|
|
|
|||||||
|
|||||||||
(Received for publication, June
21, 1995) From the
1,25-Dihydroxyvitamin D
1,25-Dihydroxyvitamin D Much attention has focused upon the
AP-1 transcription factor, which consists of a family of proteins
related to and including the c-Fos (FosB, Fra1, and Fra2) and c-Jun
(JunB, JunD) proto-oncogene products (10, 11) . The
dimeric forms of Jun and Fos family members bind to DNA exhibiting a
consensus sequence of TGA(C/T)TCA while monomers are unable to
functionally bind to DNA. These genes are expressed in a cell stage,
lineage, and inducer-specific
manner(11, 12, 13) , and it has been
demonstrated that although the Jun family members can bind to the same
DNA sequences, they do so with different affinities and may elicit
different responses with regard to expression of target
genes(14, 15, 16) . Since alterations in AP-1
activity can interfere with normal cell cycle progression, this
transcription factor may modulate the expression of genes involved in
cell growth and differentiation(17, 18, 19) .
Considering that VD Investigations into
the effects of VD A series of experiments
are reported herein which show that nuclear extracts from the sensitive
and resistant cells express VDRs that bind to the human
osteocalcin-vitamin D-response element (OC-VDRE) along with AP-1
proteins and that the activity of these complexes is regulated by
VD
Although no differences were detected between the VDRs
expressed in the sensitive and resistant cells, analysis of
electrophoretic mobility shift assays (EMSA) shows that differences in
the DNA binding activity are present in nuclear extracts from control (Fig. 1, lanes1-5) or
VD
Figure 1:
Electrophoretic mobility shift of
OC-VDRE by RWLeu-4 (A) and JMRD
Figure 2:
Analysis of VD
Because AP-1 binds to the
OC-VDRE(22, 29) , it was suspected that other bands in
the EMSA might contain Jun and Fos proteins. Experiments were
undertaken to determine if the activity of AP-1 is modified during
VD EMSA
supershifting experiments were performed to determine whether
differences in AP-1 binding activity are due to the differential
activation of specific members of the Jun and Fos families. Antibodies
specific for the Jun and Fos family members were added after a
preincubation of extracts with radiolabeled OC-VDRE as indicated in the
legend for Fig. 3. Both RWLeu-4 (Fig. 3A) and
JMRD
Figure 3:
EMSA
supershifting of OC-VDRE binding bands in RWLeu-4 (A) or
JMRD
Figure 4:
EMSA
supershift of JunD and FosB in OC-VDRE complexes from extracts treated
for 0-72 h with VD
Western immunoblots, shown in Fig. 5, confirm
that JunD protein in nuclear extracts increases in the sensitive cells
after VD
Figure 5:
Detection of AP-1 oncoproteins by Western
immunoblotting. Nuclear extracts were prepared from RWLeu-4 (lanes
1-4) and JMRD
These results
show that both the VD The results
presented here suggest that the anti-proliferative actions of VD
Volume 270,
Number 34,
Issue of August 25, pp. 19676-19679, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
inhibits the proliferation
of the chronic myelogenous leukemia cell line RWLeu-4 but not the
resistant variant, JMRD. Although these cells exhibit no
detectable differences in the vitamin D receptor, alterations in the
interaction of nuclear extracts with the
osteocalcin-1,25-dihydroxyvitamin D-response element are
noted. It is shown herein that the 1,25-dihydroxyvitamin D receptor binds to the osteocalcin-1,25-dihydroxyvitamin
D-response element along with activator protein-1 (AP-1)
complexes and that the DNA binding activities of members of the Jun and
Fos proto-oncogene families, which make up the AP-1 transcription
factor, are differentially regulated by 1,25-dihydroxyvitamin
D. It is shown that JunD DNA binding activity is enhanced
by 1,25-dihydroxyvitamin D during cell cycle arrest in the
sensitive cells but is decreased in the resistant cells. These results
suggest that the level of JunD DNA binding activity may be a critical
factor in the regulation of proliferation.
(VD) (
)plays an important role in regulating the proliferation
and differentiation of myeloid
cells(1, 2, 3, 4) . Many of the
effects of VD are mediated through the binding and
activation of high affinity nuclear receptors (VDRs) (5) that
show extensive sequence similarity to steroid, thyroid, retinoid, and
orphan nuclear receptors(6, 7) . The activity and
response element specificity of the VDR can be enhanced by nuclear
accessory factors such as the retinoid receptors and other non-receptor
transcription factors such as activator protein-1
(AP-1)(8, 9) . treatment causes myeloid leukemia cells
to differentiate into monocyte/macrophage-like cells and cease
proliferating(3, 20) , one might expect that the
activity of members of the Fos and Jun families would be modified
during VD-induced inhibition of proliferation and induction
of differentiation(21, 22) . on the human chronic myelogenous leukemia
(CML) cell line RWLeu-4 have shown that subnanomolar concentrations of
VD inhibit the proliferation and induce
monocyte/macrophage-like differentiation of these cells(20) .
To further investigations into the mechanism of the anti-proliferative
action of this hormone, a variant of the RWLeu-4 cell line, called
JMRD, in which proliferation is not inhibited by VD concentrations greater than 0.1 µM, has been
derived(23) . Although most previously described
VD-resistant cell lines have mutations in the
VDR(24, 25, 26) , initial characterization of
the VDR expressed in RWLeu-4 and JMRD cells indicates that
there are no significant differences in the affinity for VD or number of receptors expressed in these lines(23) .
Furthermore, no differences are found in the DNA coding for the
receptor or the induction of VD-responsive genes in the
sensitive and resistant cells(23) .. We also show that the inhibition of proliferation by
VD in the sensitive cells is accompanied by an increase in
the DNA binding activity of AP-1 and that JunD is a major constituent
of these AP-1 complexes. These results suggest that AP-1, and in
particular JunD, may play an important role in the anti-proliferative
actions of VD.
Reagents
VD was kindly provided by
M. R. Uskokovic of Hoffmann-LaRoche. Stock solutions of 0.2 mM VD were prepared in absolute ethanol and protected
from direct light. Tissue culture reagents were purchased from Life
Technologies, Inc. Enhanced chemiluminescence (ECL) kits were purchased
from Amersham Corp. P- and
S-nucleotides were
purchased from Amersham Corp. or DuPont NEN. Universolv liquid
scintillation mixture was purchased from ICN (Cosa Mesa, CA). All other
chemicals were of the highest commercially available purity.
Cells and Cell Culture
The human leukemia cell
lines RWLeu-4 and JMRD were cultured in complete medium
(
-modified minimum essential medium supplemented with glutamine,
100 units/ml penicillin, 100 mg/ml streptomycin, 0.1 mM non-essential amino acids, and 1 mM sodium pyruvate) plus
10% heat-inactivated fetal calf serum in a 5% CO
atmosphere
at 37 °C. Cells were inoculated at 0.5-1 10
cells/ml and grown exponentially for 3-4 days. Viability of
cells was determined by trypan blue dye exclusion.Transient Transfection Analysis
Clonal lines of
RWLeu-4 and JMRD cells expressing similar numbers of VDR as
judged by ligand binding assays were grown as described above.
Triplicate cultures containing five million cells were transfected in a
Bio-Rad gene pulser at 960 microfarads, 300 V with 20 µg of the
pGL2-(OC-VDRE) luciferase reporter construct (kindly
provided by Dr. L. Freedman, Memorial Sloan-Kettering Cancer Center)
and 1 µg of cytomegalovirus promoter/human growth hormone construct
in the presence or absence of 50 nM 1,25-VD.
Fourteen hours after transfection, luciferase activity was
assayed(27) , and growth hormone was measured from 100 µl
of supernatant by radioimmunoassay (Allegro human growth hormone kit,
Nichols Institute Diagnostics (San Juan Capistrano, CA). Promoter
activity is expressed as -fold induction of normalized relative light
units. Normalized relative light units are derived by dividing
luciferase activity by growth hormone to account for transfection
efficiency.Extraction of Nuclear Proteins
Nuclear extracts
from VD-sensitive and -resistant cells treated with 50
nM VD for varying lengths of time as indicated in
the text and figures were isolated by a modification of the method
described by Dignam et al.(28) . Briefly, 50 million
VD treated or control cells were scraped, collected by
centrifugation at 400 g, and washed once with ice-cold
phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl,
4.3 mM Na
HPO
7HO, 1.4
mM KHPO). All subsequent manipulations
were carried out at 4 °C. The cells were resuspended in 0.5 ml of
ice-cold hypotonic buffer with proteinase inhibitors (10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM
NaEDTA, 5 mM dithiothreitol, 10 µg/ml each of
aprotinin, leupeptin, Pefabloc® SC (Boehringer Mannheim),
pepstatin) and immediately centrifuged at 400 g for 10
min. The cell pellet was resuspended in the same buffer, allowed to
swell for 10 min, and the cells were disrupted by 10-12 strokes
in a Dounce homogenizer with a tight fitting pestle. The nuclei were
pelleted by centrifugation at 14,000 rpm for 5 min in a refrigerated
Eppendorf microcentrifuge and the cytosolic fraction removed. The
nuclei were resuspended in 0.25 ml of high salt buffer with proteinase
inhibitors (20 mM Hepes, pH 7.9, 20% glycerol, 120 mM NaCl, 300 mM KCl, 2 mM MgCl
, 5
mM dithiothreitol, 0.1 mM NaEDTA, 10
µg/ml each of aprotinin, leupeptin, Pefabloc, and pepstatin) and
incubated for 30 min. The nuclei were then pelleted by centrifugation
at 40,000 rpm in a type 50 rotor (Beckman), and the supernatant was
removed, dialyzed against 230 ml of storage buffer (20 mM Hepes, pH 7.9, 20% glycerol, 100 mM KCl, 0.1 mM NaEDTA, 5 mM dithiothreitol) for 1-2 h,
diluted with storage buffer to a final protein concentration of 5
µg/µl, and stored in small aliquots at -80 °C.
Protein concentrations were determined by the method of Bradford (37) (Bio-Rad) using IgG as a standard.DNA Synthesis, Purification, and
Labeling
Oligonucleotides were synthesized on an Applied
Biosystems, Inc. model 392 or 394 synthesizer. Oligonucleotides used
for electrophoretic mobility shift analysis were annealed and purified
by non-denaturing gel electrophoresis using standard
techniques(27) . Oligonucleotides were labeled with
[-P]dCTP,
[
-P]dATP, or
[
-
P]ATP by standard filling-in or
end-labeling techniques(27) . Unincorporated nucleotides were
removed using NucTrap push columns (Stratagene).
Electrophoretic Mobility Shift Analysis
Samples
containing 10-15 µg of protein from nuclear extracts of
sensitive or resistant cells were used in DNA binding reactions. Each
reaction had a final volume of 20 µl containing 10 mM Tris-HCl, pH 7.8, 0.5 mM NaEDTA, 10 mM 
-mercaptoethanol, 100 mM KCl, 10% glycerol, 1 µg
of poly(dIdC), and 10 fmol of radiolabeled oligonucleotides
(20,000-40,000 dpm). The sequence
CTAGTGCTCGGGTAGGGGTGACTCACCGGGTGAACGGGGGCATCT and its complement were
used as the human osteocalcin-VD-response element;
CTAGACGCTTGATGACTCAGCCGGAA and its complement as the consensus AP-1
oligonucleotide; and CTAGTGCTCGGGTAGAGGTCAAGGAGGTCACTCGAC and its
complement as the DR3-VDRE. Oligonucleotides containing the NF-
B
consensus (AGTTGAGGGGACTTTCCCAGGC) sequence purchased from Promega
Biotech were used as a negative control. Binding reactions were
incubated for 20 min at room temperature. Supershifting experiments
using antibodies against Jun and Fos family members were performed by
adding 0.1-3 µg of specific antibody after the initial
incubation of extracts with radiolabeled probes. Antibodies were
purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA)
(anti-c-Jun, SC-45X; anti-JunD, SC-74X; anti-c-Fos, SC-52X; anti-FosB,
SC-48X; anti-Fra2, SC-57X) or Oncogene Sciences (Oncogene Sciences,
Uniondale, NY) (anti-c-Jun, P6; anti-c-Fos, OP-17; anti-JunB, PC-28).
Antibodies against JunB and JunD were also kindly provided by Dr. R.
Bravo (Bristol-Myers Squibb). Anti-NFB (Santa Cruz Biotechnology,
Inc., SC-109X) was used as nonspecific, control antibody. Binding
reactions were continued for 30 min after addition of antibodies. The
reaction products were separated on 5% non-denaturing polyacrylamide
gels using the 0.5 Tris/borate/EDTA buffer system (44.5 mM Tris base, 44.5 mM sodium borate, 1 mM Na
EDTA) (27) and visualized by
autoradiography.Immunoblot Analysis
Nuclear extracts were prepared
from RWLeu-4 and JMRD or the cloned cells as described
above, and 10-µg aliquots of each extract were separated on a 10%
SDS-polyacrylamide gel. The proteins were then electrotransferred to
Hybond membranes (Amersham Corp.), and the membrane were
blocked with powdered milk and incubated with a 1:1500 dilution of
anti-c-Jun, anti-JunB, anti-junD, anti-c-Fos, anti-FosB, or anti-Fra2
obtained from Santa Cruz Biotechnology, Inc. or Oncogene Sciences, Inc.
Horseradish peroxidase-coupled second antibody (Amersham Corp.) was
used to visualize the cross-reactive bands by enhanced
chemiluminescence (ECL) (Amersham Corp.). Nonspecific binding was
determined by omitting the first antibody or by blocking with a 10-fold
excess of antibody-specific peptides purchased from Santa Cruz
Biotechnology, Inc.
-treated cells (Fig. 1, lanes6-10). The band labeled VDR,
identified by competition with unlabeled OC-VDREs (lanes2 and 7), a consensus VDRE (lanes3 and 8), and by blocking with the 9a7 anti-VDR antibody (data not
shown), is present in both sensitive and resistant cell extracts. Lanes1 and 6 of both A and B show that the VDR is induced in both cell types although VDR
binding in JMRD cell extracts is slightly less than that
seen in RWLeu-4 extracts. However, in agreement with previous
findings(23) , transient transfection experiments (Fig. 2) using luciferase reporter plasmids containing two
copies of the OC-VDRE demonstrate that both cell lines are equally
responsive to induction by VD.
(B)
nuclear extracts. Samples containing 10 µg of nuclear extract from
untreated cells (lanes 1-5) or from cells treated for 72
h with 50 nM VD (lanes 6-10) were
used in DNA binding reactions as described under ``Experimental
Procedures.'' Site specificity was determined by simultaneous
addition of 100-fold molar excesses of competitor oligonucleotides. Lanes1 and 6 contain no competitor; lanes2 and 7 contain unlabeled OC-VDRE; lanes3 and 8 contain unlabeled DR3-VDRE; lanes4 and 9 contain unlabeled AP-1; lanes5 and 10 contain unlabeled NF-B
as a negative control. Reactions were incubated for 20 min at room
temperature, and products were separated on 5% non-denaturing
polyacrylamide gels made with 0.5 Tris/borate/EDTA buffer for
90 min at 200 volts and visualized by
autoradiography.
responsiveness
of RWLeu-4 and JMRD cells by transient transfection.
Triplicate cultures containing five million RWLeu-4 (solidbars) or JMRD (hatchedbars) cells were transfected with 20 µg of
pGL2-(OC-VDRE) (kindly provided by Dr. L. Freedman,
Memorial Sloan-Kettering Cancer Center) and 1 µg of cytomegalovirus
promoter/human growth hormone construct in the absence or presence of
50 nM VD. Fourteen hours after transfection
luciferase activity was assayed, and growth hormone was measured from
100 µl of supernatant by radioimmunoassay techniques. Promoter
activity is expressed as -fold induction of relative light units
divided by growth hormone expression (normalized relative light
units).
-induced inhibition of proliferation using competition
binding experiments with excess unlabeled oligonucleotides containing a
consensus AP-1 binding site. Fig. 1(lanes4 and 9) shows that AP-1 binding activity is present in
nuclear extracts of the sensitive and resistant cells but that AP-1
binding is increased by VD treatment of the sensitive cells
and is decreased by VD treatment of the resistant cells.
The slowest migrating band, seen only in VD-treated RWLeu-4
cell extracts (lane6), is competed by the OC-VDRE (lane7), DR3-VDRE (lane8), AP-1
consensus sequences (lane9), as well as anti-VDR
antibodies (data not shown) and therefore appears to contain both VDR
and AP-1 associated with the same molecule. Binding specificity is
indicated by the failure of oligonucleotides containing NFB
consensus sequences to block the binding of any bands. (Fig. 3B) express active JunD
(supershifted band in lane4) and c-Fos (supershifted
band in lane 5) proteins before treatment with VD. However,
VD treatment of the RWLeu-4 cells increases the DNA binding
activity of JunD (Fig. 3A, compare lanes4 and 11) but decreases JunD DNA binding activity in
JMRD cells (Fig. 3B, compare lanes4 and 11). No consistent changes in other
members of the Jun and Fos families are detected in extracts from
either cell population using this technique. Fig. 4shows that
the increase in JunD DNA binding in the sensitive cells (Fig. 4A) is dependent upon the length of treatment
with VD but that JunD participation in AP-1 binding
complexes in the resistant cells (Fig. 4B) decreases
over this period of treatment. Taken together these results indicate
that VD differentially regulates the DNA binding activity
of AP-1 transcription factors, particularly those complexes containing
JunD proteins.
(B) nuclear extracts. OC-VDRE binding by
nuclear extracts from untreated cells (lanes 1-7) or
cells treated for 72 h with 50 nM VD (lanes
8-14) was performed as described in Fig. 1.
Antibodies (0.1-1 µg) against Jun and Fos family members were
then added, and the incubations continued for an additional 30 min.
Reaction products were separated and visualized as described in Fig. 1. Lanes1 and 8 contain no
antibodies; lanes2 and 9 contain
anti-c-Jun; lanes3 and 10 contain
anti-JunB; lanes4 and 11 contain anti-JunD; lanes5 and 12 contain anti-c-Fos; lanes6 and 13 contain anti-FosB; lanes7 and 14 contain anti-Fra2. SS, supershifted
bands.
. Nuclear extracts were prepared
from RWLeu-4 (A) or JMRD (B) cells
treated with 50 nM VD for 0 (lanes1-3), 24 h (lanes 4-6), 48 h (lanes 7-9), or 72 h (lanes 10-12). EMSA
supershift assays were performed with 15 µg of nuclear extract as
described in Fig. 3. Lanes 1, 4, 7, and 10 contain no added antibodies; lanes 2, 5, 8, and 11 contain 1 µg of antibody against JunD proteins; lanes 3,
6, 9, and 12 contain 1 µg of antibody against FosB as
an isotype-specific negative control. Lane13 contains 72-h extracts with 100-fold molar excess of unlabeled
OC-VDRE added.
treatment while the level of detectable JunD
protein decreases in extracts from the resistant cells. Slight
increases are seen in JunB, FosB, and Fra1 expression in RWLeu-4 cells,
although differences in the participation of these proteins in AP-1
complexes that bind to the OC-VDRE have not been detected. In addition,
this figure shows that extended treatment of RWLeu-4 cells with
VD causes JunD to form a doublet band on immunoblots (lanes3 and 4). This could be due to
alterations in the structure of JunD, perhaps through changes in
phosphorylation, that could modulate the activity or accumulation of
the transcription factor(30, 31) .
(lanes5-8) cells treated with 50 nM VD for 0 h (lanes 1 and 5), 24 h (lanes 2 and 6), 48 h (lanes 3 and 7), and 72 h (lanes 4 and 8). Aliquots containing 10 µg of
protein were separated on a 10% SDS-polyacrylamide gel and transferred
to Hybond membranes (Amersham Corp.). Membranes were
blocked, incubated with antibodies, and visualized by ECL as described
under ``Experimental Procedures.'' Nonspecific binding was
determined by omitting the first antibody or by blocking with a 10-fold
excess of antibody-specific peptides.
-sensitive RWLeu-4 and
VD-resistant JMRD CML cell lines express active
VDRs that are capable of binding to VDREs. The primary difference
detected between the sensitive and resistant cell lines lies in the
expression or activity of the AP-1 transcription factors. In
particular, the DNA binding activity of JunD in AP-1 complexes is
increased in the sensitive cells but is decreased in the resistant
cells. This observation is particularly salient considering the results
of Pfarr et al.(32) , which demonstrate that JunD can
decrease the transforming ability of activated Ras proteins. In CML,
the fusion of the bcr and abl proto-oncogenes results
in the expression of a chimeric p210 tyrosine kinase that can circumvent the need for
extracellular signals to activate the Ras signal transduction pathway,
thus leading to uncontrolled proliferation (33, 34) or
escape from apoptosis(35, 36) . Therefore, the
increased JunD activity in response to VD
in the sensitive
cells may indirectly inhibit the proliferative signals from
p210 and lead to a cessation of
proliferation and induction of differentiation.
in these CML cells are mediated, at least in part, by alterations
in the nature of the Jun and Fos family members in AP-1 transcription
factors. These changes could differentially regulate the expression of
specific subsets of genes that are integral to the process of
proliferation.
),
1,25-dihydroxyvitamin D; VDR, 1,25-dihydroxyvitamin D receptor; VDRE, 1,25-dihydroxyvitamin D-response
element; OC-VDRE, osteocalcin-VDRE; DR3-VDRE, direct repeat with
3-nucleotide spacer VDRE; AP-1, activator protein-1; CML, chronic
myelogenous leukemia; EMSA, electrophoretic mobility shift assay(s).
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
ABSTRACT
This article has been cited by other articles:
|
|
 |
|
  G. Liu, N. Chen, A. Kaji, A. M. Bode, C. A. Ryan, and Z. Dong Proteinase inhibitors I and II from potatoes block UVB-induced AP-1 activity by regulating the AP-1 protein compositional patterns in JB6 cells PNAS, April 25, 2001; (2001) 101116298. [Abstract] [Full Text]
|
|
|
|
 |
|
 T. D. Veenstra, M. R. Pittelkow, and R. Kumar Regulation of Cellular Growth by 1,25-Dihydroxyvitamin D3-Mediated Growth Factor Expression Physiology, February 1, 1999; 14(1): 37 - 40. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. R. Patel and J.-Y. Wang Polyamine depletion is associated with an increase in JunD/AP-1 activity in small intestinal crypt cells Am J Physiol Gastrointest Liver Physiol, February 1, 1999; 276(2): G441 - G450. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 F. Aslam, L. McCabe, B. Frenkel, A. J. van Wijnen, G. S. Stein, J. B. Lian, and J. L. Stein AP-1 and Vitamin D Receptor (VDR) Signaling Pathways Converge at the Rat Osteocalcin VDR Element: Requirement for the Internal Activating Protein-1 Site for Vitamin D-Mediated Trans-Activation Endocrinology, January 1, 1999; 140(1): 63 - 70. [Abstract] [Full Text]
|
|
|
|
|
|
M. V. Chirayath, L. Gajdzik, W. Hulla, J. Graf, H. S. Cross, and M. Peterlik Vitamin D increases tight-junction conductance and paracellular Ca2+ transport in Caco-2 cell cultures Am J Physiol Gastrointest Liver Physiol, February 1, 1998; 274(2): G389 - G396. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Inoue, P. Santiago, W. C. Horne, and R. Baron Identification of an Osteoclast Transcription Factor That Binds to the Human T Cell Leukemia Virus Type I-Long Terminal Repeat Enhancer Element J. Biol. Chem., October 3, 1997; 272(40): 25386 - 25393. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Liu, N. Chen, A. Kaji, A. M. Bode, C. A. Ryan, and Z. Dong Proteinase inhibitors I and II from potatoes block UVB-induced AP-1 activity by regulating the AP-1 protein compositional patterns in JB6 cells PNAS, May 8, 2001; 98(10): 5786 - 5791. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |