JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Sakai, I.
Right arrow Articles by Kraft, A. S.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Sakai, I.
Right arrow Articles by Kraft, A. S.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 31, Issue of August 04, pp. 18420-18427, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Signal Transduction by a CD16/CD7/Jak2 Fusion Protein (*)

(Received for publication, March 14, 1995; and in revised form, June 8, 1995)

Ikuya Sakai Lisle Nabell Andrew S. Kraft (§)

From the Division of Hematology/Oncology, Department of Medicine, University of Alabama, Birmingham, Alabama 35223

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The addition of interleukin-3 (IL-3) and granulocyte-macrophage colony-stimulating factor (GM-CSF) to hormone-dependent cells induces tyrosine phosphorylation of Janus protein kinase 2 (Jak2) and activates its in vitro kinase activity. To explore the role of Jak2 in IL-3/GM-CSF-mediated signal transduction, we constructed a CD16/CD7/Jak2 (CD16/Jak2) fusion gene containing the external domain of CD16 and the entire Jak2 molecule and expressed this fusion protein using a recombinant vaccinia virus. The clustering of CD16/Jak2 fusion protein by cross-linking with an anti-CD16 antibody induced autophosphorylation of the fusion protein but did not induce the phosphorylation of either the endogenous Jak2 or the beta chain. Cross-linking of CD16/Jak2 stimulates the tyrosine phosphorylation of a large group of proteins that are also phosphorylated after the addition of IL-3 or GM-CSF and include proteins of 145, 97, 67, 52, and 42 kDa. Closer analysis demonstrated that the CD16/Jak2 phosphorylates Shc, a 52-kDa protein, and the 145-kDa protein associated tightly with Shc, as well as mitogen-associated protein kinase (pp42). Electrophoretic mobility shift assays demonstrate that CD16/Jak2 activates the ability of signal transduction and activation of transcription (STAT) proteins to bind to an inferon--activated sequence oligonucleotide in a manner similar to that seen after IL-3 treatment. Cross-linking of the CD16/Jak2 protein stimulated increases in c-fos and junB similar to IL-3 but did not cause major changes in the levels of the c-myc message, which normally increases after IL-3 treatment. Thus, a transmembrane CD16/Jak2 fusion is capable of activating protein phosphorylation and mRNA transcription in a manner similar but not identical to hematopoietic growth factors.


INTRODUCTION

Interleukin-3 (IL-3), (^1)granulocyte-macrophage colony-stimulating factor (GM-CSF), and interleukin-5 (IL-5) stimulate their biologic effects by binding to a heterodimeric receptor composed of an alpha and beta subunit. The alpha subunits are specific to each cytokine, whereas the beta subunit is shared (beta common)(1) . This beta common subunit does not bind cytokine, but it associates with the alpha subunit to form the high affinity complex receptor. In humans there is a single beta subunit, whereas in mice there are two highly homologous beta chains. One (AIC2B) is shared by IL-3, IL-5, and GM-CSF(2, 3) , and the other (AIC2A) is used specifically by IL-3(4) . The beta chains do not have a recognizable intracellular kinase domain, but they interact with Janus protein kinase 2 (Jak2) and activate its tyrosine kinase activity(5) . Jak2 binds to the beta receptor through a near membrane proximal region containing a set of conserved residues ``box 1'' and 14 additional amino acids. (^2)In addition to Jak2 other tyrosine kinases, p93(7) , p53/p56(8, 9) , and p62(9) , have also been implicated in the signal transduction pathway triggered by IL-3 and GM-CSF.

The addition of GM-CSF or IL-3 to cells stimulates the tyrosine phosphorylation of large number of proteins having molecular masses of 145, 97, 67, 52, and 42 kDa(10, 11, 12) . The 52-kDa protein has been identified as Shc(13) . Phosphorylated Shc binds Grb2 (14) which enables the interaction with Sos and the activation of the Ras pathway (15) . The phosphorylated 145-kDa protein, whose function is not known, appears to interact with the amino terminus of Shc(13) . Mitogen-activated protein (MAP) kinase (pp42) is phosphorylated and activated by the addition of the IL-3 or GM-CSF to factor-dependent cell lines(16, 17) . In addition, other proteins known to be phosphorylated after the addition of GM-CSF or IL-3 include Vav (18) and Raf-1(19) . Using truncation mutants of the beta chain it has been demonstrated that various regions of the beta chain regulate specific signal transduction pathways(20) . For example, deletion of the carboxyl-terminal 260 amino acids (beta 626) prevented the activation of Ras, Raf-1, MAP kinase, and p70 S6 kinase. Also, in cells containing this truncation, GM-CSF-induced increases in the levels of c-fos and c-jun mRNAs could not be seen. Smaller truncation beta chain mutants containing fewer than 517 amino acids were unable to induce c-myc and pim1 upon the addition of GM-CSF.

One downstream effect of Jak stimulation is the activation of signal transduction and activation of transcription (STAT) proteins. These proteins are phosphorylated in the cytosol on tyrosine and then translocate to the nucleus where they bind to DNA or DNA-binding proteins and enhance the transcription of specific gene products. The addition of interferon- to cells activates Jak1 and Jak2 and causes STAT1 phosphorylation, leading to the transcriptional activation of a set of proteins, including guanylate-binding protein and Fc receptor (21) . These proteins contain a consensus binding sequence, TTNCNNNAA, called the interferon- activation site or -activated sequence (GAS)(22) . In addition to interferon-, treating cells with GM-CSF, IL-6, and IL-4 stimulates the binding of proteins to this GAS (23) . Although a number of different STAT proteins have been cloned, most recently STAT4(24) , STAT5(25) , and IL-4 STAT(26) , the STAT protein that mediates the effects of IL-3 and GM-CSF remains unknown.

One approach to understanding the function of the Jak2 protein is to isolate the activation of this protein kinase from other growth factor-induced signals. To accomplish this task, we have made a fusion protein of the external domain of CD16, the transmembrane domain of CD7, and the complete coding sequence of Jak2. To obtain high levels of expression in hematopoietic cells, this fusion cDNA was encoded in a vaccinia virus. Our results demonstrate that cross-linking and activation of the membrane-bound Jak2 fusion protein mimic many of the biologic effects of the addition of hormone (IL-3 or GM-CSF), i.e. phosphorylation of multiple proteins, induction of mRNAs, and increases in STAT binding. Differences remain between the biologic activity of the fusion protein and that observed at the addition of hormone. In particular, unlike hormone, CD16/Jak2 fusion was unable to stimulate increases in c-myc, a mRNA that is essential for growth.


MATERIALS AND METHODS

Cell Lines

A murine IL-3-dependent pro-B cell line, Ba/F3, was a gift from Dr. A. D'Andrea (Dana Farber Cancer Research Institute, Boston). The cells were maintained in RPMI 1640 medium with 10% fetal calf serum, 10 µM 2-mercaptoethanol, 20 mM HEPES, pH 7.8, and 10% WEHI-3B conditioned medium as a source of IL-3. WEHI-3B cells were purchased from the American Type Culture Collection (Rockville, MD). The human factor-dependent cell line MO7e was a gift from the Genetics Institute (Boston). These cells were maintained in RPMI 1640 medium with 10% fetal calf serum, 1% glutamine, and 100 units/ml recombinant human (rh)-GM-CSF.

Reagents

Monoclonal anti-CD16 antibody 3G8 F(ab`)(2) was purchased from Medarex, Inc. (Annandale, NJ). Rabbit anti-mouse IgG F(ab`)(2) was obtained from Cappel (Durham, NC), and both the anti-phosphotyrosine (anti-PY) monoclonal antibody 4G10 and polyclonal antisera to Jak2 were purchased from Upstate Biotechnology, Inc. (Lake Placid, NY). Affinity-purified polyclonal antibodies to Shc were obtained from Transduction Laboratories (Lexington, KY), and horseradish peroxidase-conjugated second antibodies were purchased from Amersham Corp. Antiserum against beta chain was generated in our laboratory as described previously(16) .

Construction of CD16/Jak2 Chimera

Recombinant vaccinia virus transfer vector, which contains CD16 extracellular domain joined to a short ``stalk'' segment of the transmembrane domain of CD7 and ZAP70 cDNA, was a gift from Dr. Brian Seed, Massachusetts General Hospital, Boston. Polymerase chain reaction was used to create an MluI site in the appropriate reading frame in the 5` end of the murine Jak2 cDNA (a gift from Dr. J. Ihle, St. Jude's Research Hospital, Memphis, TN). A 3` NotI site in the 3`-noncoding region of Jak2 cDNA was created by polymerase chain reaction allowing for ligation. ZAP70 cDNA was removed from the recombinant vector (27) by MluI/NotI digestion and replaced by Jak2 cDNA. The resulting tripartite fusion gene was introduced into 1 10^7 BSC-40 cells by electroporation (250 volts, 500 microfarads). The following day the cells were infected with wild type virus at a 0.5 multiplicity of infection. After a 24-h culture, the cells were harvested and lysed by freezing and thawing repeated three times. Recombinant vaccinia virus was selected first with guanine phosphoribosyltransferase selection followed by thymidine kinase selection as described(28) . The presence of the recombinant virus was confirmed by polymerase chain reaction of infected cells.

Infection of Recombinant Vaccinia Virus and Cross-linking

Approximately 1 10^7 Ba/F3 or MO7e cells were infected for 1 h in serum-free Dulbecco's modified Eagle's medium with recombinant vaccinia virus at a multiplicity of infection of 100. After a 12-h incubation in RPMI 1640 medium containing 10% calf serum and 10% WEHI-3B conditioned medium or rh-GM-CSF, cells were harvested, washed twice with phosphate-buffered saline, and starved for 4 h in RPMI 1640 medium supplemented with 0.5% albumin. Cells were resuspended in Dulbecco's modified Eagle's medium without serum at 10^7 cells/ml and incubated with 5 mg/ml anti-CD16 antibody F(ab`)(2) for 2.5 min followed by incubation with 25 mg/ml anti-mouse IgG F(ab`)(2) for the indicated times at 37 °C. As a control, uninfected cells were starved at the same condition and stimulated with 10% WEHI-3B conditioned medium or rh-GM-CSF.

Immunoprecipitation and Immunoblotting

Approximately 10^7 cells were lysed at 4 °C in 1 ml of lysis buffer (1% Triton X-100, 0.15 M NaCl, 0.02 M HEPES, pH 7.3, 5 mM EDTA, 5 mM NaF, 1 mM Na(3)VO(4), and 1 mM phenylmethylsulfonyl fluoride). Unsolubilized material was removed by centrifugation for 15 min at 12,000 g. The supernatant was precleared by incubation with protein A-Sepharose beads for 30 min and then incubated with the indicated antibody for 2 h at 4 °C. The immune complex was then precipitated with protein A-Sepharose beads for 30 min at 4 °C, washed three times with lysis buffer, and then boiled for 5 min with 2 Laemmli sample buffer. The proteins were electrophoresed on an SDS-polyacrylamide gel and transferred electrophoretically to an Immobilon-P transfer membrane (Millipore, Bedford, MA). After blocking with 5% bovine serum albumin (factor V, Sigma), the membrane was incubated with the appropriate primary antibody and washed three times in Tris-buffered saline containing 0.1% Tween 20 (TBST). After incubation with secondary antibody coupled with horseradish peroxidase, the filter was washed with TBST three times, and immune reactive bands were visualized by the chemiluminescence system (DuPont NEN).

MAP Kinase Enzyme Assay

In-gel MAP kinase assay was performed as described previously(20) . Cells were lysed, and total cellular proteins were separated on SDS-PAGE (12%) containing 0.5 mg/ml myelin basic protein. SDS was removed from the gel by shaking in 20% isopropyl alcohol in 50 mM Tris-HCl, pH 8.0, for 1 h followed by denaturation with 6 M guanidine HCl and renaturation in a 0.04% Tween 40-containing buffer. The gel was then incubated with kinase buffer containing 25 µCi of [-P]ATP at room temperature for 1 h. After washing the gel with 5% trichloroacetic acid and 1% sodium pyrophosphate solution, the gel was dried and visualized by autoradiography.

Northern Blot Analysis

Northern blots were carried out as described previously(16) . Twenty µg of total RNA was run on a 1% agarose/formaldehyde gel and transferred onto nylon membranes. The hybridization was carried out overnight at 42 °C in solution containing 45% formamide and 10% dextran sulfate. Blots were washed with 2 SSC (1 SSC = 0.15 M NaCl, 0.015 M sodium citrate), 0.1% SDS at room temperature for 20 min; 1 SSC, 0.1% SDS at 42 °C for 20 min; and 0.1 SSC, 0.1% SDS at 42 °C for 20 min. The probe DNAs used in these experiments were described previously(16) .

Preparation of Cell Nuclear Extracts and Electrophoretic Mobility Shift Assay (EMSA)

Nuclear extracts were prepared as described(29) . 1 10^7 cells were rinsed twice with ice-cold phosphate-buffered saline and suspended with hypotonic buffer (20 mM HEPES, pH 7.9; 20 mM NaF; 1 mM EDTA; 1 mM dithiothreitol; 1 mM Na(3)VO(4); 0.5 mM phenylmethylsulfonyl fluoride; 1 mg/ml each leupeptin, aprotinin, and pepstatin) containing 0.2% Nonidet P-40. After incubation for 10 min on ice, nuclei were precipitated. Nuclear pellets were resuspended with high salt buffer which contained 420 mM NaCl and 20% glycerol in addition to the hypotonic buffer. After incubation for 20 min on ice, extracted proteins were separated from residual nuclei by centrifugation. The GAS oligonucleotide is based on an interferon GAS of the interferon regulatory factor-1 promoter and was formed by annealing oligonucleotides with the sequences GTCGAGATTTCCCCGAAATGA and TCGACTCATTCGGGGAAATC. The annealed oligonucleotides were labeled by filling in the overhanging ends with Klenow fragment in the presence of [alpha-P]dCTP. The EMSA was performed as described(23) . Competitive inhibition experiments were performed with a 50-fold molar excess of the unlabeled oligonucleotides.


