JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prasad, A. R. K.
Right arrow Articles by Dailey, H. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prasad, A. R. K.
Right arrow Articles by Dailey, H. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 31, Issue of August 04, pp. 18198-18200, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Effect of Cellular Location on the Function of Ferrochelatase (*)

(Received for publication, May 10, 1995)

Alur R. K. Prasad (§) Harry A. Dailey (¶)

From the Department of Microbiology and Center for Metalloenzyme Studies, University of Georgia, Athens, Georgia 30602-2605

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Ferrochelatase, the terminal enzyme of the heme biosynthetic pathway, is a nuclear encoded protein that is synthesized in the cytoplasm in a precursor form and then is translocated to the matrix side of the inner mitochondrial membrane. Since the product of the enzymatic reaction, protoheme IX, is utilized almost exclusively in the cytoplasmic compartment or on the cytoplasmic side of the inner mitochondrial membrane, it was of interest to determine if the intracellular location of ferrochelatase is crucial for its effective functioning. In a ferrochelatase-deficient strain of the yeast Saccharomyces cerevisiae vectors that coded for full-length ferrochelatase and a truncated form of the enzyme that lacked the mitochondrial targeting sequence were expressed. Both of these transformed cells produce approximately equal total amounts of ferrochelatase, as determined by enzyme assays and Western blot analysis, but only with the full-length construct was ferrochelatase properly localized. In cells containing the truncated construct, ferrochelatase activity was found in all membrane fractions but was not located on the matrix side of the inner mitochondrial membrane. Cells containing either construct produced heme, although the amount of heme synthesized by cells with the truncated construct was significantly less. Interestingly in cells with improperly localized ferrochelatase the amount of b-type cytochrome decreased by 80% as opposed to c- and a-type cytochromes where the decreases were only 60 and 40%, respectively.


INTRODUCTION

In animal cells the heme biosynthetic pathway is organized such that the first and last of the pathway enzymes are located inside the mitochondrion (see (1, 2, 3) ). Aminolevulinate synthase (EC 2.3.1.37), the first committed pathway enzyme that catalyzes the condensation of glycine and succinyl CoA to form 5-aminolevulinate, is a soluble matrix enzyme while the terminal enzyme, ferrochelatase (EC 4.99.1.1), which catalyzes the insertion of ferrous iron into protoporphyrin IX, is bound to the matrix side of the inner mitochondrial membrane. Aminolevulinate synthase (4, 5, 6) and ferrochelatase (7, 8) are nuclear encoded and synthesized in the cytoplasm and are then translocated into the mitochondrion and proteolytically processed into their mature and active form. While the location of aminolevulinate synthase in the matrix space may be explained by the presence of one of its substrates, succinyl-CoA, in this compartment, the localization of ferrochelatase to this area has been a curiosity since its product, protoheme IX (heme), is utilized mainly in either the cytoplasmic compartment in cytochromes b(5) and P450 or in respiratory cytochromes that are located on the cytoplasmic side of the inner mitochondrial membrane. In addition, the enzyme that catalyzes the preceding step in the pathway, protoporphyrinogen oxidase, is located on the opposite side of the membrane from ferrochelatase (9, 10) .

In the work described below we have approached the question of intracellular topology versus cellular function in the yeast Saccharomyces cerevisiae. In particular we have used a strain of yeast in which ferrochelatase is not present and have transformed this mutant with a plasmid that will code for ferrochelatase that will not be targeted to its usual inner membrane orientation. We then determined if improper topology of the enzyme has an effect on cellular heme biosynthesis. The data presented show that while heme synthesis is possible under these conditions, the amount of heme synthesized is markedly reduced and the cellular distribution of the heme is different from what is found in normal cells.


MATERIALS AND METHODS

Strains and Growth Conditions

S. cerevisiae strain 150-2B (hereafter referred to as wild type) and GG231-4A (hem 15-5) (ferrochelatase-deficient strain) as well as Hem-15 cDNA in pBluescript Sk(+) were kindly provided by R. Labbe-Bois, University of Paris VII(11) . PRS-425, a high copy number yeast shuttle vector, was obtained from C. Glover, University of Georgia. Yeast cells were cultivated at 30 °C with vigorous aeration. Complete medium contained 1% yeast extract, 1% bactopeptone, and 2% glucose (YPD). Minimal medium (YNBG) contained 0.67% yeast nitrogen base (without amino acids), 2% glucose, and the appropriate nutritional requirements at 135 mg/liter. Tween 80 (0.2%) and ergosterol (30 mg/liter), providing essential unsaturated fatty acids, and hemin (15 mg/liter (Porphyrin Products, Logan, UT) made up freshly in 0.1 N NaOH) were added for the growth of heme-deficient strains. Yeast transformation was performed by lithium acetate treatment(12) , and cells were plated on YNBG minimal media containing ampicillin and incubated at 30 °C for 72-96 h for the appearance of transformants. Cultures of 1 liter were grown for 72 h in minimal media with selectable markers at 30 °C with vigorous shaking (250 rpm).

