![]()
|
|
||||||||
(Received for publication, March 14, 1995; and in revised form, June 2, 1995)
From the
In order to identify cDNAs that can induce oncogenic
transformation, a retroviral vector was used to transfer a library of
cDNAs from the murine 32D hemopoietic cell line into NIH 3T3
fibroblasts. We have identified and recovered a provirus containing a
1.8-kilobase pair cDNA whose expression causes morphological
transformation in NIH 3T3 cells. The transforming cDNA contains a
complete open reading frame that encodes a protein (designated Lfc)
with a region of sequence similarity to the product of the lbc oncogene. This region includes a domain that is characteristic of
the CDC24 family of guanine nucleotide exchange factors in tandem with
a pleckstrin homology (PH) domain. The Lfc protein is distinguished
from Lbc by a 150-amino acid NH
The Ras superfamily of GTP-binding proteins controls multiple
aspects of information flow within eukaryotic cells, mediating such
diverse physiological processes as vesicular transport, cytoskeletal
organization, development, and cell
proliferation(1, 2) . Ras GTPases function as binary
switches, cycling between an active GTP-bound form and an inactive
GDP-bound form(1, 3) . The proportion of active
GTP-bound Ras present in a cell is determined by two enzymatically
controlled reactions: the hydrolysis of Ras GEFs have been described for virtually all Ras GTPase
families and can be conveniently grouped based on structural
similarities(2) . One rapidly expanding group, consisting of
CDC24(4) , Dbl(5) , Vav(6, 7) ,
Ect2(8) , Bcr(9) , Abr(10, 11) ,
RasGRF(12, 13) , Tiam(14) , Tim(15) ,
Lbc(16, 17) , Ost(18) , FGD1(19) , and
Dbs(20) , share a common domain with the CDC24 protein of Saccharomyces cerevisiae. CDC24 has been shown, both
genetically (4) and biochemically(21) , to have
exchange activity on the Rho family GTPase, CDC42. These two proteins
act in concert to regulate bud site assembly. Dbl, a mammalian homolog
of CDC24, can also catalyze exchange on CDC42Hs as well as on RhoA, but
not on Rac1 or TC10(22) . Lbc stimulates exchange activity on
Rho proteins in vitro but not Cdc42Hs, Ras, or
Rac(17) . The Vav protein has been reported to show opposite
specificities to Dbl and Lbc, stimulating exchange activity on Ras
family members but showing no activity toward Rho/Rac
GTPases(23, 24, 25) . However, in other
cellular systems, Vav appears to transform cells via Ras-independent
mechanisms (26, 27) . Ect2 is unable to act as an
exchange factor for Rho or Rac (even though it binds to both of these
proteins) but has not been tested on Ras family members(8) .
Ost has exchange activity on CDC42 and RhoA but not on Ha-Ras, Rap1A,
TC10, RhoB, RhoC, RhoG, Rac1, or Rac2(18) . Two members of this
group that have not been tested for GEF function, Bcr and Abr, have GAP
activity toward Rho/Rac
proteins(11, 28, 29) , but this is mediated
by a GAP domain separate from their regions of CDC24 homology. CDC25,
and its mammalian homolog SOS, form a second structurally related group
of GEFs that have been shown to specifically act as exchange factors on
Ras family members (for review, see (2) ). One member of the
CDC25 family, RasGRF, also contains a CDC24-like domain, but this
domain fails to show activity on CDC42Hs, Rac2, RhoA, RasH, or
RalA(12) . The remaining members of the CDC24-related group
(Dbs, Tim, Tiam, and FGD1) have not been tested for any exchange
activities. We have previously reported a retroviral-based
expression system that permits the transfer of large libraries of
cDNAs(30) . This system has been used to screen a cDNA library
prepared from the 32D murine myeloid cell line for clones that have
transforming activity when expressed in NIH 3T3 fibroblasts. NIH 3T3
cells are very sensitive to oncogenes that constitutively activate the
Ras/Raf signaling pathway and has been particularly useful for
identifying CDC24-related genes (i.e.vav, dbl, ost, dbs, ect2, tim,
and lbc). We now report a new CDC24 family member, designated lfc, that was recovered in our screen.
pCTV3H was derived from pCTV3 by: 1) replacing the SalI
fragment with an oligonucleotide sequence that contains a HpaI
site (the oligonucleotide sequence reads
GTCGACAGTTAACCCGGGTCGAC), and 2) deleting the DraI(4415) to HpaI(4476) fragment. pCTV3D was
derived from pCTV3H by deleting the ScaI(3812) to StuI(4368) fragment containing the simian virus 40 (SV40)
origin of replication. pCTV3M was derived from pCTV3H by replacing
the MluI(1460) to SalI(1481) fragment with an
oligonucleotide sequence corresponding to the myristoylation site
(MGQSLT) at the NH pCTV3P was derived
from pCTV3H by replacing the SalI(1464) to SalI(1481)
fragment with an oligonucleotide sequence corresponding to the
isoprenylation sites (GCMSCKCVLS) at the COOH terminus of
Ha-ras(35) . The oligonucleotide sequence reads:
GTCGACAGTTAACGGATGCATGTCTTGCAAATGCGTGCTGTCCTAGTCGAC. pCTV3HA was
derived from pCTV3D by replacing the MluI(1460) to HpaI(1471) fragment with an oligonucleotide sequence that
encodes the influenza hemagglutinin (HA) peptide sequence (amino acids
98-108: YPYDVPDYASL) immediately downstream of the start codon (36) . The oligonucleotide sequence reads:
ACGCGTACCACCATGGAGGCCTATCCTTACGATGTGCCTGATTATGCATCTGGTTAAC. pAX142
was derived from pAX114 (37) by replacing the hCMV IE promoter
with the EF-1
cDNAs encoding modified forms of the Lfc protein fused in-frame
to isoprenylation sites were made by subcloning the constructs
specified below into the HpaI site of the pCTV3P vector
(nucleotide positions are based upon the full-length Lfc cDNA). The P3,
P6, and P11 constructs utilized the pCTV3P stop codon (P3: 5` of D6 to
1503; P6: 5` of D6 to 1839; P11: 5` of D8 to 1839). The My2 cDNA
encodes a modified form of the Lfc protein fused in-frame to a
myristoylation site. It was made by subcloning D13 into the SalI site of pCTV3M (the nucleotide position is based upon the
full-length Lfc cDNA). The My2 construct utilized the pCTV3M start
codon (My2: 385 to 3` end of D13). Constructs that place an in-frame
epitope from the HA of influenza virus at the NH PCR-directed mutagenesis was used to make the following
amino acid replacement in TL18-9c1 (M3: tryptophan (TGG)
1807-1809 to leucine (TTG)) All fragments that were
synthesized by PCR were sequenced in their entirety to confirm that
only specified mutations had occurred.
Figure 1:
Transforming activity
of the TL18-9c1 cDNA clone. NIH 3T3 cells were infected at low density
with CTV3 retroviral vector (A) or CTV3 carrying the
full-length TL18-9c1 cDNA (B). Cell cultures in 35-mm diameter
wells were stained with methylene blue 5 days after reaching
confluence.
Figure 2:
Sequence of the Lfc cDNA and encoded
protein. The presumed translation product, indicated in single-letter code, is shown below the cDNA sequence. The 5`
boundary of the original TL18-9c1 cDNA is indicated by an arrow above the nucleotide sequence. The boundaries of the various
derivatives of the full-length cDNA (D1, P3, etc.) are similarly
indicated. The presumptive initiation codons for the TL18-9c1 cDNA and
its derivatives are indicated by the arrows below the
translation sequence (D4tln, etc.). The zinc
butterfly, GEF-H, and PH domains are indicated by the singleunderline, dashedunderline, and doubleunderline, respectively. The amino acid
substitution in the M3 mutation is indicated below the
sequence.
The protein encoded by
the TL18-9c1 cDNA is not highly similar to any sequences that are
currently in the data bases and therefore is the translation product of
a novel gene. However, Lfc does have distinct similarities to the CDC24
family of GEFs and in particular to Lbc, a CDC24 family member isolated
from chronic myeloid leukemia cells. This similarity includes a
complete CDC24 family GEF homology (GEF-H) domain in tandem with a
pleckstrin homology (PH) domain. We have designated this new CDC24
family member Lfc (Lbc's first cousin). Over the 414 amino acid
region of similarity between Lbc and Lfc, 50% of the residues are
identical and only three gaps need to be inserted in the sequences to
obtain this optimal alignment (Fig. 3).
Figure 3:
Comparison of the amino acid sequences of
Lfc and Lbc. The sequences between residues 164 and 573 of Lfc and
between 1 and 415 of Lbc were optimally aligned on the basis of residue
identity (verticallines) and similarity (colons).
Lfc has 163 amino
acids extending beyond the sequences homologous to the NH
Figure 4:
Comparison of cysteine-rich domains from
regulators of the Ras super-family to the regulatory region of PKC.
mPKC
Figure 5:
Transforming activities of full-length,
truncated, and mutated Lfc cDNAs. The domain structure of the
full-length Lfc protein is illustrated in the upper line (ZB,
zinc butterfly; GEF-H, CDC24 GEF homology domain; PH, pleckstrin homology domain), and the lines below indicate
the regions of the protein included in predicted translation products
of the various cDNA derivatives. Boundaries of domains and predicted
translation products are indicated with numbers referring to amino acid
positions in the full-length protein as shown in Fig. 2. The symbols on the right indicate whether the cDNA had
(+) or lacked(-) transforming activity when expressed in NIH
3T3 cells following their infection with retroviruses derived from the
CTV3 vector carrying the indicated cDNA. The P3, P6, P10, and P11
constructs were fused to an isoprenylation site as indicated by a filledblackcircle. The My2 construct was
fused to a myristoylation site as indicated by a filledblackbox. D13 and P3 were tested with and
without HA tags at their NH
It has been suggested
previously that PH domains may be important for membrane localization
of proteins(49, 50) , although the specificity of this
interaction is not clear. In order to test whether the activity of the
PH domain in the Lfc protein could be replaced by a membrane
localization signal, the isoprenylation site from N-Ras or the
myristoylation site from the Rasheed sarcoma virus were fused to
TL18-9c1 derivatives. While removal of the complete PH domain, or any
portion thereof, eliminated the transforming activity of Lfc in NIH 3T3
cells, replacement of the domain with an isoprenylation site completely
restored transforming activity. A form of Lfc that contains an
isoprenylation site and a deletion that encroaches 3 amino acids into
the NH
Figure 6:
Expression of epitope-tagged Lfc proteins.
Epitope tagged proteins were expressed in COS cells and in NIH 3T3
cells, and detected by Western blotting, as described under
``Materials and Methods.'' COS cells were transfected as
follows: Lane1, no transfection; lane2, with pAX142/P3
Figure 7:
Expression of Lfc mRNAs. RNA was separated
by electrophoresis, transferred to nylon membranes, and hybridized with
With the exception of liver, the
major 3.7-kb mRNA was detected in all tissues examined (Fig. 7B). Levels were high in hemopoietic tissues
(thymus, spleen, and bone marrow) as well as in kidney and lung. The
latter tissue also expresses a unique assortment of mRNA forms, ranging
from 4.5 to about 1 kb.
Figure 8:
Structure of the lfc gene. DNA
isolated from 32D cells, murine liver, or human peripheral blood
leukocytes were digested with the indicated restriction enzymes,
separated by electrophoresis, transferred to nylon membrane, and
hybridized with the
We have cloned a cDNA from the murine 32D hemopoietic cell
line that causes strong transformation when expressed in NIH 3T3
fibroblasts. Lfc, the novel protein encoded by this cDNA, contains a
domain that is characteristic of the CDC24 family of guanine nucleotide
exchange factors (GEF-H) in tandem with a PH domain. Lfc is closely
related to Lbc, a CDC24 family GEF that specifically catalyzes exchange
on Rho GTPases(17) . The region of similarity between Lbc and
Lfc includes the complete GEF-H and PH domains. Expression of the Lfc
cDNA with deletions or point mutations revealed a minimum requirement
for intact PH and GEF-H domains for cellular transformation. Since the
exchange activity of the CDC24 family member Dbl has been localized to
the GEF-H domain(22) , the transformation induced by Lfc may be
a consequence of increased GEF activity in the recipient cell line.
Four members of the CDC24 family (CDC24, Ost, Lbc, and Dbl) have
exchange activity on the Rho family
GTPases(17, 18, 22, 51, 52) ,
and an activated mutant of RhoA (RhoA(63L)) causes transformation when
expressed in NIH 3T3 cells with morphology similar to that induced by
Lfc expression(27) . Although Ras family members that are
constitutively bound to GTP also transform NIH 3T3 cells, it is
unlikely that the transformation of NIH 3T3 cells by CDC24 family
members is mediated by GEF activity on Ras family members. There is a
clear distinction between induced morphologies by Ras and by
CDC24-related proteins, and GTP-bound Ras is absent in NIH 3T3 cells
transformed by CDC24 family members(26, 27) . CDC24
family members such as Lfc are presumed to transform NIH 3T3 cells by
activating one or a combination of Rho-like proteins, either directly
through their GEF activity or perhaps indirectly by interfering with
antagonists. Our observation that the Lfc PH domain can be
functionally replaced by an isoprenylation site suggests that the
recruitment of the Lfc protein to the cellular membrane is a necessary
step for cellular transformation. This may involve a direct binding of
the PH domain of Lfc to membrane lipids or an interaction between the
PH domain of Lfc and a membrane-bound protein. Our finding that
myristate is not able to substitute for a PH domain suggests that PH
domains and a COOH-terminal prenyl lipid anchor share a common property
that myristoylation at the NH A small
NH With the exception of liver tissue, Lfc mRNAs were
detected in all the cell lines and tissues that were examined. This
general pattern of expression does not correspond well to that of
either Lbc or Vav, both of which appear to be much more restricted in
their expression. Multiple sizes of mRNAs hybridizing to the Lfc probe
were detected, and the relative abundances of these varied considerably
among cell lines and tissues. However, we have not determined whether
the different mRNAs detected are all derived from the lfc gene versus very closely related genes. Under the hybridization
conditions used, such genes would have to be much more closely related
to lfc than is lbc. Differential splicing at the lfc locus is the most likely source of the multiple mRNAs, and
these could encode variant forms of the protein which in turn may
confer some tissue specificity on its functions. The ability of the
Lfc protein to trigger deregulated growth in NIH 3T3 cells appears to
be cell type-specific with no such activity detected in C3H10T1/2
cells. In this respect, Lfc differs from the CDC24 family member Dbs,
which is transforming in both NIH 3T3 and C3H10T1/2 cell
lines(20) . We have recently observed that Lfc or Dbs
expression is not sufficient to confer the phenotype of growth factor
independence on the IL-3dependent Ba/F3 cell line. (
The
nucleotide sequence(s) reported in this paper has been submitted to the
GenBank®/EMBL Data Bank with accession number(s)
U28495[GenBank].