RESULTS

Expression of CD16/CD7/Jak2 Fusion Protein

To examine the role of Jak2 in the signal transduction in the absence of IL-3 and GM-CSF, we constructed CD16/CD7/Jak2 (CD16/Jak2) fusion gene. The external domain of CD16 was fused to a short region of the CD7 molecule, which functions as a transmembrane domain to prevent receptor dimerization in the absence of cross-linking. To the CD16/CD7 fusion the entire Jak2 cDNA sequence was ligated, thus creating a transmembrane tyrosine kinase (Fig. 1A). To obtain high levels of expression of this protein in hematopoietic cells, this cDNA was incorporated into a recombinant vaccinia virus. Ba/F3 cells, a pro-B cell line dependent on IL-3 for growth, were infected with this recombinant vaccinia virus, and then 12 h later fluorescence-activated cell sorting analysis was accomplished using anti-CD16 antibody and fluorescein isothiocyanate-conjugated anti-mouse IgG. By this technique 80% of the cells were shown to express the CD16 antigen on their surfaces (Fig. 1B). To examine the production of CD16/Jak2 protein, Ba/F3 cells were infected with recombinant vaccinia virus, and cellular extracts were Western blotted with an antibody to Jak2. The Western blot demonstrated a 130-kDa endogenous Jak2 band and a 180-kDa CD16/Jak2 band which appeared after 5 h of infection and increased thereafter (Fig. 1C). At 24 h the levels of endogenous Jak2 and CD16/Jak2 were approximately equal (Fig. 1C).


Figure 1: Construction and expression of CD16/Jak2 fusion protein. Panel A, schematic diagram of CD16/Jak2 recombinant plasmid. Panel B, cell surface expression of CD16 antigen in Ba/F3 cells infected with recombinant vaccinia virus. Ba/F3 cells and Ba/F3 cells infected with recombinant vaccinia virus were incubated with a CD16 antibody followed by fluorescein-tagged goat anti-mouse IgG F(ab`)(2) and analyzed by flow cytometry. Panel C, expression of CD16/Jak2 fusion protein. Ba/F3 cells were infected with recombinant vaccinia virus for indicated times, lysed, and subjected to SDS-PAGE followed by Western blotting with anti-Jak2 antiserum. The arrows indicate 180-kDa CD16/Jak2 bands and 130-kDa endogenous Jak2 bands.



Cross-linking of the CD16/Jak2 Fusion Protein Induces Tyrosine Phosphorylation of Proteins Similar to Those Induced by IL-3

To determine whether clustering of CD16/Jak2 fusion proteins induces tyrosine phosphorylation of proteins, Ba/F3 cells were infected with recombinant vaccinia virus. Ba/F3 cells were chosen for these studies because their growth depends on the addition of either IL-3 (WEHI-3B conditioned medium) or GM-CSF(16) . The addition of growth factors to these cells has been shown to activate Jak2 protein kinases and stimulate the tyrosine phosphorylation of a specific set of proteins. Twelve hours after infection with the recombinant vaccinia virus, the Ba/F3 cells were treated, starved of both serum and IL-3 (conditioned medium) for 4 h, and then the CD16/Jak2 fusion proteins were clustered by cross-linking with anti-CD16 antibody followed by anti-mouse IgG. At specific times after the addition of cross-linker, Ba/F3 cells were lysed, and the presence of tyrosine-phosphorylated proteins was analyzed by SDS-PAGE followed by Western transfer and probing with an anti-PY antibody. Cross-linking of the CD16/Jak2 fusion stimulated the rapid phosphorylation of 220-, 200-, 145-, 120-, 97-, 67-, and 42-kDa proteins (Fig. 2). Phosphorylation of the majority of these proteins occurs rapidly and is evident within 2.5 min, persisting in most cases for greater than 60 min. A highly similar phosphorylation pattern is induced after the addition of WEHI-3B conditioned medium to the Ba/F3 cells. WEHI-3B conditioned medium induces the 145-, 97-, 67-, and 42-kDa proteins, whereas the 220-, 200-, and 120-kDa proteins are not seen. The time course of phosphorylation of these proteins differs between the cells containing the cross-linked fusion protein and those with the hormone treatment. For example the addition of WEHI-3B conditioned medium induced the phosphorylation of the 67-kDa protein within 15 min, whereas cross-linking of CD16/Jak2 fusion stimulated phosphorylation within 2.5 min. Thus, cross-linking of a transmembrane CD16/Jak2 fusion protein stimulates the phosphorylation of a set of proteins similar to those phosphorylated after the addition of growth factors to these cells.


Figure 2: Time course of tyrosine phosphorylation induced by activation of CD16/Jak2 or stimulation by WEHI-3B conditioned medium (CM). Ba/F3 cells infected with recombinant vaccinia virus were starved for 4 h in Dulbecco's modified Eagle's medium with 0.5% bovine serum albumin and cross-linked with anti-CD16 antibody for 0-60 min prior to lysis. Lysates were resolved by SDS-PAGE and immunoblotted with anti-PY antibody. Ba/F3 cells stimulated with conditioned medium were also analyzed. The molecular masses are shown on the y axis in kDa. Some of the most prominent tyrosine-phosphorylated proteins induced by both stimulants are marked by arrows.



Previously, we and others (16, 17) have demonstrated that the 42-kDa protein phosphorylated after GM-CSF or IL-3 treatment of Ba/F3 cells is MAP kinase (ERK2). To confirm that the 42-kDa protein tyrosine phosphorylated after CD16/Jak2 cross-linking is MAP kinase, we cross-linked the CD16/Jak2 expressed in Ba/F3 cells and did an anti-PY Western blot. This Western blot was stripped and reprobed with anti-Map kinase antibody. The addition of WEHI-3B conditioned medium induces a more slowly migrating form of MAP kinase in 5 min (Fig. 3B) which is still apparent by 30 min. Overlaying the anti-MAP kinase Western blot over the anti-PY blot demonstrates that the more slowly migrating band in the doublet is tyrosine-phosphorylated (Fig. 3, A and B). The cross-linking of CD16/Jak2 induces tyrosine phosphorylation of MAP kinase by 5 min. However, less MAP kinase is phosphorylated for a shorter time than after treatment with WEHI-3B conditioned medium. To confirm that MAP kinase activity was increased by cross-linking of CD16/Jak2 an in-gel protein kinase assay was performed using myelin basic protein as a substrate. Both WEHI-3B conditioned medium and cross-linking of CD16/Jak2 stimulated the phosphorylation of myelin basic protein (Fig. 3C). However, the stimulation of protein kinase activity by WEHI-3B conditioned medium was greater than that seen after cross-linking.