Plasmid Construction

The plasmid pARK1 contained the full-length yeast ferrochelatase cDNA with promoter in the yeast vector PRS-425(11) . This was obtained by removing the HindIII/BamHI fragment from the pBluescript plasmid containing the XbaI-HindIII fragment from pHEM 15-1 and ligating it into the BamHI/HindIII site of PRS-425. To form the amino-terminal (targeting sequence) truncated form of ferrochelatase two oligonucleotide primers were made corresponding to a new 5` end with an ATG start site followed by alanine 32 and the normal 3` end of yeast ferrochelatase (sense primer, TCCATGGCACAAAAGAGATCACCCAC; antisense primer, CTCTAGATTATCAAGTAGATTCGTCATTGCC). Polymerase chain reaction was performed using 50 ng of Hem 15 cDNA as template, 1 mM of each primer, 5 units of Taq polymerase (Promega) in a final volume of 100 ml. The program was 30 cycles of 1 min at 95 °C, 1 min at 60 °C, and 2 min at 72 °C followed by a 7-min extension at 72 °C. A DNA fragment of 1100 base pairs was recovered following agarose gel electrophoresis, gene-cleaned (Bio 101), and cloned into pT7 Blue vector (Novagen) (pARK2). A second polymerase chain reaction construct was made to isolate the yeast ferrochelatase promoter region (240 base pairs total size) flanked by HindIII and SalI sites (sense primer, CATCAAGCTTGGTCACCGTAAGCCT; antisense primer, GATCGTCGACTTTAAACGTTCTTT). The isolated fragment was digested with HindIII and SalI and ligated into a HindIII/SalI-digested pARK2. The resulting plasmid, pARK2.1, contained the yeast ferrochelatase promoter and all normal 5` upstream sequences followed by an engineered ATG translational start site at the beginning of the normal mature (proteolytically) processed ferrochelatase. This entire region was excised by HindIII/BamHI digestion followed by ligation into PRS-425. This yeast expression vector is named pARK3.

Procedures and Reagents

Mitochondria were isolated from a homogenate of yeast spheroplasts by differential centrifugation(12) , and further purification of mitochondria was done by isopycnic density gradient. Mitoplasts were prepared by treating the pure mitochondria with 0.12 mg of digitonin/mg of protein(13) . The relative purity of each fraction was ascertained from the specific activity of marker enzymes. Succinate dehydrogenase was used as a marker enzyme for the inner membrane and monoamine oxidase as an outer membrane marker enzyme. Ferrochelatase activity was determined using iron and mesoporphyrin (Porphyrin Products) as substrates(14) . Protein was quantitated using the bicinchoninic acid procedure available from Pierce. Intact, Tween 20-treated mitochondria and mitoplasts were reacted with the sulfhydryl reagent 4,4-maleimidylstilbene-2,2-disulfonic acid (DMSD) (^1)freshly prepared at a concentration of 50 mM in dimethyl sulfoxide as described previously (15) and then assayed for ferrochelatase activity. Western blot analysis of crude yeast cell extracts was done by published procedures (16) using polyclonal rabbit anti-human ferrochelatase antibody.


RESULTS AND DISCUSSION

Ferrochelatase in eukaryotic cells is initially synthesized with a mitochondrial targeting sequence that is proteolytically removed as part of the energy-requiring translocation process(7, 8) . For most proteins that have been examined, complete removal of a targeting sequence from the precursor form of the protein results in improper cellular targeting of the modified protein (see (17) ). In the current work we have taken advantage of a ferrochelatase minus strain of S. cerevisiae to study the effect of altered cellular location of ferrochelatase on the ability of the cell to carry out normal heme biosynthesis.