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-terminal extension that
contains a cysteine- and histidine-rich domain similar to the
diacylglycerol-binding site (zinc butterfly) found in protein kinase C.
NH
- and COOH-terminal deletion analysis revealed that both
the PH and putative guanine nucleotide exchange factor domains are
required, but the zinc butterfly is dispensable, for transformation.
Although the removal of the PH domain of the Lfc protein completely
eliminated its ability to transform NIH 3T3 cells, replacement of this
domain with an isoprenylation site restored all of its transforming
activity. This suggests that a PH domain-dependent recruitment of the
Lfc protein to the cellular membrane is a necessary step for cellular
transformation. The lfc gene is expressed in a broad range of
tissues as well as in a variety of hemopoietic and non-hemopoietic cell
lines. Lfc appears to be a new member of a growing family of proteins
that are likely to act as activators of Ras-like proteins in a
developmental or cell-lineage specific manner.
GTP to Ras
GDP
and the subsequent replacement of GDP with GTP following GDP
dissociation. There are three families of proteins that control these
reactions and thus coordinately regulate the activity of
Ras(2) . GTPase-activating proteins (GAPs) (
)increase the rate of hydrolysis of RasGTP, a
unidirectional reaction that increases the concentration of inactive
GDP-bound Ras in a cell. Guanine nucleotide dissociation inhibitors
decrease the rate of GDP release from Ras, thus maintaining Ras in an
inactive state. Guanine nucleotide exchange factors (GEFs) accelerate
the release of GDP from Ras, thus allowing GTP binding and Ras
reactivation.
Cell Lines
32D cells (31) were cultured
in Dulbecco's modified Eagle's medium (DMEM) containing
10% fetal bovine serum and 5 ng/ml murine interleukin-3. COS cells (32) were cultured in DMEM containing 10% fetal bovine serum.
NIH 3T3 and C3H10T1/2 cells were obtained from American Type Culture
Collection and cultured at low density in DMEM containing either 10%
calf serum (NIH 3T3) or 10% fetal bovine serum (C3H10T1/2 and C127).
GP+E-86 packaging cells (33) were cultured in DMEM
containing 10% calf serum.Vector Construction
The pCTV1, pCTV3, and pCTV3K
retroviral vectors have been described previously(30) .
terminus of the Rasheed sarcoma
virus(34) . The oligonucleotide sequence reads:
ACGCGTACCACCATGGGACAGAGCCTGACCAAAGGAGGTACCGTCGAC.
promoter(38) .cDNA Library Construction
mRNA was prepared from
32D cells by lysis in guanidinium isothiocyanate as
described(39) , followed by binding to
oligo(dT)-cellulose(40) . cDNA was synthesized with random
sequence hexamers and Moloney murine leukemia virus reverse
transcriptase using methods provided by the supplier of the polymerase
(Life Technologies, Inc.). BstXI adapters (41) were
added to the termini of the double-stranded cDNA, which was then
ligated with BstXI-cut pCTV1 retroviral vector(30) . Escherichia coli MC1061/p3 (41) were transformed with
the ligation mixture by electroporation and plated in soft
agar(42) . Pooled plasmid DNA was purified from the transformed
bacteria by alkaline lysis(43) , followed by digestion with
RNase A and RNase T1 and precipitation with ethanol.Production of Viruses and Infection of NIH 3T3
Cells
Plasmid DNA was introduced into the GP+E-86 ecotropic
packaging cell line (33) by DEAE-dextran
transfection(44) . A 6-cm dish of cells at 70% confluence was
washed twice with DMEM containing 20 mM HEPES, pH 7.2
(DMEM/H). 2 ml of DMEM/H containing 2 µg/ml plasmid DNA and 0.2
mg/ml DEAE-dextran (M
500,000) was then added to
the cells, followed by a 1-h incubation at 37 °C in a humidified
incubator with a 5% CO
atmosphere. The medium was then
replaced with DMEM/H containing 10% calf serum and 0.2 mM
chloroquine, and the incubation was continued for another 3 h, after
which the medium was replaced with chloroquine-free medium. At 48 h
after the beginning of the transfection, the medium was replaced with
DMEM/H containing 5 mM sodium butyrate(45) . The
medium was collected 24 h later and filtered. After the addition of an
equal volume of fresh DMEM/H containing 10% calf serum and of Polybrene
to a concentration of 10 µg/ml, the medium was added to a 10-cm
dish containing 2 10
NIH 3T3 cells. The infecting
medium was removed 18 h later, after which the NIH 3T3 cell culture was
fed at 3-day intervals with DMEM/H, 10% calf serum.Recovery of cDNAs from Infected Cells
Genomic DNA
was prepared from infected NIH 3T3 cell clones by proteinase K
digestion, phenol extraction, and ethanol precipitation. 25-µl PCR
reactions contained the following components: 20 mM Tris-Cl,
pH 8.75, 10 mM KCl, 10 mM ammonium sulfate, 2
mM MgCl
, 0.1% Triton X-100, 0.1 mg/ml bovine serum
albumin, 0.2 mM each of dATP, dCTP, dGTP, and dTTP, 100 ng
each of 5` and 3` primers, 300 ng of template genomic DNA, and 1.25
units of Pfu DNA polymerase (Stratagene, La Jolla, CA).
Amplification was performed with the following thermal cycles: 95
°C for 60 s 1; 95 °C for 60 s, 50 °C for 30 s, 72
°C for 180 s
30. The amplified DNA was extracted with
phenol:chloroform (1:1), ethanol-precipitated, and digested with MluI and BsiWI (restriction enzymes with recognition
sites that flank the cDNA within the integrated provirus). The
amplified cDNAs were purified by agarose gel electrophoresis,
electro-eluted and ethanol-precipitated, and cloned by ligation into
pCTV3 and transformation of E. coli MC1061/p3.
Isolation of 5` Extended cDNAs
A pair of primers
matching the 5` end of the TL18-9c1 cDNA was synthesized and used in
conjunction with primers matching sites in the vector that flank the 5`
end of the cDNA insertion. Nested PCR reactions were performed on
plasmid DNA of the cDNA library, using Pfu DNA polymerase and
the cycling parameters listed above. Amplified cDNA products were
gel-purified and cloned into pBluescript KS+ (Stratagene) for
sequence determination. No discrepancies in sequence were found in the
regions of overlap of the TL18-9c1 cDNA and the various PCR products.Construction of TL18-9c1 Derivatives
cDNAs
encoding truncated forms of the Lfc protein were generated by
restriction enzyme digestion or PCR amplification of the TL18-9c1 cDNA
as indicated below with the position of termini in the full-length Lfc
cDNA sequence in parentheses. In the cases of COOH-terminal truncation
of the coding region, insertion into the CTV3 vector resulted in the
placement of a TAG stop codon in-frame and within 5-10 bp
downstream of the cDNA. The D13 construct utilized an artificial stop
codon that had been introduced by PCR. For NH
-terminal
truncations, the junctions were chosen to ensure that the next ATG
codon was in-frame and in a good context for initiation of translation.
The D6, D7, D8, D9, and D13 constructs utilized artificial start codons
that had been introduced by PCR.
terminus
of Lfc sequences were made by subcloning the constructs specified below
into the HpaI site of pCTV3HA (the nucleotide position is
based upon the full-length Lfc cDNA). D13HA and P3
HA
utilized the pCTV3HA start codon. Two additional constructs,
pAX142/D13
HA and pAX142/P3
HA, were made by replacing the MluI-ClaI fragment of pAX142 with the MluI-ClaI fragments of D13
HA and P3
HA,
respectively (D13
HA: 342 to 3` end of D13; P3
HA: 342 to 3`
end of P3).
COS Cell Transfection
pAX142/P3HA or
pAX142/D13
HA plasmid DNA was introduced into the COS cell line by
DEAE-dextran transfection(44) . For a 10-cm tissue culture
dish, a solution was prepared with 10 mg of DNA diluted with 2 ml of TS
(TS = 1 mM MgCl
, 1 mM CaCl
in TD (TD = 140 mM NaCl, 5 mM KCl, 0.5
mM NaH
PO
, 25 mM Tris, pH
7.5)). Then an equal volume of TS containing 1 mg/ml DEAE-Dextran was
added. COS cells (about 70% confluent) were washed with TS, followed by
TD. The DNA solution was added and the cells were incubated at 37
°C for 50 min. The solution was discarded, and the cells were
incubated with 10 ml of TS containing 20% glycerol for 2 min, swirling
every 30 s. The cells were washed with TS, then with DMEM containing 5%
fetal bovine serum (Life Technologies, Inc.) then incubated with 20 ml
of DMEM containing 5% fetal bovine serum and 200 µM chloroquine, at 37 °C for 2 h. The chloroquine-containing
media was replaced with DMEM (5% fetal bovine serum), and the cells
were incubated at 37 °C for 48 h. Cells were washed with PBS and
then lifted from the dishes by incubating with PBS containing 2 mM EDTA. After centrifuging at 1000 rpm for 5 min, the cell membrane
was lysed by resuspending the cells in PBS containing 1% Nonidet P40
(Sigma) and incubating on ice for 10 min. The suspension was spun at
13,000 rpm for 5 min. The supernatant was used in Western blot
analysis.Western Blot Analysis
Cell lysates were boiled for
2 min with SDS sample buffer. Proteins were separated on a 12.5%
SDS-polyacrylamide gel and then electroblotted onto Immobilon
polyvinylidene difluoride membrane (Millipore) at 90 V for 1 h at 2
°C using 20 mM Tris, 150 mM glycine, 20%
methanol, pH 8.0, as transferring buffer. The membrane was then blocked
overnight with PBS containing 5% bovine serum albumin and 0.02% sodium
azide. Blots were washed four times for 10 min with TBST (25
mM Tris, 2.7 mM KCl, 137 mM NaCl, 0.05%
Tween 20, pH 7.4) and then incubated for 80 min at 23 °C with 2
µg/ml mouse anti-HA (12CA5) antibody (Boehringer Mannheim), 1%
bovine serum albumin in TBST. Blots were washed as before and then
incubated for 45 min with a 1:4000 dilution of donkey anti-mouse IgG
peroxidase conjugate (Bio/Can). Blots were again washed and
immunoreactive bands were detected by incubating the blot with LumiGLO
substrate (KPL) solution for 1 min and then exposing it to Kodak
(X-Omat®) AR film.Sequence Analysis and Comparisons
cDNA sequences
were determined by a chain termination procedure using Vent
thermostable polymerase (New England Biolabs, Beverley, MA). Continuous
sequences were determined for both strands. Data base comparisons were
performed with the MPSearch program, using the Blitz server operated by
the European Molecular Biology Laboratory (Heidelberg, Germany). The
sequence similarity analysis of Lfc and Lbc was performed with the
Bestfit program of the Genetics Computer Group (Madison, WI).Hybridization Analysis of RNA and DNA
Total
cellular RNA, mRNA, and genomic DNA were prepared as described above.
RNA was separated by electrophoresis through agarose gels containing
0.66 M formaldehyde and transferred to Zeta-Probe nylon
membranes (Bio-Rad). Hybridization and high stringency washing were
performed as described(46) , using DNA probes labeled with P by extension of random sequence primers(47) .
Oncogenic Selection and Recovery of the TL18-9c1 cDNA
Clone
We have screened a cDNA library prepared from the 32D
murine myeloid cell line for clones that have transforming activity
when expressed in NIH 3T3 fibroblasts. The retroviral-based expression
cloning system that was employed in this screen has been described in
detail elsewhere(30) . The 32D library was constructed in the
retroviral pCTV-1 vector, converted into a library of viral clones by
transient transfection of the ecotropic packaging cell line
GP+E-86, and transferred to NIH 3T3 cells by infection. Numerous
transformed foci arose when the cells reached confluence. One of these
cell clones, TL18-9, was isolated, expanded, and examined by PCR for
the presence of proviral inserts. A single provirus-derived fragment of
2100 bp was amplified consisting of a cDNA insert (
1800 bp) and
a linked 300-bp supF gene. This fragment was purified and
recovered by insertion into the retroviral vector pCTV3K using the supF gene as a selectable marker for E. coli transformation. The recovered cDNA, designated TL18-9c1, was
converted to retroviral form and retested for transforming activity in
the NIH 3T3 and C3H10T1/2 cell lines. The NIH 3T3 cells became very
refractile within 3 days and continued to proliferate rapidly, forming
large dense foci after confluence had been reached (Fig. 1).
Normally, NIH 3T3 cells form a single monolayer and become quiescent at
confluence. No transforming activity was detected in the C3H10T1/2 cell
line (data not shown).
TL18-9c1 Encodes a Protein with Structural Similarities
to the CDC24 Family of GEFs
The sequence of the TL18-9c1 cDNA
contained an MluI site at its 5` end that did not correspond
to the site that had been inserted into the pCTV vectors for use in the
recovery of proviral inserts(30) . Since this presumably
represented an internal MluI site, cDNAs with extended 5` ends
were recovered to obtain the sequence of a full-length TL18-9c1 cDNA.
PCR screening of four libraries derived from cell lines that express
the TL18-9c1 mRNAs produced fragments that extended the 5` end of
TL18-9c1 by at most only an additional 43 bp. The combined cDNA
sequence had a length of 1882 bp with a single, complete ORF starting
with an ATG codon at nucleotide 121 (Fig. 2). This codon is in a
moderately good context for translation initiation with a purine (A) at
-3 and a pyrimidine (T) at +4(48) . Although there
are no additional initiation or termination codons upstream of this
site, the sequence is highly GC-rich (>75%) and therefore is
unlikely to be coding. Assuming that translation starts at nucleotide
121, the full-length cDNA would encode a protein of 573 amino acids
with a predicted molecular mass of 69 kDa.
terminus of Lbc. This unique NH
-terminal sequence has
no extended similarities to other proteins but does contain a
histidine- and cysteine-rich motif (zinc butterfly; residues
40-86), which has been described in protein kinase C as well as
in several known effectors of the Ras superfamily (Fig. 4).
and mVav are from mouse; c-Raf and n-chimaerin are
from human (sequences taken from (71) ). mPKC
contains
two zinc fingers, and the corresponding zinc finger is indicated in parentheses. Conserved cysteines and histidines are boxed.
Domains Required for Transformation in the Lfc
Protein
Since the transforming TL18-9c1 cDNA contains the
presumptive Lfc ORF in its entirety, the full-length Lfc protein has
transforming activity in NIH 3T3 cells. A series of deletions were made
in the 5` end of the TL18-9c1 cDNA to determine the boundary of the
sequences that are required for transforming activity (Fig. 5).
Deletions that precisely bracket the NH
-terminal zinc
butterfly have no effect on the transforming activity of the Lfc
protein, indicating that this domain is not required for
transformation. Deletions that leave the GEF-H domain intact had strong
transforming activity, whereas deletions that removed as few as 3
residues from the NH
terminus of the GEF-H domain were no
longer transforming in NIH 3T3 cells. A truncation of the 3` end of the
Lfc cDNA that removed 21 residues(552-573), 18 of which were from
the PH domain, was also no longer transforming in NIH 3T3 cells. In
addition, a point mutation in the conserved tryptophan residue
(Trp
Leu) in the PH domain also abolished the
ability of Lfc to transform NIH 3T3 cells. Thus, both the GEF-H domain
and the PH domain are required for transformation, whereas the
NH
-terminal zinc butterfly is not.
terminus.
terminus of the GEF-H domain were not transforming.
This indicates that transformation potentiated by prenylation of Lfc is
still dependent on the function provided by the GEF-H domain. To ensure
that Lfc derivatives that lack a PH domain were being expressed, the
HA1 epitope of influenza virus hemagglutinin was fused to the NH
terminus of D13 (D13HA) as well as to the prenylated
derivative P3 (P3
HA). The epitope tag had no discernible effect
on the respective transforming activities of these Lfc derivatives in
NIH 3T3 cells. Western blot analysis of lysates from COS or NIH 3T3
cells that had been transfected with D13
HA or P3
HA
confirmed that proteins of the expected sizes (46.3 and 45.5 kDa,
respectively) were present in the Lfc-transfected or -infected cells (Fig. 6). In contrast to the results obtained with the
isoprenylation site, a myristoylation site was not able to compensate
for loss of the PH domain.
HA; lane3, with
pAX142/D13
HA. NIH 3T3 cells were infected as follows: lane4, with CTV3H; lane5, with P3
HA; lane6, with D13
HA. Loading in lanes4 and 6 were estimated to be 10-fold and 5-fold
less than lane5, respectively. Loading was estimated
by the intensity of the endogenous bands.
Expression of Lfc
A variety of hemopoietic and
non-hemopoietic cell lines were examined for expression of the lfc gene (Fig. 7A). A probe derived from the
full-length TL18-9c1 cDNA detected a major 3.7-kb mRNA in all cell
lines, albeit with considerable variation in amount. In addition, this
probe detected a number of less abundant mRNAs of different sizes, e.g. at 4.5 and 3.3 kb.
P-labeled TL18-9c1 cDNA probes. Size markers are denatured
DNA fragments of the indicated lengths that hybridize to the probe. PanelA, total RNA from the indicated cell lines:
32D, GM979, DA-3, and B6SutA
(myeloid cell lines), Ba/F3
and A20 (B cell line), C3H10T1/2 and NIH 3T3 (fibroblast cell lines),
MBL2 (T cell line), and P388 (macrophage cell line). PanelB, poly(A)
RNA from
the indicated tissues. Ethidium bromide-stained gels are shown below
the autoradiograms to show quantities of
RNA.
Structure and Conservation of the lfc
Gene
Restriction enzyme digestions of genomic DNA isolated from
32D cells and normal mouse liver produced the same pattern of
hybridization with a probe derived from the Lfc cDNA (Fig. 8).
This indicates that the cDNA cloned from the 32D library was not
derived from a gene that had undergone any gross rearrangements in the
32D cell line. DNA fragments hybridizing to the probe were also readily
detected in human genomic DNA, indicating that the lfc gene
was conserved during the evolutionary divergence of humans and mouse.
P-labeled TL18-9c1
cDNA.
terminus is not able to
mimic. This may simply be a requirement for membrane localization
proximal to the COOH terminus rather than the NH
terminus
of Lfc. Alternatively, prenylation may target Lfc to a membrane domain
where it is effective as a GEF, while myristoylation does not. Another
protein that contains a PH domain,
-adrenergic receptor kinase, is
also dependent upon membrane localization to maintain its cellular
function(53, 54) . Although the removal of the PH
domain from
-adrenergic receptor kinase reduces its kinase
activity to basal levels, replacement of this domain with an
isoprenylation site restores most of its activity(53) . Our
findings support the proposal that PH domains may provide an
alternative mechanism to post-translational addition of lipid molecules
for membrane localization(49) . It has been shown recently that
the membrane targeting of SOS (a CDC25 family GEF) by the introduction
of myristoylation or farnesylation sites is sufficient for activating
the Ras signaling pathway(55) .
-terminal deletion that removes the zinc butterfly has no
effect on the transforming activity of the Lfc protein. In PKC, this
motif has been implicated both in the coordination of zinc (56, 57, 58, 59) and in
phospholipid-dependent phorbol ester/diacylglycerol
binding(60, 61, 62, 63, 64) .
