![]()
|
|
||||||||
(Received for publication, March
14, 1995; and in revised form, June 8, 1995) From the
The addition of interleukin-3 (IL-3) and granulocyte-macrophage
colony-stimulating factor (GM-CSF) to hormone-dependent cells induces
tyrosine phosphorylation of Janus protein kinase 2 (Jak2) and activates
its in vitro kinase activity. To explore the role of Jak2 in
IL-3/GM-CSF-mediated signal transduction, we constructed a
CD16/CD7/Jak2 (CD16/Jak2) fusion gene containing the external domain of
CD16 and the entire Jak2 molecule and expressed this fusion protein
using a recombinant vaccinia virus. The clustering of CD16/Jak2 fusion
protein by cross-linking with an anti-CD16 antibody induced
autophosphorylation of the fusion protein but did not induce the
phosphorylation of either the endogenous Jak2 or the
Interleukin-3 (IL-3), ( The addition of GM-CSF or IL-3 to cells stimulates the
tyrosine phosphorylation of large number of proteins having molecular
masses of 145, 97, 67, 52, and 42
kDa(10, 11, 12) . The 52-kDa protein has been
identified as Shc(13) . Phosphorylated Shc binds Grb2 (14) which enables the interaction with Sos and the activation
of the Ras pathway (15) . The phosphorylated 145-kDa protein,
whose function is not known, appears to interact with the amino
terminus of Shc(13) . Mitogen-activated protein (MAP) kinase
(pp42) is phosphorylated and activated by the addition of the IL-3 or
GM-CSF to factor-dependent cell lines(16, 17) . In
addition, other proteins known to be phosphorylated after the addition
of GM-CSF or IL-3 include Vav (18) and Raf-1(19) .
Using truncation mutants of the One downstream effect of Jak stimulation is the activation of signal
transduction and activation of transcription (STAT) proteins. These
proteins are phosphorylated in the cytosol on tyrosine and then
translocate to the nucleus where they bind to DNA or DNA-binding
proteins and enhance the transcription of specific gene products. The
addition of interferon- One approach to understanding the function of the Jak2
protein is to isolate the activation of this protein kinase from other
growth factor-induced signals. To accomplish this task, we have made a
fusion protein of the external domain of CD16, the transmembrane domain
of CD7, and the complete coding sequence of Jak2. To obtain high levels
of expression in hematopoietic cells, this fusion cDNA was encoded in a
vaccinia virus. Our results demonstrate that cross-linking and
activation of the membrane-bound Jak2 fusion protein mimic many of the
biologic effects of the addition of hormone (IL-3 or GM-CSF), i.e. phosphorylation of multiple proteins, induction of mRNAs, and
increases in STAT binding. Differences remain between the biologic
activity of the fusion protein and that observed at the addition of
hormone. In particular, unlike hormone, CD16/Jak2 fusion was unable to
stimulate increases in c-myc, a mRNA that is essential for
growth.
Figure 1:
Construction
and expression of CD16/Jak2 fusion protein. Panel A, schematic
diagram of CD16/Jak2 recombinant plasmid. Panel B, cell
surface expression of CD16 antigen in Ba/F3 cells infected with
recombinant vaccinia virus. Ba/F3 cells and Ba/F3 cells infected with
recombinant vaccinia virus were incubated with a CD16 antibody followed
by fluorescein-tagged goat anti-mouse IgG F(ab`)
Figure 2:
Time
course of tyrosine phosphorylation induced by activation of CD16/Jak2
or stimulation by WEHI-3B conditioned medium (CM). Ba/F3 cells
infected with recombinant vaccinia virus were starved for 4 h in
Dulbecco's modified Eagle's medium with 0.5% bovine serum
albumin and cross-linked with anti-CD16 antibody for 0-60 min
prior to lysis. Lysates were resolved by SDS-PAGE and immunoblotted
with anti-PY antibody. Ba/F3 cells stimulated with conditioned medium
were also analyzed. The molecular masses are shown on the y axis in kDa. Some of the most prominent tyrosine-phosphorylated
proteins induced by both stimulants are marked by arrows.
Previously, we and others (16, 17) have
demonstrated that the 42-kDa protein phosphorylated after GM-CSF or
IL-3 treatment of Ba/F3 cells is MAP kinase (ERK2). To confirm that the
42-kDa protein tyrosine phosphorylated after CD16/Jak2 cross-linking is
MAP kinase, we cross-linked the CD16/Jak2 expressed in Ba/F3 cells and
did an anti-PY Western blot. This Western blot was stripped and
reprobed with anti-Map kinase antibody. The addition of WEHI-3B
conditioned medium induces a more slowly migrating form of MAP kinase
in 5 min (Fig. 3B) which is still apparent by 30 min.
Overlaying the anti-MAP kinase Western blot over the anti-PY blot
demonstrates that the more slowly migrating band in the doublet is
tyrosine-phosphorylated (Fig. 3, A and B). The
cross-linking of CD16/Jak2 induces tyrosine phosphorylation of MAP
kinase by 5 min. However, less MAP kinase is phosphorylated for a
shorter time than after treatment with WEHI-3B conditioned medium. To
confirm that MAP kinase activity was increased by cross-linking of
CD16/Jak2 an in-gel protein kinase assay was performed using myelin
basic protein as a substrate. Both WEHI-3B conditioned medium and
cross-linking of CD16/Jak2 stimulated the phosphorylation of myelin
basic protein (Fig. 3C). However, the stimulation of
protein kinase activity by WEHI-3B conditioned medium was greater than
that seen after cross-linking.
Figure 3:
Tyrosine phosphorylation of MAP kinase
after stimulation with WEHI-3B conditioned medium (CM) or
activation of CD16/Jak2 kinase. Ba/F3 cells or Ba/F3 cells were
infected with recombinant vaccinia virus, starved for 4 h, and then
stimulated with WEHI-3B conditioned medium or cross-linked with
anti-CD16 antibody for the times shown. Cell lysates were resolved by
SDS-PAGE and immunoblotted with anti-PY antibody (panel A) or
anti-MAP kinase antibody (panel B). The arrow indicates tyrosine-phosphorylated MAP kinase. Panel C,
MAP kinase enzyme activation. Cell lysates (20 µg) were separated
by SDS-PAGE (12%) containing 0.5 mg/ml myelin basic protein. Kinase
assay was performed as described under ``Materials and
Methods.'' The arrow indicates 42-kDa MAP kinase
bands.
Figure 4:
Immunoblot analysis evaluating changes in
tyrosine phosphorylation of
To examine whether tyrosine
phosphorylation of
Figure 5:
Tyrosine phosphorylation of Shc after
cross-linking of CD16/Jak2 in Ba/F3 cells and MO7e cells. Ba/F3 cells (panels A and B) or MO7e cells (panels C and D) were infected with recombinant vaccinia virus, starved for
4 h, and then treated with cytokines (WEHI-3B conditioned medium or
rh-GM-CSF) or cross-linked with anti-CD16 antibody for 15 min. Cell
lysates were precipitated with anti-Shc antibody, resolved by
SDS-PAGE, and immunoblotted with anti-PY antibody (panels A and C) or anti-Shc antibody (panels B and D). Arrows indicate the Shc proteins. The open
arrow indicates 145-kDa tyrosine-phosphorylated protein
coprecipitated with anti-Shc antibody.
Figure 6:
EMSA demonstrate that cross-linking of
CD16/Jak2 induces the protein binding to a GAS oligonucleotide. Ba/F3
cells or Ba/F3 cells infected with recombinant vaccinia virus were
stimulated with WEHI-3B conditioned medium or cross-linked with
anti-CD16 antibody for 15 min after 4 h of starvation. Nuclear extracts
were prepared and DNA-binding complexes were assayed by EMSA, using a
Figure 7:
Northern blots of mRNA after cross-linking
of CD16/Jak2. Panel A, Ba/F3 cells or Ba/F3 cells infected
with recombinant vaccinia virus were starved for 4 h and then
stimulated with WEHI-3B conditioned medium or cross-linked with
anti-CD16 antibody for varying lengths of time. Total RNA was then
extracted, and Northern blots were performed as described under
``Materials and Methods.'' The Northern blot was probed,
stripped, and reprobed with the cDNAs shown on the left side of the figure. Panel B, Ba/F3 cells or Ba/F3 cells
infected with recombinant vaccinia virus were starved for 4 h, and then
both groups of cells were treated with WEHI-3B conditioned medium.
Northern blots were performed as described under ``Materials and
Methods.''
To examine the function of the specific protein kinases in T
cell activation, Kolanus et al.(27) constructed a
fusion of the Syk and ZAP70 tyrosine kinases in which the CD16
extracellular domain, a CD7 transmembrane domain, and the entire
protein tyrosine kinase cDNA were fused and expressed using a vaccinia
virus(27) . Cross-linking of the CD16 induced the tyrosine
phosphorylation of Syk or ZAP70. This activation led to calcium
mobilization. Aggregation of the Syk tyrosine kinase or the Fyn and
ZAP70 tyrosine kinases together led to the initiation of cytolytic
effector function. By being able to activate a single tyrosine kinase
in the absence of T cell receptor activation, it was possible to
dissect the phosphoproteins phosphorylated by each of these protein
kinases. We have applied this approach to the analysis to Jak2
signal transduction by replacing the ZAP70 sequence in these vectors
containing CD16/CD7 with Jak2 and cloning this fusion protein into a
recombinant vaccinia virus, allowing high levels of protein expression.
Cross-linking of the CD16/Jak2 stimulates the phosphorylation of
proteins having a molecular mass of 145, 97, 67, 52, and 42 kDa. These
proteins have been identified previously as substrates phosphorylated
after the addition of growth factors, including IL-3, GM-CSF,
erythropoietin, and growth hormone, all of which are known to activate
Jak2(5, 40, 41, 42) . Cross-linking
of CD16/Jak2 stimulates the phosphorylation of a 200-kDa protein.
Anti-Jak2 antibody coprecipitated this 200-kDa protein along with
CD16/Jak2 fusion protein. To evaluate the possibility that this 200-kDa
protein is of viral origin, we established an NIH-3T3 cell line stably
expressing CD16/Jak2. Cross-linking of CD16/Jak2 in this cell line also
stimulated the phosphorylation of a 200-kDa protein that coprecipitated
with anti-Jak2 antibody, suggesting that this is not a viral protein.
Also, a similar size protein was tyrosine phosphorylated and
coprecipitated with anti-Shc antibody after IL-3 treatment of 32D
cells(43) . Since endogenous Jak2 protein is bound to the first
60 amino acids of the GM-CSF receptor, the transmembrane structure of
this chimeric protein mimics the cellular location of Jak2 when it is
stimulated to phosphorylate its substrates. Interestingly, we did not
find that the CD16/Jak2 chimera phosphorylated endogenous Jak2, thus
suggesting that Jak2 protein must associate with a receptor and be
located at the membrane to be phosphorylated. Also, cross-linking of
the fusion protein did not demonstrate phosphorylation of the One of the proteins phosphorylated after activation
of CD16/Jak2 as well as WEHI-3B conditioned medium treatment is Shc.