To accomplish this two plasmids were constructed. In one, the complete cDNA sequence for yeast ferrochelatase and its promoter was placed into the yeast vector pRS-425, and in the second the mitochondrial targeting sequence was removed leaving an engineered ATG start site spaced at the same distance from the yeast promoter as was found in the original yeast ferrochelatase cDNA. Both of these plasmids were transformed into the ferrochelatase-deficient (Hem-15) strain GG231-4A. While growth of this strain without a ferrochelatase-coding plasmid results in petite cells, the presence of either the normal or leader minus ferrochelatase cDNA allowed for growth indistinguishable from wild type yeast. This observation alone suggested that either the altered ferrochelatase was somehow still targeted to its proper position on the matrix side of the inner mitochondrial membrane or that improperly targeted ferrochelatase could still carry out its physiological function at levels sufficient to support apparently normal growth.

Examination of the cellular distribution of normal versus truncated ferrochelatase clearly demonstrated that the plasmid-encoded normal enzyme was synthesized and properly targeted to the inner mitochondrial membrane (Table 1). The amino-terminal truncated enzyme, however, was found scattered throughout all cellular membrane fractions. No soluble ferrochelatase was detected in the isolated cytoplasmic fraction (data not shown). Although truncated ferrochelatase was found in all membrane fractions, the highest specific activity was found in isolated inner mitochondrial membranes. The explanation for this is not currently obvious but may be due to secondary, internal targeting signals. Western blot analysis of crude cell extracts showed that the amount of immunoreactive ferrochelatase protein is approximately equal in both yeast constructs (data not shown).



The orientation of normal and truncated ferrochelatases was examined with the membrane-impermeant sulfhydryl reagent DMSD(15) . By using this reagent on isolated intact and disrupted mitochondria and mitoplasts it is possible to determine if the ferrochelatase activity found associated with mitochondria is due to outward (cytoplasmic) or inward (matrix) facing ferrochelatase. A 24% drop in ferrochelatase activity was found in DMSD-treated normal mitochondria due to mechanical damage that occurred during organelle isolation. In DMSD-treated intact mitochondria from cells with truncated ferrochelatase, however, there was a 94% drop in ferrochelatase activity. Treatment of mitochondria with 1.0% Tween 20 to disrupt membrane integrity and DMSD resulted in a 98% drop in activity for both normal and truncated ferrochelatase. Similar data were found with mitoplasts. These data as presented in Table 2demonstrate that while the plasmid-encoded, full-length ferrochelatase is properly translocated to the matrix side of the inner membrane, the truncated form of ferrochelatase remains on the external side of the inner membrane.



Since it was observed that the cells containing improperly targeted ferrochelatase were capable of apparently normal, aerobic growth, it was of interest to determine cellular cytochrome levels. Data presented in Table 3compare the levels of three classes of yeast cytochromes from mutant cells containing a plasmid-encoded full-length ferrochelatase and cells containing a plasmid-encoded truncated ferrochelatase. For all classes of cytochromes the amount of cytochrome formed in cells with the truncated ferrochelatase was significantly lower than the levels in cells with normal ferrochelatase. Interestingly, however, the decreases observed were not uniform. While microsomal b-type cytochromes (e.g. cytochrome b(5) and P450) were decreased by almost 80%, c-type cytochromes were decreased approximately 60% and a-type cytochromes only 40%. It is not clear whether the differences in molecular and cellular distribution of the synthesized heme are attributable to the lowered level of total heme synthesized or the fact that in the truncated enzyme-containing cells, the protoheme being formed is for some reason less available for addition to apo b-type and apo c-type cytochromes than it is for a-type cytochromes.



In conclusion, we have demonstrated that the putative targeting, or leader, sequence of yeast ferrochelatase is necessary for proper topological distribution of ferrochelatase. Furthermore, it was shown that improperly localized ferrochelatase is still able to catalyze iron insertion for cellular heme synthesis but that it functions much less efficiently than the properly localized enzyme. This is made even more obvious when one recognizes that even with decreased levels of ferrochelatase on the cytoplasmic side of the inner mitochondrial membrane in the truncated constructs, the specific activity of the enzyme present is in excess of what would be required to synthesize normal levels of cellular heme if the enzyme were properly located. The last observation that the levels of individual classes of cytochromes vary in the truncated ferrochelatase construct is of interest and worthy of further investigation since this may yield clues about regulation of intracellular heme trafficking and allocation.


FOOTNOTES

*
This work was supported by National Institutes of Health Grants DK 32303 and DK 35898 (to H. A. D.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Current address: Division of Infectious Diseases, Jefferson Medical College, Thomas Jefferson University, 1020 Locus St., Philadelphia, PA 19107.

To whom correspondence should be addressed. Tel.: 706-542-2690; Fax: 706-542-2674; Dailey{at}BSCR.UGA.EDU.

^1
The abbreviation used is: DMSD, 4,4-maleimidylstilbene-2,2-disulfonic acid.


ACKNOWLEDGEMENTS

We thank R. Labbe-Bois for kindly supplying strains of S. cerevisiae and a plasmid containing yeast ferrochelatase. We also acknowledge the help of T. A. Dailey in construction of some of the plasmids used in this study.


REFERENCES

  1. Jordan, P. M. (1990) in Biosynthesis of Heme and Chlorophylls (Dailey, H. A., ed) pp. 55-121, McGraw-Hill Publishing Co., New York
  2. Dailey, H. A. (1990) in Biosynthesis of Heme and Chlorophylls (Dailey, H. A., ed) pp. 123-161, McGraw-Hill Publishing Co., New York
  3. Labbe-Bois, R., and Labbe, P. (1990) in Biosynthesis of Heme and Chlorophylls (Dailey, H. A., ed) pp. 235-285, McGraw-Hill Publishing Co., New York
  4. Yamauchi, K., Hayashi, N., and Kikuchi, G.(1980)FEBS Lett.115,15-18 [CrossRef][Medline] [Order article via Infotrieve]
  5. Ades, I. Z., and Harpe, K. G.(1981)J. Biol. Chem.256,9329-9333 [Abstract/Free Full Text]
  6. Borthwick, I. A., Srivastava, G., Day, A. R., Pirola, B. A., Snoswell, M. A., May, B. K., and Elliott, W. H.(1985)Eur. J. Biochem. 150,481-484 [Medline] [Order article via Infotrieve]
  7. Karr, S. R., and Dailey, H. A.(1988)Biochem. J.254,799-803 [Medline] [Order article via Infotrieve]
  8. Camadro, J. M., and Labbe, P.(1988)J. Biol. Chem.263,11675-11682 [Abstract/Free Full Text]
  9. Deybach, J. C., da Silva, V., Grandchamp, B., and Nordmann, Y.(1985)Eur. J. Biochem.149,431-435 [Medline] [Order article via Infotrieve]
  10. Ferreira, G. C., Andrew, T. L., Karr, S. W., and Dailey, H. A.(1988)J. Biol. Chem.263,3835-3839 [Abstract/Free Full Text]
  11. Labbe-Bois, R. (1990)J. Biol. Chem.265,7278-7283 [Abstract/Free Full Text]
  12. Daum, G., Bohni, P. C., and Schatz, G.(1982)J. Biol. Chem.257,13028-13033 [Abstract/Free Full Text]
  13. Greenawalt, J. W. (1974)Methods Enzymol.31,310-323 [Medline] [Order article via Infotrieve]
  14. Dailey, H. A., and Fleming, J. E.(1983)J. Biol. Chem.258,11453-11459 [Abstract/Free Full Text]
  15. Harbin, B. M., and Dailey, H. A.(1985)Biochemistry24,366-370 [CrossRef][Medline] [Order article via Infotrieve]
  16. Tobin, H., Staehelin, T., and Gordon, J.(1979)Proc. Natl. Acad. Sci. U. S. A.76,4350-4354 [Abstract/Free Full Text]
  17. Roise, D., and Schatz, G.(1988)J. Biol. Chem.263,4509-4511 [Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Bacteriol.Home page
T. A. Dailey and H. A. Dailey
Identification of [2Fe-2S] Clusters in Microbial Ferrochelatases
J. Bacteriol., May 1, 2002; 184(9): 2460 - 2464.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
S. T. Magness, A. Tugores, and D. A. Brenner
Analysis of ferrochelatase expression during hematopoietic development of embryonic stem cells
Blood, June 1, 2000; 95(11): 3568 - 3577.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
V.M. Sellers, T.A. Dailey, and H.A. Dailey
Examination of Ferrochelatase Mutations That Cause Erythropoietic Protoporphyria
Blood, May 15, 1998; 91(10): 3980 - 3985.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K.-S. Chow, D. P. Singh, J. M. Roper, and A. G. Smith
A Single Precursor Protein for Ferrochelatase-I from Arabidopsis Is Imported in Vitro into Both Chloroplasts and Mitochondria
J. Biol. Chem., October 31, 1997; 272(44): 27565 - 27571.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Prasad, A. R. K.
Right arrow Articles by Dailey, H. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Prasad, A. R. K.
Right arrow Articles by Dailey, H. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.