Figure 3: Tyrosine phosphorylation of MAP kinase after stimulation with WEHI-3B conditioned medium (CM) or activation of CD16/Jak2 kinase. Ba/F3 cells or Ba/F3 cells were infected with recombinant vaccinia virus, starved for 4 h, and then stimulated with WEHI-3B conditioned medium or cross-linked with anti-CD16 antibody for the times shown. Cell lysates were resolved by SDS-PAGE and immunoblotted with anti-PY antibody (panel A) or anti-MAP kinase antibody (panel B). The arrow indicates tyrosine-phosphorylated MAP kinase. Panel C, MAP kinase enzyme activation. Cell lysates (20 µg) were separated by SDS-PAGE (12%) containing 0.5 mg/ml myelin basic protein. Kinase assay was performed as described under ``Materials and Methods.'' The arrow indicates 42-kDa MAP kinase bands.



Clustering of CD16/Jak2 Fusion Proteins Does Not Induce Tyrosine Phosphorylation of Endogenous Jak2 or the beta Chain

It is possible that the cross-linking of the CD16/Jak2 fusion mediates its effect on signal transduction pathways by stimulating either the phosphorylation of endogenous Jak2 or the beta chain. It has been hypothesized that phosphorylation of the beta chain could activate signal transduction by creating a binding site for SH2 domain-containing proteins. To exclude this possibility, both CD16/Jak2 and endogenous Jak2 were precipitated from Ba/F3 cells infected with recombinant vaccinia virus using anti-Jak2 antibody. Tyrosine phosphorylation of these proteins was examined by anti-PY antibody Western blotting before and after cross-linking. The 180-kDa CD16/Jak2 fusion proteins were strongly tyrosine phosphorylated after cross-linking (Fig. 4A). No tyrosine phosphorylation of endogenous Jak2 was seen. After cross-linking, an unknown 200-kDa tyrosine-phosphorylated protein coprecipitated with CD16/Jak2. Coprecipitation of this protein was also seen in MO7e cells (data not shown). In contrast, the addition of conditioned medium (IL-3) stimulated the phosphorylation of Jak2. Stripping this Western blot and reprobing with Jak2 antiserum demonstrated equivalent amounts of Jak2 in all lanes (data not shown).


Figure 4: Immunoblot analysis evaluating changes in tyrosine phosphorylation of beta chain and Jak2 in cytokine stimulation or CD16/Jak2 activation. Panel A, Ba/F3 cells or Ba/F3 cells infected with recombinant vaccinia virus were starved for 4 h and then stimulated with conditioned medium (CM) or cross-linked with anti-CD16 antibody for 15 min. Cell lysates were precipitated with anti-Jak2 antibody, resolved by SDS-PAGE, and immunoblotted with anti-PY antibody. Arrows indicate CD16/Jak2 and endogenous Jak2 band. Panel B, MO7e or MO7e cells infected with recombinant vaccinia virus were stimulated with rh-GM-CSF or cross-linked with anti-CD16 antibody for 15 min. Cell lysates were precipitated with anti-beta chain antiserum, resolved by SDS-PAGE, and immunoblotted with anti-PY antibody.



To examine whether tyrosine phosphorylation of beta chain occurred after cross-linking of CD16/Jak2 in MO7e cells, a GM-CSF-dependent human cell line was infected with the recombinant vaccinia virus. This cell line was chosen for these experiments because of the availability in our laboratory of an immunoprecipitating antibody to the human beta chain. As with previous experiments, after infection the cells were starved of growth factors for 4 h followed by cross-linking of the CD16/Jak2 fusion proteins. Cell lysates were immunoprecipitated with anti-beta antibody followed by Western blotting with anti-PY antibody. The addition of rh-GM-CSF to MO7e cells stimulated tyrosine phosphorylation of the 130-kDa beta chain (Fig. 4B). However, cross- linking of CD16/Jak2 did not cause any effect on the phosphorylation of the beta chain. To confirm that cross-linking stimulated phosphorylation, aliquots of cell lysates were also analyzed by Western blotting with anti-PY antibody. The appearance of additional phosphorylated bands after cross-linking demonstrates that CD16/Jak2 was active in these cells (data not shown). Thus, the CD16/Jak2 protein is capable of stimulating the phosphorylation of a wide range of proteins, but it does not cause the phosphorylation of either endogenous Jak2 or the beta chain.

CD16/Jak2 Fusion Protein Phosphorylates Shc and a 145-kDa Protein

Shc is an SH2 domain-containing protein that is tyrosine phosphorylated after stimulation of cells with a wide variety of cytokines, including GM-CSF and IL-3(30, 31, 32, 33, 34) . Shc contains a Grb2 binding site, which enables it to interact with the Ras pathway and regulate activation of MAP kinase(15) . Cross-linking of the CD16/Jak2 fusion proteins in either Ba/F3 (Fig. 5, A and B) or MO7e cells (Fig. 5, C and D) induces the tyrosine phosphorylation of Shc, as demonstrated by immunoprecipitation of Shc followed by Western blotting with anti-PY. Stripping of this blot and probing with anti-Shc antibody demonstrate that equivalent amounts of Shc protein have been precipitated in both treated and untreated cells (Fig. 5). In Ba/F3 cells, Shc immunoprecipitation pulls down a tyrosine-phosphorylated 145-kDa protein. Recently it has been demonstrated that a tyrosine-phosphorylated 145-kDa protein binds to the amino terminus of Shc in platelet-derived growth factor-stimulated cells(13) . It is possible that the 145-kDa protein mediates the interaction between CD16/JAK2 and the Shc protein.


Figure 5: Tyrosine phosphorylation of Shc after cross-linking of CD16/Jak2 in Ba/F3 cells and MO7e cells. Ba/F3 cells (panels A and B) or MO7e cells (panels C and D) were infected with recombinant vaccinia virus, starved for 4 h, and then treated with cytokines (WEHI-3B conditioned medium or rh-GM-CSF) or cross-linked with anti-CD16 antibody for 15 min. Cell lysates were precipitated with anti-Shc antibody, resolved by SDS-PAGE, and immunoblotted with anti-PY antibody (panels A and C) or anti-Shc antibody (panels B and D). Arrows indicate the Shc proteins. The open arrow indicates 145-kDa tyrosine-phosphorylated protein coprecipitated with anti-Shc antibody.



