JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whitehead, I.
Right arrow Articles by Kay, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whitehead, I.
Right arrow Articles by Kay, R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 31, Issue of August 04, pp. 18388-18395, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Expression Cloning of lfc, a Novel Oncogene with Structural Similarities to Guanine Nucleotide Exchange Factors and to the Regulatory Region of Protein Kinase C (*)

(Received for publication, March 14, 1995; and in revised form, June 2, 1995)

Ian Whitehead (§) Heather Kirk Cristina Tognon Genny Trigo-Gonzalez Robert Kay (¶)

From the Department of Medical Genetics, University of British Columbia, and the Terry Fox Laboratory, British Columbia Cancer Agency, Vancouver, British Columbia V5Z 4E6, Canada

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

In order to identify cDNAs that can induce oncogenic transformation, a retroviral vector was used to transfer a library of cDNAs from the murine 32D hemopoietic cell line into NIH 3T3 fibroblasts. We have identified and recovered a provirus containing a 1.8-kilobase pair cDNA whose expression causes morphological transformation in NIH 3T3 cells. The transforming cDNA contains a complete open reading frame that encodes a protein (designated Lfc) with a region of sequence similarity to the product of the lbc oncogene. This region includes a domain that is characteristic of the CDC24 family of guanine nucleotide exchange factors in tandem with a pleckstrin homology (PH) domain. The Lfc protein is distinguished from Lbc by a 150-amino acid NH(2)-terminal extension that contains a cysteine- and histidine-rich domain similar to the diacylglycerol-binding site (zinc butterfly) found in protein kinase C. NH(2)- and COOH-terminal deletion analysis revealed that both the PH and putative guanine nucleotide exchange factor domains are required, but the zinc butterfly is dispensable, for transformation. Although the removal of the PH domain of the Lfc protein completely eliminated its ability to transform NIH 3T3 cells, replacement of this domain with an isoprenylation site restored all of its transforming activity. This suggests that a PH domain-dependent recruitment of the Lfc protein to the cellular membrane is a necessary step for cellular transformation. The lfc gene is expressed in a broad range of tissues as well as in a variety of hemopoietic and non-hemopoietic cell lines. Lfc appears to be a new member of a growing family of proteins that are likely to act as activators of Ras-like proteins in a developmental or cell-lineage specific manner.


INTRODUCTION

The Ras superfamily of GTP-binding proteins controls multiple aspects of information flow within eukaryotic cells, mediating such diverse physiological processes as vesicular transport, cytoskeletal organization, development, and cell proliferation(1, 2) . Ras GTPases function as binary switches, cycling between an active GTP-bound form and an inactive GDP-bound form(1, 3) . The proportion of active GTP-bound Ras present in a cell is determined by two enzymatically controlled reactions: the hydrolysis of RasbulletGTP to RasbulletGDP and the subsequent replacement of GDP with GTP following GDP dissociation. There are three families of proteins that control these reactions and thus coordinately regulate the activity of Ras(2) . GTPase-activating proteins (GAPs) (^1)increase the rate of hydrolysis of RasbulletGTP, a unidirectional reaction that increases the concentration of inactive GDP-bound Ras in a cell. Guanine nucleotide dissociation inhibitors decrease the rate of GDP release from Ras, thus maintaining Ras in an inactive state. Guanine nucleotide exchange factors (GEFs) accelerate the release of GDP from Ras, thus allowing GTP binding and Ras reactivation.

GEFs have been described for virtually all Ras GTPase families and can be conveniently grouped based on structural similarities(2) . One rapidly expanding group, consisting of CDC24(4) , Dbl(5) , Vav(6, 7) , Ect2(8) , Bcr(9) , Abr(10, 11) , RasGRF(12, 13) , Tiam(14) , Tim(15) , Lbc(16, 17) , Ost(18) , FGD1(19) , and Dbs(20) , share a common domain with the CDC24 protein of Saccharomyces cerevisiae. CDC24 has been shown, both genetically (4) and biochemically(21) , to have exchange activity on the Rho family GTPase, CDC42. These two proteins act in concert to regulate bud site assembly. Dbl, a mammalian homolog of CDC24, can also catalyze exchange on CDC42Hs as well as on RhoA, but not on Rac1 or TC10(22) . Lbc stimulates exchange activity on Rho proteins in vitro but not Cdc42Hs, Ras, or Rac(17) . The Vav protein has been reported to show opposite specificities to Dbl and Lbc, stimulating exchange activity on Ras family members but showing no activity toward Rho/Rac GTPases(23, 24, 25) . However, in other cellular systems, Vav appears to transform cells via Ras-independent mechanisms (26, 27) . Ect2 is unable to act as an exchange factor for Rho or Rac (even though it binds to both of these proteins) but has not been tested on Ras family members(8) . Ost has exchange activity on CDC42 and RhoA but not on Ha-Ras, Rap1A, TC10, RhoB, RhoC, RhoG, Rac1, or Rac2(18) . Two members of this group that have not been tested for GEF function, Bcr and Abr, have GAP activity toward Rho/Rac proteins(11, 28, 29) , but this is mediated by a GAP domain separate from their regions of CDC24 homology. CDC25, and its mammalian homolog SOS, form a second structurally related group of GEFs that have been shown to specifically act as exchange factors on Ras family members (for review, see (2) ). One member of the CDC25 family, RasGRF, also contains a CDC24-like domain, but this domain fails to show activity on CDC42Hs, Rac2, RhoA, RasH, or RalA(12) . The remaining members of the CDC24-related group (Dbs, Tim, Tiam, and FGD1) have not been tested for any exchange activities.

We have previously reported a retroviral-based expression system that permits the transfer of large libraries of cDNAs(30) . This system has been used to screen a cDNA library prepared from the 32D murine myeloid cell line for clones that have transforming activity when expressed in NIH 3T3 fibroblasts. NIH 3T3 cells are very sensitive to oncogenes that constitutively activate the Ras/Raf signaling pathway and has been particularly useful for identifying CDC24-related genes (i.e.vav, dbl, ost, dbs, ect2, tim, and lbc). We now report a new CDC24 family member, designated lfc, that was recovered in our screen.


MATERIALS AND METHODS

Cell Lines

32D cells (31) were cultured in Dulbecco's modified Eagle's medium (DMEM) containing 10% fetal bovine serum and 5 ng/ml murine interleukin-3. COS cells (32) were cultured in DMEM containing 10% fetal bovine serum. NIH 3T3 and C3H10T1/2 cells were obtained from American Type Culture Collection and cultured at low density in DMEM containing either 10% calf serum (NIH 3T3) or 10% fetal bovine serum (C3H10T1/2 and C127). GP+E-86 packaging cells (33) were cultured in DMEM containing 10% calf serum.