Activation of receptor tyrosine kinases such as epidermal growth factor
(EGF; 44), platelet-derived growth factor(45) ,
Fms(46) , and insulin receptor (45) leads to the
tyrosine phosphorylation of Shc proteins. Also, many cytokines such as
IL-3(31, 32, 34) , GM-CSF(34) ,
erythropoietin(30, 32) , steel
factor(31, 32, 34) , and IL-2 (33) also induce tyrosine phosphorylation of Shc, although
their receptors are not tyrosine kinases. We demonstrate that
activation of CD16/Jak2 kinase induces tyrosine phosphorylation of Shc
in both Ba/F3 and MO7e cell lines. Since the Clustering of the CD16/Jak2 protein causes phosphorylation of a
145-kDa tyrosine-phosphorylated protein. This protein
coimmunoprecipitates with Shc. Association of 140-150-kDa
tyrosine-phosphorylated protein with Shc has been reported in several
hematopoietic cell lines, including MO7e, after treatment with several
cytokines such as IL-3(31, 34) , GM-CSF(34) ,
steel factor(31, 34) , erythropoietin (30, 31) and macrophage colony-stimulating
factor(46) . A previous experiment revealed that this 145-kDa
protein is not immunologically related to the Cross-linking
of the chimera activates MAP kinase, although to a lesser extent than
treatment with WEHI-3B conditioned medium. It is possible that the
stimulation of MAP kinase by CD16/Jak2 may be mediated through the
activation of Shc/Grb2 and then the Ras pathway, although the elevated
level of Shc phosphorylation and the small change in MAP kinase
activity might suggest that these proteins are not tightly linked in
Ba/F3 cells. The observation that growth factors induce a more
exaggerated MAP kinase phosphorylation may suggest either that
additional pathways are necessary for full activation or that growth
factors are capable of inhibiting an endogenous MAP kinase phosphatase. Like the addition of WEHI-3B conditioned medium, clustering of the
CD16/Jak2 fusion protein is able to stimulate steady-state increases in
the mRNAs for c-fos and JunB. In contrast,
cross-linking the fusion protein stimulated much greater increases in
c-jun mRNA than that seen after WEHI-3B conditioned medium
treatment. On the other hand, CD16/Jak2 could not stimulate changes in
c-myc, whereas WEHI-3B conditioned medium treatment of cells
markedly induced this mRNA. Vaccinia virus infection does not prevent
the induction of c-myc by WEHI-3B conditioned medium (Fig. 7B), suggesting that the signal created by the
fusion protein is not capable of stimulating changes in this mRNA.
Since the results of CD16/Jak2 clustering and growth factor addition
are very similar, i.e. phosphorylation, STAT protein
activation, etc., it is possible that activation of Jak2 is not
sufficient alone to stimulate an increase in c-myc mRNA. EGF
binds to its receptor on fibroblasts and activates another Jak family
member, Jak1 (49) . When the EGF receptor is transfected into
hematopoietic cells, EGF treatment is able to stimulate tyrosine
phosphorylation of a large number of cellular proteins but is unable to
stimulate growth or increase c-myc levels(50) . When
the cells are transfected with c-myc cDNA, they then become
responsive to EGF-stimulated growth(50) . Also, the
erythropoeitin receptor contains a short amino acid sequence that does
not interact with Jak2 but is required for growth (51), suggesting that
activation of Jak and specific proliferation-related signals may be
separate. Regulation of c-myc may require a more complex set
of growth factor-mediated pathways than Jak2 activation. In summary,
selective activation of Jak2 using CD16/Jak2 chimera in
IL-3/GM-CSF-dependent cell lines induces a set of
tyrosine-phosphorylated proteins similar to those stimulated by IL-3 or
GM-CSF treatment. Our results indicate that many but not all of the
downstream effects of growth factor addition may be mediated directly
by the Jak2 protein kinase.
Volume 270,
Number 31,
Issue of August 04, pp. 18420-18427, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
chain.
Cross-linking of CD16/Jak2 stimulates the tyrosine phosphorylation of a
large group of proteins that are also phosphorylated after the addition
of IL-3 or GM-CSF and include proteins of 145, 97, 67, 52, and 42 kDa.
Closer analysis demonstrated that the CD16/Jak2 phosphorylates Shc, a
52-kDa protein, and the 145-kDa protein associated tightly with Shc, as
well as mitogen-associated protein kinase (pp42). Electrophoretic
mobility shift assays demonstrate that CD16/Jak2 activates the ability
of signal transduction and activation of transcription (STAT) proteins
to bind to an inferon--activated sequence oligonucleotide in a
manner similar to that seen after IL-3 treatment. Cross-linking of the
CD16/Jak2 protein stimulated increases in c-fos and junB similar to IL-3 but did not cause major changes in the levels of
the c-myc message, which normally increases after IL-3
treatment. Thus, a transmembrane CD16/Jak2 fusion is capable of
activating protein phosphorylation and mRNA transcription in a manner
similar but not identical to hematopoietic growth factors.
