Molecular Cloning and Functional Expression of a Novel CC Chemokine Receptor cDNA from a Human Basophilic Cell Line

doi:10.1074/jbc.270.33.19495

HOME

HELP

FEEDBACK

SUBSCRIPTIONS

Volume 270, Number 33, Issue of August 18, pp. 19495-19500, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Molecular Cloning and Functional Expression of a Novel CC Chemokine Receptor cDNA from a Human Basophilic Cell Line (*)

(Received for publication, May 5, 1995; and in revised form, May 15, 1995)

Christine A. Power (§), , Alexandra Meyer , Karin Nemeth , Kevin B. Bacon (¶), , Arlene J. Hoogewerf , Amanda E. I. Proudfoot , Timothy N. C. Wells

From the Glaxo Institute for Molecular Biology, CH-1228 Plan-les-Ouates, Geneva, Switzerland

ABSTRACT

INTRODUCTION

EXPERIMENTAL PROCEDURES

RESULTS AND DISCUSSION

FOOTNOTES

ACKNOWLEDGEMENTS

REFERENCES

ABSTRACT

We report the cloning and characterization of a novel basophil CC chemokine receptor, K5-5, from the human immature basophilic cell line KU-812. The predicted protein sequence of K5-5 shows only 49% identity to the macrophage inflammatory protein-1 alpha /RANTES receptor (CC CKR-1) and 47% identity to monocyte chemotactic protein-1 receptor (b form), suggesting that this cDNA encodes a novel member of the CC chemokine receptor family. Analysis of K5-5 mRNA expression indicates that it is restricted to leukocyte-rich tissues. In addition, we have shown significant levels of K5-5 mRNA in human basophils, which were up-regulated by treatment with interleukin-5. The CC chemokines, macrophage inflammatory protein-1 alpha , RANTES, and monocyte chemotactic protein-1 were able to stimulate a Ca-activated chloride channel in Xenopus laevis oocytes injected with K5-5 cRNA, whereas no signal was detected in response to monocyte chemotactic protein-2, macrophage inflammatory protein-1 beta , or the CXC chemokine, interleukin-8. Taken together, these results indicate for the first time the presence of a CC chemokine receptor on basophils, which functions as a ``shared'' CC chemokine receptor and may therefore be implicated in the pathogenesis of basophil-mediated allergic diseases.

INTRODUCTION

Basophils have been implicated in the pathogenesis of a number of allergic inflammatory reactions including asthma, allergic rhinitis, and atopic dermatitis in addition to other inflammatory pathologies such as parasitic infections and inflammatory bowel disease(1, 2, 3, 4, 5) . Recent reports have demonstrated that local production of a number of chemotactic peptides and activating factors including RANTES, monocyte chemotactic protein-1 (MCP-1), ()macrophage inflammatory protein-1 alpha (MIP-1 alpha ), and interleukin-8 (IL-8) by a variety of stimulated cell types, can influence the recruitment of basophils to inflammatory sites and the subsequent release of mediators such as histamine and peptidoleukotrienes(6, 7, 8, 9) . These chemotactic peptides are members of a group of at least 15 structurally related proinflammatory mediators known as chemokines, which have been divided into two families based on the spacing of the first two of four conserved cysteines, namely CXC chemokines or CC chemokines (10, 11) .

The specific effects of chemokines on the target cell are mediated by receptors, which belong to the serpentine family of seven-transmembrane (7-TM), G-protein-coupled receptors(12) . To date, at least five human chemokine receptors have been identified by cDNA cloning, of which four have highly homologous sequences at the protein level. The two IL-8 receptors (A and B) identified both bind the CXC chemokine IL-8, with a 4 nM dissociation constant (K). However, the IL-8 receptor B is promiscuous in that it binds to IL-8 and other CXC chemokines such as neutrophil-activating peptide-2 and Gro alpha /melanocyte growth-stimulating activity at equal high affinity(13, 14) . The third member of this receptor family has been shown to bind the CC chemokines MIP-1 alpha and RANTES and has been called CC CKR-1(15, 16) . More recently a specific receptor for MCP-1 has been identified(17) . The fifth human chemokine receptor, found mainly on the surface of erythrocytes, is a promiscuous chemokine receptor (which binds both CXC and CC chemokines) and has been shown to be identical to the Duffy antigen(18) . In addition to these receptors, there is a functional promiscuous CC chemokine receptor encoded by human cytomegalovirus open reading frame US28(15, 19) . Although the latter two proteins both appear to be 7-TM receptors based on hydrophobicity plots, they show less than 30% amino acid identity to the other chemokine receptors.

It is likely that still more as yet unidentified chemokine receptors exist to accommodate the growing number of chemokines identified year by year despite the ligand promiscuity observed in the known receptors. For example, specific high affinity receptors for MIP-1 alpha and RANTES, distinct from CC CKR-1, have been proposed to exist on basophils, eosinophils, and monocytes based on the results of cross-desensitization experiments in response to various CC chemokines (20, 21, 22, 23, 24) . In an attempt to identify novel basophil chemokine receptors, we have used the technique of reverse transcriptase-polymerase chain reaction with degenerate oligonucleotide primers (25) that corresponded to conserved amino acid sequences found in the IL-8 receptors, and in CC CKR-1, betweeen transmembrane domains 3 and 4 and within transmembrane domain 7. Since human basophils are difficult to obtain at high purity in large numbers, we used a human immature basophilic cell line, KU812, derived from a patient with chronic myelogenous leukemia in blast crisis(26) . These cells express a number of basophil-related intracellular proteins, and both RANTES and IL-8 are able to induce chemotaxis of these cells(27) . Cloning and sequencing of PCR products revealed a novel 7-TM receptor-related sequence, K5-5, which was subsequently used to obtain a full-length cDNA from a human spleen cDNA library.

EXPERIMENTAL PROCEDURES

Materials

Restriction enzymes and DNA modifying enzymes were purchased from New England Biolabs unless otherwise stated. All cell culture reagents were from Life Technologies, Inc. Antibodies were from Becton Dickinson. Radiolabeled chemokines were from DuPont NEN. MIP-1 alpha

, RANTES, IL-8, MCP-1, and neurokinin-A were expressed in Escherichia coli and prepared at the Glaxo Institute for Molecular Biology(28) . All other chemokines used in this study were purchased from Peprotech.

Cells and Cell Lines

The KU812 cell line was a gift from Dr. K. Kishi (Niigata, Japan)(26) . All of the cell lines used in this study were maintained in RPMI 1640 medium containing 10% heat-inactivated fetal calf serum and 50 µg/ml gentamicin. Total peripheral blood mononuclear cells and polymorphonuclear cells were purified by density gradient centrifugation on Ficoll (Pharmacia Biotech Inc.) according to the manufacturer's instructions. Leukocytes were sorted by FACS using the appropriately labeled antibody on a FACStar (Becton Dickinson) to obtain pure populations (>90%) of B cells (CD20), T cells (CD3), and monocytes (CD14). Basophils were purified by negative selection using a magnetic activated cell sorter system (Miltenyi Biotec)(20) . Pulmonary macrophages were prepared from resected human lung samples as described previously(29) .

Reverse Transcriptase-PCR

Total RNA was isolated from 1

KU812 cells by the method of Chomczynski and Sacchi (30) . Poly(A)

mRNA was subsequently isolated by oligo(dT)-cellulose chromatography using a poly(A) quick mRNA purification kit (Stratagene). Single-stranded cDNA was prepared from 1 µg of poly(A)

mRNA in a 50-µl reaction containing 1 µg of oligo(dT)

, 4 mM methyl mercuric hydroxide, 1 mM dNTPs, 50 mM Tris-HCl buffer, pH 8.3, 50 mM KCl, 8 mM MgCl (2)

, 10 units of RNAsin, and 100 units of avian myeloblastosis virus reverse transcriptase-XL (Life Sciences, Inc.) for 60 min at 42 °C. One-tenth of the reaction mixture was then subjected to 40 cycles of PCR (95 °C, 2 min; 37 °C, 2 min; and 72 °C, 2 min) in 10 mM Tris-HCl, pH 8.3, buffer, 50 mM KCl, 1.5 mM MgCl (2)

, 0.2 mM dNTPS, and 2.5 units of Amplitaq

(Perkin-Elmer) using 3 µM of each degenerate oligonucleotide primer (sense, 5` GIT A(C/T)(C/T) TIG CIA T(A/C/T)G TIC A(C/T)G C; antisense, 5` A(A/C)I (A/G)C(A/G) TAI A(A/G/T)I AII GG(A/G) TTI AI(A/G/C) in a Techne PHC-2 thermal cycler. PCR reaction products were visualized on 1% agarose gels containing 0.5 µg/ml ethidium bromide. Reaction products migrating at the predicted size (500-550 bp) were gel-purified and rendered blunt-ended by sequential treatment with T4 polynucleotide kinase and E. coli DNA polymerase I Klenow fragment. Blunt-ended PCR products were ligated into the EcoRV site of pBluescript II SK

(Stratagene) using T4 DNA ligase. Ligation products were electroporated into electrocompetent E. coli strain XL-1 blue (Stratagene) using a Bio-Rad gene pulser (2.5 kV, 25 microfarads, 200 ohms). After electroporation, cells were diluted to 1 ml with L broth, grown at 37 °C for 1 h, and plated on LB plates containing 100 µg/ml ampicillin. Following overnight incubation at 37 °C, individual bacterial colonies were selected for small scale plasmid DNA preparations using the Wizard

miniprep DNA purification system (Promega). Miniprep DNA was digested with restriction enzymes HindIII and EcoRI. Reaction products were analyzed on 1% agarose gels. Miniprep DNAs that yielded an insert size of approximately 500-550 bp were then subjected to DNA sequence analysis using T3 and T7 primers and Sequenase

(U.S. Biochemical Corp.).

cDNA Library Screening

CsCl gradient-purified (31) plasmid DNA for clone TM(2-7)5-5 was digested at 37 °C with restriction enzymes HindIII and EcoRI. The resultant 514-bp insert DNA, which corresponded to the sequenced PCR product was gel-purified, labeled with [

P]dCTP (Amersham International) using a random-primed DNA-labeling kit (Boehringer Mannheim), and used to screen 5

clones of a human spleen

GT11 cDNA library (Clontech). Following hybridization, duplicating positives were rescreened with the same probe until a pure positive phage plaque was obtained. Purified phage DNA was digested with EcoRI for 16 h at 37 °C. cDNA inserts were gel-purified and ligated into the EcoRI site of pBluescript II SK

. Ligation products were transformed into E. coli strain XL-1 blue by electroporation. Miniprep DNA was prepared from 3-ml overnight cultures derived from individual ampicillin-resistant bacterial colonies. Minipreps that contained cDNA inserts were subsequently sequenced using T3 and T7 primers on an Applied Biosystems DNA sequencer. One clone designated K5-5 was shown by sequencing with the T7 primer to contain the putative 5` end of TM(2-7)5-5 and was subsequently resequenced with several internal sequencing primers based on the previous sequencing results as follows: K5-5AS, 5`AGAGTACTTGGTTTT GCAGTAG (antisense); K5-5AS2, 5` GCAGCAGTGAACAAAAGCCAG (antisense); K5-5A, 5` CATAGTGCTCTTCCTAGAGAC (sense); K5-5B, 5` GGTTGAGCAGGTACACATCAG (antisense); K5-5C, 5` CAATACTGTGGGCTCCTCC (sense); K5-5D, 5` GCTCAGGTCCATGACTG (sense); K5-5E, 5` CTCATGAGCATTGATAG (sense); K5-5F, 5` CTGAGCGCAACCATACC (sense); K5-5G, 5` GCTAGAAGTCCTTCAGG (sense); K5-5H, 5` GGATCATGATCTTCATG (sense); K5-5FLA, 5` AAATGAAACCCACGGATATAGCAG (sense); K5-5FLB, 5` TCCTACAGAGCATCATGAAGATC (antisense).

Analysis of K5-5 Receptor mRNA Expression

A multiple tissue Northern blot II was purchased from Clontech and probed with the 514-bp HindIII/EcoRI insert from TM(2-7)5-5 according to the manufacturer's instructions. Total RNA was prepared from cell lines and peripheral blood leukocyte populations(30) . Ten micrograms of total RNA (1 mg/ml) and 0.5 µl of oligo(dT)

(0.5 mg/ml) was heated at 70 °C for 10 min and then cooled on ice for 2 min, followed by the addition of 4 µl of 5

1st strand buffer (250 mM Tris-HCl, pH 8.3, 375 mM KCl, 15 mM MgCl (2)

), 2 µl of 0.1 M dithiothreitol, 1 µl of 10 mM dNTPs, and 1 µl of Superscript

(Life Technologies, Inc.) for 1 h at 37 °C. Two-microliter aliquots of each reverse transcriptase reaction were then subjected to 40 cycles of PCR (2 min at 95 °C; 2 min at 55 °C, and 2 min at 72 °C) in a 100-µl reaction mixture containing 100 pmol each of primers K5-5FLA and K5-5FLB. For basophils and KU812 cells, each reverse transcriptase reaction was also tested with specific primers for CC CKR-1 (forward, 5` ACCATGGAAACTCCAAACACCACAG; reverse, 5` GTCAGAACCCAGCAGAGAGTTCATG); MCP-1 receptor B (forward, 5` AACATGCTGTCCACATCTCGTTCT; reverse, 5` CGTTTATAAACCAGCCGAGACTTC); IL-8 receptor B (forward, 5` AACATGGAGAGTGACAGCTTTG; reverse, 5` TTAGAGAGTAGTGGAAGTGTG); and IL-8 receptor A (forward, 5` GACATGTCAAATATTACAGATCC; reverse, 5` TCAGAGGTTGGAAGAGACATTGACAG). As a control, glyceraldehyde-3-phosphate dehydrogenase was used (forward, 5` CATGGGGAAGGTGAAGGTCG; reverse 5` TTACTCCTTGGAGGCCATG). PCR reaction products were analyzed on 1% agarose gels. The predicted size of PCR products for the chemokine receptors was approximately 1.1 kb and 1.0 kb for glyceraldehyde-3-phosphate dehydrogenase.

Expression of K5-5 cRNA in Xenopus Oocytes

CsCl gradient-purified K5-5 plasmid DNA (5 µg) was linearized using restriction enzyme BamHI in a 100-µl reaction volume overnight at 37 °C. Linearized plasmids were treated with 2 µl of proteinase K (Boehringer Mannheim) for 30 min at 37 °C. DNA was extracted twice with phenol (0.1 M Tris-saturated, pH 8.0) and once with chloroform. Linearized DNA was precipitated following the addition of 0.1 volume of 3 M sodium acetate, pH 5.5, and 2.5 volumes of ethanol for 1 h at -80 °C. The DNA was recovered by centrifugation, washed with 70% ethanol, and dissolved in RNase-free water at 250 ng/µl.

A full-length cDNA encoding the MIP1 alpha /RANTES receptor (CC CKR-1) was obtained by reverse transcriptase-PCR from the human eosinophilic cell line EOL-3 (32) using specific primers based on the published sequence (15) and subcloned into the EcoRV site of pcDNAI(33) . A full-length cDNA encoding the MCP-1 receptor b was obtained from a human hypodense eosinophil ZAPII cDNA library ()and subcloned as an XhoI/KpnI fragment into pcDNA1. Linearized DNA was prepared from CC CKR-1/pcDNAI by XbaI digestion and from MCP-1RB/pcDNA1 by HindIII digestion as described above.

Capped cRNA transcripts were generated from 1 µg of linearized DNA in a 100-µl reaction volume containing 20 µl of 5 transcription buffer (200 mM Tris-HCl, pH 7.5, 30 mM MgCl (2) , 10 mM spermidine, and 50 mM NaCl), 4 µl of NTP mix (10 mM ATP, UTP, and CTP, 3 mM GTP), 4 µl of 0.75 M dithiothreitol, 2.5 µl of RNAsin, 0.5 µl of GTP (10 mM), 4 µl of 10 mM CAP analog (mG(5`)ppp(5`)G) and 2.5 µl of T7 RNA polymerase (Promega) for K5-5 and CC CKR-1 or SP6 RNA polymerase (Promega) for MCP-1 receptor b. After 1.5 h at 37 °C, 4 µl of RQ1 DNase (Promega) was added, and the reaction mixture was incubated for a further 15 min at 37 °C. The reaction mixture was then extracted twice with 0.1 M Tris-HCl, pH 8.0, saturated phenol/chloroform (1:1 v/v) and once with chloroform. cRNA was precipitated overnight at -20 °C after addition of 0.1 volume of 3 M sodium acetate, pH 5.5, and 2.5 volumes of ethanol. cRNA was recovered by centrifugation, washed in 70% ethanol, and resuspended in sterile water at 0.5 µg/µl.

Oocytes were harvested from adult female Xenopus laevis by a modification of the method of Bertrand et al.(34) . Oocytes were defollicullated by incubation in 0.2% (w/v) collagenase (Sigma) in 50 ml of OR2 medium (82.5 mM NaCl, 2.5 mM KCl, 1 mM Na (2) HPO (4) , 15 mM HEPES, pH 7.6) in a spinner flask under slow agitation for 2 h at room temperature. Oocytes were rinsed carefully with OR2 followed by MBS (88 mM NaCl, 1 mM KCl, 0.33 mM Ca(NO (3) ) (2) , 0.41 mM CaCl (2) , 0.82 mM MgSO (4) , 2.4 mM NaHCO (3) , 10 mM HEPES, pH 7.6) and allowed to recover for at least 1-2 h in MBS before selecting stage V-VI oocytes. Selected oocytes were incubated in MBS-supplemented penicillin/streptomycin (100 units/ml) overnight at 18 °C before injection.

Oocytes were microinjected using an Inject + Matic air pump (Gabay) using needles made from Drummond calibrated 6-µl capillaries. cRNA (25 ng in 50 nl) was injected into the cytoplasm. Oocytes were individually transferred to wells of a 96-well flat bottom culture dish and incubated in MBS for 24-72 h.

Electrophysiological recordings were made 3 days after injection in oocytes superfused with OR2 medium (containing 2 mM CaCl (2) and 1 mM MgCl (2) ) at room temperature under voltage-clamped conditions using two microelectrodes (1-2 megaohms, both filled with 3 M KCl), with the membrane potential routinely clamped at -100 mV using a Gene Clamp 500 instrument (Axon).

Test chemokines were dissolved in distilled water and then diluted to a final concentration of 1 µM in OR2. Fifty microliters of each chemokine was applied directly onto voltage-clamped oocytes for 6 s, and the current induced was monitored on a Tektronix 5113 dual beam storage oscilloscope linked to an IBM-PC. When multiple chemokines were tested on a single oocyte, a recovery time of 2 min was allowed between each application.

RESULTS AND DISCUSSION

In order to isolate novel chemokine receptor-like sequences, we have used a reverse transcriptase-PCR strategy. Degenerate oligonucleotide primers corresponding to the intracellular loop between transmembrane domains 3 and 4 with the peptide sequence RYLAIVH and to transmembrane domain 7 with the consensus peptide sequence CLNP(I/L/M/V)(L/I)Y(A/V)F were designed based on the published sequence of the human IL-8 receptors and CC CKR-1. These regions are well conserved between chemotactic peptide receptors. In view of the pharmacological evidence for the existence of novel chemokine receptors in basophils(20) , we chose the human immature basophilic leukemia cell line, KU-812, as a source of RNA. This cell line has previously been shown to have basophil-like properties(26) . The resultant PCR products of approximately 500-550 bp from this reaction were gel-purified, subcloned into Bluescript II SK, and sequenced. Most of the sequences analyzed encoded the previously described human homologue (35) of the bovine neuropeptide Y receptor(36) . The ligand of the human receptor remains unknown. We also detected a number of clones that showed 60% homology at the DNA level to the recently cloned MIP1 alpha /RANTES receptor (CC CKR-1). One of these clones, TM(2-7)5-5 was subsequently used to screen 5 10 plaque-forming units of a human spleen cDNA library in GT11. This resulted in the isolation of clone K5-5, which contained the same sequence as that identified by reverse transcriptase-PCR. K5-5 contained a 1676-bp cDNA insert of which 182 bp are 5`-untranslated sequence. The first 88 bases are pyrimidine-rich, suggesting the presence of an unspliced intron(37) . The identification of an incompletely spliced transcript is not unusual (particularly in lymphocytes) and may represent an important mechanism for translational regulation in vivo(38) . Translation of the longest open reading frame of 1080 bases predicts a protein of 360 amino acids (Fig. 1). There are a total of three potential N-glycosylation sites(39) ; the first is located in the N terminus extracellular domain (Asn) and the other two in the extracellular loop between transmembrane domains 4 and 5 (Asn and Asn, respectively). It is unlikely that the first site on Asn is glycosylated in vivo(40) . There are two intracellular consensus sequences for protein kinase C phosphorylation(41) , located in the second intracellular loop on Ser and in the C-terminal cytoplasmic domain on Thr. There are also three potential intracellular sites for casein kinase-II phosphorylation (42) on Ser, Ser, and Ser, respectively. The carboxyl-terminal domain also contains a total of 9 Ser and Thr residues, which may be important sites for regulation of receptor activity by phosphorylation with, for example, G-protein-coupled receptor kinases(43) . Alignment of the deduced amino acid sequence with the other chemokine receptors shows that K5-5 has 49% identity to CC CKR-1 (over 356 amino acids), 46% identity to the MCP-1 receptor b form (over 360 amino acids), and 42% (over 302 amino acids) and 41% (over 295 amino acids) identity to IL-8 receptors A and B, respectively (Fig. 2). Interestingly, the greatest divergence occurs in the N-terminal extracellular domain, which has been shown to control ligand binding specificity in the IL-8 receptors(44) . In this region, the amino acid identity is reduced significantly to 30% over 40 amino acids with the MCP-1 receptor and 42% over 26 amino acids for CC CKR-1.

Figure 1: cDNA sequence and deduced amino acid sequence of clone K5-5. Potential N-glycosylation sites are marked with an asterisk. The nucleotide sequence of clone TM(2-7)5-5 obtained by reverse transcriptase-PCR is underlined. The sequence of K5-5 has been submitted to the GenBank/EMBL/DDBJ data bases and has the accession number X85740.

Figure 2: Alignment of amino acid sequences encoding human chemokine receptors. IL-8 RA(5) , IL-8 RB(6) , CC CKR-1(7) , MCP-1 receptor b(9) , and K5-5 are shown. The putative transmembrane-spanning domains are underlined. The numbering of residues is based on the IL-8 RA sequence.

Northern blot analysis indicated that K5-5 hybridized to an approximately 4.0-kb mRNA species expressed at high levels in thymus and in peripheral blood leukocytes and to a lesser extent in spleen (Fig. 3a). In order to define specific leukocyte populations expressing K5-5 mRNA, we analyzed FACS-purified peripheral blood leukocytes and a number of leukocyte cell lines by reverse transcriptase-PCR. Expression of mRNA was evident in the KU812 cell line as well as in unstimulated or interleukin-2-stimulated peripheral blood T cells, B cells, and monocytes (Fig. 3b). We could also detect high levels of mRNA for K5-5 in human platelets. ()The size of the cloned cDNA shown in Fig. 1is considerably smaller than the transcript size of 4.0 kb indicated by Northern blotting. This probably reflects priming from adenine-rich sequences other than the poly(A) tail in the 3`-untranslated region.

Figure 3: Analysis of K5-5 receptor mRNA expression. a, Northern blot analysis of human tissues. Lane1, spleen; lane2, thymus; lane3, prostate; lane4, testis; lane5, ovary; lane6, small intestine; lane7, colon; lane8, peripheral blood leukocytes. b, reverse transcriptase-PCR analysis of peripheral blood leukocytes and some human leukocytic cell lines. Lane1, molecular weight markers (1-kb ladder; Life Technologies, Inc.); lane2, IL-2-stimulated peripheral blood T cells (48 h); lane3, untreated peripheral blood T cells; lane4, Jurkat cells; lane5, MOLT-4 cells; lane6, tonsillar B cells; lane7, peripheral blood B cells; lane8, pulmonary macrophages; lane9, peripheral blood monocytes; lane10, KU812 cells; lane11, EOL-3 cells.

The human immature basophilic cell line KU812, in which K5-5 was originally identified, has previously been shown to undergo chemotaxis in response to RANTES and IL-8 following pretreatment with IL-5 or phorbol myristate acetate(27) . An analysis of the chemokine receptor profile in these cells by reverse transcriptase-PCR indicates the presence of K5-5 and the IL-8 receptor B only (Fig. 4a). By analogy, freshly purifed human basophils were shown to express IL-8 receptor B mRNA with barely detectable levels of K5-5 mRNA (Fig. 4b). However, after stimulation for 15 min with IL-5 (10 ng/ml), there was significant up-regulation of K5-5 mRNA and weak expression of MCP-1 receptor mRNA in basophils (Fig. 4c). RANTES, MCP-1, and MIP-1 alpha are known to induce chemotaxis, histamine release, and Ca mobilization in basophils. However, since RANTES and MIP-1 alpha have not been reported to activate the MCP-1 receptor, and the other known receptor for MIP-1 alpha /RANTES (CC CKR-1) does not appear to be expressed on these cells under these conditions, it was possible that K5-5 encoded a novel CC chemokine receptor, especially in view of the homology of K5-5 to known chemokine receptors.

Figure 4: Expression of chemokine receptor mRNA by reverse transcriptase PCR in KU812 cells and peripheral blood basophils. a, KU812 cells. Lane1, 1-kb ladder markers; lane2, K5-5; lane3, MCP-1 receptor b; lane4, CC CKR-1; lane5, 0 DNA control; lane6, IL-8 RA; lane7, IL-8 RB; lane8, glyceraldehyde-3-phosphate dehydrogenase. b, basophils (unstimulated); c, IL-5-stimulated basophils. Lanes1, molecular mass markers; lanes2, K5-5; lanes3, IL-8 RA; lanes4, IL-8 RB; lanes5, MCP-1 receptor b; lanes6, CC CKR-1; lanes7, glyceraldehyde-3-phosphate dehydrogenase.

Therefore, to determine if K5-5 encodes a functional chemokine receptor, we transiently expressed full-length K5-5 cRNA in X. laevis oocytes. The ability of various chemokines to induce Ca mobilization in oocytes and thus stimulate a Ca-activated chloride channel, was assayed using the voltage clamp technique(34, 45) . Signalling by the CC CKR-1 and the MCP-1 receptor b was examined in parallel. Results on individual oocytes, tested 3 days after microinjection of cRNA, are shown in Fig. 5. Of the chemokines tested, only CC chemokines MIP-1 alpha , MCP-1, and RANTES were able to induce a chloride current in the oocytes injected with K5-5 cRNA (Fig. 5a). The amplitude of the transient current induced varied from oocyte to oocyte but was consistently highest in response to MIP-1 alpha ranging from 50 to 2200 nA (n = 29). In some, but not all oocytes that responded to MIP-1 alpha , we also detected a chloride current on subsequent application of MCP-1 and to a lesser extent with RANTES, ranging from 30 to 1500 nA and 80 to 1000 nA, respectively. No oocyte response was detected on application of IL-8, MCP-2, MIP-1 beta , or buffer alone. The transient current induced by MIP-1 alpha or MCP-1 was comparable with that seen with oocytes injected with cRNA encoding the CC CKR-1 or the MCP-1 receptors (Fig. 5, b and c). In order to show that the chemokine-induced responses observed in K5-5-injected oocytes were specific, we tested the same chemokines on oocytes microinjected with the cRNA for an unrelated 7-TM receptor, the neurokinin-2 receptor(46) . These oocytes failed to respond to any of the chemokines tested while maintaining a robust response to 1 µM neurokinin-A (Fig. 5d). These results indicate that K5-5 can function as a promiscuous CC chemokine receptor. In basophils it is likely that K5-5 is the functional MIP-1 alpha receptor since we were unable to detect mRNA coding for the previously identified MIP-1 alpha /RANTES receptor (CC CKR-1) in either unstimulated or IL-5-stimulated cells.

Figure 5: Current induced in voltage-clamped oocytes on stimulation with different chemokine ligands. Chemokines (1 µM) were applied for 6 s at 2-min intervals. Results of individual oocytes tested are shown. The scalemarker is positioned at the start of the application. a, K5-5 cRNA oocytes i-iv; b, CC CKR-1 cRNA; c, MCP-1 receptor b cRNA; d, neurokinin-2 receptor cRNA oocytes i-iv.

In summary, we report the cloning and functional expression of a novel CC chemokine receptor, K5-5, from the immature basophilic cell line KU812. Using electrophysiological studies in oocytes we have identified MIP-1 alpha , MCP-1, and RANTES as ligands for this receptor. The presence of K5-5 mRNA in basophils, T cells, and monocytes is consistent with the finding that MIP-1 alpha , MCP-1, and RANTES have been previously shown to exert a diverse range of activities on these cell types, including histamine release, chemotaxis, and Ca mobilization in basophils (7, 47) and chemotaxis in T cells(48, 49, 50) and monocytes(51) . However, since we and others have now shown that these cell types express several different chemokine receptors with overlapping specificities it is not clear if different ligands acting at the same receptor induce different signaling pathways or whether the activation of distinct receptors accounts for the diversity in cellular responses to a given chemokine. Although K5-5 shows promiscuity in the Xenopus oocyte system, it is possible that in vivo the ligand specificity is determined by the cell background in which the receptor is expressed, for example, in terms of coupling to relevant G-proteins or regulation of receptor-mediated signal transduction by a kinase/phosphatase regulatory pathway. Hence in the future, it will be necessary to characterize postreceptor signaling pathways in order to define the precise function of these receptors in different leukocyte populations and their relevance in inflammatory diseases.

FOOTNOTES

*: The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
§: To whom correspondence should be addressed: Glaxo Institute for Molecular Biology, 14, chemin des Aulx, 1228 Plan-les-Ouates, Geneva, Switzerland. Tel.: 41-22-706-97-52; Fax: 41-22-794-69-65.
¶: Current address: DNAX Institute of Molecular and Cellular Biology, Palo Alto, CA 94304.
(): The abbreviations used are: MCP, monocyte chemotactic protein; 7-TM, 7-transmembrane; CC CKR-1, CC chemokine receptor-1; FACS, fluorescence-activated cell sorting; IL, interleukin; MBS, modified Barth's saline; MIP, macrophage inflammatory protein; PCR, polymerase chain reaction; RANTES, regulated on activation, normal T-expressed and secreted; bp, base pair(s); kb, kilobase(s).
(): C. A. Power and J. Armstrong, unpublished data.
(): C. A. Power, unpublished data.

ACKNOWLEDGEMENTS

We thank Drs. Steve Arkinstall, Darcey Black, and Andre Chollet for helpful discussion; Dr. Diana Quint for purification of basophils; Dr. Jean-Pierre Aubry for FACS purification of leukocytes; and Mireille Guerrier and Martine Huguenin for DNA sequencing.

Note Added in Proof-Subsequent to the acceptance of this manuscript for publication we were advised that the MCP-2 used in these studies was not fully active. We have also been made aware of the existence of a novel eosinophil chemokine receptor CC CKR-3. We therefore suggest that K5-5 be designated CC CKR-4.

REFERENCES

Denburg, J. A., Telizyn, S., Belda, A., Dolovich, J., and Bienenstock, J. (1985) J. Allergy Clin. Immunol. 76,466-472 [CrossRef][Medline] [Order article via Infotrieve]
Otsuka, H., Dolovich, J., Befus, A., Bienenstock, J., and Denburg, J. A., (1986) Am. Rev. Respir. Dis. 133,757-762 [Medline] [Order article via Infotrieve]
Charlesworth, E. N., Hood, A. F., Soter, N. A., Kagey-Sobotka, A., Norman P. S., and Lichtenstein, L. M. (1989) J. Clin. Invest. 83,1519-1526
Grant, J. A., Lett-Brown, M. A., Warner, J. A., Plant, M., Lichtenstein, L. M., Haak-Frendscho, M., and Kaplan, A. P. (1986) Fed. Proc. 45,2653-2658 [Medline] [Order article via Infotrieve]
Frew, A. J., and Kay, A. B. (1991) Clin. Exp. Immunol. 84,270-274 [Medline] [Order article via Infotrieve]
Kuna, P., Reddigari, S. R., Schall, T. J., Rucinski, D., Sadick, M., and Kaplan, A. P. (1993) J. Immunol. 150,1932-1943 [Abstract]
Alam, R., Forsythe P. A., Stafford, S., Lett-Brown, M. A., and Grant, J. A. (1992) J. Exp. Med. 176,781-786 [Abstract/Free Full Text]
Bischoff, S. C., Krieger, M., Brunner, T., and Dahinden, C. A. (1992) J. Exp. Med. 175,1271-1275 [Abstract/Free Full Text]
Krieger, M., Brunner, T., Bischoff, S. C., von Tscharner, V., Walz, A., Moser, B., Baggiolini, M., and Dahinden, C. A. (1992) J. Immunol. 149,2662-2667 [Abstract]
Miller, M. D., and Krangel, M. S. (1992) Crit. Rev. Immunol. 12,17-46 [Medline] [Order article via Infotrieve]
Schall, T. J. (1991) Cytokine 3,165-183 [CrossRef][Medline] [Order article via Infotrieve]
Kelvin, D. J., Michiel, D. F., Johnston, J. A., Lloyd, A. R., Sprenger, H., Oppenheim, J. J., and Wang, J-M. (1993) J. Leukocyte Biol. 54,604-612 [Abstract]
Holmes, W. E., Lee, J., Kuang, W. J., Rice, G. C., Wood, M. L. (1991) Science 253,1278-1280 [Abstract/Free Full Text]
Murphy, P. M., and Tiffany, H. L. (1991) Science 253,1280-1283 [Abstract/Free Full Text]
Neote, K., DiGregorio, D., Mak, J. Y., Horuk, R., and Schall, T. J. (1993) Cell 72,415-425 [CrossRef][Medline] [Order article via Infotrieve]
Gao, J. L., Kuhns, D. B., Tiffany, H. L., McDermott, D., Li X., Francke, U., and Murphy, P. M. (1993) J. Exp. Med. 177,1421-1427 [Abstract/Free Full Text]
Charo, I. F., Myers, S., Herman, A., Franci, C., Connolly, A. J., and Coughlin, S. R. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,2752-2756 [Abstract/Free Full Text]
Neote, K., Darbonne, W., Ogez, J., Horuk, R., and Schall, T. J. (1993) J. Biol. Chem. 268,12247-12249 [Abstract/Free Full Text]
Gao, J-L., and Murphy, P. M. (1994) J. Biol. Chem. 269,28539-28542 [Abstract/Free Full Text]
Bischoff, S. C., Krieger, M., Brunner, T., Rot, A., von Tscharner, V., Baggiolini, M., and Dahinden, C. A. (1993) Eur. J. Immunol. 23,761-767 [Medline] [Order article via Infotrieve]
Ming Wang, J., McVicar, D. W., Oppenheim, J. J., Kelvin, D. J. (1993) J. Exp. Med. 177,699-705 [Abstract/Free Full Text]
Van Riper, G., Siciliano, S., Fischer, P., Meure, R., Springer, M. S., and Rosen, H. (1993) J. Exp. Med. 177,851-856 [Abstract/Free Full Text]
Van Riper, G., Nicholson, D. W., Scheid, M. P., Fischer, P. A., Springer, M. S., and Rosen, H. (1994) J. Immunol. 152,4055-4061 [Abstract]
Avalos, B. R., Bartynski, K. J., Elder, P. J., Kotur, M. S., Burton, W. G., and Wilkie, N. M. (1994) Blood 84,1790-1801 [Abstract/Free Full Text]
Libert, F., Parmentier, M., Lefort, A., Dinsart, C., Van Sande, J., Maenhaut, C., Simons, M. J., Dumont, J. E., and Vassart, G. (1989) Science 244,569-572 [Abstract/Free Full Text]
Kishi, K. (1985) Leukemia Res. 9,381-390 [CrossRef][Medline] [Order article via Infotrieve]
Bacon, K. B., Flores-Romo, L., Aubry, J-P., Wells, T. N. C., and Power, C. A. (1994) Immunology 82,473-481 [Medline] [Order article via Infotrieve]
Alouani, S., Gaertner, H. F., Mermod, J-J., Power, C. A., Bacon, K. B., Wells, T. N. C., and Proudfoot, A. E. I. (1995) Eur. J. Biochem. 227,328-334 [Medline] [Order article via Infotrieve]
Nicod, L. P., Lipscomb, M. F., Toews, G. B., and Weissler, J. C. (1989) J. Leukocyte Biol. 45,458-465 [Abstract]
Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162,156-159 [Medline] [Order article via Infotrieve]
Sambrook, J., Fritsch, E., and Maniatis, T. (1989) in Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
Morita, M. (1993) Jap. J. Clin. Exp. Med. 51,712-717
Lusti-Narasimhan, M., Power, C. A., Allet, B., Alouani, S., Bacon, K. B., Mermod, J-J., Proudfoot, A. E. I., and Wells, T. N. C. (1995) J. Biol. Chem. 270,2716-2721 [Abstract/Free Full Text]
Bertrand, D., Cooper, E., Valera, S., Rungger, D., and Ballivet, M. (1991) Methods Neurosci. 4,174-193
Herzog, H., Hort, Y. J., Shine, J., and Selbie, L. A. (1993) DNA Cell Biol. 12,465-471 [Medline] [Order article via Infotrieve]
Rimland, J., Xin, W., Sweetnam, P., Saijoh, K., Nestler, E. J., and Duman, R. S. (1991) Mol. Pharmacol. 40,869-875 [Abstract]
Shapiro, M. B., and Senepathy, P. (1987) Nucleic Acids Res. 15,7155-7174 [Abstract/Free Full Text]
Kozak, M. (1991) J. Cell Biol. 115,887-903 [Abstract/Free Full Text]
Marshall, R. D. (1972) Annu. Rev. Biochem. 41,673-702 [CrossRef][Medline] [Order article via Infotrieve]
Gavel, Y., and von Heijne, G. (1990) Protein Eng. 3,433-442 [Abstract/Free Full Text]
Woodget, J. R., Gould, K. L., and Hunter, T. (1986) Eur. J. Biochem. 161,177-184 [Medline] [Order article via Infotrieve]
Pinna, L. A. (1990) Biochim. Biophys. Acta 1054,267-284 [Medline] [Order article via Infotrieve]
Dohlman, H. G., Thorner, J., Caron, M. G., and Lefkowitz, R. J. (1991) Annu. Rev. Biochem. 60,653-688 [CrossRef][Medline] [Order article via Infotrieve]
LaRosa, G. J., Thomas, K. M., Kaufmann, M. E., Mark, R., White, M., Taylor, L., Gray, G., Witt, D., and Navarro, J. (1992) J. Biol. Chem. 267,25402-25406 [Abstract/Free Full Text]
Schultz, P., Stannek, P., Voigt, M., Jakobs, K. H., and Gierschik, P. (1992) Biochem. J. 284,207-212
Turcatti, G., Ceszkowski, K., and Chollet, A. (1993) J. Recept. Res. 13,639-52 [Medline] [Order article via Infotrieve]
Kuna, P., Reddigari, S. R., Schall, T. J., Rucinski, D., Viksman, M. Y., and Kaplan, A. P. (1992) J. Immunol. 149,636-642 [Abstract]
Carr, M. W., Roth, S. J., Luther, E., Rose, S. S., and Springer, T. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,3652-3656 [Abstract/Free Full Text]
Loetscher, P., Seitz, M., Clark-Lewis, I., Baggiolini, M., and Moser, B. (1994) FASEB J. 8,1055-1060 [Abstract]
Taub, D. D., Conlon, K., Lloyd, A. R., Oppenheim, J. J., and Kelvin, D. J. (1993) Science 260,355-358 [Abstract/Free Full Text]
Yoshimura, T., and Leonard, E. J. (1992) Cytokines 4,131-152 [Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us Add to Digg

Digg

Technorati What's this?

This article has been cited by other articles:

A. W. Mailloux and M. R. I. Young
NK-Dependent Increases in CCL22 Secretion Selectively Recruits Regulatory T Cells to the Tumor Microenvironment
J. Immunol., March 1, 2009; 182(5): 2753 - 2765.
[Abstract] [Full Text] [PDF]

R. S. Y. Wong, V. Bodart, M. Metz, J. Labrecque, G. Bridger, and S. P. Fricker
Comparison of the Potential Multiple Binding Modes of Bicyclam, Monocylam, and Noncyclam Small-Molecule CXC Chemokine Receptor 4 Inhibitors
Mol. Pharmacol., December 1, 2008; 74(6): 1485 - 1495.
[Abstract] [Full Text] [PDF]

T. Traeger, W. Kessler, V. Assfalg, K. Cziupka, P. Koerner, C. Dassow, K. Breitbach, M. Mikulcak, I. Steinmetz, K. Pfeffer, et al.
Detrimental Role of CC Chemokine Receptor 4 in Murine Polymicrobial Sepsis
Infect. Immun., November 1, 2008; 76(11): 5285 - 5293.
[Abstract] [Full Text] [PDF]

I. A. Khasabova, C. L. Stucky, C. Harding-Rose, L. Eikmeier, A. J. Beitz, L. G. Coicou, A. E. Hanson, D. A. Simone, and V. S. Seybold
Chemical Interactions between Fibrosarcoma Cancer Cells and Sensory Neurons Contribute to Cancer Pain
J. Neurosci., September 19, 2007; 27(38): 10289 - 10298.
[Abstract] [Full Text] [PDF]

C. E. Brown, R. P. Vishwanath, B. Aguilar, R. Starr, J. Najbauer, K. S. Aboody, and M. C. Jensen
Tumor-Derived Chemokine MCP-1/CCL2 Is Sufficient for Mediating Tumor Tropism of Adoptively Transferred T Cells
J. Immunol., September 1, 2007; 179(5): 3332 - 3341.
[Abstract] [Full Text] [PDF]

N. F. Pinheiro Jr., M. D. R. Hermida, M. P. Macedo, J. Mengel, A. Bafica, and W. L. C. dos-Santos
Leishmania Infection Impairs {beta}1-Integrin Function and Chemokine Receptor Expression in Mononuclear Phagocytes
Infect. Immun., July 1, 2006; 74(7): 3912 - 3921.
[Abstract] [Full Text] [PDF]

R. Niwa, M. Sakurada, Y. Kobayashi, A. Uehara, K. Matsushima, R. Ueda, K. Nakamura, and K. Shitara
Enhanced Natural Killer Cell Binding and Activation by Low-Fucose IgG1 Antibody Results in Potent Antibody-Dependent Cellular Cytotoxicity Induction at Lower Antigen Density
Clin. Cancer Res., March 15, 2005; 11(6): 2327 - 2336.
[Abstract] [Full Text] [PDF]

B. OSTERUD and E. BJORKLID
Role of Monocytes in Atherogenesis
Physiol Rev, October 1, 2003; 83(4): 1069 - 1112.
[Abstract] [Full Text] [PDF]

S. Senechal, P. de Nadai, N. Ralainirina, A. Scherpereel, H. Vorng, P. Lassalle, A.-B. Tonnel, A. Tsicopoulos, and B. Wallaert
Effect of Diesel on Chemokines and Chemokine Receptors Involved in Helper T Cell Type 1/Type 2 Recruitment in Patients with Asthma
Am. J. Respir. Crit. Care Med., July 15, 2003; 168(2): 215 - 221.
[Abstract] [Full Text] [PDF]

K. Ichiyama, S. Yokoyama-Kumakura, Y. Tanaka, R. Tanaka, K. Hirose, K. Bannai, T. Edamatsu, M. Yanaka, Y. Niitani, N. Miyano-Kurosaki, et al.
A duodenally absorbable CXC chemokine receptor 4 antagonist, KRH-1636, exhibits a potent and selective anti-HIV-1 activity
PNAS, April 1, 2003; 100(7): 4185 - 4190.
[Abstract] [Full Text] [PDF]

L. Agrawal, Z. Vanhorn-Ali, and G. Alkhatib
Multiple determinants are involved in HIV coreceptor use as demonstrated by CCR4/CCL22 interaction in peripheral blood mononuclear cells (PBMCs)
J. Leukoc. Biol., November 1, 2002; 72(5): 1063 - 1074.
[Abstract] [Full Text] [PDF]

C.-C. Ku, J. A. Padilla, C. Grose, E. C. Butcher, and A. M. Arvin
Tropism of Varicella-Zoster Virus for Human Tonsillar CD4+ T Lymphocytes That Express Activation, Memory, and Skin Homing Markers
J. Virol., October 11, 2002; 76(22): 11425 - 11433.
[Abstract] [Full Text] [PDF]

H. Katayama, A. Yokoyama, N. Kohno, K. Sakai, K. Hiwada, H. Yamada, and K. Hirai
Production of Eosinophilic Chemokines by Normal Pleural Mesothelial Cells
Am. J. Respir. Cell Mol. Biol., April 1, 2002; 26(4): 398 - 403.
[Abstract] [Full Text] [PDF]

A. Prat, K. Biernacki, J.-F. Lavoie, J. Poirier, P. Duquette, and J. P. Antel
Migration of Multiple Sclerosis Lymphocytes Through Brain Endothelium
Arch Neurol, March 1, 2002; 59(3): 391 - 397.
[Abstract] [Full Text] [PDF]

L. A. Jopling, I. Sabroe, D. P. Andrew, T. J. Mitchell, Y. Li, M. R. Hodge, T. J. Williams, and J. E. Pease
The Identification, Characterization, and Distribution of Guinea Pig CCR4 and Epitope Mapping of a Blocking Antibody
J. Biol. Chem., February 22, 2002; 277(9): 6864 - 6873.
[Abstract] [Full Text] [PDF]

E. A. de Wynter, C. M. Heyworth, N. Mukaida, E. Jaworska, A. Weffort-Santos, K. Matushima, and N. G. Testa
CCR1 chemokine receptor expression isolates erythroid from granulocyte-macrophage progenitors
J. Leukoc. Biol., September 1, 2001; 70(3): 455 - 460.
[Abstract] [Full Text] [PDF]

M. Iikura, M. Miyamasu, M. Yamaguchi, H. Kawasaki, K. Matsushima, M. Kitaura, Y. Morita, O. Yoshie, K. Yamamoto, and K. Hirai
Chemokine receptors in human basophils: inducible expression of functional CXCR4
J. Leukoc. Biol., July 1, 2001; 70(1): 113 - 120.
[Abstract] [Full Text] [PDF]

C. Blanpain, R. Buser, C. A. Power, M. Edgerton, C. Buchanan, M. Mack, G. Simmons, P. R. Clapham, M. Parmentier, and A. E. I. Proudfoot
A chimeric MIP-1{alpha}/RANTES protein demonstrates the use of different regions of the RANTES protein to bind and activate its receptors
J. Leukoc. Biol., June 1, 2001; 69(6): 977 - 985.
[Abstract] [Full Text] [PDF]

Y. Kim, S.-s. J. Sung, W. A. Kuziel, S. Feldman, S. M. Fu, and C. E. Rose Jr
Enhanced Airway Th2 Response After Allergen Challenge in Mice Deficient in CC Chemokine Receptor-2 (CCR2)
J. Immunol., April 15, 2001; 166(8): 5183 - 5192.
[Abstract] [Full Text] [PDF]

A. Heinemann, A. Hartnell, V. E. L. Stubbs, K. Murakami, D. Soler, G. LaRosa, P. W. Askenase, T. J. Williams, and I. Sabroe
Basophil Responses to Chemokines Are Regulated by Both Sequential and Cooperative Receptor Signaling
J. Immunol., December 15, 2000; 165(12): 7224 - 7233.
[Abstract] [Full Text] [PDF]

K. J. Clemetson, J. M. Clemetson, A. E. I. Proudfoot, C. A. Power, M. Baggiolini, and T. N. C. Wells
Functional expression of CCR1, CCR3, CCR4, and CXCR4 chemokine receptors on human platelets
Blood, December 15, 2000; 96(13): 4046 - 4054.
[Abstract] [Full Text] [PDF]

T. Nanki and P. E. Lipsky
Lack of correlation between chemokine receptor and Th1/Th2 cytokine expression by individual memory T cells
Int. Immunol., December 1, 2000; 12(12): 1659 - 1667.
[Abstract] [Full Text] [PDF]

T. Nanki, K. Hayashida, H. S. El-Gabalawy, S. Suson, K. Shi, H. J. Girschick, S. Yavuz, and P. E. Lipsky
Stromal Cell-Derived Factor-1-CXC Chemokine Receptor 4 Interactions Play a Central Role in CD4+ T Cell Accumulation in Rheumatoid Arthritis Synovium
J. Immunol., December 1, 2000; 165(11): 6590 - 6598.
[Abstract] [Full Text] [PDF]

J. A. Belperio, M. D. Burdick, M. P. Keane, Y. Y. Xue, J. P. Lynch III, B. L. Daugherty, S. L. Kunkel, and R. M. Strieter
The Role of the CC Chemokine, RANTES, in Acute Lung Allograft Rejection
J. Immunol., July 1, 2000; 165(1): 461 - 472.
[Abstract] [Full Text] [PDF]

Y. Chvatchko, A. J. Hoogewerf, A. Meyer, S. Alouani, P. Juillard, R. Buser, F. Conquet, A. E.I. Proudfoot, T. N.C. Wells, and C. A. Power
A Key Role for CC Chemokine Receptor 4 in Lipopolysaccharide-induced Endotoxic Shock
J. Exp. Med., May 15, 2000; 191(10): 1755 - 1764.
[Abstract] [Full Text] [PDF]

C. Murdoch and A. Finn
Chemokine receptors and their role in inflammation and infectious diseases
Blood, May 15, 2000; 95(10): 3032 - 3043.
[Abstract] [Full Text] [PDF]

K. Arima, K. Nasu, H. Narahara, K. Fujisawa, N. Matsui, and I. Miyakawa
Effects of lipopolysaccharide and cytokines on production of RANTES by cultured human endometrial stromal cells
Mol. Hum. Reprod., March 1, 2000; 6(3): 246 - 251.
[Abstract] [Full Text] [PDF]

P. M. Murphy, M. Baggiolini, I. F. Charo, C. A. Hebert, R. Horuk, K. Matsushima, L. H. Miller, J. J. Oppenheim, and C. A. Power
International Union of Pharmacology. XXII. Nomenclature for Chemokine Receptors
Pharmacol. Rev., March 1, 2000; 52(1): 145 - 176.
[Abstract] [Full Text] [PDF]

N. Nasreen, K. A. Mohammed, G. Galffy, M. J. Ward, and V. B. Antony
MCP-1 in pleural injury: CCR2 mediates haptotaxis of pleural mesothelial cells
Am J Physiol Lung Cell Mol Physiol, March 1, 2000; 278(3): L591 - L598.
[Abstract] [Full Text] [PDF]

G. Franchin, G. Zybarth, W. W. Dai, L. Dubrovsky, N. Reiling, H. Schmidtmayerova, M. Bukrinsky, and B. Sherry
Lipopolysaccharide Inhibits HIV-1 Infection of Monocyte- Derived Macrophages Through Direct and Sustained Down-Regulation of CC Chemokine Receptor 5
J. Immunol., March 1, 2000; 164(5): 2592 - 2601.
[Abstract] [Full Text] [PDF]

C.-R. Yu, K. W. C. Peden, M. B. Zaitseva, H. Golding, and J. M. Farber
CCR9A and CCR9B: Two Receptors for the Chemokine CCL25/TECK/Ck{beta}-15 That Differ in Their Sensitivities to Ligand
J. Immunol., February 1, 2000; 164(3): 1293 - 1305.
[Abstract] [Full Text] [PDF]

A. M. Norment, L. Y. Bogatzki, B. N. Gantner, and M. J. Bevan
Murine CCR9, a Chemokine Receptor for Thymus-Expressed Chemokine That Is Up-Regulated Following Pre-TCR Signaling
J. Immunol., January 15, 2000; 164(2): 639 - 648.
[Abstract] [Full Text] [PDF]

J. M. Burns, G. K. Lewis, and A. L. DeVico
Soluble complexes of regulated upon activation, normal T cells expressed and secreted (RANTES) and glycosaminoglycans suppress HIV-1 infection but do not induce Ca2+ signaling
PNAS, December 7, 1999; 96(25): 14499 - 14504.
[Abstract] [Full Text] [PDF]

S. Ying, Q. Meng, K. Zeibecoglou, D. S. Robinson, A. Macfarlane, M. Humbert, and A. B. Kay
Eosinophil Chemotactic Chemokines (Eotaxin, Eotaxin-2, RANTES, Monocyte Chemoattractant Protein-3 (MCP-3), and MCP-4), and C-C Chemokine Receptor 3 Expression in Bronchial Biopsies from Atopic and Nonatopic (Intrinsic) Asthmatics
J. Immunol., December 1, 1999; 163(11): 6321 - 6329.
[Abstract] [Full Text] [PDF]

A. J. Morris and C. C. Malbon
Physiological Regulation of G Protein-Linked Signaling
Physiol Rev, October 1, 1999; 79(4): 1373 - 1430.
[Abstract] [Full Text] [PDF]

K F Chung and P J Barnes
Cytokines in asthma
Thorax, September 1, 1999; 54(9): 825 - 857.
[Full Text]

F. Hadida, V. Vieillard, L. Mollet, I. Clark-Lewis, M. Baggiolini, and P. Debre
Cutting Edge: RANTES Regulates Fas Ligand Expression and Killing by HIV-Specific CD8 Cytotoxic T Cells
J. Immunol., August 1, 1999; 163(3): 1105 - 1109.
[Abstract] [Full Text] [PDF]

M. Foti, F. Granucci, D. Aggujaro, E. Liboi, W. Luini, S. Minardi, A. Mantovani, S. Sozzani, and P. Ricciardi-Castagnoli
Upon dendritic cell (DC) activation chemokines and chemokine receptor expression are rapidly regulated for recruitment and maintenance of DC at the inflammatory site
Int. Immunol., June 1, 1999; 11(6): 979 - 986.
[Abstract] [Full Text] [PDF]

M. A. Giembycz and M. A. Lindsay
Pharmacology of the Eosinophil
Pharmacol. Rev., June 1, 1999; 51(2): 213 - 340.
[Abstract] [Full Text] [PDF]

J. Dürig, N. G. Testa, and C. M. Heyworth
Distinct Biological Effects of Macrophage Inflammatory Protein-1{alpha} and Stroma-Derived Factor-1{alpha} on CD34+ Hemopoietic Cells
Stem Cells, March 1, 1999; 17(2): 62 - 71.
[Abstract] [Full Text]

L. Pedroza-Martins, K. B. Gurney, B. E. Torbett, and C. H. Uittenbogaart
Differential Tropism and Replication Kinetics of Human Immunodeficiency Virus Type 1�Isolates in Thymocytes: Coreceptor Expression Allows Viral Entry, but Productive Infection of Distinct Subsets Is Determined at the Postentry Level
J. Virol., December 1, 1998; 72(12): 9441 - 9452.
[Abstract] [Full Text] [PDF]

P. J. Barnes, K. F. Chung, and C. P. Page
Inflammatory Mediators of Asthma: An Update
Pharmacol. Rev., December 1, 1998; 50(4): 515 - 596.
[Abstract] [Full Text] [PDF]

D. D'Ambrosio, A. Iellem, R. Bonecchi, D. Mazzeo, S. Sozzani, A. Mantovani, and F. Sinigaglia
Cutting Edge: Selective Up-Regulation of Chemokine Receptors CCR4 and CCR8 upon Activation of Polarized Human Type 2 Th Cells
J. Immunol., November 15, 1998; 161(10): 5111 - 5115.
[Abstract] [Full Text] [PDF]

J. Durig, E. A. de Wynter, C. Kasper, M. A. Cross, J. Chang, N. G. Testa, and C. M. Heyworth
Expression of Macrophage Inflammatory Protein-1alpha Receptors in Human CD34+ Hematopoietic Cells and Their Modulation by Tumor Necrosis Factor-alpha and Interferon-gamma
Blood, November 1, 1998; 92(9): 3073 - 3081.
[Abstract] [Full Text] [PDF]

A. Albini, S. Ferrini, R. Benelli, S. Sforzini, D. Giunciuglio, M. G. Aluigi, A. E.�I. Proudfoot, S. Alouani, T. N.�C. Wells, G. Mariani, et al.
HIV-1 Tat protein mimicry of chemokines
PNAS, October 27, 1998; 95(22): 13153 - 13158.
[Abstract] [Full Text] [PDF]

S. Struyf, P. Proost, S. Sozzani, A. Mantovani, A. Wuyts, E. De Clercq, D. Schols, and J. Van Damme
Cutting Edge: Enhanced Anti-HIV-1 Activity and Altered Chemotactic Potency of NH2-Terminally Processed Macrophage-Derived Chemokine (MDC) Imply an Additional MDC Receptor
J. Immunol., September 15, 1998; 161(6): 2672 - 2675.
[Abstract] [Full Text] [PDF]

E.A. de Wynter, J. Durig, M.A. Cross, C.M. Heyworth, and N.G. Testa
Differential Response of CD34+ Cells Isolated from Cord Blood and Bone Marrow to MIP-1{alpha} and the Expression of MIP-1{alpha} Receptors on These Immature Cells
Stem Cells, September 1, 1998; 16(5): 349 - 356.
[Abstract] [Full Text]

F. Hadida, V. Vieillard, B. Autran, I. Clark-Lewis, M. Baggiolini, and P. Debre
HIV-specific T Cell Cytotoxicity Mediated by RANTES Via the Chemokine Receptor CCR3
J. Exp. Med., August 3, 1998; 188(3): 609 - 614.
[Abstract] [Full Text] [PDF]

O. Pleskoff, C. Treboute, and M. Alizon
The Cytomegalovirus-Encoded Chemokine Receptor US28 Can Enhance Cell-Cell Fusion Mediated by Different Viral Proteins
J. Virol., August 1, 1998; 72(8): 6389 - 6397.
[Abstract] [Full Text] [PDF]

M. Mellado, J. M. Rodriguez-Frade, A. Aragay, G. del Real, A. M. Martin, A. J. Vila-Coro, A. Serrano, F. Mayor Jr., and C. Martinez-A.
The Chemokine Monocyte Chemotactic Protein 1 Triggers Janus Kinase 2 Activation and Tyrosine Phosphorylation of the CCR2B Receptor
J. Immunol., July 15, 1998; 161(2): 805 - 813.
[Abstract] [Full Text] [PDF]

F. Sallusto, D. Lenig, C. R. Mackay, and A. Lanzavecchia
Flexible Programs of Chemokine Receptor Expression on Human Polarized T Helper 1�and 2�Lymphocytes
J. Exp. Med., March 16, 1998; 187(6): 875 - 883.
[Abstract] [Full Text] [PDF]

I. M. Hayes, N. J. Jordan, S. Towers, G. Smith, J. R. Paterson, J. J. Earnshaw, A. G. Roach, J. Westwick, and R. J. Williams
Human Vascular Smooth Muscle Cells Express Receptors for CC Chemokines
Arterioscler. Thromb. Vasc. Biol., March 1, 1998; 18(3): 397 - 403.
[Abstract] [Full Text] [PDF]

B. Lu, B. J. Rutledge, L. Gu, J. Fiorillo, N. W. Lukacs, S. L. Kunkel, R. North, C. Gerard, and B. J. Rollins
Abnormalities in Monocyte Recruitment and Cytokine Expression in Monocyte Chemoattractant Protein 1-deficient Mice
J. Exp. Med., February 16, 1998; 187(4): 601 - 608.
[Abstract] [Full Text] [PDF]

S. K. Gupta, P. G. Lysko, K. Pillarisetti, E. Ohlstein, and J. M. Stadel
Chemokine Receptors in Human Endothelial Cells. FUNCTIONAL EXPRESSION OF CXCR4 AND ITS TRANSCRIPTIONAL REGULATION BY INFLAMMATORY CYTOKINES
J. Biol. Chem., February 13, 1998; 273(7): 4282 - 4287.
[Abstract] [Full Text] [PDF]

H. L. Tiffany, G. Alkhatib, C. Combadiere, E. A. Berger, and P. M. Murphy
CC Chemokine Receptors 1 and 3 Are Differentially Regulated by IL-5 During Maturation of Eosinophilic HL-60 Cells
J. Immunol., February 1, 1998; 160(3): 1385 - 1392.
[Abstract] [Full Text] [PDF]

T. Imai, D. Chantry, C. J. Raport, C. L. Wood, M. Nishimura, R. Godiska, O. Yoshie, and P. W. Gray
Macrophage-derived Chemokine Is a Functional Ligand for the CC Chemokine Receptor 4
J. Biol. Chem., January 16, 1998; 273(3): 1764 - 1768.
[Abstract] [Full Text] [PDF]

R. J.�B. Nibbs, S. M. Wylie, J. Yang, N. R. Landau, and G. J. Graham
Cloning and Characterization of a Novel Promiscuous Human beta -Chemokine Receptor D6
J. Biol. Chem., December 19, 1997; 272(51): 32078 - 32083.
[Abstract] [Full Text] [PDF]

H. M. Sarau, J. A. Rush, J. J. Foley, M. E. Brawner, D. B. Schmidt, J. R. White, and M. S. Barnette
Characterization of Functional Chemokine Receptors (CCR1 and CCR2) on EoL-3 Cells: A Model System to Examine the Role of Chemokines in Cell Function
J. Pharmacol. Exp. Ther., October 1, 1997; 283(1): 411 - 418.
[Abstract] [Full Text]

C. A. Power, D. J. Church, A. Meyer, S. Alouani, A. E.I. Proudfoot, I. Clark-Lewis, S. Sozzani, A. Mantovani, and T. N.C. Wells
Cloning and Characterization of a Specific Receptor for the Novel CC Chemokine MIP-3alpha from Lung Dendritic Cells
J. Exp. Med., September 15, 1997; 186(6): 825 - 835.
[Abstract] [Full Text] [PDF]

B. J. Rollins
Chemokines
Blood, August 1, 1997; 90(3): 909 - 928.
[Full Text] [PDF]

H. L. Tiffany, L. L. Lautens, J.-L. Gao, J. Pease, M. Locati, C. Combadiere, W. Modi, T. I. Bonner, and P. M. Murphy
Identification of CCR8: A Human Monocyte and Thymus Receptor for the CC Chemokine I-309
J. Exp. Med., July 7, 1997; 186(1): 165 - 170.
[Abstract] [Full Text] [PDF]

T. A. Berkhout, H. M. Sarau, K. Moores, J. R White, N. Elshourbagy, E. Appelbaum, J. Makwana, J. J. Foley, D. B Schmidt, C. Imburgia, et al.
Cloning, in Vitro Expression, and Functional Characterization of a Novel Human CC Chemokine of the Monocyte Chemotactic Protein (MCP) Family (MCP-4) That Binds and Signals through the CC Chemokine Receptor 2B
J. Biol. Chem., June 27, 1997; 272(26): 16404 - 16413.
[Abstract] [Full Text] [PDF]

B.-S. Youn, S.-H. Kim, M. S. Lyu, C. A. Kozak, D. D. Taub, and B. S. Kwon
Molecular Cloning and Characterization of a cDNA, CHEMR1, Encoding a Chemokine Receptor With a Homology to the Human C-C Chemokine Receptor, CCR-4
Blood, June 15, 1997; 89(12): 4448 - 4460.
[Abstract] [Full Text] [PDF]

M. Baba, T. Imai, M. Nishimura, M. Kakizaki, S. Takagi, K. Hieshima, H. Nomiyama, and O. Yoshie
Identification of CCR6, the Specific Receptor for a Novel Lymphocyte-directed CC Chemokine LARC
J. Biol. Chem., June 6, 1997; 272(23): 14893 - 14898.
[Abstract] [Full Text] [PDF]

T. Imai, M. Baba, M. Nishimura, M. Kakizaki, S. Takagi, and O. Yoshie
The T Cell-directed CC Chemokine TARC Is a Highly Specific Biological Ligand for CC Chemokine Receptor 4
J. Biol. Chem., June 6, 1997; 272(23): 15036 - 15042.
[Abstract] [Full Text] [PDF]

J.-L. Gao, T. A. Wynn, Y. Chang, E. J. Lee, H. E. Broxmeyer, S. Cooper, H. L. Tiffany, H. Westphal, J. Kwon-Chung, and P. M. Murphy
Impaired Host Defense, Hematopoiesis, Granulomatous Inflammation and Type 1-Type 2�Cytokine Balance in Mice Lacking CC Chemokine Receptor 1
J. Exp. Med., June 2, 1997; 185(11): 1959 - 1968.
[Abstract] [Full Text] [PDF]

R. Yoshida, T. Imai, K. Hieshima, J. Kusuda, M. Baba, M. Kitaura, M. Nishimura, M. Kakizaki, H. Nomiyama, and O. Yoshie
Molecular Cloning of a Novel Human CC Chemokine EBI1-ligand Chemokine That Is a Specific Functional Ligand for EBI1, CCR7
J. Biol. Chem., May 23, 1997; 272(21): 13803 - 13809.
[Abstract] [Full Text] [PDF]

R. Godiska, D. Chantry, C. J. Raport, S. Sozzani, P. Allavena, D. Leviten, A. Mantovani, and P. W. Gray
Human Macrophage-derived Chemokine (MDC), a Novel Chemoattractant for Monocytes, Monocyte-derived Dendritic Cells, and Natural Killer Cells
J. Exp. Med., May 5, 1997; 185(9): 1595 - 1604.
[Abstract] [Full Text] [PDF]

L.-M. Wong, S. J. Myers, C.-L. Tsou, J. Gosling, H. Arai, and I. F. Charo
Organization and Differential Expression of the Human Monocyte Chemoattractant Protein 1Receptor Gene. EVIDENCE FOR THE ROLE OF THE CARBOXYL-TERMINAL TAIL IN RECEPTOR TRAFFICKING
J. Biol. Chem., January 10, 1997; 272(2): 1038 - 1045.
[Abstract] [Full Text] [PDF]

C.-A. N. Dunstan, M. N. Salafranca, S. Adhikari, Y. Xia, L. Feng, and J. K. Harrison
Identification of Two Rat Genes Orthologous to the Human Interleukin-8 Receptors
J. Biol. Chem., December 20, 1996; 271(51): 32770 - 32776.
[Abstract] [Full Text] [PDF]

T. Imai, T. Yoshida, M. Baba, M. Nishimura, M. Kakizaki, and O. Yoshie
Molecular Cloning of a Novel T Cell-directed CC Chemokine Expressed in Thymus by Signal Sequence Trap Using Epstein-Barr Virus Vector
J. Biol. Chem., August 30, 1996; 271(35): 21514 - 21521.
[Abstract] [Full Text] [PDF]

S. K. Ahuja and P. M. Murphy
The CXC Chemokines Growth-regulated Oncogene (GRO) alpha , GRObeta , GROgamma , Neutrophil-activating Peptide-2, and Epithelial Cell-derived Neutrophil-activating Peptide-78 Are Potent Agonists for the Type B, but Not the Type A, Human Interleukin-8 Receptor
J. Biol. Chem., August 23, 1996; 271(34): 20545 - 20550.
[Abstract] [Full Text] [PDF]

F. S. Monteclaro and I. F. Charo
The Amino-terminal Extracellular Domain of the MCP-1 Receptor, but Not the RANTES/MIP-1alpha Receptor, Confers Chemokine Selectivity. EVIDENCE FOR A TWO-STEP MECHANISM FOR MCP-1 RECEPTOR ACTIVATION
J. Biol. Chem., August 9, 1996; 271(32): 19084 - 19092.
[Abstract] [Full Text] [PDF]

C. J. Raport, J. Gosling, V. L. Schweickart, P. W. Gray, and I. F. Charo
Molecular Cloning and Functional Characterization of a Novel Human CC Chemokine Receptor (CCR5) for RANTES, MIP-1beta , and MIP-1alpha
J. Biol. Chem., July 19, 1996; 271(29): 17161 - 17166.
[Abstract] [Full Text] [PDF]

A. Meyer, A. J. Coyle, A. E.I. Proudfoot, T. N.C. Wells, and C. A. Power
Cloning and Characterization of a Novel Murine Macrophage Inflammatory Protein-1alpha Receptor
J. Biol. Chem., June 14, 1996; 271(24): 14445 - 14451.
[Abstract] [Full Text] [PDF]

J.-H. Gong, M. Uguccioni, B. Dewald, M. Baggiolini, and I. Clark-Lewis
RANTES and MCP-3 Antagonists Bind Multiple Chemokine Receptors
J. Biol. Chem., May 3, 1996; 271(18): 10521 - 10527.
[Abstract] [Full Text] [PDF]

M. Kitaura, T. Nakajima, T. Imai, S. Harada, C. Combadiere, H. L. Tiffany, P. M. Murphy, and O. Yoshie
Molecular Cloning of Human Eotaxin, an Eosinophil-selective CC Chemokine, and Identification of a Specific Eosinophil Eotaxin Receptor, CC Chemokine Receptor 3
J. Biol. Chem., March 29, 1996; 271(13): 7725 - 7730.
[Abstract] [Full Text] [PDF]

M. Lusti-Narasimhan, A. Chollet, C. A. Power, B. Allet, A. E. I. Proudfoot, and T. N. C. Wells
A Molecular Switch of Chemokine Receptor Selectivity
J. Biol. Chem., February 9, 1996; 271(6): 3148 - 3153.
[Abstract] [Full Text] [PDF]

C. Combadiere, S. K. Ahuja, J. Van Damme, H. L. Tiffany, J.-L. Gao, and P. M. Murphy
Monocyte Chemoattractant Protein-3 Is a Functional Ligand for CC Chemokine Receptors 1 and 2B
J. Biol. Chem., December 15, 1995; 270(50): 29671 - 29675.
[Abstract] [Full Text] [PDF]

This Article

Abstract

Full Text (PDF)

Submit a Letter to Editor

Alert me when this article is cited

Alert me when eLetters are posted

Alert me if a correction is posted

Citation Map

Services

Email this article to a friend

Similar articles in this journal

Similar articles in PubMed

Alert me to new issues of the journal

Download to citation manager

Request Permissions

Citing Articles

Citing Articles via HighWire

Citing Articles via Google Scholar

Google Scholar

Articles by Power, C. A.

Articles by Wells, T. N. C.

Search for Related Content

PubMed

PubMed Citation

Articles by Power, C. A.

Articles by Wells, T. N. C.

Social Bookmarking

What's this?