Vector Construction

The pCTV1, pCTV3, and pCTV3K retroviral vectors have been described previously(30) .

pCTV3H was derived from pCTV3 by: 1) replacing the SalI fragment with an oligonucleotide sequence that contains a HpaI site (the oligonucleotide sequence reads GTCGACAGTTAACCCGGGTCGAC), and 2) deleting the DraI(4415) to HpaI(4476) fragment.

pCTV3D was derived from pCTV3H by deleting the ScaI(3812) to StuI(4368) fragment containing the simian virus 40 (SV40) origin of replication.

pCTV3M was derived from pCTV3H by replacing the MluI(1460) to SalI(1481) fragment with an oligonucleotide sequence corresponding to the myristoylation site (MGQSLT) at the NH(2) terminus of the Rasheed sarcoma virus(34) . The oligonucleotide sequence reads: ACGCGTACCACCATGGGACAGAGCCTGACCAAAGGAGGTACCGTCGAC.

pCTV3P was derived from pCTV3H by replacing the SalI(1464) to SalI(1481) fragment with an oligonucleotide sequence corresponding to the isoprenylation sites (GCMSCKCVLS) at the COOH terminus of Ha-ras(35) . The oligonucleotide sequence reads: GTCGACAGTTAACGGATGCATGTCTTGCAAATGCGTGCTGTCCTAGTCGAC.

pCTV3HA was derived from pCTV3D by replacing the MluI(1460) to HpaI(1471) fragment with an oligonucleotide sequence that encodes the influenza hemagglutinin (HA) peptide sequence (amino acids 98-108: YPYDVPDYASL) immediately downstream of the start codon (36) . The oligonucleotide sequence reads: ACGCGTACCACCATGGAGGCCTATCCTTACGATGTGCCTGATTATGCATCTGGTTAAC.

pAX142 was derived from pAX114 (37) by replacing the hCMV IE promoter with the EF-1alpha promoter(38) .

cDNA Library Construction

mRNA was prepared from 32D cells by lysis in guanidinium isothiocyanate as described(39) , followed by binding to oligo(dT)-cellulose(40) . cDNA was synthesized with random sequence hexamers and Moloney murine leukemia virus reverse transcriptase using methods provided by the supplier of the polymerase (Life Technologies, Inc.). BstXI adapters (41) were added to the termini of the double-stranded cDNA, which was then ligated with BstXI-cut pCTV1 retroviral vector(30) . Escherichia coli MC1061/p3 (41) were transformed with the ligation mixture by electroporation and plated in soft agar(42) . Pooled plasmid DNA was purified from the transformed bacteria by alkaline lysis(43) , followed by digestion with RNase A and RNase T1 and precipitation with ethanol.

Production of Viruses and Infection of NIH 3T3 Cells

Plasmid DNA was introduced into the GP+E-86 ecotropic packaging cell line (33) by DEAE-dextran transfection(44) . A 6-cm dish of cells at 70% confluence was washed twice with DMEM containing 20 mM HEPES, pH 7.2 (DMEM/H). 2 ml of DMEM/H containing 2 µg/ml plasmid DNA and 0.2 mg/ml DEAE-dextran (M(r) 500,000) was then added to the cells, followed by a 1-h incubation at 37 °C in a humidified incubator with a 5% CO(2) atmosphere. The medium was then replaced with DMEM/H containing 10% calf serum and 0.2 mM chloroquine, and the incubation was continued for another 3 h, after which the medium was replaced with chloroquine-free medium. At 48 h after the beginning of the transfection, the medium was replaced with DMEM/H containing 5 mM sodium butyrate(45) . The medium was collected 24 h later and filtered. After the addition of an equal volume of fresh DMEM/H containing 10% calf serum and of Polybrene to a concentration of 10 µg/ml, the medium was added to a 10-cm dish containing 2 10^5 NIH 3T3 cells. The infecting medium was removed 18 h later, after which the NIH 3T3 cell culture was fed at 3-day intervals with DMEM/H, 10% calf serum.

Recovery of cDNAs from Infected Cells

Genomic DNA was prepared from infected NIH 3T3 cell clones by proteinase K digestion, phenol extraction, and ethanol precipitation. 25-µl PCR reactions contained the following components: 20 mM Tris-Cl, pH 8.75, 10 mM KCl, 10 mM ammonium sulfate, 2 mM MgCl(2), 0.1% Triton X-100, 0.1 mg/ml bovine serum albumin, 0.2 mM each of dATP, dCTP, dGTP, and dTTP, 100 ng each of 5` and 3` primers, 300 ng of template genomic DNA, and 1.25 units of Pfu DNA polymerase (Stratagene, La Jolla, CA). Amplification was performed with the following thermal cycles: 95 °C for 60 s 1; 95 °C for 60 s, 50 °C for 30 s, 72 °C for 180 s 30. The amplified DNA was extracted with phenol:chloroform (1:1), ethanol-precipitated, and digested with MluI and BsiWI (restriction enzymes with recognition sites that flank the cDNA within the integrated provirus). The amplified cDNAs were purified by agarose gel electrophoresis, electro-eluted and ethanol-precipitated, and cloned by ligation into pCTV3 and transformation of E. coli MC1061/p3.

Isolation of 5` Extended cDNAs

A pair of primers matching the 5` end of the TL18-9c1 cDNA was synthesized and used in conjunction with primers matching sites in the vector that flank the 5` end of the cDNA insertion. Nested PCR reactions were performed on plasmid DNA of the cDNA library, using Pfu DNA polymerase and the cycling parameters listed above. Amplified cDNA products were gel-purified and cloned into pBluescript KS+ (Stratagene) for sequence determination. No discrepancies in sequence were found in the regions of overlap of the TL18-9c1 cDNA and the various PCR products.

Construction of TL18-9c1 Derivatives

cDNAs encoding truncated forms of the Lfc protein were generated by restriction enzyme digestion or PCR amplification of the TL18-9c1 cDNA as indicated below with the position of termini in the full-length Lfc cDNA sequence in parentheses. In the cases of COOH-terminal truncation of the coding region, insertion into the CTV3 vector resulted in the placement of a TAG stop codon in-frame and within 5-10 bp downstream of the cDNA. The D13 construct utilized an artificial stop codon that had been introduced by PCR. For NH(2)-terminal truncations, the junctions were chosen to ensure that the next ATG codon was in-frame and in a good context for initiation of translation. The D6, D7, D8, D9, and D13 constructs utilized artificial start codons that had been introduced by PCR.

cDNAs encoding modified forms of the Lfc protein fused in-frame to isoprenylation sites were made by subcloning the constructs specified below into the HpaI site of the pCTV3P vector (nucleotide positions are based upon the full-length Lfc cDNA). The P3, P6, and P11 constructs utilized the pCTV3P stop codon (P3: 5` of D6 to 1503; P6: 5` of D6 to 1839; P11: 5` of D8 to 1839).

The My2 cDNA encodes a modified form of the Lfc protein fused in-frame to a myristoylation site. It was made by subcloning D13 into the SalI site of pCTV3M (the nucleotide position is based upon the full-length Lfc cDNA). The My2 construct utilized the pCTV3M start codon (My2: 385 to 3` end of D13).

Constructs that place an in-frame epitope from the HA of influenza virus at the NH(2) terminus of Lfc sequences were made by subcloning the constructs specified below into the HpaI site of pCTV3HA (the nucleotide position is based upon the full-length Lfc cDNA). D13bulletHA and P3bulletHA utilized the pCTV3HA start codon. Two additional constructs, pAX142/D13bulletHA and pAX142/P3bulletHA, were made by replacing the MluI-ClaI fragment of pAX142 with the MluI-ClaI fragments of D13bulletHA and P3bulletHA, respectively (D13bulletHA: 342 to 3` end of D13; P3bulletHA: 342 to 3` end of P3).

PCR-directed mutagenesis was used to make the following amino acid replacement in TL18-9c1 (M3: tryptophan (TGG) 1807-1809 to leucine (TTG))

All fragments that were synthesized by PCR were sequenced in their entirety to confirm that only specified mutations had occurred.

COS Cell Transfection

pAX142/P3bulletHA or pAX142/D13bulletHA plasmid DNA was introduced into the COS cell line by DEAE-dextran transfection(44) . For a 10-cm tissue culture dish, a solution was prepared with 10 mg of DNA diluted with 2 ml of TS (TS = 1 mM MgCl(2), 1 mM CaCl(2) in TD (TD = 140 mM NaCl, 5 mM KCl, 0.5 mM NaH(2)PO(4), 25 mM Tris, pH 7.5)). Then an equal volume of TS containing 1 mg/ml DEAE-Dextran was added. COS cells (about 70% confluent) were washed with TS, followed by TD. The DNA solution was added and the cells were incubated at 37 °C for 50 min. The solution was discarded, and the cells were incubated with 10 ml of TS containing 20% glycerol for 2 min, swirling every 30 s. The cells were washed with TS, then with DMEM containing 5% fetal bovine serum (Life Technologies, Inc.) then incubated with 20 ml of DMEM containing 5% fetal bovine serum and 200 µM chloroquine, at 37 °C for 2 h. The chloroquine-containing media was replaced with DMEM (5% fetal bovine serum), and the cells were incubated at 37 °C for 48 h. Cells were washed with PBS and then lifted from the dishes by incubating with PBS containing 2 mM EDTA. After centrifuging at 1000 rpm for 5 min, the cell membrane was lysed by resuspending the cells in PBS containing 1% Nonidet P40 (Sigma) and incubating on ice for 10 min. The suspension was spun at 13,000 rpm for 5 min. The supernatant was used in Western blot analysis.

Western Blot Analysis

Cell lysates were boiled for 2 min with SDS sample buffer. Proteins were separated on a 12.5% SDS-polyacrylamide gel and then electroblotted onto Immobilon polyvinylidene difluoride membrane (Millipore) at 90 V for 1 h at 2 °C using 20 mM Tris, 150 mM glycine, 20% methanol, pH 8.0, as transferring buffer. The membrane was then blocked overnight with PBS containing 5% bovine serum albumin and 0.02% sodium azide. Blots were washed four times for 10 min with TBST (25 mM Tris, 2.7 mM KCl, 137 mM NaCl, 0.05% Tween 20, pH 7.4) and then incubated for 80 min at 23 °C with 2 µg/ml mouse anti-HA (12CA5) antibody (Boehringer Mannheim), 1% bovine serum albumin in TBST. Blots were washed as before and then incubated for 45 min with a 1:4000 dilution of donkey anti-mouse IgG peroxidase conjugate (Bio/Can). Blots were again washed and immunoreactive bands were detected by incubating the blot with LumiGLO substrate (KPL) solution for 1 min and then exposing it to Kodak (X-Omat®) AR film.

Sequence Analysis and Comparisons

cDNA sequences were determined by a chain termination procedure using Vent thermostable polymerase (New England Biolabs, Beverley, MA). Continuous sequences were determined for both strands. Data base comparisons were performed with the MPSearch program, using the Blitz server operated by the European Molecular Biology Laboratory (Heidelberg, Germany). The sequence similarity analysis of Lfc and Lbc was performed with the Bestfit program of the Genetics Computer Group (Madison, WI).

Hybridization Analysis of RNA and DNA

Total cellular RNA, mRNA, and genomic DNA were prepared as described above. RNA was separated by electrophoresis through agarose gels containing 0.66 M formaldehyde and transferred to Zeta-Probe nylon membranes (Bio-Rad). Hybridization and high stringency washing were performed as described(46) , using DNA probes labeled with P by extension of random sequence primers(47) .


RESULTS

Oncogenic Selection and Recovery of the TL18-9c1 cDNA Clone

We have screened a cDNA library prepared from the 32D murine myeloid cell line for clones that have transforming activity when expressed in NIH 3T3 fibroblasts. The retroviral-based expression cloning system that was employed in this screen has been described in detail elsewhere(30) . The 32D library was constructed in the retroviral pCTV-1 vector, converted into a library of viral clones by transient transfection of the ecotropic packaging cell line GP+E-86, and transferred to NIH 3T3 cells by infection. Numerous transformed foci arose when the cells reached confluence. One of these cell clones, TL18-9, was isolated, expanded, and examined by PCR for the presence of proviral inserts. A single provirus-derived fragment of approx2100 bp was amplified consisting of a cDNA insert (approx1800 bp) and a linked 300-bp supF gene. This fragment was purified and recovered by insertion into the retroviral vector pCTV3K using the supF gene as a selectable marker for E. coli transformation. The recovered cDNA, designated TL18-9c1, was converted to retroviral form and retested for transforming activity in the NIH 3T3 and C3H10T1/2 cell lines. The NIH 3T3 cells became very refractile within 3 days and continued to proliferate rapidly, forming large dense foci after confluence had been reached (Fig. 1). Normally, NIH 3T3 cells form a single monolayer and become quiescent at confluence. No transforming activity was detected in the C3H10T1/2 cell line (data not shown).


Figure 1: Transforming activity of the TL18-9c1 cDNA clone. NIH 3T3 cells were infected at low density with CTV3 retroviral vector (A) or CTV3 carrying the full-length TL18-9c1 cDNA (B). Cell cultures in 35-mm diameter wells were stained with methylene blue 5 days after reaching confluence.