Cross-linking of CD16/Jak2 Stimulates the Binding of Proteins to the GAS

Recently, a number of STAT proteins have been cloned(24, 25, 26, 35, 36) . The binding of growth factors, i.e. IL-6 or erythropoietin, or interferons-alpha and - to their receptors stimulates the tyrosine phosphorylation of these STAT proteins in the cytosol(37, 38, 39) . STAT proteins whose phosphorylation is stimulated by interferon- bind to the GAS whose consensus is TTNCNNAA(22) . Likewise, IL-3 and GM-CSF have been shown to induce phosphorylation on the tyrosine of STAT proteins that bind to the GAS probe(23) . To examine whether activation of CD16/Jak2 is also capable of inducing this activity, nuclear extracts were prepared from Ba/F3 cells infected with recombinant vaccinia virus before and 15 min after cross-linking. As a control, cells were treated with WEHI-3B conditioned medium for 15 min, and nuclear extracts were made. EMSA was performed with oligonucleotides containing the GAS of interferon regulatory factor-1 (24) and these nuclear extracts. Stimulation by either the CD16/Jak2 or the addition of hormone induces the appearance of a similar set of retarded complexes (Fig. 6). These complexes are competed by the addition of a 50 molar excess of unlabeled GAS oligonucleotides, demonstrating that the binding is specific. Thus, even though CD16/Jak2 protein is bound to the cell membrane, cross-linking is able to activate STAT proteins.


Figure 6: EMSA demonstrate that cross-linking of CD16/Jak2 induces the protein binding to a GAS oligonucleotide. Ba/F3 cells or Ba/F3 cells infected with recombinant vaccinia virus were stimulated with WEHI-3B conditioned medium or cross-linked with anti-CD16 antibody for 15 min after 4 h of starvation. Nuclear extracts were prepared and DNA-binding complexes were assayed by EMSA, using a P-labeled GAS probe alone or in the presence of 50-fold molar excess of unlabeled GAS oligonucleotide. The retarded DNA-binding complexes are shown by an arrow.



Activation of CD16/Jak2 Fusion Proteins Induces Increases in the Cellular Levels of Immediate-Early Response Genes but Not myc

Previously we have demonstrated (16) that the addition of GM-CSF or IL-3 to Ba/F3 cells induces a rapid accumulation in the immediate-early response genes, i.e. c-fos, junB etc. To examine whether changes in the levels of mRNAs were induced by clustering of CD16/Jak2 fusion proteins, Ba/F3 cells infected with recombinant vaccinia virus were cross-linked with anti-CD16 antibody for various times, and total RNAs were isolated. These RNAs were run on an agarose gel and transferred to nylon membrane; the filter was then probed, stripped, and reprobed with several cDNAs. As a control, total RNA was isolated from Ba/F3 cells stimulated for varying periods of time with WEHI-3B conditioned medium (IL-3). As seen on Northern blots (Fig. 7A), clustering of CD16 induces slightly less of an increase in the levels of c-fosand junBthan that seen after the addition of WEHI-3B conditioned medium (Fig. 7A). Although both cross-linking and the addition of WEHI-3B conditioned medium cause increases in c-junlevels, the effect of cross-linking CD16/Jak2 is much more pronounced. The reverse was true for c-myc levels (Fig. 7A). The addition of WEHI-3B conditioned medium stimulated a large increase in this mRNA, whereas the cross-linking of CD16/Jak2 had almost no effect on c-myc levels. To exclude the possibility that vaccinia virus infection prevents the induction of c-myc, Ba/F3 cells were infected with recombinant vaccinia virus and then stimulated with WEHI-3B conditioned medium. The level of fusion protein mRNA is similar in both viral infections (Fig. 7, A and B) as demonstrated by the CD16 Northern blot. Although the level of c-myc induction is slightly depressed, vaccinia virus infection does not block the increase in c-myc levels demonstrated after the addition of WEHI-3B conditioned medium (IL-3) (Fig. 7B).


Figure 7: Northern blots of mRNA after cross-linking of CD16/Jak2. Panel A, Ba/F3 cells or Ba/F3 cells infected with recombinant vaccinia virus were starved for 4 h and then stimulated with WEHI-3B conditioned medium or cross-linked with anti-CD16 antibody for varying lengths of time. Total RNA was then extracted, and Northern blots were performed as described under ``Materials and Methods.'' The Northern blot was probed, stripped, and reprobed with the cDNAs shown on the left side of the figure. Panel B, Ba/F3 cells or Ba/F3 cells infected with recombinant vaccinia virus were starved for 4 h, and then both groups of cells were treated with WEHI-3B conditioned medium. Northern blots were performed as described under ``Materials and Methods.''




DISCUSSION

To examine the function of the specific protein kinases in T cell activation, Kolanus et al.(27) constructed a fusion of the Syk and ZAP70 tyrosine kinases in which the CD16 extracellular domain, a CD7 transmembrane domain, and the entire protein tyrosine kinase cDNA were fused and expressed using a vaccinia virus(27) . Cross-linking of the CD16 induced the tyrosine phosphorylation of Syk or ZAP70. This activation led to calcium mobilization. Aggregation of the Syk tyrosine kinase or the Fyn and ZAP70 tyrosine kinases together led to the initiation of cytolytic effector function. By being able to activate a single tyrosine kinase in the absence of T cell receptor activation, it was possible to dissect the phosphoproteins phosphorylated by each of these protein kinases.

We have applied this approach to the analysis to Jak2 signal transduction by replacing the ZAP70 sequence in these vectors containing CD16/CD7 with Jak2 and cloning this fusion protein into a recombinant vaccinia virus, allowing high levels of protein expression. Cross-linking of the CD16/Jak2 stimulates the phosphorylation of proteins having a molecular mass of 145, 97, 67, 52, and 42 kDa. These proteins have been identified previously as substrates phosphorylated after the addition of growth factors, including IL-3, GM-CSF, erythropoietin, and growth hormone, all of which are known to activate Jak2(5, 40, 41, 42) . Cross-linking of CD16/Jak2 stimulates the phosphorylation of a 200-kDa protein. Anti-Jak2 antibody coprecipitated this 200-kDa protein along with CD16/Jak2 fusion protein. To evaluate the possibility that this 200-kDa protein is of viral origin, we established an NIH-3T3 cell line stably expressing CD16/Jak2. Cross-linking of CD16/Jak2 in this cell line also stimulated the phosphorylation of a 200-kDa protein that coprecipitated with anti-Jak2 antibody, suggesting that this is not a viral protein. Also, a similar size protein was tyrosine phosphorylated and coprecipitated with anti-Shc antibody after IL-3 treatment of 32D cells(43) . Since endogenous Jak2 protein is bound to the first 60 amino acids of the GM-CSF receptor, the transmembrane structure of this chimeric protein mimics the cellular location of Jak2 when it is stimulated to phosphorylate its substrates. Interestingly, we did not find that the CD16/Jak2 chimera phosphorylated endogenous Jak2, thus suggesting that Jak2 protein must associate with a receptor and be located at the membrane to be phosphorylated. Also, cross-linking of the fusion protein did not demonstrate phosphorylation of the beta chain, suggesting that the observed biologic changes were not being mediated by stimulating the creation of SH2 protein binding sites on the beta chain.

One of the proteins phosphorylated after activation of CD16/Jak2 as well as WEHI-3B conditioned medium treatment is Shc. Activation of receptor tyrosine kinases such as epidermal growth factor (EGF; 44), platelet-derived growth factor(45) , Fms(46) , and insulin receptor (45) leads to the tyrosine phosphorylation of Shc proteins. Also, many cytokines such as IL-3(31, 32, 34) , GM-CSF(34) , erythropoietin(30, 32) , steel factor(31, 32, 34) , and IL-2 (33) also induce tyrosine phosphorylation of Shc, although their receptors are not tyrosine kinases. We demonstrate that activation of CD16/Jak2 kinase induces tyrosine phosphorylation of Shc in both Ba/F3 and MO7e cell lines. Since the beta chain of the GM-CSF receptor is not phosphorylated, it is unlikely that Shc phosphorylation is secondary to physical association with this receptor. By comparing the sequence of the Trk transmembrane tyrosine kinase and the polyoma middle T protein, a consensus binding sequence for Shc of NPXY has been hypothesized(47) . Interestingly, neither Jak2 nor the beta chain contains this sequence. A carboxyl truncation of the beta chain to residue 626 of GM-CSF receptor could not be stimulated by GM-CSF to activate Shc or the Ras pathway but stimulated Jak2 phosphorylation(5, 20) . In contrast, a mutant EGF receptor lacking all autophosphorylation sites was still able to induce tyrosine phosphorylation of Shc, complex formation of Shc-Grb2, and activation of MAP kinase after stimulation of EGF in fibroblast, although tyrosine phosphorylation of the receptor itself, Ras-GTPase activating protein complex formation, and phospholipase C- were dramatically reduced(48) . These results, including those with the CD16/Jak2 chimera, suggest alternative pathways for Shc activation.

Clustering of the CD16/Jak2 protein causes phosphorylation of a 145-kDa tyrosine-phosphorylated protein. This protein coimmunoprecipitates with Shc. Association of 140-150-kDa tyrosine-phosphorylated protein with Shc has been reported in several hematopoietic cell lines, including MO7e, after treatment with several cytokines such as IL-3(31, 34) , GM-CSF(34) , steel factor(31, 34) , erythropoietin (30, 31) and macrophage colony-stimulating factor(46) . A previous experiment revealed that this 145-kDa protein is not immunologically related to the beta chain, c-Kit, mSos1or Jak family member(31) . Recent data suggest that the pp145 protein associates with the amino-terminal portion of Shc(13) . It is possible that the pp145 protein mediates some interaction with Jak which allows Shc phosphorylation.

Cross-linking of the chimera activates MAP kinase, although to a lesser extent than treatment with WEHI-3B conditioned medium. It is possible that the stimulation of MAP kinase by CD16/Jak2 may be mediated through the activation of Shc/Grb2 and then the Ras pathway, although the elevated level of Shc phosphorylation and the small change in MAP kinase activity might suggest that these proteins are not tightly linked in Ba/F3 cells. The observation that growth factors induce a more exaggerated MAP kinase phosphorylation may suggest either that additional pathways are necessary for full activation or that growth factors are capable of inhibiting an endogenous MAP kinase phosphatase.

Like the addition of WEHI-3B conditioned medium, clustering of the CD16/Jak2 fusion protein is able to stimulate steady-state increases in the mRNAs for c-fos and JunB. In contrast, cross-linking the fusion protein stimulated much greater increases in c-jun mRNA than that seen after WEHI-3B conditioned medium treatment. On the other hand, CD16/Jak2 could not stimulate changes in c-myc, whereas WEHI-3B conditioned medium treatment of cells markedly induced this mRNA. Vaccinia virus infection does not prevent the induction of c-myc by WEHI-3B conditioned medium (Fig. 7B), suggesting that the signal created by the fusion protein is not capable of stimulating changes in this mRNA. Since the results of CD16/Jak2 clustering and growth factor addition are very similar, i.e. phosphorylation, STAT protein activation, etc., it is possible that activation of Jak2 is not sufficient alone to stimulate an increase in c-myc mRNA. EGF binds to its receptor on fibroblasts and activates another Jak family member, Jak1 (49) . When the EGF receptor is transfected into hematopoietic cells, EGF treatment is able to stimulate tyrosine phosphorylation of a large number of cellular proteins but is unable to stimulate growth or increase c-myc levels(50) . When the cells are transfected with c-myc cDNA, they then become responsive to EGF-stimulated growth(50) . Also, the erythropoeitin receptor contains a short amino acid sequence that does not interact with Jak2 but is required for growth (51), suggesting that activation of Jak and specific proliferation-related signals may be separate. Regulation of c-myc may require a more complex set of growth factor-mediated pathways than Jak2 activation.

In summary, selective activation of Jak2 using CD16/Jak2 chimera in IL-3/GM-CSF-dependent cell lines induces a set of tyrosine-phosphorylated proteins similar to those stimulated by IL-3 or GM-CSF treatment. Our results indicate that many but not all of the downstream effects of growth factor addition may be mediated directly by the Jak2 protein kinase.


FOOTNOTES

*
This work was supported by National Institutes of Health Grants DK44741 (to A. S. K.) and DK48882 (to L. N.) and by an American Cancer Society career development award (to L. N.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed. Tel.: 205-934-4436; Fax: 205-975-6911.

^1
The abbreviations used are: IL, interleukin; GM-CSF, granulocyte-macrophage colony-stimulating factor; Jak2, Janus protein kinase 2; MAP, mitogen-activated protein; STAT, signal transduction and activation of transcription; GAS, -activated sequence; rh, recombinant human; anti-PY, anti-phosphotyrosine; PAGE, polyacrylamide gel electrophoresis; EMSA, electrophoresis mobility shift assay; EGF, epidermal growth factor.

^2
Zhao, Y., Wagner, F., Frank, S., and Kraft, A. S. (1995) J. Biol. Chem.270, 13814-13818.


ACKNOWLEDGEMENTS

We acknowledge the help of the laboratories of Drs. B. Seed (Massachusetts General Hospital) and J. Kudlow (University of Alabama). We thank Dr. B. Weaver for editorial assistance.


REFERENCES

  1. Kitamura, T., Sato, N., Arai, K., and Miyajima, A.(1991)Cell66,1165-1174 [CrossRef][Medline] [Order article via Infotrieve]
  2. Kitamura, T., Hayashida, K., Sakamaki, K., Yokota, T., Arai, K., and Miyajima, A.(1991) Proc. Natl. Acad. Sci. U. S. A.88,5082-5086 [Abstract/Free Full Text]
  3. Takai, T., Murata, Y., Kitamura, T., Miyajima, A., Tominaga, A., and Takatsu, K.(1993) J. Exp. Med.177,1523-1529 [Abstract/Free Full Text]
  4. Itoh, N., Yonehara, S., Schreurs, J., Gorman, D. M., Maruyama, K., Ishii, A., Yahara, I., Arai, K., and Miyajima, A.(1990)Science247,324-327 [Abstract/Free Full Text]
  5. Quelle, F. W., Sato, N., Witthuhn, B. A., Inhorn, R. C., Eder, M., Miyajima, A., Griffin, J. D., and Ihle, J. N.(1994)Mol. Cell. Biol.14,4335-4341 [Abstract/Free Full Text]
  6. He, T., Jiang, N., Zhuang, H., Quelle, D. E., and Wojchowski, D. M.(1994) J. Biol. Chem.269,18291-18294 [Abstract/Free Full Text]
  7. Hanazono, Y., Chiba, S., Sasaki, K., Mano, H., Miyajima, A., Arai, K., Yazaki, Y., and Hirai, H. (1993)EMBO J.12,1641-1646 [Medline] [Order article via Infotrieve]
  8. Torigoe, T., O'Connor, R., Santole, D., and Reed, J. C.(1992) Blood80,617-624 [Abstract/Free Full Text]
  9. Corey, S., Eguinoa, A., Puyana-theal, K., Bolen, J. B., Cantley, L., Mollinedo, F., Jackson, T. R., Hawkins, P. T., and Stephens, R. T.(1993)EMBO J. 12,2681-2690 [Medline] [Order article via Infotrieve]
  10. Kanakura, Y., Druker, B., Cannistra, S. A., Furukawa, Y., Torimoto, Y., and Griffin, J. D. (1990)Blood76,706-715 [Abstract/Free Full Text]
  11. Wang, L. A., Keegan, D., Paul, W. E., Heidaran, M. A., Gutkind, J. S., and Pierce, J. H. (1992)EMBO J.11,4899-4908 [Medline] [Order article via Infotrieve]
  12. Duronio, V., Clark-Lewis, I., Federsppiel, B., Wieler, J. S., and Schrader, J. W. (1992)J. Biol. Chem.267,21856-21863 [Abstract/Free Full Text]
  13. Kavanaugh, W. M., and Williams, L. T.(1994)Science266,1862-1865 [Abstract/Free Full Text]
  14. Rozakis-Adcock, M., McGlade, J., Mbamalu, G., Pelicci, G., Daly, R., Li, W., Batzer, A., Thomas, S., Brugge, J., Schlessinger, J., and Pawson, P.(1992) Nature360,689-692 [CrossRef][Medline] [Order article via Infotrieve]
  15. Rozakis-Adcock, M., Fernley, R., Wade, J., Pawson, T., and Bowtell, D.(1993) Nature363,83-85 [CrossRef][Medline] [Order article via Infotrieve]
  16. Polotskaya, A., Zhao, Y., Lilly, M., and Kraft, A. S.(1993)Cell Growth & Differ.4,523-531
  17. Okuda, K., Sanghera, J. S., Pelech, S. L., Kanakura, Y., Hallek, M., and Griffin, J. D. (1992)Blood79,2880-2887 [Abstract/Free Full Text]
  18. Alai, M., Mui, A. L., Cutler, R. L., Bustelo, X. R., Barbacid, M., and Krystal, G. (1992)J. Biol. Chem.267,18021-18025 [Abstract/Free Full Text]
  19. Carroll, M. P., Clark-Lewis, I., Rapp, U. R., and May, W. S.(1990)J. Biol. Chem.265,19812-19817 [Abstract/Free Full Text]
  20. Sato, N., Sakamaki, K., Terada, N., Arai, K., and Miyajima, A.(1993)EMBO J. 12,4181-4189 [Medline] [Order article via Infotrieve]
  21. Darnell, J. E., Jr., Kerr, I. M., and Stark, G. R.(1994)Science 264,1415-1421 [Abstract/Free Full Text]
  22. Decker, T., Lew, D. J., Mirkovitch, J., and Darnell, J. E., Jr.(1991)EMBO J. 10,927-932 [Medline] [Order article via Infotrieve]
  23. Lamb, P., Kessler, L. V., Suto, C., Levy, D. E., Seidil, H. M., Stein, R. B., and Rosen, J. (1994)Blood8,2063-2071
  24. Yamahara, K., Quelle, F. W., Thierfelder, W. E., Kreider, B. L., Gilbert, D. J., Jenkins, N. A., Copeland, N. G., Silvennoinen, O., and Ihle, J. N.(1994) Mol. Cell. Biol.14,4342-4349 [Abstract/Free Full Text]
  25. Wakao, H., Gouileux, F., and Groner, B.(1994)EMBO J.13,2182-2191 [Medline] [Order article via Infotrieve]
  26. Hou, J., Schindler, U., Henzel, W. J., Ho, T. C., Brasseur, M., and McKnight, S. L. (1994)Science265,1701-1706 [Abstract/Free Full Text]
  27. Kolanus, W., Romeo, C., and Seed, B.(1993)Cell74,171-183 [CrossRef][Medline] [Order article via Infotrieve]
  28. Earl, P. L., and Moss, B. (1991) Curr. Protocols Mol. Biol.15, (suppl.) 16.17.1-16.17.16
  29. Sadowski, H. B., and Gilman, M. Z.(1993)Nature362,79-83 [CrossRef][Medline] [Order article via Infotrieve]
  30. Damen, J. E., Liu, L., Cutler, R. L., and Krystal, G.(1993)Blood 82,2296-2303 [Abstract/Free Full Text]
  31. Liu, L., Damen, J. E., Cutler, R. L., and Krystal, G.(1994)Mol. Cell. Biol. 14,6926-6935 [Abstract/Free Full Text]
  32. Cutler, R. L., Liu, L., Damen, J. E., and Krystal, G.(1993)J. Biol. Chem. 268,21463-21465 [Abstract/Free Full Text]
  33. Zhu, X., Suen, K., Barbacid, M., Bolen, J., and Fargnoli, J.(1994)J. Biol. Chem.269,5518-5522 [Abstract/Free Full Text]
  34. Matsuguchi, T., Salgia, R., Hallek, M., Eder, M., Druker, B., Ernst, J. T., and Griffin, J. D. (1994)J. Biol. Chem.269,5016-5021 [Abstract/Free Full Text]
  35. Fu, X., Schindler, C., Improta, T., Aebersold, R., and Darnell, J. E., Jr.(1992) Proc. Natl. Acad. Sci. U. S. A.89,7840-7843 [Abstract/Free Full Text]
  36. Akira, S., Nishio, Y., Inoue, M., Wang, X., Wei, S., Matsusaka, T., Yoshida, K., Sudo, T., Naruto, M., and Kishimoto, K.(1994)Cell 77,63-71 [CrossRef][Medline] [Order article via Infotrieve]
  37. Zhong, Z., Wen, Z., and Darnell, J. E., Jr.(1994)Science264,95-98 [Abstract/Free Full Text]
  38. Finbloom, D. S., Petricoin, E. F., III, Hackett, R. H., David, M., Feldman, G. M., Igarashi, K., Fibach, E., Weber, M. J., Thorner, M. O., Silva, C. M., and Larner, A. C.(1994)Mol. Cell. Biol. 14,2113-2118 [Abstract/Free Full Text]
  39. Larner, A. C., David, M., Feldman, G. M., Igarashi, K., Hackett, R. H., Webb, D. S. A., Sweitzer, S. M., Petricoin, E. F., III, and Finbloom, D. S. (1993)Science261,1730-1733 [Abstract/Free Full Text]
  40. Argetsinger, L. S., Campbell, G. S., Yang, X., Witthuhn, B. A., Silvennoinen, O., Ihle, J. N., and Carter-Su, C.(1993)Cell74,237-244 [CrossRef][Medline] [Order article via Infotrieve]
  41. Silvennoinen, O., Witthuhn, B. A., Quelle, F. W., Cleveland, J. L., Yi, T., and Ihle, J. N.(1993)Proc. Natl. Acad. Sci. U. S. A. 90,8433-8443
  42. Witthuhn, B. A., Quelle, F. W., Silvennoinen, O., Yi, T., Tang, B., Miura, O., and Ihle, J. N. (1993)Cell74,227-236 [CrossRef][Medline] [Order article via Infotrieve]
  43. Miura, Y., Miura, O., Ihle, J. N., and Aoki, N.(1994)J. Biol. Chem. 269,29962-29969 [Abstract/Free Full Text]
  44. Ruff-Jamison, S., McGlade, J., Pawson, T., Chen, K., and Cohen, S.(1993) J. Biol. Chem.268,7610-7612 [Abstract/Free Full Text]
  45. Pronk, G. J., MacGlade, J., Pelicci, G., Pawson, T., and Bos, J. L.(1993)J. Biol. Chem.268,5748-5753 [Abstract/Free Full Text]
  46. Lioubin, M. N., Myles, G. M., Carlberg, K., Bowtell, D., and Rohrschneider, L. R.(1994) Mol. Cell. Biol.14,5682-5691 [Abstract/Free Full Text]
  47. Prigent, S. A., and Gulick, W. J.(1994)EMBO J.13,2831-2841 [Medline] [Order article via Infotrieve]
  48. Gotoh, N., Tojo, A., Muroya, K., Hasimoto, Y., Hattori, S., Nakamura, S., Takenawa, T., Yazaki, Y., and Shibuya, M.(1994)Proc. Natl. Acad. Sci. U. S. A.91,167-171 [Abstract/Free Full Text]
  49. Shual, K., Zlemlecki, A., Wilkis, A. F., Harpur, A. G., Sadowski, H. B., Gilman, M. Z., and Darnell, J. E.(1993)Nature366,580-583 [CrossRef][Medline] [Order article via Infotrieve]
  50. Shibuya, H., Yoneyama, M., Ninomiya-Tsuji, N., Matsumoto, K., and Taniguchi, T.(1992) Cell70,57-67 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
BloodHome page
I. Sakai, K. Takeuchi, H. Yamauchi, H. Narumi, and S. Fujita
Constitutive expression of SOCS3 confers resistance to IFN-alpha in chronic myelogenous leukemia cells
Blood, September 26, 2002; 100(8): 2926 - 2931.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. G. Drachman, Y. Miyakawa, J. N. Luthi, D. D. Dahlen, A. Raney, A. E. Geddis, and K. Kaushansky
Studies with Chimeric Mpl/JAK2 Receptors Indicate That Both JAK2 and the Membrane-proximal Domain of Mpl Are Required for Cellular Proliferation
J. Biol. Chem., June 21, 2002; 277(26): 23544 - 23553.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. C. Orban, M. K. Levings, and J. W. Schrader
Heterodimerization of the alpha and beta Chains of the Interleukin-3 (IL-3) Receptor Is Necessary and Sufficient for IL-3-Induced Mitogenesis
Blood, September 1, 1999; 94(5): 1614 - 1622.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. S. Watowich, K. D. Liu, X. Xie, S. Y. Lai, A. Mikami, G. D. Longmore, and M. A. Goldsmith
Oligomerization and Scaffolding Functions of the Erythropoietin Receptor Cytoplasmic Tail
J. Biol. Chem., February 26, 1999; 274(9): 5415 - 5421.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
R. C. Gregory, N. Jiang, K. Todokoro, J. Crouse, R. E. Pacifici, and D. M. Wojchowski
Erythropoietin Receptor and STAT5-Specific Pathways Promote SKT6 Cell Hemoglobinization
Blood, August 15, 1998; 92(4): 1104 - 1118.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Cell Mol. Bio.Home page
M. E. Bates, W. W. Busse, and P. J. Bertics
Interleukin 5 Signals through Shc and Grb2 in Human Eosinophils
Am. J. Respir. Cell Mol. Biol., January 1, 1998; 18(1): 75 - 83.
[Abstract] [Full Text]


Home page
EndocrinologyHome page
B. P. Ceresa, C. M. Horvath, and J. E. Pessin
Signal Transducer and Activator of Transcription-3 Serine Phosphorylation by Insulin Is Mediated by a Ras/Raf/MEK-Dependent Pathway
Endocrinology, October 1, 1997; 138(10): 4131 - 4137.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
P. Peeters, S. D. Raynaud, J. Cools, I. Wlodarska, J. Grosgeorge, P. Philip, F. Monpoux, L. Van Rompaey, M. Baens, H. Van den Berghe, et al.
Fusion of TEL, the ETS-Variant Gene 6 (ETV6), to the Receptor-Associated Kinase JAK2 as a Result of t(9; 12) in a Lymphoid and t(9; 15; 12) in a Myeloid Leukemia
Blood, October 1, 1997; 90(7): 2535 - 2540.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Sakai and A. S. Kraft
The Kinase Domain of Jak2 Mediates Induction of Bcl-2 and Delays Cell Death in Hematopoietic Cells
J. Biol. Chem., May 9, 1997; 272(19): 12350 - 12358.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Joneja and D. M. Wojchowski
Mitogenic Signaling and Inhibition of Apoptosis via the Erythropoietin Receptor Box-1 Domain
J. Biol. Chem., April 25, 1997; 272(17): 11176 - 11184.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. H. Nelson, B. C. McIntosh, L. L. Rosencrans, and P. D. Greenberg
Requirement for an initial signal from the membrane-proximal region of the interleukin 2 receptor gamma c chain for Janus kinase activation leading to T cell proliferation
PNAS, March 4, 1997; 94(5): 1878 - 1883.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Nakamura, H. Chin, N. Miyasaka, and O. Miura
An Epidermal Growth Factor Receptor/Jak2 Tyrosine Kinase Domain Chimera Induces Tyrosine Phosphorylation of Stat5 and Transduces a Growth Signal in Hematopoietic Cells
J. Biol. Chem., August 9, 1996; 271(32): 19483 - 19488.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. P. Ceresa and J. E. Pessin
Insulin Stimulates the Serine Phosphorylation of the Signal Transducer and Activator of Transcription (STAT3) Isoform
J. Biol. Chem., May 24, 1996; 271(21): 12121 - 12124.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services