)granulocyte-macrophage
colony-stimulating factor (GM-CSF), and interleukin-5 (IL-5) stimulate
their biologic effects by binding to a heterodimeric receptor composed
of an
and
subunit. The
subunits are specific to each
cytokine, whereas the
subunit is shared (
common)(1) . This
common subunit does not bind cytokine,
but it associates with the
subunit to form the high affinity
complex receptor. In humans there is a single
subunit, whereas in
mice there are two highly homologous
chains. One (AIC2B) is
shared by IL-3, IL-5, and GM-CSF(2, 3) , and the other
(AIC2A) is used specifically by IL-3(4) . The
chains do
not have a recognizable intracellular kinase domain, but they interact
with Janus protein kinase 2 (Jak2) and activate its tyrosine kinase
activity(5) . Jak2 binds to the
receptor through a near
membrane proximal region containing a set of conserved residues
``box 1'' and 14 additional amino acids. (
)In
addition to Jak2 other tyrosine kinases,
p93(7) ,
p53/p56
(8, 9) , and
p62
(9) , have also been
implicated in the signal transduction pathway triggered by IL-3 and
GM-CSF.
chain it has been demonstrated
that various regions of the
chain regulate specific signal
transduction pathways(20) . For example, deletion of the
carboxyl-terminal 260 amino acids (
626) prevented the activation
of Ras, Raf-1, MAP kinase, and p70 S6 kinase. Also, in cells containing
this truncation, GM-CSF-induced increases in the levels of c-fos and c-jun mRNAs could not be seen. Smaller truncation
chain mutants containing fewer than 517 amino acids were unable
to induce c-myc and pim1 upon the addition of GM-CSF. to cells activates Jak1 and Jak2 and
causes STAT1 phosphorylation, leading to the transcriptional activation
of a set of proteins, including guanylate-binding protein and Fc
receptor
(21) . These proteins contain a consensus binding
sequence, TTNCNNNAA, called the interferon-
activation site or
-activated sequence (GAS)(22) . In addition to
interferon-
, treating cells with GM-CSF, IL-6, and IL-4 stimulates
the binding of proteins to this GAS (23) . Although a number of
different STAT proteins have been cloned, most recently
STAT4(24) , STAT5(25) , and IL-4 STAT(26) , the
STAT protein that mediates the effects of IL-3 and GM-CSF remains
unknown.
Cell Lines
A murine IL-3-dependent
pro-B cell line, Ba/F3, was a gift from Dr. A. D'Andrea (Dana
Farber Cancer Research Institute, Boston). The cells were maintained in
RPMI 1640 medium with 10% fetal calf serum, 10 µM
2-mercaptoethanol, 20 mM HEPES, pH 7.8, and 10% WEHI-3B
conditioned medium as a source of IL-3. WEHI-3B cells were purchased
from the American Type Culture Collection (Rockville, MD). The human
factor-dependent cell line MO7e was a gift from the Genetics Institute
(Boston). These cells were maintained in RPMI 1640 medium with 10%
fetal calf serum, 1% glutamine, and 100 units/ml recombinant human
(rh)-GM-CSF.Reagents
Monoclonal anti-CD16 antibody
3G8 F(ab`)
was purchased from Medarex, Inc. (Annandale,
NJ). Rabbit anti-mouse IgG F(ab`)
was obtained from Cappel
(Durham, NC), and both the anti-phosphotyrosine (anti-PY) monoclonal
antibody 4G10 and polyclonal antisera to Jak2 were purchased from
Upstate Biotechnology, Inc. (Lake Placid, NY). Affinity-purified
polyclonal antibodies to Shc were obtained from Transduction
Laboratories (Lexington, KY), and horseradish peroxidase-conjugated
second antibodies were purchased from Amersham Corp. Antiserum against
chain was generated in our laboratory as described
previously(16) .Construction of CD16/Jak2
Chimera
Recombinant vaccinia virus transfer vector, which
contains CD16 extracellular domain joined to a short
``stalk'' segment of the transmembrane domain of CD7 and
ZAP70 cDNA, was a gift from Dr. Brian Seed, Massachusetts General
Hospital, Boston. Polymerase chain reaction was used to create an MluI site in the appropriate reading frame in the 5` end of
the murine Jak2 cDNA (a gift from Dr. J. Ihle, St. Jude's
Research Hospital, Memphis, TN). A 3` NotI site in the
3`-noncoding region of Jak2 cDNA was created by polymerase chain
reaction allowing for ligation. ZAP70 cDNA was removed from the
recombinant vector (27) by MluI/NotI
digestion and replaced by Jak2 cDNA. The resulting tripartite fusion
gene was introduced into 1 10
BSC-40 cells by
electroporation (250 volts, 500 microfarads). The following day the
cells were infected with wild type virus at a 0.5 multiplicity of
infection. After a 24-h culture, the cells were harvested and lysed by
freezing and thawing repeated three times. Recombinant vaccinia virus
was selected first with guanine phosphoribosyltransferase selection
followed by thymidine kinase selection as described(28) . The
presence of the recombinant virus was confirmed by polymerase chain
reaction of infected cells.Infection of Recombinant Vaccinia Virus and
Cross-linking
Approximately 1 10
Ba/F3
or MO7e cells were infected for 1 h in serum-free Dulbecco's
modified Eagle's medium with recombinant vaccinia virus at a
multiplicity of infection of 100. After a 12-h incubation in RPMI 1640
medium containing 10% calf serum and 10% WEHI-3B conditioned medium or
rh-GM-CSF, cells were harvested, washed twice with phosphate-buffered
saline, and starved for 4 h in RPMI 1640 medium supplemented with 0.5%
albumin. Cells were resuspended in Dulbecco's modified
Eagle's medium without serum at 10
cells/ml and
incubated with 5 mg/ml anti-CD16 antibody F(ab`)
for 2.5
min followed by incubation with 25 mg/ml anti-mouse IgG F(ab`)
for the indicated times at 37 °C. As a control, uninfected
cells were starved at the same condition and stimulated with 10%
WEHI-3B conditioned medium or rh-GM-CSF.Immunoprecipitation and
Immunoblotting
Approximately 10
cells were
lysed at 4 °C in 1 ml of lysis buffer (1% Triton X-100, 0.15 M NaCl, 0.02 M HEPES, pH 7.3, 5 mM EDTA, 5 mM NaF, 1 mM Na
VO
, and 1 mM phenylmethylsulfonyl fluoride). Unsolubilized material was removed
by centrifugation for 15 min at 12,000 g. The
supernatant was precleared by incubation with protein A-Sepharose beads
for 30 min and then incubated with the indicated antibody for 2 h at 4
°C. The immune complex was then precipitated with protein
A-Sepharose beads for 30 min at 4 °C, washed three times with lysis
buffer, and then boiled for 5 min with 2
Laemmli sample buffer.