It has been proposed that the coordination of zinc in this region is
necessary to stabilize a structural motif that is required for lipid
interactions and phorbol ester
binding(56, 57, 58, 59) .
Diacylglycerol/phorbol ester binding activates PKCs and causes them to
become tightly associated with the cellular
membrane(60, 63, 64, 65) .
Homologous cysteine-rich motifs have also been described in one other
serine/threonine kinase, Raf(66) ; in diacylglycerol
kinases(56, 67) ; in a Caenorhabditis gene of
unknown function, unc-13(68, 69) ; and in two proteins
that modify the activity of G-proteins, n-chimaerin (61) and Vav(70) . Although the coordination of zinc is
a property shared by all of these domains, only the domains found in
PKCs, unc-13, and n-chimaerin are capable of binding phorbol
esters(56, 61, 66, 69, 71) .
Unlike the Lfc protein, the structural integrity of the zinc butterfly
must be maintained in the Vav protein in order for it to retain its
transforming activity in NIH 3T3 cells(72) . Thus, in at least
one respect, the transformation of NIH 3T3 cells by Vav and Lfc appears
to be mechanistically different. Although neither zinc or phorbol ester
binding has yet been demonstrated for the Lfc protein, the
identification of a second CDC24 family member with a zinc butterfly
motif suggests that lipid-dependent binding may be a more general
mechanism for modulating the activity of this family of G protein
regulators.
)We are
currently investigating the role of Lfc in regulating hemopoietic cell
proliferation and whether the cell type specificity of Lfc and other
CDC24 family members can be attributed to specific functional domains.
We thank Arthur Bank for providing the GP+E-86
packaging cell line.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
This article has been cited by other articles:
![]() |
U. J. K. Soh and B. C. Low BNIP2 extra long inhibits RhoA and cellular transformation by Lbc RhoGEF via its BCH domain J. Cell Sci., May 15, 2008; 121(10): 1739 - 1749. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. O. Olabisi, G. M. Mahon, E. V. Kostenko, Z. Liu, H. L. Ozer, and I. P. Whitehead Bcr interacts with components of the endosomal sorting complex required for transport-I and is required for epidermal growth factor receptor turnover. Cancer Res., June 15, 2006; 66(12): 6250 - 6257. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Liu, E. V. Kostenko, G. M. Mahon, O. O. Olabisi, and I. P. Whitehead Transformation by the Rho-specific Guanine Nucleotide Exchange Factor Dbs Requires ROCK I-mediated Phosphorylation of Myosin Light Chain J. Biol. Chem., June 9, 2006; 281(23): 16043 - 16051. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. M. Longhurst, M. Watanabe, J. D. Rothstein, and M. Jackson Interaction of PDZRhoGEF with Microtubule-associated Protein 1 Light Chains: LINK BETWEEN MICROTUBULES, ACTIN CYTOSKELETON, AND NEURONAL POLARITY J. Biol. Chem., April 28, 2006; 281(17): 12030 - 12040. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. J. Bakal, D. Finan, J. LaRose, C. D. Wells, G. Gish, S. Kulkarni, P. DeSepulveda, A. Wilde, and R. Rottapel The Rho GTP exchange factor Lfc promotes spindle assembly in early mitosis PNAS, July 5, 2005; 102(27): 9529 - 9534. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. E. Martinez, L. Yuan, C. Lacza, H. Ransom, G. M. Mahon, I. P. Whitehead, and L. E. Hake XGef Mediates Early CPEB Phosphorylation during Xenopus Oocyte Meiotic Maturation Mol. Biol. Cell, March 1, 2005; 16(3): 1152 - 1164. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. V. Kostenko, G. M. Mahon, L. Cheng, and I. P. Whitehead The Sec14 Homology Domain Regulates the Cellular Distribution and Transforming Activity of the Rho-specific Guanine Nucleotide Exchange Factor Dbs J. Biol. Chem., January 28, 2005; 280(4): 2807 - 2817. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Yoshizuka, R. Moriuchi, T. Mori, K. Yamada, S. Hasegawa, T. Maeda, T. Shimada, Y. Yamada, S. Kamihira, M. Tomonaga, et al. An Alternative Transcript Derived from the Trio Locus Encodes a Guanosine Nucleotide Exchange Factor with Mouse Cell-transforming Potential J. Biol. Chem., October 15, 2004; 279(42): 43998 - 44004. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. Smallhorn, M. J. Murray, and R. Saint The epithelial-mesenchymal transition of the Drosophila mesoderm requires the Rho GTP exchange factor Pebble Development, June 1, 2004; 131(11): 2641 - 2651. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Carrasco and I. Merida Diacylglycerol-dependent Binding Recruits PKC{theta} and RasGRP1 C1 Domains to Specific Subcellular Localizations in Living T Lymphocytes Mol. Biol. Cell, June 1, 2004; 15(6): 2932 - 2942. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Cheng, G. M. Mahon, E. V. Kostenko, and I. P. Whitehead Pleckstrin Homology Domain-mediated Activation of the Rho-specific Guanine Nucleotide Exc |