JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lehel, C.
Right arrow Articles by Anderson, W. B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lehel, C.
Right arrow Articles by Anderson, W. B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 33, Issue of August 18, pp. 19651-19658, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Protein Kinase C Subcellular Localization Domains and Proteolytic Degradation Sites
A MODEL FOR PROTEIN KINASE C CONFORMATIONAL CHANGES (*)

(Received for publication, November 7, 1994; and in revised form, June 20, 1995)

Csaba Lehel (1) Zoltán Oláh (1)(§) Gábor Jakab (2) Zoltán Szállási (3) György Petrovics (1) Gyöngyi Harta (2) Peter M. Blumberg (3) Wayne B. Anderson (1)(¶)

From the  (1)Laboratory of Cellular Oncology, NCI, the (2)Clinical Neuroscience Branch and Laboratory of Experimental Neuropathology, NINDS, and the (3)Laboratory of Cellular Carcinogenesis and Tumor Promotion, NCI, National Institutes of Health, Bethesda, Maryland 20892

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Protein kinase C (PKC) has been found to have unique properties among the PKC isozymes in terms of its membrane association, oncogenic potential, and substrate specificity. Recently we have demonstrated that PKC localizes to the Golgi network via its zinc finger domain and that both the holoenzyme and its zinc finger region modulate Golgi function. To further characterize the relationship between the domain organization and the subcellular localization of PKC, a series of NIH 3T3 cell lines were created, each overexpressing a different truncated version of PKC. The overexpressed proteins each were designed to contain an -epitope tag peptide at the COOH terminus to allow ready detection with an antibody specific for the tag. The subcellular localization of the recombinant proteins was analyzed by in vivo phorbol ester binding, immunocytochemistry, and cell fractionation followed by immunoblotting. Results revealed several regions of PKC that contain putative subcellular localization signals. The presence either of the hinge region or of a 33-amino-acid region including the pseudosubstrate sequence in the recombinant proteins resulted in association with the plasma membrane and cytoskeletal components. The catalytic domain was found predominantly in the cytosolic fraction. The accessibility and thus the dominance of these localization signals is likely to be affected by the overall conformation of the recombinant proteins. Regions with putative proteolytic degradation sites also were identified. The susceptibility of the overexpressed proteins to proteolytic degradation was dependent on the protein conformation. Based on these observations, a model depicting the interaction and hierarchy of the suspected localization signals and proteolytic degradation sites is presented.


INTRODUCTION

Protein kinase C (PKC) (^1)is a family of more than 10 isozymes of serine/threonine protein kinases that are central to many signal transduction pathways(1, 2, 3) . Although these isozymes share a similar structural domain organization, differences in their substrate specificity, cofactor requirements, tissue and cellular distribution, and subcellular localization suggest that each of the different PKC isozymes plays a specific and distinct regulatory role(s) in cellular signal transduction. However, the elucidation of PKC isozyme-specific functions has been hindered by the presence of multiple isozymes in the majority of tissues and cell lines studied, as well as by the almost complete lack of isozyme-specific in vivo activator or inhibitor molecules(4) . To date the most successful approaches to reveal PKC isozyme-specific phenomena have been either to overexpress a single isozyme in a given cell type(5, 6, 7) or to carry out antisense treatment of cells to specifically decrease the level of just one isotype(8, 9) .

Among the PKC isozymes, only PKC has been reported to exhibit full oncogenic potential(7, 10) . PKC also has been implicated in the regulation of other biological processes, including antiviral resistance(11) , hormone secretion(12) , and regulation of transporters (13, 14) . PKC displays unusual membrane association (13, 15) and a restricted in vitro substrate specificity(16) . Recently, we reported that PKC exhibited a unique association with Golgi membranes via its zinc finger domain and, in accordance with this subcellular localization, specifically modulated Golgi function(14) . These results suggested that the zinc finger domain of PKC might act as a specific localization signal.

Subcellular localization could be a key component in determining the functional and regulatory specificity of a given PKC isozyme. The PKC isozymes have been reported to localize to various subcellular compartments(17, 18, 19, 20, 21, 22, 23) , other proteins that appear to serve as anchoring factors for PKC have been cloned(24) , and regions with potential subcellular localization signals have been postulated for some of the isoforms(14, 19) . However, the precise determinants of subcellular localization and their potential importance in defining the function of a given PKC molecule have not yet been fully characterized for any of the isozymes.

A general model for the regulation of PKC activity often includes the translocation (tight association) of PKC to membranes in response to activator binding, accompanied by a conformational change within the lipid environment of the membrane that results in a catalytically active PKC(1) . This is followed by rapid inactivation, apparently due to a decrease in activator binding and dissociation of PKC from the membrane complex. However, if PKC remains tightly associated with the membrane for longer time periods, as in the case of activation by phorbol 12-myristate 13-acetate (PMA), the activated PKC becomes susceptible to down-regulation through proteolytic degradation(26, 27) . Although translocation is a rapid, dramatic subcellular redistribution of PKC, almost nothing is known about the molecular mechanism(s) and in vivo determinants of this process(2, 25) . Likewise, little is known of the events involved in the down-regulation and proteolytic degradation of PKC(27) . Whereas one protease cleavage site has been mapped to the border of the hinge region and catalytic domain of the cPKC isozymes(26) , the protease(s) involved in vivo is not clear(27) . Further, it is likely that other protease-sensitive sites also are involved in the progressive degradation of PKC.

PKC, a novel PKC isozyme, is one of the PKC isotypes reported to undergo translocation and to be susceptible to proteolytic degradation (13, 15, 28, 29) . To explore the effects of various domains of PKC on its conformation, subcellular localization, activator-induced translocation, and proteolytic stability, we have utilized stably transfected NIH 3T3 cell lines that overexpress different domain fragments of PKC. An epitope tag was added to the COOH termini of the mutant proteins to allow uniform detection by an antibody recognizing the tag peptide(30) . We have used these overexpressed recombinant polypeptides to identify regions of the molecule possibly involved in determining its subcellular distribution and translocation. In addition, we have investigated the proteolytic susceptibility of these recombinant proteins and have found several protease-sensitive regions.


EXPERIMENTAL PROCEDURES

Materials

DMEM, G418, and the antibody recognizing the COOH-terminal 12 amino acids of PKC were from Life Technologies, Inc. PMA was purchased from Calbiochem (San Diego, CA). [^3H]Phorbol 12,13-dibutyrate (PDBu) (20 Ci/mmol) was obtained from DuPont NEN.

Generation of the PKC Fragment Overexpressor Lines

The following oligonucleotides were synthesized and used to generate the PKC constructs: 5`-1, CCGCGTCGACCATGGTAGTGTTCAATGG; 5`-2, CGATCTCGAGGGATCATCGGGCGAAGCC; 5`-3, CAGGGTCGACCAGGTCAATGGCCACAAG; 5`-4, CCCTCTCGAGAACGGTGAAGTCCGGCAA; 3`-1, TTCCGCGC GCGTCCACCCCACAATTGGG; 3`-2, CCAAGCGCGCGGCCTGGCCTTGCCGGAC; and 3`-3, ATTCGCGCGCTCAGGGCATCAGGTCTTCAC. The development of the -epitope tagging system is described in detail in Olah, et al.(30) . This tagging system was proven to be suitable for all major immunological applications in NIH 3T3 cells, and the tag sequence was found to be neutral in determining intracellular localization. The eukaryotic pMTH expression vector contains a Zn-inducible metallothionein promoter, an ATG translational start codon, XhoI and MluI restriction enzyme sites, and the sequence coding for the -tag. In-frame cloning of a PCR-generated cDNA fragment into the XhoI and MluI sites results in the addition of a start codon at the NH(2) terminus and the -tag at the COOH terminus. By using the proofreading Vent polymerase (New England Biolabs) and the mouse cDNA coding for PKC (a generous gift from H. Mischak, Institute for Clinical Molecular Biology and Tumor Genetics, Munich, Germany) as template, PCR fragments were generated for the constructs depicted in Fig. 1. The following oligonucleotides were used as primers: 5`-1 and 3`-1 for the 1 construct; 5`-2 and 3`-1 for the 2 construct; 5`-3 and 3`-1 for the 3 construct; 5`-4 and 3`-3 for the 4 construct; 5`-2 and 3`-3 for the 5 construct; 5`-3 and 3`-3 for the 6 construct; 5`-3 and 3`-2 for the 7 construct; and 5`-1 and 3`-3 for the holoenzyme construct. To minimize the chance of generating unwanted point mutants, only 15 PCR cycles were employed. The cycle parameters were: 45 s at 60 °C; 45 s to 2 min 10 s at 72 °C (depending on the length of the PCR product); and 1 min at 95 °C. The fragments were cut by the XhoI/SalI and BssHII restriction enzymes and cloned into the pMTH expression vector. Randomly chosen clones were sequenced, and no mutation was detected.


Figure 1: Domain organization of PKC and its various recombinant -epitope-tagged derivatives. The numbers denote the NH(2)- and COOH-terminal amino acids of the various constructs. PS and ATP correspond to the pseudosubstrate region and the ATP-binding site, respectively, whereas represents the 12-amino-acid -epitope tag. With mouse PKC cDNA as template, PCR fragments were generated for the various recombinant proteins and cloned into the -epitope tagging vector, pMTH, as described under ``Experimental Procedures.''



Selection of High Level Monoclonal Overexpressor Lines

Because of the initial difficulties encountered in obtaining high level overexpressor cell lines, the following procedure was employed to ensure the efficient identification of clones with the highest level of overexpression. The pMTH constructs were transfected into NIH 3T3 cells by the calcium phosphate precipitation method, and G418-resistant (800 µg/ml) colonies were selected on 96-well plates. After 10-14 days the surviving colonies were detached by trypsinization (50 µl/well). One 25-µl aliquot from each well was transferred to a well in a new 96-well plate, and a second 25-µl aliquot from the same well was transferred to a well in 24-well replica plates. Fresh G418-containing DMEM was added to the cells on both the 24- and 96-well plates. When the cells growing on the 96-well plates reached confluency, their protein content (BCA method, Pierce) and [^3H]PDBu binding capacity were determined as described below. Colonies with the highest specific [^3H]PDBu binding capacity were identified and isolated from the 24-well replica plates and were further analyzed by immunoblotting. In place of [^3H]PDBu binding, a 96-well dot-blot assay using the anti--tag antibody was employed as a first step in screening for -epitope-tagged catalytic domain (fragment 4) overexpressor clones.

In Vivo [^3H]PDBu Binding Assay

The zinc finger region of protein kinase C functions in vivo as a high affinity receptor for phorbol ester tumor promoters, but only if it is in a membrane-associated state(13, 31) . In vivo [^3H]PDBu binding was performed as described(13) . Briefly, confluent cells in 24- or 96-well plates were changed to serum-free DMEM in the presence or absence of 20 µM zinc acetate and incubated under these conditions for 16 h. The serum-deprived cells were then incubated with 2 nM [^3H]PDBu for 5 min at 37 °C, followed by three washes with ice-cold phosphate-buffered saline. The amount of [^3H]PDBu bound was determined by liquid scintillation counting of aliquots of total cell lysates.

Cell Fractionation and Western Blot Analysis

The cells were cultured in DMEM supplemented with 10% fetal calf serum. Once the cells reached confluence, the medium was changed to serum-free DMEM, and the cells were incubated for 16 h in the presence of 20 µM zinc acetate to induce the up-regulation of the metallothionein promoter-controlled genes. The cells then were washed with ice-cold phosphate-buffered saline, harvested by scraping into lysis buffer (20 mM Tris-HCl (pH 7.4), 5 mM EGTA, 1 mM phenylmethylsulfonyl fluoride, and 20 µM leupeptin), and disrupted by Dounce homogenization. The cell homogenates were fractionated by differential centrifugation into nuclear (pellet of 800 g, 10 min of centrifugation), particulate (plasma membrane-enriched) (100,000 g, 1 h pellet of the nucleus-free, 800 g supernatant), and cytosolic (100,000 g supernatant) fractions. The nuclear and particulate fractions were further fractionated by treatment with 1% Triton X-100 for 30 min, followed by centrifugation (100,000 g for 1 h) to yield detergent-solubilized (nuclear membrane- and plasma membrane-enriched membrane fractions) and detergent-insoluble (nuclear scaffold and cytoskeleton) fractions. Equal amounts of protein from each fraction were separated by SDS-PAGE, and the recombinant proteins were detected by immunoblotting with a polyclonal antibody raised against the last 12 amino acids of PKC. The ECL (Amersham) protocol was used to visualize the immunoreactive bands.

Immunocytochemistry

The cells were grown on Permanox 8-well polystyrene chamber slides (Nunc Inc., Naperville, IL). Cells initially grown in the presence of 10% fetal calf serum were changed to serum-free DMEM supplemented with 20 µM zinc acetate to up-regulate the expression of the recombinant proteins. Following two washes with ice-cold phosphate-buffered saline, the cells were fixed with 4% paraformaldehyde in phosphate-buffered saline for 1 h at 4 °C. The fixed cells were permeabilized by incubation in 1% Triton X-100 for 2 h at 4 °C. Nonspecific antibody binding was blocked by 1 h of incubation with 2% low fat milk, and then the anti--tag antibody was applied at 1 µg/ml for 2 h at room temperature. Cyanine-conjugated (Cy3) anti-rabbit goat IgG (Jackson Immuno-Research) was used as second antibody at 1 µg/ml for 2 h at room temperature, and immunoreactivity was visualized with a Leica fluorescent microscope.


RESULTS

Generation of NIH 3T3 Cell Lines Overexpressing Various Mutants of PKC

The PKC constructs depicted in Fig. 1were inserted into the zinc-inducible vector pMTH to facilitate the addition of the -tag, a 12-amino-acid antibody epitope tag, to the COOH-terminal end of the recombinant proteins(30) . A series of deletion mutants (1-7) was created, based on the predicted domain organization of PKC(1, 2) . Fragments 1, 2, and 3 contain the zinc finger domain with various extensions to the NH(2) terminus. Fragment 4 represents the catalytic domain, whereas 5 and 6 have only deletions NH(2)-terminal to the zinc finger domain. The recombinant protein 7 encompasses the zinc finger domain and the hinge region. Due to initial difficulties in obtaining high level overexpressor cell lines for these constructs, a two-step colony screening procedure was employed for the fast and efficient identification of clones with the highest levels of overexpression. First, clones with high in vivo phorbol ester binding capacity were identified, and then their level of overexpression was further analyzed by immunoblotting (for details, see ``Experimental Procedures''). The clones that were selected for further characterization in this study were chosen as the best overexpressors for the given construct from among at least 30 individual clones in each case. The recombinant proteins were overexpressed at a high level, as judged by immunoblotting and in vivo phorbol ester binding assays (Fig. 2, and data not shown).


Figure 2: Characterization of the recombinant protein overexpressor cell lines by immunoblotting. Overexpressor cells were lysed at 80% confluency in SDS-PAGE sample buffer, 10 µg of protein/lane was applied to SDS-PAGE, and immunoblot analysis was carried out with the anti -epitope tag antibody (see ``Experimental Procedures''). Molecular mass markers are shown at the left.



Western Blot Analysis of the Subcellular Localization of the Recombinant Proteins

To characterize the subcellular localization of the mutant proteins, overexpressor cells were lysed and fractionated into cytosolic, plasma membrane-enriched, nuclear, and cytoskeletal fractions, as described under ``Experimental Procedures.'' The presence of the -tagged recombinant proteins in each fraction was analyzed by immunoblotting with the specific -tag antibody, which recognizes the same antibody epitope tag (the last 12 amino acids of PKC) at the COOH termini of each recombinant protein. As demonstrated in Fig. 3, each protein was detected in multiple fractions, with the holoenzyme and its longest truncated mutant (5) found in all fractions. The catalytic domain fragment (4) also was detected in most of the fractions, with the highest level present in the cytosol. In contrast, the remainder of the mutant proteins (1, 2, 3, 6, and 7) were found to be distributed solely within the particulate fractions, with none detected in the cytosolic fraction. The 3 and 6 proteins were the most confined in their subcellular distribution, being present only in the nuclear fractions. The major differences noted in subcellular distribution between the 2 and the 3 and between the 5 and the 6 recombinant proteins are indicated by arrows in Fig. 3. These differences apparently are conferred by the presence or the absence of the pseudosubstrate region in these -epitope-tagged mutant proteins (Table 1).


Figure 3: Analysis of the subcellular distribution of the various PKC recombinant fragments by cell fractionation and immunoblotting. Confluent cells were deprived of serum and induced in the presence of 20 µM zinc acetate for 16 h, disrupted by Dounce homogenization, and fractionated by centrifugation into nuclear, particulate, and cytosolic fractions as described under ``Experimental Procedures.'' The nuclear and particulate fractions were further separated by Triton X-100 detergent extraction, resulting in detergent-soluble (nuclear and particulate) fractions, and detergent-insoluble (nuclear scaffold and cytoskeleton) fractions. 10 µg of protein/lane was applied to SDS-PAGE, and the recombinant proteins in each fraction were detected by immunoblotting. The arrows indicate the major subcellular localization differences between the 2 and 3 recombinant proteins and the 5 and 6 proteins, respectively.





Immunocytochemical Analysis of the Subcellular Distribution and PMA-induced Translocation of the Recombinant Proteins

Immunocytochemistry also was employed as an approach to further characterize the distribution of the -epitope-tagged mutant proteins (Fig. 4). The overexpressor cells were fixed and stained for the presence of the recombinant proteins using the antibody recognizing the -epitope tag, as described under ``Experimental Procedures.'' The PKC holoenzyme (Fig. 4H) was found predominantly distributed in the cytoplasm but also was detected at the perinuclear region previously identified as Golgi (14) and to a minor degree localized to the plasma membrane. 5, the longest deletion mutant protein (Fig. 4E), and the 4 catalytic domain mutant (Fig. 4D) also exhibited a predominant, diffuse cytoplasmic staining pattern. In sharp contrast, the 1 (Fig. 4A), 2 (Fig. 4B), and 7 (Fig. 4G) recombinant proteins all showed similar subcellular staining patterns, with prominent plasma membrane and Golgi localization. As in the case of the results obtained by Western blot analysis, the 3 (Fig. 4C) and 6 (Fig. 4F) proteins again exhibited the most restricted distribution, with both recombinant proteins found only at the perinuclear Golgi region. The unexpected discrepancy between the nuclear localization of the 3 and 6 proteins as revealed by subcellular fractionation and their specific distribution to the Golgi as observed by immunocytochemical localization may be due to the tight association of perinuclear Golgi vesicles with the microtubule organizing center(32, 33) . This complex may result in the recovery of 3 and 6 proteins along with the nuclear preparation during the cell fractionation protocol and may also explain their incomplete detergent solubility. These results also suggest that PKC may itself be part of the complex establishing the coupling between the microtubule organizing center and Golgi vesicles. In Fig. 4F it also was noted that the level of overexpression of the 6 fragment showed great cell to cell variability, despite their monoclonal origin and the long term maintenance of 6 fragment overexpression. Conceivably, this variability may be due to differences in expression at different phases of the cell cycle. To establish that the -epitope tag did not influence the Golgi localization of fragment 3, an hemagglutinin-tagged version of the fragment 3 zinc finger domain also was created and stably transfected into NIH 3T3 cells. Its subcellular localization was found to be identical to that of the -epitope-tagged 3 protein. Furthermore, co-overexpression of hemagglutinin-tagged fragment 3 in cells overexpressing -tagged fragment 4 was found to have no effect on the characteristic, distinct subcellular localization of either of these recombinant proteins (data not shown).


Figure 4: Immunocytochemical analysis of NIH 3T3 cell lines overexpressing the various -epitope-tagged recombinant proteins, with the empty pMTH vector as a control. The cells were fixed with paraformaldehyde, solubilized by exposure to Triton X-100 detergent, and incubated with the anti--tag antibody as described under ``Experimental Procedures.'' Immunofluorescent staining was employed using Cy3-conjugated anti-rabbit antibody. A, 1; B, 2; C, 3; D, 4; E, 5; F, 6; G, 7; H, holo PKC overexpressor cells. I presents cells transfected with the empty pMTH vector. The large arrows point to the plasma membrane, whereas the small arrows designate the Golgi. Note the strictly perinuclear decoration of cells overexpressing the 3 and 6 proteins. The bar represents 20 µm.



The short term, PMA-induced subcellular redistribution of the -epitope-tagged mutant proteins also was investigated by immunocytochemistry. Most of the mutant proteins (including the 1 and 5 proteins, data not shown) were completely translocated to the plasma membrane within 10 min of treatment of the cells with PMA (Fig. 5). The subcellular distribution of the 4 catalytic domain fragment, which does not contain the phorbol ester-binding domain, was not affected by PMA treatment, whereas the 3 zinc finger domain fragment was observed to translocate at a much slower rate (data not shown).


Figure 5: PMA-induced subcellular redistribution of the PKC recombinant proteins. The overexpressor cells were exposed to PMA for 10 min and then fixed and stained as described in the legend to Fig. 4. A and B, holo PKC; C and D, 2; E and F, 6; G and H, 7 overexpressor cells. A, C, E, and G, untreated cells. B, D, F, and H, cells after PMA treatment. The large arrows indicate the plasma membrane, whereas the small arrows designate the Golgi. The bar represents 20 µm.



Proteolytic Degradation of the Recombinant Proteins

Previous studies have demonstrated that activation of PKC by growth factor or phorbol ester treatment of intact cells causes the enzyme to become susceptible to proteolytic degradation(26) . The availability of this series of mutant -epitope-tagged PKC recombinant proteins provided an opportunity to better characterize this process. PMA treatment of the different overexpressor cell types induced a rapid but not complete degradation of all of the recombinant proteins. Intermediate degradation products induced in response to PMA treatment, however, were not detectable by Western blot analysis, presumably due to their short half-life (data not shown). In contrast, sustained high levels of expression of the recombinant proteins (several days of zinc induction to up-regulate expression), accompanied by a slower, uninduced proteolysis of the recombinant proteins, which occurred at confluency, resulted in the accumulation of some intermediate degradation products at levels that could be detected by immunoblot analysis (Fig. 6). The low levels of the 4 and 6 proteins found even under these conditions suggest that these mutant proteins may be proteolytically unstable molecules. A pool of the 2 protein was degraded, resulting in a fragment that is only slightly larger in size than the 3 zinc finger protein. This finding suggests that the 2 protein was cleaved between the pseudosubstrate region and the zinc finger domain. Limited proteolysis of the PKC holoenzyme and the 5 recombinant protein resulted in the generation of fragments seemingly identical in size. The largest proteolytic fragment generated was indistinguishable from the 4 catalytic domain fragment. The appearance of this fragment suggests the presence of a possible in vivo cleavage site for PKC located between the hinge region and the catalytic domain. No degradation products were detected for the remainder of the overexpressed mutant proteins. This may be due either to their relative stability (3 and 7) or to the low levels of accumulation of the recombinant proteins themselves (4 and 6). In either case, this would hinder the detection of possible proteolyzed forms. After sustained, high level expression of the 3 fragment, a protein band of about 35 kDa was reproducibly recognized by the specific -tag antibody in extracts prepared from these cells. The exact origin of this band is not clear. However, it is possible that this 35-kDa band might represent a dimeric, complexed form of the zinc finger domain that may be resistant to dissociation under the denaturing conditions of electrophoresis(34) .


Figure 6: Analysis of the proteolytic degradation of the various overexpressed PKC mutant proteins. The overproducer cells were grown in DMEM supplemented with 10% fetal calf serum and 75 µM zinc acetate and were maintained for an additional 3-4 days in the same composition medium after reaching confluency to allow accumulation of the indicated recombinant proteins to as high a level as possible. The cells then were harvested in hot SDS sample buffer to prevent further degradation, and 50 µg of protein/lane was applied to SDS-PAGE and analyzed by immunoblotting as described under ``Experimental Procedures.'' The nonspecific immunoreactivity in the 90-kDa range in lanes from 1 to 4 is most likely due to sample overloading. Molecular mass markers are shown at the left.




DISCUSSION

Recently we showed that the zinc finger region of PKC localizes exclusively to the Golgi and suggested that this domain may function as a localization signal for the holoenzyme(14) . In the present study we have employed NIH 3T3 cell lines stably overexpressing various -epitope-tagged domain fragments of PKC to better characterize the role(s) that the protein domains of PKC may play in determining subcellular localization and structural stability. The subcellular distribution of the mutant proteins was analyzed by in vivo [^3H]PDBu binding assay, immunocytochemistry, and cell fractionation followed by immunoblotting. Our results indicate that in addition to the zinc finger domain, at least three other regions of PKC may function as subcellular localization signals. The pseudosubstrate and hinge regions, which are part of the 2 and 7 mutant proteins, respectively, but which are absent from the 3 protein, facilitated plasma membrane and cytoskeletal association ( Fig. 3and 4). Further, the catalytic domain seems to contain determinants for cytosolic localization, because only those mutant proteins that contain this domain exhibited cytosolic distribution. Alternatively, the diffuse distribution conferred by the presence of the catalytic domain might be interpreted to indicate a lack of localization signal in this region. To answer this question would require further experiments.

Because activator-induced conformational changes and membrane association appear to be involved with the proteolytic down-regulation of PKC, the susceptibility of the recombinant proteins to proteolysis also was assessed (Fig. 6). It is of interest that although PMA induced proteolytic degradation, the degradation products themselves were detected only in confluent, resting cells. Whether proteolysis under the two conditions operates via the same mechanism and generates the same fragments requires further investigation. Our current hypothesis is that they do, only the faster rate of PMA-induced degradation does not allow the accumulation and thus the detection of the intermediate products.

The degradation products of holo-PKC and of the 2 and 5 mutant proteins allowed us to identify three protease-sensitive regions of PKC: between the pseudosubstrate region and zinc finger domain, at the border of the hinge region and catalytic domain, and within the catalytic domain, probably close to the ATP-binding site. Proteolytic cleavage between the hinge region and the catalytic domain is thought to be an initial step in the degradation of PKC. Cleavage at this site has been reported for a number of PKC isozymes, including PKC, and is carried out in vivo by unknown proteases (27) or in vitro by incubation with trypsin or calpain(26, 28, 29) . An additional cleavage at or near the ATP-binding site conceivably could serve to rapidly inactivate the unregulated catalytic domain. The presence of another protease-sensitive site between the pseudosubstrate region and the zinc finger domain has been observed in vitro(35) . The results presented in Fig. 6indicate that this cleavage site also plays a role in the degradation of PKC in vivo as well.

Some of the findings presented in this communication cannot be accounted for simply by the presence or absence of individual localization signals or protease-sensitive sites. For example, the 6 protein is unstable, whereas the larger 5 and the smaller 7 proteins are more stable. Further, the 6 protein localized exclusively to the Golgi, whereas the larger 5 and the smaller 7 proteins exhibited a broader subcellular distribution. To help clarify the results reported and discussed here, we have summarized the observations in the schematic model presented in Fig. 7. Although additional information probably is required for a complete understanding of the structural interrelationships of PKC, this schematic representation of intracellular domain-domain interactions is in agreement with the results obtained and also takes into account features of previous models depicting the structure-function relationship of PKC(25, 36) . According to this model, in the resting state the holo PKC protein is folded into a compact structure via two strong interdomain interactions: between the pseudosubstrate region and the substrate recognition pocket of the catalytic domain and between the hinge region and the catalytic domain (Fig. 7A). The former interaction has been postulated in earlier models ( (25) and references therein), whereas the latter may be identical with the activated C kinase receptor-binding site pseudo activated C kinase receptor interaction suggested by Ron et al.(24) . Further, in our representation the plasma membrane localization signal may be identical with the activated C kinase receptor-binding portion of the hinge region(24) . In this folded, compact conformation neither the ``dominant'' localization signals (pseudosubstrate region, zinc finger domain, localization signal in the hinge region; see also below) nor the protease-sensitive sites are primarily exposed on the surface. Thus, in this state the protein is proteolytically stable and found diffusely distributed primarily in the cytosol due to the presence of putative cytoplasmic localization signal(s) within the catalytic domain (Fig. 3; (28) ). Deletion of the NH(2)-terminal 133 amino acids of the V(0) region, which results in the 5 recombinant protein, had no effect on the localization or stability of the molecule. The corresponding NH(2)-terminal region was also found to be dispensible in determining the cofactor dependence of the closely related nPKC isozyme(25) , although its possible function in Ca binding was suggested by sequence comparison(37) .


Figure 7: A schematic model for PKC depicting domain-domain interactions, putative localization signals, and proteolytic degradation sites. The empty and gray boxes represent the pseudosubstrate and hinge regions, respectively. The stipled two-tooth comb-like structures represent the zinc finger region, and the small black dots represent protease-sensitive sites. A, the completely folded structure of holo PKC in its inactive state. Two strong interdomain interactions are suggested: between the pseudosubstrate region and catalytic domain and between the hinge region and the catalytic domain. Note that the dominant localization signals (pseudosubstrate region, zinc finger domain, hinge region), as well as the protease-sensitive sites, are buried within the molecule. B, represents the structure of the 6 recombinant protein. The lack of the pseudosubstrate region results in partial unfolding, which gives the zinc finger domain dominance in determining the subcellular localization and also exposes a protease-sensitive site. The plasma membrane localization signal present in the hinge region remains inaccessible. C, activation induces unfolding of the holo PKC protein. Binding of an activating ligand (large black oval) to the zinc finger region induces this major conformational change due to disruption of the two interdomain interactions. The ``sticky'' surfaces of the pseudosubstrate and hinge regions then can function as localization signals for tight association with membranes. The three putative proteolytic degradation sites also would be exposed in this membrane-associated, activated conformational state.



In contrast, deletion through the pseudosubstrate region, represented by the 6 mutant protein, apparently induces major conformational changes by disrupting one of the crucial interdomain interactions (Fig. 7B). In this state the protein would be in a partially unfolded conformation with at least some of the protease-sensitive sites now accessible. This would be consistent with the low level of the 6 protein found in the cell. The plasma membrane localization signal of the hinge region, which would be exposed on the surface of the smaller 7 protein, is still buried in this case. On the other hand, the zinc finger region would be readily accessible in this conformation of the 6 protein to dominantly exert its Golgi localization effect over the cytosolic distribution provided by the catalytic domain.

This model is in agreement with the recent hypothesis that cofactor-induced activation of PKC is accompanied by the dissociation of the pseudosubstrate region from the substrate-binding domain, along with association of the now exposed NH(2)-terminal region with acidic phospholipids of membranes(25, 38) . Further, our results suggest that PMA treatment also disrupts the other intramolecular interaction between the hinge region and the catalytic domain (Fig. 7C). The observation that PMA induces the translocation of the strictly Golgi-localized 6 protein to the plasma membrane (Fig. 5), apparently by allowing the localization signal of the hinge region to appear on the surface, is in accordance with this hypothesis. According to this model the activator-induced conformational changes allow all three dominant localization signals to become exposed, thus providing sufficient information for the activated molecule to redistribute to its required subcellular localization. The exposed pseudosubstrate and hinge regions, as a function of their cytoskeletal binding capacities (Fig. 3), also might play a role in the subcellular redistribution process itself for PKC. The identification of interactions between cytoskeletal proteins and the pseudosubstrate region of PKC supports this hypothesis(36) .

Consistent with this model is the suggestion that proteolytic cleavage at the site between the pseudosubstrate region and the zinc finger domain, as demonstrated in Fig. 6, may be one of the first steps in the down-regulation of activated PKC. This would serve to lock the protein into an open, proteolytically susceptible conformation and also would remove one of the postulated localization signals. Further studies are required to define the physiological relevance of this cleavage site.

The results presented also establish an apparent order of dominance among the localization signals of PKC. In the absence of activation by PMA, the zinc finger region shows clear dominance over the cytoplasmic localization signal(s) of the catalytic domain in the 6 protein, whereas it can contribute equally with the pseudosubstrate and hinge regions in defining the localization of the 2 and 7 proteins, respectively ( Fig. 3and Fig. 4). With PMA treatment, however, the pseudosubstrate and hinge regions are clearly dominant in directing the localization of the PKC mutant proteins over both the zinc finger and catalytic domains. Because in the 2 and 7 recombinant proteins both the pseudosubstrate and hinge regions would be exposed on the surface of the molecule even prior to PMA binding, it seems unlikely that their contribution would increase with PMA treatment. Rather, a decreased ability of the zinc finger region to act as a Golgi localization signal upon PMA binding would explain the complete Golgi to plasma membrane translocations of the 2, 6, and 7 proteins (Fig. 5). (^2)

These findings raise several questions. Is the hypothesis that the zinc finger region can serve as a localization signal applicable to other PKC isozymes? What happens to the degradation products of PKC? Because, in contrast to the catalytic domain fragment, most of the mutant proteins representing the regulatory domains of PKC proved to be fairly stable, it is conceivable that they might accumulate to relatively high levels as degradation products of endogenous PKC. Do these proteolytic fragments have any biological function? Our observation that the Golgi-localized zinc finger domain affects Golgi function suggests that proteolytically generated fragments of PKC may play a role in cellular regulation(13) . Additional studies utilizing PKC mutant proteins as described are required to answer these important considerations.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Present address: Research Institute for Genetic and Human Therapy, Gaithersburg, MD 20879.

To whom reprint requests should be addressed: Laboratory of Cellular Oncology, NCI, NIH, Bldg. 37, Rm. 1E14, Bethesda, MD 20892. Tel.: 301-496-9247; Fax: 301-480-0471.

(^1)
The abbreviations used are: PKC, protein kinase C; PDBu, phorbol 12,13-dibutyrate; PMA, phorbol 12-myristate 13-acetate; DMEM, Dulbecco's modified Eagle's medium; PCR, polymerase chain reaction; PAGE, polyacrylamide gel electrophoresis.

(^2)
C. Lehel, Z. Oláh, G. Jakab, and W. B. Anderson, manuscript in preparation.


ACKNOWLEDGEMENTS

We thank Dr. H. Mischak (Institute for Clinical Molecular Biology and Tumor Genetics, Munich, Germany) for providing the mouse PKC cDNA.


REFERENCES

  1. Nishizuka, Y. (1992) Science 258,607-614 [Abstract/Free Full Text]
  2. Hug, H., and Sarre, T. F. (1993) Biochem. J. 291,329-343
  3. Dekker, L. V., and Parker, P. J. (1994) Trends Biochem. Sci. 19,73-77 [CrossRef][Medline] [Order article via Infotrieve]
  4. Szállási, Z., Kosa, K., Smith, C. B., Dlugosz, A. A., Williams, E. K., Yuspa, S. H., and Blumberg, P. (1995) Mol. Pharmacol. 47,285-265
  5. Hirai, S.-I., Izumi, Y., Higa, K., Kaibuchi, K., Mizuno, K., Osada, S.-I., Suzuki, K., and Ohno, S. (1994) EMBO J. 13,2331-2340 [Medline] [Order article via Infotrieve]
  6. Watanabe, T., Ono, Y., Taniyama, Y., Hazama, K., Igarashi, K., Ogita, K., Kikkawa, U., and Nishizuka, Y. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,10159-10163 [Abstract/Free Full Text]
  7. Cacace, A. M., Guadagno, S. N., Krauss, R. S., Fabbro, D., and Weinstein, I. B. (1993) Oncogene 8,2095-2104 [Medline] [Order article via Infotrieve]
  8. Dean, N. M., McKay, R., Condon, T. P., and Bennett, C. F. (1994) J. Biol. Chem. 269,16416-16424 [Abstract/Free Full Text]
  9. Baxter, G. T., Miller, D. L., Kuo, R. C., Wada, H. G., and Owicki, J. C. (1992) Biochemistry 31,10950-10954 [CrossRef][Medline] [Order article via Infotrieve]
  10. Mischak, H., Goodnight, J., Kolch, W., Martiny-Baron, G., Schaechtle, C., Kazanietz, M. G., Blumberg, P. M., Pierce, J. H., and Mushinski, J. F. (1993) J. Biol. Chem. 268,6090-6096 [Abstract/Free Full Text]
  11. Pfeffer, L. M., Eisenkraft, B. L., Reich, N. C., Improta, T., Baxter, G., Daniel-Issakani, S., and Strulovici, B. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,7988-7992 [Abstract/Free Full Text]
  12. Akita, Y., Ohno, S., Yajima, Y., Konno, Y., Saido, T. C., Mizuno, K., Chida, K., Osada, S., Kuroki, T., Kawashima, S., and Suzuki, K. (1994) J. Biol. Chem. 269,4653-4660 [Abstract/Free Full Text]
  13. Lehel, C., Olah, Z., Mischak, H., Mushinski, J. F., and Anderson, W. B. (1994) J. Biol. Chem. 269,4761-4766 [Abstract/Free Full Text]
  14. Lehel, C., Olah, Z., Jakab, G., and Anderson, W. B. (1995) Proc. Natl. Acad. Sci. U. S. A. 92,1406-1410 [Abstract/Free Full Text]
  15. Olivier, A. R., and Parker, P. J. (1994) J. Biol. Chem. 269,2758-2763 [Abstract/Free Full Text]
  16. Schaap, D., Parker, P. J., Bristol, A., Kriz, R., and Knopf, J. (1989) FEBS Lett. 243,351-357 [CrossRef][Medline] [Order article via Infotrieve]
  17. Kraft, A., and Anderson, W. B. (1983) Nature 301,621-623 [CrossRef][Medline] [Order article via Infotrieve]
  18. Jaken, S., Leach, K., and Klauck, T. (1989) J. Cell Biol. 109,697-704 [Abstract/Free Full Text]
  19. James, G., and Olson, E. (1992) J. Cell Biol. 116,863-874 [Abstract/Free Full Text]
  20. Divecha, N., Banfic, H., and Irvine, R. F. (1993) Cell 74,405-407 [CrossRef][Medline] [Order article via Infotrieve]
  21. Thomas, T. P., Talwar, H. S., and Anderson, W. B. (1988) Cancer Res. 48,1910-1919 [Abstract/Free Full Text]
  22. Spudich, A., Meyer, T., and Stryer, L. (1992) Cell Motil. Cytoskeleton 22,250-256 [CrossRef][Medline] [Order article via Infotrieve]
  23. Chida, K., Sagara, H., Suzuki, Y., Murakami, A., Osada, S.-I., Ohno, S., Hirosawa, K., and Kuroki, T. (1994) Mol. Cell. Biol. 14,3782-3790 [Abstract/Free Full Text]
  24. Ron, D., Chen, C. H., Caldwell, J., Jamieson, L., Orr, E., and Mochly-Rosen, D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,839-843 [Abstract/Free Full Text]
  25. Dekker, L. V., McIntyre, P., and Parker, P. J. (1993) J. Biol. Chem. 268,19498-19504 [Abstract/Free Full Text]
  26. Kishimoto, A., Mikawa, K., Hashimoto, K., Yasuda, I., Tanaka, S., Tominaga, M., Kuroda., T., and Nishizuka, Y. (1989) J. Biol. Chem. 264,4088-4092 [Abstract/Free Full Text]
  27. Junco, M., Webster, C., Crawford, C., Bosca, L., and Parker, P. J. (1994) Eur. J. Biochem. 223,259-263 [Medline] [Order article via Infotrieve]
  28. Baxter, G., Oto, E., Daniel-Issakani, S., and Strulovici, B. (1992) J. Biol. Chem. 267,1910-1917 [Abstract/Free Full Text]
  29. Schaap, D., Hsuan, J., Totty, N., and Parker, P. J. (1990) Eur. J. Biochem. 191,431-435 [Medline] [Order article via Infotrieve]
  30. Olah, Z., Lehel, C., Jakab, G., and Anderson, W. B. (1994) Anal. Biochem. 221,94-102 [CrossRef][Medline] [Order article via Infotrieve]
  31. Leach, K. L., James, M. L., and Blumberg, P. M. (1983) Proc. Natl. Acad. Sci. U. S. A. 80,4208-4212 [Abstract/Free Full Text]
  32. Moskalewski, S., and Thyberg, J. (1992) J. Submicrosc. Cytol. Pathol. 24,359-370 [Medline] [Order article via Infotrieve]
  33. Reaves, B., and Banting, G. (1992) J. Cell Biol. 116,85-94 [Abstract/Free Full Text]
  34. Fafournoux, P., Noel, J., and Pouyssegur, J. (1994) J. Biol. Chem. 269,2589-2596 [Abstract/Free Full Text]
  35. Newton, A. C., and Orr, J. W. (1994) J. Cell. Biochem. 18D,(suppl.) 68
  36. Liao, L., Hyatt, S. L., Chapline, C., and Jaken, S. (1994) Biochemistry 33,1229-1233 [CrossRef][Medline] [Order article via Infotrieve]
  37. Sossin, W. S., and Schwartz, J. H. (1993) Trends Biochem. Sci. 18,207-208 [CrossRef][Medline] [Order article via Infotrieve]
  38. Mosior, M., and McLaughlin, S. (1991) Biophys. J. 60,149-159 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Biol. CellHome page
I. Fernandez-Ulibarri, M. Vilella, F. Lazaro-Dieguez, E. Sarri, S. E. Martinez, N. Jimenez, E. Claro, I. Merida, K. N.J. Burger, and G. Egea
Diacylglycerol Is Required for the Formation of COPI Vesicles in the Golgi-to-ER Transport Pathway
Mol. Biol. Cell, September 1, 2007; 18(9): 3250 - 3263.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Heart Circ. Physiol.Home page
S. L. Robia, M. Kang, and J. W. Walker
Novel determinant of PKC-{epsilon} anchoring at cardiac Z-lines
Am J Physiol Heart Circ Physiol, November 1, 2005; 289(5): H1941 - H1950.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. W. Nasser, R. J. Marjoram, S. L. Brown, and R. M. Richardson
Cross-Desensitization among CXCR1, CXCR2, and CCR5: Role of Protein Kinase C-{epsilon}
J. Immunol., June 1, 2005; 174(11): 6927 - 6933.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
A. Denys, A. Hichami, and N. A. Khan
n-3 PUFAs modulate T-cell activation via protein kinase C-{alpha} and -{varepsilon} and the NF-{kappa}B signaling pathway
J. Lipid Res., April 1, 2005; 46(4): 752 - 758.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
O. Rey, J. R. Reeve Jr., E. Zhukova, J. Sinnett-Smith, and E. Rozengurt
G Protein-coupled Receptor-mediated Phosphorylation of the Activation Loop of Protein Kinase D: DEPENDENCE ON PLASMA MEMBRANE TRANSLOCATION AND PROTEIN KINASE C{epsilon}
J. Biol. Chem., August 13, 2004; 279(33): 34361 - 34372.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
H.-Y. Park, H. Wu, C. E. Killoran, and B. A. Gilchrest
The receptor for activated C-kinase-I (RACK-I) anchors activated PKC-{beta} on melanosomes
J. Cell Sci., July 15, 2004; 117(16): 3659 - 3668.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Zhang, D. Hodge, T. J. Rogers, and J. J. Oppenheim
Ca2+-independent Protein Kinase Cs Mediate Heterologous Desensitization of Leukocyte Chemokine Receptors by Opioid Receptors
J. Biol. Chem., April 4, 2003; 278(15): 12729 - 12736.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
B. Junoy, H. Maccario, J.-L. Mas, A. Enjalbert, and S. V. Drouva
Proteasome Implication in Phorbol Ester- and GnRH-Induced Selective Down-Regulation of PKC ({alpha}, {epsilon}, {zeta}) in {alpha}T3-1 and L{beta}T2 Gonadotrope Cell Lines
Endocrinology, April 1, 2002; 143(4): 1386 - 1403.
[Abstract] [Full Text] [PDF]


Home page