The proteins were electrophoresed on an SDS-polyacrylamide gel and
transferred electrophoretically to an Immobilon-P transfer membrane
(Millipore, Bedford, MA). After blocking with 5% bovine serum albumin
(factor V, Sigma), the membrane was incubated with the appropriate
primary antibody and washed three times in Tris-buffered saline
containing 0.1% Tween 20 (TBST). After incubation with secondary
antibody coupled with horseradish peroxidase, the filter was washed
with TBST three times, and immune reactive bands were visualized by the
chemiluminescence system (DuPont NEN).
MAP Kinase Enzyme Assay
In-gel MAP kinase
assay was performed as described previously(20) . Cells were
lysed, and total cellular proteins were separated on SDS-PAGE (12%)
containing 0.5 mg/ml myelin basic protein. SDS was removed from the gel
by shaking in 20% isopropyl alcohol in 50 mM Tris-HCl, pH 8.0,
for 1 h followed by denaturation with 6 M guanidine HCl and
renaturation in a 0.04% Tween 40-containing buffer. The gel was then
incubated with kinase buffer containing 25 µCi of
[-
P]ATP at room temperature for 1 h. After
washing the gel with 5% trichloroacetic acid and 1% sodium
pyrophosphate solution, the gel was dried and visualized by
autoradiography.
Northern Blot Analysis
Northern blots
were carried out as described previously(16) . Twenty µg of
total RNA was run on a 1% agarose/formaldehyde gel and transferred onto
nylon membranes. The hybridization was carried out overnight at 42
°C in solution containing 45% formamide and 10% dextran sulfate.
Blots were washed with 2 SSC (1
SSC = 0.15 M NaCl, 0.015 M sodium citrate), 0.1% SDS at room
temperature for 20 min; 1
SSC, 0.1% SDS at 42 °C for 20
min; and 0.1
SSC, 0.1% SDS at 42 °C for 20 min. The probe
DNAs used in these experiments were described previously(16) .
Preparation of Cell Nuclear Extracts and
Electrophoretic Mobility Shift Assay (EMSA)
Nuclear
extracts were prepared as described(29) . 1 10
cells were rinsed twice with ice-cold phosphate-buffered saline
and suspended with hypotonic buffer (20 mM HEPES, pH 7.9; 20
mM NaF; 1 mM EDTA; 1 mM dithiothreitol; 1
mM Na
VO
; 0.5 mM
phenylmethylsulfonyl fluoride; 1 mg/ml each leupeptin, aprotinin, and
pepstatin) containing 0.2% Nonidet P-40. After incubation for 10 min on
ice, nuclei were precipitated. Nuclear pellets were resuspended with
high salt buffer which contained 420 mM NaCl and 20% glycerol
in addition to the hypotonic buffer. After incubation for 20 min on
ice, extracted proteins were separated from residual nuclei by
centrifugation. The GAS oligonucleotide is based on an interferon GAS
of the interferon regulatory factor-1 promoter and was formed by
annealing oligonucleotides with the sequences GTCGAGATTTCCCCGAAATGA and
TCGACTCATTCGGGGAAATC. The annealed oligonucleotides were labeled by
filling in the overhanging ends with Klenow fragment in the presence of
[
-P]dCTP. The EMSA was performed as
described(23) . Competitive inhibition experiments were
performed with a 50-fold molar excess of the unlabeled
oligonucleotides.
Expression of CD16/CD7/Jak2 Fusion
Protein
To examine the role of Jak2 in the signal
transduction in the absence of IL-3 and GM-CSF, we constructed
CD16/CD7/Jak2 (CD16/Jak2) fusion gene. The external domain of CD16 was
fused to a short region of the CD7 molecule, which functions as a
transmembrane domain to prevent receptor dimerization in the absence of
cross-linking. To the CD16/CD7 fusion the entire Jak2 cDNA sequence was
ligated, thus creating a transmembrane tyrosine kinase (Fig. 1A). To obtain high levels of expression of this
protein in hematopoietic cells, this cDNA was incorporated into a
recombinant vaccinia virus. Ba/F3 cells, a pro-B cell line dependent on
IL-3 for growth, were infected with this recombinant vaccinia virus,
and then 12 h later fluorescence-activated cell sorting analysis was
accomplished using anti-CD16 antibody and fluorescein
isothiocyanate-conjugated anti-mouse IgG. By this technique 80% of the
cells were shown to express the CD16 antigen on their surfaces (Fig. 1B). To examine the production of CD16/Jak2
protein, Ba/F3 cells were infected with recombinant vaccinia virus, and
cellular extracts were Western blotted with an antibody to Jak2. The
Western blot demonstrated a 130-kDa endogenous Jak2 band and a 180-kDa
CD16/Jak2 band which appeared after 5 h of infection and increased
thereafter (Fig. 1C). At 24 h the levels of endogenous
Jak2 and CD16/Jak2 were approximately equal (Fig. 1C).
and
analyzed by flow cytometry. Panel C, expression of CD16/Jak2
fusion protein. Ba/F3 cells were infected with recombinant vaccinia
virus for indicated times, lysed, and subjected to SDS-PAGE followed by
Western blotting with anti-Jak2 antiserum. The arrows indicate
180-kDa CD16/Jak2 bands and 130-kDa endogenous Jak2
bands.
Cross-linking of the CD16/Jak2 Fusion Protein Induces
Tyrosine Phosphorylation of Proteins Similar to Those Induced by
IL-3
To determine whether clustering of CD16/Jak2 fusion
proteins induces tyrosine phosphorylation of proteins, Ba/F3 cells were
infected with recombinant vaccinia virus. Ba/F3 cells were chosen for
these studies because their growth depends on the addition of either
IL-3 (WEHI-3B conditioned medium) or GM-CSF(16) . The addition
of growth factors to these cells has been shown to activate Jak2
protein kinases and stimulate the tyrosine phosphorylation of a
specific set of proteins. Twelve hours after infection with the
recombinant vaccinia virus, the Ba/F3 cells were treated, starved of
both serum and IL-3 (conditioned medium) for 4 h, and then the
CD16/Jak2 fusion proteins were clustered by cross-linking with
anti-CD16 antibody followed by anti-mouse IgG. At specific times after
the addition of cross-linker, Ba/F3 cells were lysed, and the presence
of tyrosine-phosphorylated proteins was analyzed by SDS-PAGE followed
by Western transfer and probing with an anti-PY antibody. Cross-linking
of the CD16/Jak2 fusion stimulated the rapid phosphorylation of 220-,
200-, 145-, 120-, 97-, 67-, and 42-kDa proteins (Fig. 2).
Phosphorylation of the majority of these proteins occurs rapidly and is
evident within 2.5 min, persisting in most cases for greater than 60
min. A highly similar phosphorylation pattern is induced after the
addition of WEHI-3B conditioned medium to the Ba/F3 cells. WEHI-3B
conditioned medium induces the 145-, 97-, 67-, and 42-kDa proteins,
whereas the 220-, 200-, and 120-kDa proteins are not seen. The time
course of phosphorylation of these proteins differs between the cells
containing the cross-linked fusion protein and those with the hormone
treatment. For example the addition of WEHI-3B conditioned medium
induced the phosphorylation of the 67-kDa protein within 15 min,
whereas cross-linking of CD16/Jak2 fusion stimulated phosphorylation
within 2.5 min. Thus, cross-linking of a transmembrane CD16/Jak2 fusion
protein stimulates the phosphorylation of a set of proteins similar to
those phosphorylated after the addition of growth factors to these
cells.
Clustering of CD16/Jak2 Fusion Proteins Does Not
Induce Tyrosine Phosphorylation of Endogenous Jak2 or the
It is possible that the cross-linking of the CD16/Jak2
fusion mediates its effect on signal transduction pathways by
stimulating either the phosphorylation of endogenous Jak2 or the
Chain
chain. It has been hypothesized that phosphorylation of the
chain
could activate signal transduction by creating a binding site for SH2
domain-containing proteins. To exclude this possibility, both CD16/Jak2
and endogenous Jak2 were precipitated from Ba/F3 cells infected with
recombinant vaccinia virus using anti-Jak2 antibody. Tyrosine
phosphorylation of these proteins was examined by anti-PY antibody
Western blotting before and after cross-linking. The 180-kDa CD16/Jak2
fusion proteins were strongly tyrosine phosphorylated after
cross-linking (Fig. 4A). No tyrosine phosphorylation of
endogenous Jak2 was seen. After cross-linking, an unknown 200-kDa
tyrosine-phosphorylated protein coprecipitated with CD16/Jak2.
Coprecipitation of this protein was also seen in MO7e cells (data not
shown). In contrast, the addition of conditioned medium (IL-3)
stimulated the phosphorylation of Jak2. Stripping this Western blot and
reprobing with Jak2 antiserum demonstrated equivalent amounts of Jak2
in all lanes (data not shown).
chain and Jak2 in cytokine
stimulation or CD16/Jak2 activation. Panel A, Ba/F3 cells or
Ba/F3 cells infected with recombinant vaccinia virus were starved for 4
h and then stimulated with conditioned medium (CM) or
cross-linked with anti-CD16 antibody for 15 min. Cell lysates were
precipitated with anti-Jak2 antibody, resolved by SDS-PAGE, and
immunoblotted with anti-PY antibody. Arrows indicate CD16/Jak2
and endogenous Jak2 band. Panel B, MO7e or MO7e cells infected
with recombinant vaccinia virus were stimulated with rh-GM-CSF or
cross-linked with anti-CD16 antibody for 15 min. Cell lysates were
precipitated with anti-
chain antiserum, resolved by SDS-PAGE, and
immunoblotted with anti-PY antibody.
chain occurred after cross-linking of
CD16/Jak2 in MO7e cells, a GM-CSF-dependent human cell line was
infected with the recombinant vaccinia virus. This cell line was chosen
for these experiments because of the availability in our laboratory of
an immunoprecipitating antibody to the human
chain. As with
previous experiments, after infection the cells were starved of growth
factors for 4 h followed by cross-linking of the CD16/Jak2 fusion
proteins. Cell lysates were immunoprecipitated with anti-
antibody
followed by Western blotting with anti-PY antibody. The addition of
rh-GM-CSF to MO7e cells stimulated tyrosine phosphorylation of the
130-kDa
chain (Fig. 4B). However, cross- linking
of CD16/Jak2 did not cause any effect on the phosphorylation of the
chain. To confirm that cross-linking stimulated phosphorylation,
aliquots of cell lysates were also analyzed by Western blotting with
anti-PY antibody. The appearance of additional phosphorylated bands
after cross-linking demonstrates that CD16/Jak2 was active in these
cells (data not shown). Thus, the CD16/Jak2 protein is capable of
stimulating the phosphorylation of a wide range of proteins, but it
does not cause the phosphorylation of either endogenous Jak2 or the
chain.CD16/Jak2 Fusion Protein Phosphorylates Shc and a
145-kDa Protein
Shc is an SH2 domain-containing protein
that is tyrosine phosphorylated after stimulation of cells with a wide
variety of cytokines, including GM-CSF and
IL-3(30, 31, 32, 33, 34) .
Shc contains a Grb2 binding site, which enables it to interact with the
Ras pathway and regulate activation of MAP kinase(15) .
Cross-linking of the CD16/Jak2 fusion proteins in either Ba/F3 (Fig. 5, A and B) or MO7e cells (Fig. 5, C and D) induces the tyrosine
phosphorylation of Shc, as demonstrated by immunoprecipitation of Shc
followed by Western blotting with anti-PY. Stripping of this blot and
probing with anti-Shc antibody demonstrate that equivalent amounts of
Shc protein have been precipitated in both treated and untreated cells (Fig. 5). In Ba/F3 cells, Shc immunoprecipitation pulls down a
tyrosine-phosphorylated 145-kDa protein. Recently it has been
demonstrated that a tyrosine-phosphorylated 145-kDa protein binds to
the amino terminus of Shc in platelet-derived growth factor-stimulated
cells(13) . It is possible that the 145-kDa protein mediates
the interaction between CD16/JAK2 and the Shc protein.
Cross-linking of CD16/Jak2 Stimulates the Binding of
Proteins to the GAS
Recently, a number of STAT proteins
have been
cloned(24, 25, 26, 35, 36) .
The binding of growth factors, i.e. IL-6 or erythropoietin, or
interferons-
and - to their receptors stimulates the tyrosine
phosphorylation of these STAT proteins in the
cytosol(37, 38, 39) . STAT proteins whose
phosphorylation is stimulated by interferon-
bind to the GAS whose
consensus is TTNCNNAA(22) . Likewise, IL-3 and GM-CSF have been
shown to induce phosphorylation on the tyrosine of STAT proteins that
bind to the GAS probe(23) . To examine whether activation of
CD16/Jak2 is also capable of inducing this activity, nuclear extracts
were prepared from Ba/F3 cells infected with recombinant vaccinia virus
before and 15 min after cross-linking. As a control, cells were treated
with WEHI-3B conditioned medium for 15 min, and nuclear extracts were
made. EMSA was performed with oligonucleotides containing the GAS of
interferon regulatory factor-1 (24) and these nuclear
extracts. Stimulation by either the CD16/Jak2 or the addition of
hormone induces the appearance of a similar set of retarded complexes (Fig. 6). These complexes are competed by the addition of a 50
molar excess of unlabeled GAS oligonucleotides, demonstrating
that the binding is specific. Thus, even though CD16/Jak2 protein is
bound to the cell membrane, cross-linking is able to activate STAT
proteins.
P-labeled GAS probe alone or in the presence of 50-fold
molar excess of unlabeled GAS oligonucleotide. The retarded DNA-binding
complexes are shown by an arrow.
Activation of CD16/Jak2 Fusion Proteins Induces
Increases in the Cellular Levels of Immediate-Early Response Genes but
Not myc
Previously we have demonstrated (16) that
the addition of GM-CSF or IL-3 to Ba/F3 cells induces a rapid
accumulation in the immediate-early response genes, i.e. c-fos, junB etc. To examine whether
changes in the levels of mRNAs were induced by clustering of CD16/Jak2
fusion proteins, Ba/F3 cells infected with recombinant vaccinia virus
were cross-linked with anti-CD16 antibody for various times, and total
RNAs were isolated. These RNAs were run on an agarose gel and
transferred to nylon membrane; the filter was then probed, stripped,
and reprobed with several cDNAs. As a control, total RNA was isolated
from Ba/F3 cells stimulated for varying periods of time with WEHI-3B
conditioned medium (IL-3). As seen on Northern blots (Fig. 7A), clustering of CD16 induces slightly less of
an increase in the levels of c-fosand junBthan that seen after the addition of WEHI-3B conditioned
medium (Fig. 7A). Although both cross-linking and the
addition of WEHI-3B conditioned medium cause increases in c-junlevels, the effect of cross-linking CD16/Jak2 is much more
pronounced. The reverse was true for c-myc levels (Fig. 7A). The addition of WEHI-3B conditioned medium
stimulated a large increase in this mRNA, whereas the cross-linking of
CD16/Jak2 had almost no effect on c-myc levels. To exclude the
possibility that vaccinia virus infection prevents the induction of
c-myc, Ba/F3 cells were infected with recombinant vaccinia
virus and then stimulated with WEHI-3B conditioned medium. The level of
fusion protein mRNA is similar in both viral infections (Fig. 7, A and B) as demonstrated by the CD16 Northern blot.
Although the level of c-myc induction is slightly depressed,
vaccinia virus infection does not block the increase in c-myc levels demonstrated after the addition of WEHI-3B conditioned
medium (IL-3) (Fig. 7B).
chain, suggesting that the observed biologic changes were not being
mediated by stimulating the creation of SH2 protein binding sites on
the
chain.
chain of the GM-CSF
receptor is not phosphorylated, it is unlikely that Shc phosphorylation
is secondary to physical association with this receptor. By comparing
the sequence of the Trk transmembrane tyrosine kinase and the polyoma
middle T protein, a consensus binding sequence for Shc of NPXY
has been hypothesized(47) . Interestingly, neither Jak2 nor the
chain contains this sequence. A carboxyl truncation of the
chain to residue 626 of GM-CSF receptor could not be stimulated by
GM-CSF to activate Shc or the Ras pathway but stimulated Jak2
phosphorylation(5, 20) . In contrast, a mutant EGF
receptor lacking all autophosphorylation sites was still able to induce
tyrosine phosphorylation of Shc, complex formation of Shc-Grb2, and
activation of MAP kinase after stimulation of EGF in fibroblast,
although tyrosine phosphorylation of the receptor itself, Ras-GTPase
activating protein complex formation, and phospholipase C- were
dramatically reduced(48) . These results, including those with
the CD16/Jak2 chimera, suggest alternative pathways for Shc activation.
chain, c-Kit,
mSos1or Jak family member(31) . Recent data suggest that the
pp145 protein associates with the amino-terminal portion of
Shc(13) . It is possible that the pp145 protein mediates some
interaction with Jak which allows Shc phosphorylation.
-activated sequence; rh, recombinant human;
anti-PY, anti-phosphotyrosine; PAGE, polyacrylamide gel
electrophoresis; EMSA, electrophoresis mobility shift assay; EGF,
epidermal growth factor.
We acknowledge the help of the laboratories of Drs. B.
Seed (Massachusetts General Hospital) and J. Kudlow (University of
Alabama). We thank Dr. B. Weaver for editorial assistance.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
I. Sakai, K. Takeuchi, H. Yamauchi, H. Narumi, and S. Fujita Constitutive expression of SOCS3 confers resistance to IFN-alpha in chronic myelogenous leukemia cells Blood, September 26, 2002; 100(8): 2926 - 2931. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. G. Drachman, Y. Miyakawa, J. N. Luthi, D. D. Dahlen, A. Raney, A. E. Geddis, and K. Kaushansky Studies with Chimeric Mpl/JAK2 Receptors Indicate That Both JAK2 and the Membrane-proximal Domain of Mpl Are Required for Cellular Proliferation J. Biol. Chem., June 21, 2002; 277(26): 23544 - 23553. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. C. Orban, M. K. Levings, and J. W. Schrader Heterodimerization of the alpha and beta Chains of the Interleukin-3 (IL-3) Receptor Is Necessary and Sufficient for IL-3-Induced Mitogenesis Blood, September 1, 1999; 94(5): 1614 - 1622. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. S. Watowich, K. D. Liu, X. Xie, S. Y. Lai, A. Mikami, G. D. Longmore, and M. A. Goldsmith Oligomerization and Scaffolding Functions of the Erythropoietin Receptor Cytoplasmic Tail J. Biol. Chem., February 26, 1999; 274(9): 5415 - 5421. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. C. Gregory, N. Jiang, K. Todokoro, J. Crouse, R. E. Pacifici, and D. M. Wojchowski Erythropoietin Receptor and STAT5-Specific Pathways Promote SKT6 Cell Hemoglobinization Blood, August 15, 1998; 92(4): 1104 - 1118. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. E. Bates, W. W. Busse, and P. J. Bertics Interleukin 5 Signals through Shc and Grb2 in Human Eosinophils Am. J. Respir. Cell Mol. Biol., January 1, 1998; 18(1): 75 - 83. [Abstract] [Full Text] |
||||
![]() |
B. P. Ceresa, C. M. Horvath, and J. E. Pessin Signal Transducer and Activator of Transcription-3 Serine Phosphorylation by Insulin Is Mediated by a Ras/Raf/MEK-Dependent Pathway Endocrinology, October 1, 1997; 138(10): 4131 - 4137. [Abstract] [Full Text] [PDF] |
||||
![]() |
P. Peeters, S. D. Raynaud, J. Cools, I. Wlodarska, J. Grosgeorge, P. Philip, F. Monpoux, L. Van Rompaey, M. Baens, H. Van den Berghe, et al. Fusion of TEL, the ETS-Variant Gene 6 (ETV6), to the Receptor-Associated Kinase JAK2 as a Result of t(9; 12) in a Lymphoid and t(9; 15; 12) in a Myeloid Leukemia Blood, October 1, 1997; 90(7): 2535 - 2540. [Abstract] [Full Text] [PDF] |
||||
![]() |
I. Sakai and A. S. Kraft The Kinase Domain of Jak2 Mediates Induction of Bcl-2 and Delays Cell Death in Hematopoietic Cells J. Biol. Chem., May 9, 1997; 272(19): 12350 - 12358. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. Joneja and D. M. Wojchowski Mitogenic Signaling and Inhibition of Apoptosis via the Erythropoietin Receptor Box-1 Domain J. Biol. Chem., April 25, 1997; 272(17): 11176 - 11184. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. H. Nelson, B. C. McIntosh, L. L. Rosencrans, and P. D. Greenberg Requirement for an initial signal from the membrane-proximal region of the interleukin 2 receptor gamma c chain for Janus kinase activation leading to T cell proliferation PNAS, March 4, 1997; 94(5): 1878 - 1883. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Nakamura, H. Chin, N. Miyasaka, and O. Miura An Epidermal Growth Factor Receptor/Jak2 Tyrosine Kinase Domain Chimera Induces Tyrosine Phosphorylation of Stat5 and Transduces a Growth Signal in Hematopoietic Cells J. Biol. Chem., August 9, 1996; 271(32): 19483 - 19488. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. P. Ceresa and J. E. Pessin Insulin Stimulates the Serine Phosphorylation of the Signal Transducer and Activator of Transcription (STAT3) Isoform J. Biol. Chem., May 24, 1996; 271(21): 12121 - 12124. [Abstract] [Full Text] [PDF] |
||||
| |||||||||||||||||||||