TL18-9c1 Encodes a Protein with Structural Similarities to the CDC24 Family of GEFs

The sequence of the TL18-9c1 cDNA contained an MluI site at its 5` end that did not correspond to the site that had been inserted into the pCTV vectors for use in the recovery of proviral inserts(30) . Since this presumably represented an internal MluI site, cDNAs with extended 5` ends were recovered to obtain the sequence of a full-length TL18-9c1 cDNA. PCR screening of four libraries derived from cell lines that express the TL18-9c1 mRNAs produced fragments that extended the 5` end of TL18-9c1 by at most only an additional 43 bp. The combined cDNA sequence had a length of 1882 bp with a single, complete ORF starting with an ATG codon at nucleotide 121 (Fig. 2). This codon is in a moderately good context for translation initiation with a purine (A) at -3 and a pyrimidine (T) at +4(48) . Although there are no additional initiation or termination codons upstream of this site, the sequence is highly GC-rich (>75%) and therefore is unlikely to be coding. Assuming that translation starts at nucleotide 121, the full-length cDNA would encode a protein of 573 amino acids with a predicted molecular mass of 69 kDa.


Figure 2: Sequence of the Lfc cDNA and encoded protein. The presumed translation product, indicated in single-letter code, is shown below the cDNA sequence. The 5` boundary of the original TL18-9c1 cDNA is indicated by an arrow above the nucleotide sequence. The boundaries of the various derivatives of the full-length cDNA (D1, P3, etc.) are similarly indicated. The presumptive initiation codons for the TL18-9c1 cDNA and its derivatives are indicated by the arrows below the translation sequence (D4tln, etc.). The zinc butterfly, GEF-H, and PH domains are indicated by the singleunderline, dashedunderline, and doubleunderline, respectively. The amino acid substitution in the M3 mutation is indicated below the sequence.



The protein encoded by the TL18-9c1 cDNA is not highly similar to any sequences that are currently in the data bases and therefore is the translation product of a novel gene. However, Lfc does have distinct similarities to the CDC24 family of GEFs and in particular to Lbc, a CDC24 family member isolated from chronic myeloid leukemia cells. This similarity includes a complete CDC24 family GEF homology (GEF-H) domain in tandem with a pleckstrin homology (PH) domain. We have designated this new CDC24 family member Lfc (Lbc's first cousin). Over the 414 amino acid region of similarity between Lbc and Lfc, 50% of the residues are identical and only three gaps need to be inserted in the sequences to obtain this optimal alignment (Fig. 3).


Figure 3: Comparison of the amino acid sequences of Lfc and Lbc. The sequences between residues 164 and 573 of Lfc and between 1 and 415 of Lbc were optimally aligned on the basis of residue identity (verticallines) and similarity (colons).



Lfc has 163 amino acids extending beyond the sequences homologous to the NH(2) terminus of Lbc. This unique NH(2)-terminal sequence has no extended similarities to other proteins but does contain a histidine- and cysteine-rich motif (zinc butterfly; residues 40-86), which has been described in protein kinase C as well as in several known effectors of the Ras superfamily (Fig. 4).


Figure 4: Comparison of cysteine-rich domains from regulators of the Ras super-family to the regulatory region of PKC. mPKC and mVav are from mouse; c-Raf and n-chimaerin are from human (sequences taken from (71) ). mPKC contains two zinc fingers, and the corresponding zinc finger is indicated in parentheses. Conserved cysteines and histidines are boxed.



Domains Required for Transformation in the Lfc Protein

Since the transforming TL18-9c1 cDNA contains the presumptive Lfc ORF in its entirety, the full-length Lfc protein has transforming activity in NIH 3T3 cells. A series of deletions were made in the 5` end of the TL18-9c1 cDNA to determine the boundary of the sequences that are required for transforming activity (Fig. 5). Deletions that precisely bracket the NH(2)-terminal zinc butterfly have no effect on the transforming activity of the Lfc protein, indicating that this domain is not required for transformation. Deletions that leave the GEF-H domain intact had strong transforming activity, whereas deletions that removed as few as 3 residues from the NH(2) terminus of the GEF-H domain were no longer transforming in NIH 3T3 cells. A truncation of the 3` end of the Lfc cDNA that removed 21 residues(552-573), 18 of which were from the PH domain, was also no longer transforming in NIH 3T3 cells. In addition, a point mutation in the conserved tryptophan residue (Trp Leu) in the PH domain also abolished the ability of Lfc to transform NIH 3T3 cells. Thus, both the GEF-H domain and the PH domain are required for transformation, whereas the NH(2)-terminal zinc butterfly is not.


Figure 5: Transforming activities of full-length, truncated, and mutated Lfc cDNAs. The domain structure of the full-length Lfc protein is illustrated in the upper line (ZB, zinc butterfly; GEF-H, CDC24 GEF homology domain; PH, pleckstrin homology domain), and the lines below indicate the regions of the protein included in predicted translation products of the various cDNA derivatives. Boundaries of domains and predicted translation products are indicated with numbers referring to amino acid positions in the full-length protein as shown in Fig. 2. The symbols on the right indicate whether the cDNA had (+) or lacked(-) transforming activity when expressed in NIH 3T3 cells following their infection with retroviruses derived from the CTV3 vector carrying the indicated cDNA. The P3, P6, P10, and P11 constructs were fused to an isoprenylation site as indicated by a filledblackcircle. The My2 construct was fused to a myristoylation site as indicated by a filledblackbox. D13 and P3 were tested with and without HA tags at their NH(2) terminus.



It has been suggested previously that PH domains may be important for membrane localization of proteins(49, 50) , although the specificity of this interaction is not clear. In order to test whether the activity of the PH domain in the Lfc protein could be replaced by a membrane localization signal, the isoprenylation site from N-Ras or the myristoylation site from the Rasheed sarcoma virus were fused to TL18-9c1 derivatives. While removal of the complete PH domain, or any portion thereof, eliminated the transforming activity of Lfc in NIH 3T3 cells, replacement of the domain with an isoprenylation site completely restored transforming activity. A form of Lfc that contains an isoprenylation site and a deletion that encroaches 3 amino acids into the NH(2) terminus of the GEF-H domain were not transforming. This indicates that transformation potentiated by prenylation of Lfc is still dependent on the function provided by the GEF-H domain. To ensure that Lfc derivatives that lack a PH domain were being expressed, the HA1 epitope of influenza virus hemagglutinin was fused to the NH(2) terminus of D13 (D13bulletHA) as well as to the prenylated derivative P3 (P3bulletHA). The epitope tag had no discernible effect on the respective transforming activities of these Lfc derivatives in NIH 3T3 cells. Western blot analysis of lysates from COS or NIH 3T3 cells that had been transfected with D13bulletHA or P3bulletHA confirmed that proteins of the expected sizes (46.3 and 45.5 kDa, respectively) were present in the Lfc-transfected or -infected cells (Fig. 6). In contrast to the results obtained with the isoprenylation site, a myristoylation site was not able to compensate for loss of the PH domain.


Figure 6: Expression of epitope-tagged Lfc proteins. Epitope tagged proteins were expressed in COS cells and in NIH 3T3 cells, and detected by Western blotting, as described under ``Materials and Methods.'' COS cells were transfected as follows: Lane1, no transfection; lane2, with pAX142/P3bulletHA; lane3, with pAX142/D13bulletHA. NIH 3T3 cells were infected as follows: lane4, with CTV3H; lane5, with P3bulletHA; lane6, with D13bulletHA. Loading in lanes4 and 6 were estimated to be 10-fold and 5-fold less than lane5, respectively. Loading was estimated by the intensity of the endogenous bands.



Expression of Lfc

A variety of hemopoietic and non-hemopoietic cell lines were examined for expression of the lfc gene (Fig. 7A). A probe derived from the full-length TL18-9c1 cDNA detected a major 3.7-kb mRNA in all cell lines, albeit with considerable variation in amount. In addition, this probe detected a number of less abundant mRNAs of different sizes, e.g. at 4.5 and 3.3 kb.


Figure 7: Expression of Lfc mRNAs. RNA was separated by electrophoresis, transferred to nylon membranes, and hybridized with P-labeled TL18-9c1 cDNA probes. Size markers are denatured DNA fragments of the indicated lengths that hybridize to the probe. PanelA, total RNA from the indicated cell lines: 32D, GM979, DA-3, and B6SutA(1) (myeloid cell lines), Ba/F3 and A20 (B cell line), C3H10T1/2 and NIH 3T3 (fibroblast cell lines), MBL2 (T cell line), and P388 (macrophage cell line). PanelB, poly(A) RNA from the indicated tissues. Ethidium bromide-stained gels are shown below the autoradiograms to show quantities of RNA.



With the exception of liver, the major 3.7-kb mRNA was detected in all tissues examined (Fig. 7B). Levels were high in hemopoietic tissues (thymus, spleen, and bone marrow) as well as in kidney and lung. The latter tissue also expresses a unique assortment of mRNA forms, ranging from 4.5 to about 1 kb.

Structure and Conservation of the lfc Gene

Restriction enzyme digestions of genomic DNA isolated from 32D cells and normal mouse liver produced the same pattern of hybridization with a probe derived from the Lfc cDNA (Fig. 8). This indicates that the cDNA cloned from the 32D library was not derived from a gene that had undergone any gross rearrangements in the 32D cell line. DNA fragments hybridizing to the probe were also readily detected in human genomic DNA, indicating that the lfc gene was conserved during the evolutionary divergence of humans and mouse.


Figure 8: Structure of the lfc gene. DNA isolated from 32D cells, murine liver, or human peripheral blood leukocytes were digested with the indicated restriction enzymes, separated by electrophoresis, transferred to nylon membrane, and hybridized with the P-labeled TL18-9c1 cDNA.




DISCUSSION

We have cloned a cDNA from the murine 32D hemopoietic cell line that causes strong transformation when expressed in NIH 3T3 fibroblasts. Lfc, the novel protein encoded by this cDNA, contains a domain that is characteristic of the CDC24 family of guanine nucleotide exchange factors (GEF-H) in tandem with a PH domain. Lfc is closely related to Lbc, a CDC24 family GEF that specifically catalyzes exchange on Rho GTPases(17) . The region of similarity between Lbc and Lfc includes the complete GEF-H and PH domains. Expression of the Lfc cDNA with deletions or point mutations revealed a minimum requirement for intact PH and GEF-H domains for cellular transformation. Since the exchange activity of the CDC24 family member Dbl has been localized to the GEF-H domain(22) , the transformation induced by Lfc may be a consequence of increased GEF activity in the recipient cell line. Four members of the CDC24 family (CDC24, Ost, Lbc, and Dbl) have exchange activity on the Rho family GTPases(17, 18, 22, 51, 52) , and an activated mutant of RhoA (RhoA(63L)) causes transformation when expressed in NIH 3T3 cells with morphology similar to that induced by Lfc expression(27) . Although Ras family members that are constitutively bound to GTP also transform NIH 3T3 cells, it is unlikely that the transformation of NIH 3T3 cells by CDC24 family members is mediated by GEF activity on Ras family members. There is a clear distinction between induced morphologies by Ras and by CDC24-related proteins, and GTP-bound Ras is absent in NIH 3T3 cells transformed by CDC24 family members(26, 27) . CDC24 family members such as Lfc are presumed to transform NIH 3T3 cells by activating one or a combination of Rho-like proteins, either directly through their GEF activity or perhaps indirectly by interfering with antagonists.

Our observation that the Lfc PH domain can be functionally replaced by an isoprenylation site suggests that the recruitment of the Lfc protein to the cellular membrane is a necessary step for cellular transformation. This may involve a direct binding of the PH domain of Lfc to membrane lipids or an interaction between the PH domain of Lfc and a membrane-bound protein. Our finding that myristate is not able to substitute for a PH domain suggests that PH domains and a COOH-terminal prenyl lipid anchor share a common property that myristoylation at the NH(2) terminus is not able to mimic. This may simply be a requirement for membrane localization proximal to the COOH terminus rather than the NH(2) terminus of Lfc. Alternatively, prenylation may target Lfc to a membrane domain where it is effective as a GEF, while myristoylation does not. Another protein that contains a PH domain, beta-adrenergic receptor kinase, is also dependent upon membrane localization to maintain its cellular function(53, 54) . Although the removal of the PH domain from beta-adrenergic receptor kinase reduces its kinase activity to basal levels, replacement of this domain with an isoprenylation site restores most of its activity(53) . Our findings support the proposal that PH domains may provide an alternative mechanism to post-translational addition of lipid molecules for membrane localization(49) . It has been shown recently that the membrane targeting of SOS (a CDC25 family GEF) by the introduction of myristoylation or farnesylation sites is sufficient for activating the Ras signaling pathway(55) .

A small NH(2)-terminal deletion that removes the zinc butterfly has no effect on the transforming activity of the Lfc protein. In PKC, this motif has been implicated both in the coordination of zinc (56, 57, 58, 59) and in phospholipid-dependent phorbol ester/diacylglycerol binding(60, 61, 62, 63, 64) . It has been proposed that the coordination of zinc in this region is necessary to stabilize a structural motif that is required for lipid interactions and phorbol ester binding(56, 57, 58, 59) . Diacylglycerol/phorbol ester binding activates PKCs and causes them to become tightly associated with the cellular membrane(60, 63, 64, 65) . Homologous cysteine-rich motifs have also been described in one other serine/threonine kinase, Raf(66) ; in diacylglycerol kinases(56, 67) ; in a Caenorhabditis gene of unknown function, unc-13(68, 69) ; and in two proteins that modify the activity of G-proteins, n-chimaerin (61) and Vav(70) . Although the coordination of zinc is a property shared by all of these domains, only the domains found in PKCs, unc-13, and n-chimaerin are capable of binding phorbol esters(56, 61, 66, 69, 71) . Unlike the Lfc protein, the structural integrity of the zinc butterfly must be maintained in the Vav protein in order for it to retain its transforming activity in NIH 3T3 cells(72) . Thus, in at least one respect, the transformation of NIH 3T3 cells by Vav and Lfc appears to be mechanistically different. Although neither zinc or phorbol ester binding has yet been demonstrated for the Lfc protein, the identification of a second CDC24 family member with a zinc butterfly motif suggests that lipid-dependent binding may be a more general mechanism for modulating the activity of this family of G protein regulators.

With the exception of liver tissue, Lfc mRNAs were detected in all the cell lines and tissues that were examined. This general pattern of expression does not correspond well to that of either Lbc or Vav, both of which appear to be much more restricted in their expression. Multiple sizes of mRNAs hybridizing to the Lfc probe were detected, and the relative abundances of these varied considerably among cell lines and tissues. However, we have not determined whether the different mRNAs detected are all derived from the lfc gene versus very closely related genes. Under the hybridization conditions used, such genes would have to be much more closely related to lfc than is lbc. Differential splicing at the lfc locus is the most likely source of the multiple mRNAs, and these could encode variant forms of the protein which in turn may confer some tissue specificity on its functions.

The ability of the Lfc protein to trigger deregulated growth in NIH 3T3 cells appears to be cell type-specific with no such activity detected in C3H10T1/2 cells. In this respect, Lfc differs from the CDC24 family member Dbs, which is transforming in both NIH 3T3 and C3H10T1/2 cell lines(20) . We have recently observed that Lfc or Dbs expression is not sufficient to confer the phenotype of growth factor independence on the IL-3dependent Ba/F3 cell line. (^2)We are currently investigating the role of Lfc in regulating hemopoietic cell proliferation and whether the cell type specificity of Lfc and other CDC24 family members can be attributed to specific functional domains.


FOOTNOTES

*
This work was funded by grants from the Medical Research Council of Canada and the British Columbia Health Research Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank®/EMBL Data Bank with accession number(s) U28495[GenBank].

§
Supported by a fellowship from the Leukemia Research Foundation.

Supported by scholarships from British Columbia Health Research Foundation and Medical Research Council of Canada. To whom correspondence should be addressed: Dept. of Medical Genetics/Terry Fox Laboratory, 601 W. 10th Ave., Vancouver, British Columbia V5Z 4E6, Canada. Tel.: 604-877-6070; Fax: 604-877-0712; robert{at}terryfox.ubc.ca.

^1
The abbreviations used are: GAP, GTPase-activating protein; GEF, guanine nucleotide exchange factor; DMEM, Dulbecco's modified Eagle's medium; HA, hemagglutinin; PCR, polymerase chain reaction; PBS, phosphate-buffered saline; bp, base pair(s); kb, kilobase pair(s); PH, pleckstrin homology.

^2
C. Tognon and R. Kay, unpublished observations.


ACKNOWLEDGEMENTS

We thank Arthur Bank for providing the GP+E-86 packaging cell line.


REFERENCES

  1. Bourne, H. R., Sanders, D. A., and McCormick, F.(1991)Nature349,117-127 [CrossRef][Medline] [Order article via Infotrieve]
  2. Boguski, M. S., and McCormick, F.(1993)Nature366,643-654 [CrossRef][Medline] [Order article via Infotrieve]
  3. Bourne, H. R., Sanders, D. A., and McCormick, F.(1990)Nature348,125-132 [CrossRef][Medline] [Order article via Infotrieve]
  4. Drubin, D. G. (1991)Cell65,1093-1096 [CrossRef][Medline] [Order article via Infotrieve]
  5. Eva, A., Vecchio, G., Rao, C. D., Tronick, S. R., and Aaronson, S. A.(1988) Proc. Natl. Acad. Sci. U. S. A.85,2061-2065 [Abstract/Free Full Text]
  6. Katzav, S., Martin-Zanca, D., and Barbacid, M.(1989)EMBO J.8,2283-2290 [Medline] [Order article via Infotrieve]
  7. Adams, J. M., Houston, H., Allen, J., Lints, T., and Harvey, R.(1992) Oncogene7,611-618 [Medline] [Order article via Infotrieve]
  8. Miki, T., Smith, C. L., Long, J. E., Eva, A., and Fleming, T. P.(1993)Nature 362,462-465 [CrossRef][Medline] [Order article via Infotrieve]
  9. Hariharan, I. K., and Adams, J. M.(1987)EMBO J.6,115-119 [Medline] [Order article via Infotrieve]
  10. Tan, E.-C., Leung, T., Manser, E., and Lim, L.(1993)J. Biol. Chem. 268,27291-27298 [Abstract/Free Full Text]
  11. Heisterkamp, N., Kaartinen, V., van Soest, S., Bokoch, G. M., and Groffen, J. (1993)J. Biol. Chem.268,16903-16906 [Abstract/Free Full Text]
  12. Shou, C., Farnsworth, C. L., Neel, B. G., and Feig, L. A.(1992)Nature 358,351-354 [CrossRef][Medline] [Order article via Infotrieve]
  13. Cen, H., Papageorge, A. G., Zippel, R., Lowy, R. D., and Zhang, K.(1992)EMBO J.11,4007-4015 [Medline] [Order article via Infotrieve]
  14. Habets, G. G. M., Scholtes, E. H. M., Zuydgeest, D., van der Kammen, R. A., Stam, J. C., Berns, A., and Collard, J. G.(1994)Cell 77,537-549 [CrossRef][Medline] [Order article via Infotrieve]
  15. Chan, A. M.-L., McGovern, E. S., Catalano, G., Fleming, T. P., and Miki, T. (1994)Oncogene9,1057-1063 [Medline] [Order article via Infotrieve]
  16. Toksoz, D., and Williams D. A.(1994)Oncogene9,621-628 [Medline] [Order article via Infotrieve]
  17. Zheng, Y., Olson, M. F., Hall, A., Cerione, R. A., and Toksoz, D.(1995)J. Biol. Chem.270,9031-9034 [Abstract/Free Full Text]
  18. Horii, Y., Beeler, J. F., Sakaguchi, K., Tachibana, M., and Miki, T.(1994) EMBO J.13,4776-4786 [Medline] [Order article via Infotrieve]
  19. Pasteris, N. G., Cadle, A., Logie, L. J., Porteous, M. E. M., Schwartz, C. E., Stevenson, R. E., Glover, T. W., Wilroy, R. S., and Gorski, J. L.(1994) Cell79,669-678 [CrossRef][Medline] [Order article via Infotrieve]
  20. Whitehead, I., Kirk, H., and Kay, R.(1995)Oncogene10,713-721 [Medline] [Order article via Infotrieve]
  21. Zheng, Y., Cerione, Y., and Bender, A.(1994)J. Biol. Chem.269,2369-2372 [Abstract/Free Full Text]
  22. Hart, M. J., Eva, A., Zangrilli, D., Aaronson, S. A., Evans, T., Cerione, R. A., and Zheng, Y.(1994)J. Biol. Chem.269,62-65 [Abstract/Free Full Text]
  23. Gulbins, E., Coggeshall, M., Baier, G., Katzav, S., Burn, P., and Altman, A.(1993) Science260,822-824 [Abstract/Free Full Text]
  24. Gulbins, E., Coggeshall, K. M., Langlet, C., Baier, G., Bonneyfoy-Bernard, N., Burn, P., Wittinghofer, A., Katzav, S., and Altman, A.(1994) Mol. Cell. Biol.14,906-913 [Abstract/Free Full Text]
  25. Gulbins, E., Coggeshall, M. K., Baier, G., Telford, D., Langlet, C., Baier-Bitterlich, G., Bonnefoy-Berard, N., Burn, P., Wittinghofer, A., and Altman, A. (1994)Mol. Cell. Biol.14,4749-4758 [Abstract/Free Full Text]
  26. Bustelo, X. R., Suen, K.-L., Leftheris, K., Meyers, C. A., and Barbacid, M.(1994) Oncogene9,2405-2413 [Medline] [Order article via Infotrieve]
  27. Khosravi-Far, R., Chrzanowska-Wodnicka, M., Solski, P. A., Eva, A., Burridge, K., and Der, C. J.(1994)Mol. Cell. Biol.14,6848-6857 [Abstract/Free Full Text]
  28. Diekmann, D., Brill, S., Garrett, M. D., Totty, N., Hsuan, J., Monfries, C., Hall, C., Lim, L., and Hall, A.(1991)Nature351,400-402 [CrossRef][Medline] [Order article via Infotrieve]
  29. Hart, M. J., Maru, Y., Leonard, D., Witte, O. N., Evans, T., and Cerione, R. A.(1992) Science258,812-815 [Abstract/Free Full Text]
  30. Whitehead, I., Kirk, H., and Kay, R.(1995)Mol. Cell. Biol.15,704-710 [Abstract]
  31. Greenberger, J. S., Sakakeeny, M. A., Humphries, R. K., Eaves, C. J., and Eckner, R. J. (1983)Proc. Natl. Acad. Sci. U. S. A.80,2931-2935 [Abstract/Free Full Text]
  32. Gluzman, Y.(1981) Cell23,175-182 [CrossRef][Medline] [Order article via Infotrieve]
  33. Markowitz, D., Goff, S., and Bank, A.(1988)J. Virol.62,1120-1124 [Abstract/Free Full Text]
  34. Cox, A. D., and Der, C. J.(1992)Curr. Opin. Cell Biol.4,1008-1016 [CrossRef][Medline] [Order article via Infotrieve]
  35. Buss, J. E., Solski, P. A., Schaeffer, J. P., MacDonald, M. J., and Der, C. J.(1989) Science243,1600-1602 [Abstract/Free Full Text]
  36. Chen, Y. T., Holcomb, C., and Moore, H. P. H.(1993)Proc. Natl. Acad. Sci. U. S. A.90,6508- 6512 [Abstract/Free Full Text]
  37. Kay, R., and Humphries, K.(1991)Methods Mol. Cell. Biol.2,254-265
  38. Mizushima, S., and Nagata, S.(1990)Nucleic Acids Res.18,5322 [Free Full Text]
  39. Chomczynski, P., and Sacchi, N.(1987)Anal. Biochem.162,156-159 [Medline] [Order article via Infotrieve]
  40. Jacobson, A. (1987)Methods Enzymol.152,254-261 [Medline] [Order article via Infotrieve]
  41. Seed, B., and Aruffo, A. (1987)Proc. Natl. Acad. Sci. U. S. A.84,3365-3369 [Abstract/Free Full Text]
  42. Vogeli, G., Horn, E., Laurent, M., and Nath, P.(1985)Anal. Biochem. 151,442-444 [CrossRef][Medline] [Order article via Infotrieve]
  43. Birnboim, H. C., and Doly, J.(1979)Nucleic Acids Res.7,1513-1523 [Abstract/Free Full Text]
  44. Luthman, H., and Magnusson, G.(1983)Nucleic Acids Res.11,1295-1308 [Abstract/Free Full Text]
  45. Gorman, C. M., Howard, B. H., and Reeves, R.(1983)Nucleic Acids Res. 11,7631-7648 [Abstract/Free Full Text]
  46. Engler-Blum, G., Meier, M., Frank, J., and Mller, G. A.(1993) Anal. Biochem.210,235- 244 [CrossRef][Medline] [Order article via Infotrieve]
  47. Hodgson, C. P., and Fisk, R. Z.(1987)Nucleic Acids Res.15,6295 [Free Full Text]
  48. Kozak, M.(1991)J. Biol. Chem.266,19867-19870 [Free Full Text]
  49. Harlan, J. E., Hajduk, P. J., Yoon, H. S., and Fesik, S. W.(1994)Nature 371,168-170 [CrossRef][Medline] [Order article via Infotrieve]
  50. Davis, L., and Bennett, V.(1994)J. Biol. Chem.269,4409-4416 [Abstract/Free Full Text]
  51. Hart, M. J., Eva, A., Evans, T., Aaronson, S. A., and Cerione, R. A.(1991) Nature354,311-314 [CrossRef][Medline] [Order article via Infotrieve]
  52. Yaku, H., Sasaki, T., and Takai, Y.(1994)Biochem. Biophys. Res. Commun. 198,811-817 [CrossRef][Medline] [Order article via Infotrieve]
  53. Koch, W. J., Inglese, J., Stone, W. C., and Lefkowitz, R.(1993)J. Biol. Chem.268,8256-8260 [Abstract/Free Full Text]
  54. Pitcher, J., Inglese, J., Higgins, J. B., Arriza, J. L., Casey, P. J., Kim, C., Benovic, J. L., Kwatra, M. M., Caron, M. G., and Lefkowitz, R. J.(1992) Science257,1264-1271 [Abstract/Free Full Text]
  55. Aronheim, A., Engelberg, D., Li, N., Al-Alawi, N., Schlessinger, J., and Karin, M.(1994) Cell78,949-961 [CrossRef][Medline] [Order article via Infotrieve]
  56. Ahmed, S., Kozma, R., Lee, J., Monfries, C., Harden, N., and Lim, L.(1991) Biochem. J.280,233-241
  57. Bell, R. M., and Burns, D. J.(1991)J. Biol. Chem.266,4661-4664 [Free Full Text]
  58. Hubbard, S. R., Bishop, W. R., Kirschmeier, P., George, S. J., Cramer, S. P., and Hendrickson, W. A.(1991)Science254,1776-1779 [Abstract/Free Full Text]
  59. Quest, A. F. G., Bloomenthal, J., Bardes, E. S. G., and Bell, R. M.(1992) J. Biol. Chem.267,10193-10197 [Abstract/Free Full Text]
  60. Ono, Y., Fujii, T., Igarashi, K., Kuno, T., Tanaka, C., Kikkawa, U., and Nishizuka, Y. (1989)Proc. Natl. Acad. Sci. U. S. A.86,4868-4871 [Abstract/Free Full Text]
  61. Ahmed, S., Kozma, R., Monfries, C., Hall, C., Lim, H. H., Smith, P., and Lim, L.(1990) Biochem. J.272,767-773 [Medline] [Order article via Infotrieve]
  62. Kaibuchi, K., Fukumoto, Y., Oku, N., Takai, Y., Arai, K., and Maramatsu, M.(1989) J. Biol. Chem.264,13489-13496 [Abstract/Free Full Text]
  63. Burns, D. J., and Bell, R. M.(1991)J. Biol. Chem.266,18330-18338 [Abstract/Free Full Text]
  64. Quest, A. F. G., Bardes, E. S. G., and Bell, R. M.(1994)J. Biol. Chem. 269,2961-2970 [Abstract/Free Full Text]
  65. Quest, A. F. G., Bardes, E. S. G., and Bell, R. M.(1994)J. Biol. Chem. 269,2953-2960 [Abstract/Free Full Text]
  66. Ghosh, S., Xie, W. Q., Quest, A. F., Mabrouk, G. M., Strum, J. C., and Bell, R. M. (1994)J. Biol. Chem.269,10000-10007 [Abstract/Free Full Text]
  67. Schaap, D., de Widt, J., van der Wal, J., Vandekerckhove, J., van Damme, J., Gussow, D., Ploegh, H. L., van Blitterswijk, W. J., and van der Bend, R. L.(1990) FEBS275,151-158 [CrossRef][Medline] [Order article via Infotrieve]
  68. Maruyama, I. N., and Brenner, S.(1991)Proc. Natl. Acad. Sci. U. S. A. 88,5729-5733 [Abstract/Free Full Text]
  69. Ahmed, S., Maruyama, I. N., Kozma, R., Lee, J., Brenner, S., and Lim, L.(1992) Biochem. J.287,995-999
  70. Bustelo, X. R., Ledbetter, J. A., and Barbacid, M.(1992)Nature 356,68-74 [CrossRef][Medline] [Order article via Infotrieve]
  71. Kazanietz, M. G., Bustelo, X. R., Barbacid, M., Kolch, W., Mischak, H., Wong, G., Pettit, G. R., Bruns, J. D., and Blumberg, P. M.(1994)J. Biol. Chem.269,11590-11594 [Abstract/Free Full Text]
  72. Coppola, J., Bryant, S., Koda, T., Conway, D., and Barbacid, M.(1991)Cell Growth Diff.2,95-105 [Abstract]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Cell Sci.Home page
U. J. K. Soh and B. C. Low
BNIP2 extra long inhibits RhoA and cellular transformation by Lbc RhoGEF via its BCH domain
J. Cell Sci., May 15, 2008; 121(10): 1739 - 1749.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
O. O. Olabisi, G. M. Mahon, E. V. Kostenko, Z. Liu, H. L. Ozer, and I. P. Whitehead
Bcr interacts with components of the endosomal sorting complex required for transport-I and is required for epidermal growth factor receptor turnover.
Cancer Res., June 15, 2006; 66(12): 6250 - 6257.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Liu, E. V. Kostenko, G. M. Mahon, O. O. Olabisi, and I. P. Whitehead
Transformation by the Rho-specific Guanine Nucleotide Exchange Factor Dbs Requires ROCK I-mediated Phosphorylation of Myosin Light Chain
J. Biol. Chem., June 9, 2006; 281(23): 16043 - 16051.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. M. Longhurst, M. Watanabe, J. D. Rothstein, and M. Jackson
Interaction of PDZRhoGEF with Microtubule-associated Protein 1 Light Chains: LINK BETWEEN MICROTUBULES, ACTIN CYTOSKELETON, AND NEURONAL POLARITY
J. Biol. Chem., April 28, 2006; 281(17): 12030 - 12040.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
C. J. Bakal, D. Finan, J. LaRose, C. D. Wells, G. Gish, S. Kulkarni, P. DeSepulveda, A. Wilde, and R. Rottapel
The Rho GTP exchange factor Lfc promotes spindle assembly in early mitosis
PNAS, July 5, 2005; 102(27): 9529 - 9534.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. E. Martinez, L. Yuan, C. Lacza, H. Ransom, G. M. Mahon, I. P. Whitehead, and L. E. Hake
XGef Mediates Early CPEB Phosphorylation during Xenopus Oocyte Meiotic Maturation
Mol. Biol. Cell, March 1, 2005; 16(3): 1152 - 1164.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. V. Kostenko, G. M. Mahon, L. Cheng, and I. P. Whitehead
The Sec14 Homology Domain Regulates the Cellular Distribution and Transforming Activity of the Rho-specific Guanine Nucleotide Exchange Factor Dbs
J. Biol. Chem., January 28, 2005; 280(4): 2807 - 2817.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Yoshizuka, R. Moriuchi, T. Mori, K. Yamada, S. Hasegawa, T. Maeda, T. Shimada, Y. Yamada, S. Kamihira, M. Tomonaga, et al.
An Alternative Transcript Derived from the Trio Locus Encodes a Guanosine Nucleotide Exchange Factor with Mouse Cell-transforming Potential
J. Biol. Chem., October 15, 2004; 279(42): 43998 - 44004.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
M. Smallhorn, M. J. Murray, and R. Saint
The epithelial-mesenchymal transition of the Drosophila mesoderm requires the Rho GTP exchange factor Pebble
Development, June 1, 2004; 131(11): 2641 - 2651.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
S. Carrasco and I. Merida
Diacylglycerol-dependent Binding Recruits PKC{theta} and RasGRP1 C1 Domains to Specific Subcellular Localizations in Living T Lymphocytes
Mol. Biol. Cell, June 1, 2004; 15(6): 2932 - 2942.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Cheng, G. M. Mahon, E. V. Kostenko, and I. P. Whitehead
Pleckstrin Homology Domain-mediated Activation of the Rho-specific Guanine Nucleotide Exc