ferrochelatase. Furthermore, it was shown that improperly localized
ferrochelatase is still able to catalyze iron insertion for cellular
heme synthesis but that it functions much less efficiently than the
properly localized enzyme. This is made even more obvious when one
recognizes that even with decreased levels of ferrochelatase on the
cytoplasmic side of the inner mitochondrial membrane in the truncated
constructs, the specific activity of the enzyme present is in excess of
what would be required to synthesize normal levels of cellular heme if
the enzyme were properly located. The last observation that the levels
of individual classes of cytochromes vary in the truncated
ferrochelatase construct is of interest and worthy of further
investigation since this may yield clues about regulation of
intracellular heme trafficking and allocation.
Volume 270,
Number 31,
Issue of August 04, pp. 18198-18200, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
and P450 or in respiratory cytochromes that are
located on the cytoplasmic side of the inner mitochondrial membrane. In
addition, the enzyme that catalyzes the preceding step in the pathway,
protoporphyrinogen oxidase, is located on the opposite side of the
membrane from ferrochelatase (9, 10) .
Strains and Growth Conditions
S. cerevisiae strain 150-2B (hereafter referred to as wild type) and
GG231-4A (hem 15-5) (ferrochelatase-deficient strain) as
well as Hem-15 cDNA in pBluescript Sk(+) were kindly provided by
R. Labbe-Bois, University of Paris VII(11) . PRS-425, a high
copy number yeast shuttle vector, was obtained from C. Glover,
University of Georgia. Yeast cells were cultivated at 30 °C with
vigorous aeration. Complete medium contained 1% yeast extract, 1%
bactopeptone, and 2% glucose (YPD). Minimal medium (YNBG) contained
0.67% yeast nitrogen base (without amino acids), 2% glucose, and the
appropriate nutritional requirements at 135 mg/liter. Tween 80 (0.2%)
and ergosterol (30 mg/liter), providing essential unsaturated fatty
acids, and hemin (15 mg/liter (Porphyrin Products, Logan, UT) made up
freshly in 0.1 N NaOH) were added for the growth of
heme-deficient strains. Yeast transformation was performed by lithium
acetate treatment(12) , and cells were plated on YNBG minimal
media containing ampicillin and incubated at 30 °C for 72-96
h for the appearance of transformants. Cultures of 1 liter were grown
for 72 h in minimal media with selectable markers at 30 °C with
vigorous shaking (250 rpm).Plasmid Construction
The plasmid pARK1 contained
the full-length yeast ferrochelatase cDNA with promoter in the yeast
vector PRS-425(11) . This was obtained by removing the HindIII/BamHI fragment from the pBluescript plasmid
containing the XbaI-HindIII fragment from pHEM
15-1 and ligating it into the BamHI/HindIII
site of PRS-425. To form the amino-terminal (targeting sequence)
truncated form of ferrochelatase two oligonucleotide primers were made
corresponding to a new 5` end with an ATG start site followed by
alanine 32 and the normal 3` end of yeast ferrochelatase (sense primer,
TCCATGGCACAAAAGAGATCACCCAC; antisense primer,
CTCTAGATTATCAAGTAGATTCGTCATTGCC). Polymerase chain reaction was
performed using 50 ng of Hem 15 cDNA as template, 1 mM of each
primer, 5 units of Taq polymerase (Promega) in a final volume
of 100 ml. The program was 30 cycles of 1 min at 95 °C, 1 min at 60
°C, and 2 min at 72 °C followed by a 7-min extension at 72
°C. A DNA fragment of 1100 base pairs was recovered following
agarose gel electrophoresis, gene-cleaned (Bio 101), and cloned into
pT7 Blue vector (Novagen) (pARK2). A second polymerase chain reaction
construct was made to isolate the yeast ferrochelatase promoter region
(240 base pairs total size) flanked by HindIII and SalI sites (sense primer, CATCAAGCTTGGTCACCGTAAGCCT; antisense
primer, GATCGTCGACTTTAAACGTTCTTT). The isolated fragment was digested
with HindIII and SalI and ligated into a HindIII/SalI-digested pARK2. The resulting plasmid,
pARK2.1, contained the yeast ferrochelatase promoter and all normal 5`
upstream sequences followed by an engineered ATG translational start
site at the beginning of the normal mature (proteolytically) processed
ferrochelatase. This entire region was excised by HindIII/BamHI digestion followed by ligation into
PRS-425. This yeast expression vector is named pARK3.
Procedures and Reagents
Mitochondria were isolated
from a homogenate of yeast spheroplasts by differential
centrifugation(12) , and further purification of mitochondria
was done by isopycnic density gradient. Mitoplasts were prepared by
treating the pure mitochondria with 0.12 mg of digitonin/mg of
protein(13) . The relative purity of each fraction was
ascertained from the specific activity of marker enzymes. Succinate
dehydrogenase was used as a marker enzyme for the inner membrane and
monoamine oxidase as an outer membrane marker enzyme. Ferrochelatase
activity was determined using iron and mesoporphyrin (Porphyrin
Products) as substrates(14) . Protein was quantitated using the
bicinchoninic acid procedure available from Pierce. Intact, Tween
20-treated mitochondria and mitoplasts were reacted with the sulfhydryl
reagent 4,4-maleimidylstilbene-2,2-disulfonic acid (DMSD) (
)freshly prepared at a concentration of 50 mM in
dimethyl sulfoxide as described previously (15) and then
assayed for ferrochelatase activity. Western blot analysis of crude
yeast cell extracts was done by published procedures (16) using
polyclonal rabbit anti-human ferrochelatase antibody.
and P450) were
decreased by almost 80%, c-type cytochromes were decreased
approximately 60% and a-type cytochromes only 40%. It is not
clear whether the differences in molecular and cellular distribution of
the synthesized heme are attributable to the lowered level of total
heme synthesized or the fact that in the truncated enzyme-containing
cells, the protoheme being formed is for some reason less available for
addition to apo b-type and apo c-type cytochromes
than it is for a-type cytochromes.
We thank R. Labbe-Bois for kindly supplying strains of S. cerevisiae and a plasmid containing yeast ferrochelatase.
We also acknowledge the help of T. A. Dailey in construction of some of
the plasmids used in this study.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
T. A. Dailey and H. A. Dailey Identification of [2Fe-2S] Clusters in Microbial Ferrochelatases J. Bacteriol., May 1, 2002; 184(9): 2460 - 2464. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. T. Magness, A. Tugores, and D. A. Brenner Analysis of ferrochelatase expression during hematopoietic development of embryonic stem cells Blood, June 1, 2000; 95(11): 3568 - 3577. [Abstract] [Full Text] [PDF] |
||||
![]() |
V.M. Sellers, T.A. Dailey, and H.A. Dailey Examination of Ferrochelatase Mutations That Cause Erythropoietic Protoporphyria Blood, May 15, 1998; 91(10): 3980 - 3985. [Abstract] [Full Text] [PDF] |
||||
![]() |
K.-S. Chow, D. P. Singh, J. M. Roper, and A. G. Smith A Single Precursor Protein for Ferrochelatase-I from Arabidopsis Is Imported in Vitro into Both Chloroplasts and Mitochondria J. Biol. Chem., October 31, 1997; 272(44): 27565 - 27571. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |