Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lasky, S. R.
Right arrow Articles by Maizel, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lasky, S. R.
Right arrow Articles by Maizel, A. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 34, Issue of August 25, pp. 19676-19679, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Differential Regulation of JunD by Dihydroxycholecalciferol in Human Chronic Myelogenous Leukemia Cells (*)

(Received for publication, June 21, 1995)

Stephen R. Lasky (1)(§) Keigo Iwata (1) Alan G. Rosmarin (2) David G. Caprio (2) Abby L. Maizel (1)

From the  (1)Roger Williams Medical Center, Section of Experimental Pathology and (2)Miriam Hospital, Division of Hematology, Brown University School of Medicine, Providence, Rhode Island 02908

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS AND DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

1,25-Dihydroxyvitamin D(3) inhibits the proliferation of the chronic myelogenous leukemia cell line RWLeu-4 but not the resistant variant, JMRD(3). Although these cells exhibit no detectable differences in the vitamin D receptor, alterations in the interaction of nuclear extracts with the osteocalcin-1,25-dihydroxyvitamin D(3)-response element are noted. It is shown herein that the 1,25-dihydroxyvitamin D(3) receptor binds to the osteocalcin-1,25-dihydroxyvitamin D(3)-response element along with activator protein-1 (AP-1) complexes and that the DNA binding activities of members of the Jun and Fos proto-oncogene families, which make up the AP-1 transcription factor, are differentially regulated by 1,25-dihydroxyvitamin D(3). It is shown that JunD DNA binding activity is enhanced by 1,25-dihydroxyvitamin D(3) during cell cycle arrest in the sensitive cells but is decreased in the resistant cells. These results suggest that the level of JunD DNA binding activity may be a critical factor in the regulation of proliferation.


INTRODUCTION

1,25-Dihydroxyvitamin D(3) (VD(3)) (^1)plays an important role in regulating the proliferation and differentiation of myeloid cells(1, 2, 3, 4) . Many of the effects of VD(3) are mediated through the binding and activation of high affinity nuclear receptors (VDRs) (5) that show extensive sequence similarity to steroid, thyroid, retinoid, and orphan nuclear receptors(6, 7) . The activity and response element specificity of the VDR can be enhanced by nuclear accessory factors such as the retinoid receptors and other non-receptor transcription factors such as activator protein-1 (AP-1)(8, 9) .

Much attention has focused upon the AP-1 transcription factor, which consists of a family of proteins related to and including the c-Fos (FosB, Fra1, and Fra2) and c-Jun (JunB, JunD) proto-oncogene products (10, 11) . The dimeric forms of Jun and Fos family members bind to DNA exhibiting a consensus sequence of TGA(C/T)TCA while monomers are unable to functionally bind to DNA. These genes are expressed in a cell stage, lineage, and inducer-specific manner(11, 12, 13) , and it has been demonstrated that although the Jun family members can bind to the same DNA sequences, they do so with different affinities and may elicit different responses with regard to expression of target genes(14, 15, 16) . Since alterations in AP-1 activity can interfere with normal cell cycle progression, this transcription factor may modulate the expression of genes involved in cell growth and differentiation(17, 18, 19) . Considering that VD(3) treatment causes myeloid leukemia cells to differentiate into monocyte/macrophage-like cells and cease proliferating(3, 20) , one might expect that the activity of members of the Fos and Jun families would be modified during VD(3)-induced inhibition of proliferation and induction of differentiation(21, 22) .

Investigations into the effects of VD(3) on the human chronic myelogenous leukemia (CML) cell line RWLeu-4 have shown that subnanomolar concentrations of VD(3) inhibit the proliferation and induce monocyte/macrophage-like differentiation of these cells(20) . To further investigations into the mechanism of the anti-proliferative action of this hormone, a variant of the RWLeu-4 cell line, called JMRD(3), in which proliferation is not inhibited by VD(3) concentrations greater than 0.1 µM, has been derived(23) . Although most previously described VD(3)-resistant cell lines have mutations in the VDR(24, 25, 26) , initial characterization of the VDR expressed in RWLeu-4 and JMRD(3) cells indicates that there are no significant differences in the affinity for VD(3) or number of receptors expressed in these lines(23) . Furthermore, no differences are found in the DNA coding for the receptor or the induction of VD(3)-responsive genes in the sensitive and resistant cells(23) .

A series of experiments are reported herein which show that nuclear extracts from the sensitive and resistant cells express VDRs that bind to the human osteocalcin-vitamin D-response element (OC-VDRE) along with AP-1 proteins and that the activity of these complexes is regulated by VD(3). We also show that the inhibition of proliferation by VD(3) in the sensitive cells is accompanied by an increase in the DNA binding activity of AP-1 and that JunD is a major constituent of these AP-1 complexes. These results suggest that AP-1, and in particular JunD, may play an important role in the anti-proliferative actions of VD(3).


EXPERIMENTAL PROCEDURES

Reagents

VD(3) was kindly provided by M. R. Uskokovic of Hoffmann-LaRoche. Stock solutions of 0.2 mM VD(3) were prepared in absolute ethanol and protected from direct light. Tissue culture reagents were purchased from Life Technologies, Inc. Enhanced chemiluminescence (ECL) kits were purchased from Amersham Corp. P- and S-nucleotides were purchased from Amersham Corp. or DuPont NEN. Universolv liquid scintillation mixture was purchased from ICN (Cosa Mesa, CA). All other chemicals were of the highest commercially available purity.

Cells and Cell Culture

The human leukemia cell lines RWLeu-4 and JMRD(3) were cultured in complete medium (alpha-modified minimum essential medium supplemented with glutamine, 100 units/ml penicillin, 100 mg/ml streptomycin, 0.1 mM non-essential amino acids, and 1 mM sodium pyruvate) plus 10% heat-inactivated fetal calf serum in a 5% CO(2) atmosphere at 37 °C. Cells were inoculated at 0.5-1 10^5 cells/ml and grown exponentially for 3-4 days. Viability of cells was determined by trypan blue dye exclusion.

Transient Transfection Analysis

Clonal lines of RWLeu-4 and JMRD(3) cells expressing similar numbers of VDR as judged by ligand binding assays were grown as described above. Triplicate cultures containing five million cells were transfected in a Bio-Rad gene pulser at 960 microfarads, 300 V with 20 µg of the pGL2-(OC-VDRE)(2) luciferase reporter construct (kindly provided by Dr. L. Freedman, Memorial Sloan-Kettering Cancer Center) and 1 µg of cytomegalovirus promoter/human growth hormone construct in the presence or absence of 50 nM 1,25-VD(3). Fourteen hours after transfection, luciferase activity was assayed(27) , and growth hormone was measured from 100 µl of supernatant by radioimmunoassay (Allegro human growth hormone kit, Nichols Institute Diagnostics (San Juan Capistrano, CA). Promoter activity is expressed as -fold induction of normalized relative light units. Normalized relative light units are derived by dividing luciferase activity by growth hormone to account for transfection efficiency.

Extraction of Nuclear Proteins

Nuclear extracts from VD(3)-sensitive and -resistant cells treated with 50 nM VD(3) for varying lengths of time as indicated in the text and figures were isolated by a modification of the method described by Dignam et al.(28) . Briefly, 50 million VD(3) treated or control cells were scraped, collected by centrifugation at 400 g, and washed once with ice-cold phosphate-buffered saline (137 mM NaCl, 2.7 mM KCl, 4.3 mM Na(2)HPO(4)bullet7H(2)O, 1.4 mM KH(2)PO(4)). All subsequent manipulations were carried out at 4 °C. The cells were resuspended in 0.5 ml of ice-cold hypotonic buffer with proteinase inhibitors (10 mM Hepes, pH 7.9, 10 mM KCl, 0.1 mM Na(2)EDTA, 5 mM dithiothreitol, 10 µg/ml each of aprotinin, leupeptin, Pefabloc® SC (Boehringer Mannheim), pepstatin) and immediately centrifuged at 400 g for 10 min. The cell pellet was resuspended in the same buffer, allowed to swell for 10 min, and the cells were disrupted by 10-12 strokes in a Dounce homogenizer with a tight fitting pestle. The nuclei were pelleted by centrifugation at 14,000 rpm for 5 min in a refrigerated Eppendorf microcentrifuge and the cytosolic fraction removed. The nuclei were resuspended in 0.25 ml of high salt buffer with proteinase inhibitors (20 mM Hepes, pH 7.9, 20% glycerol, 120 mM NaCl, 300 mM KCl, 2 mM MgCl(2), 5 mM dithiothreitol, 0.1 mM Na(2)EDTA, 10 µg/ml each of aprotinin, leupeptin, Pefabloc, and pepstatin) and incubated for 30 min. The nuclei were then pelleted by centrifugation at 40,000 rpm in a type 50 rotor (Beckman), and the supernatant was removed, dialyzed against 230 ml of storage buffer (20 mM Hepes, pH 7.9, 20% glycerol, 100 mM KCl, 0.1 mM Na(2)EDTA, 5 mM dithiothreitol) for 1-2 h, diluted with storage buffer to a final protein concentration of 5 µg/µl, and stored in small aliquots at -80 °C. Protein concentrations were determined by the method of Bradford (37) (Bio-Rad) using IgG as a standard.

DNA Synthesis, Purification, and Labeling

Oligonucleotides were synthesized on an Applied Biosystems, Inc. model 392 or 394 synthesizer. Oligonucleotides used for electrophoretic mobility shift analysis were annealed and purified by non-denaturing gel electrophoresis using standard techniques(27) . Oligonucleotides were labeled with [alpha-P]dCTP, [alpha-P]dATP, or [-P]ATP by standard filling-in or end-labeling techniques(27) . Unincorporated nucleotides were removed using NucTrap push columns (Stratagene).

Electrophoretic Mobility Shift Analysis

Samples containing 10-15 µg of protein from nuclear extracts of sensitive or resistant cells were used in DNA binding reactions. Each reaction had a final volume of 20 µl containing 10 mM Tris-HCl, pH 7.8, 0.5 mM Na(2)EDTA, 10 mM beta-mercaptoethanol, 100 mM KCl, 10% glycerol, 1 µg of poly(dIbulletdC), and 10 fmol of radiolabeled oligonucleotides (20,000-40,000 dpm). The sequence CTAGTGCTCGGGTAGGGGTGACTCACCGGGTGAACGGGGGCATCT and its complement were used as the human osteocalcin-VD(3)-response element; CTAGACGCTTGATGACTCAGCCGGAA and its complement as the consensus AP-1 oligonucleotide; and CTAGTGCTCGGGTAGAGGTCAAGGAGGTCACTCGAC and its complement as the DR3-VDRE. Oligonucleotides containing the NF-kappaB consensus (AGTTGAGGGGACTTTCCCAGGC) sequence purchased from Promega Biotech were used as a negative control. Binding reactions were incubated for 20 min at room temperature. Supershifting experiments using antibodies against Jun and Fos family members were performed by adding 0.1-3 µg of specific antibody after the initial incubation of extracts with radiolabeled probes. Antibodies were purchased from Santa Cruz Biotechnology, Inc. (Santa Cruz, CA) (anti-c-Jun, SC-45X; anti-JunD, SC-74X; anti-c-Fos, SC-52X; anti-FosB, SC-48X; anti-Fra2, SC-57X) or Oncogene Sciences (Oncogene Sciences, Uniondale, NY) (anti-c-Jun, P6; anti-c-Fos, OP-17; anti-JunB, PC-28). Antibodies against JunB and JunD were also kindly provided by Dr. R. Bravo (Bristol-Myers Squibb). Anti-NFkappaB (Santa Cruz Biotechnology, Inc., SC-109X) was used as nonspecific, control antibody. Binding reactions were continued for 30 min after addition of antibodies. The reaction products were separated on 5% non-denaturing polyacrylamide gels using the 0.5 Tris/borate/EDTA buffer system (44.5 mM Tris base, 44.5 mM sodium borate, 1 mM Na(2)EDTA) (27) and visualized by autoradiography.

Immunoblot Analysis

Nuclear extracts were prepared from RWLeu-4 and JMRD(3) or the cloned cells as described above, and 10-µg aliquots of each extract were separated on a 10% SDS-polyacrylamide gel. The proteins were then electrotransferred to Hybond membranes (Amersham Corp.), and the membrane were blocked with powdered milk and incubated with a 1:1500 dilution of anti-c-Jun, anti-JunB, anti-junD, anti-c-Fos, anti-FosB, or anti-Fra2 obtained from Santa Cruz Biotechnology, Inc. or Oncogene Sciences, Inc. Horseradish peroxidase-coupled second antibody (Amersham Corp.) was used to visualize the cross-reactive bands by enhanced chemiluminescence (ECL) (Amersham Corp.). Nonspecific binding was determined by omitting the first antibody or by blocking with a 10-fold excess of antibody-specific peptides purchased from Santa Cruz Biotechnology, Inc.


RESULTS AND DISCUSSION

Although no differences were detected between the VDRs expressed in the sensitive and resistant cells, analysis of electrophoretic mobility shift assays (EMSA) shows that differences in the DNA binding activity are present in nuclear extracts from control (Fig. 1, lanes1-5) or VD(3)-treated cells (Fig. 1, lanes6-10). The band labeled VDR, identified by competition with unlabeled OC-VDREs (lanes2 and 7), a consensus VDRE (lanes3 and 8), and by blocking with the 9a7 anti-VDR antibody (data not shown), is present in both sensitive and resistant cell extracts. Lanes1 and 6 of both A and B show that the VDR is induced in both cell types although VDR binding in JMRD(3) cell extracts is slightly less than that seen in RWLeu-4 extracts. However, in agreement with previous findings(23) , transient transfection experiments (Fig. 2) using luciferase reporter plasmids containing two copies of the OC-VDRE demonstrate that both cell lines are equally responsive to induction by VD(3).


Figure 1: Electrophoretic mobility shift of OC-VDRE by RWLeu-4 (A) and JMRD(3) (B) nuclear extracts. Samples containing 10 µg of nuclear extract from untreated cells (lanes 1-5) or from cells treated for 72 h with 50 nM VD(3) (lanes 6-10) were used in DNA binding reactions as described under ``Experimental Procedures.'' Site specificity was determined by simultaneous addition of 100-fold molar excesses of competitor oligonucleotides. Lanes1 and 6 contain no competitor; lanes2 and 7 contain unlabeled OC-VDRE; lanes3 and 8 contain unlabeled DR3-VDRE; lanes4 and 9 contain unlabeled AP-1; lanes5 and 10 contain unlabeled NF-kappaB as a negative control. Reactions were incubated for 20 min at room temperature, and products were separated on 5% non-denaturing polyacrylamide gels made with 0.5 Tris/borate/EDTA buffer for 90 min at 200 volts and visualized by autoradiography.




Figure 2: Analysis of VD(3) responsiveness of RWLeu-4 and JMRD(3) cells by transient transfection. Triplicate cultures containing five million RWLeu-4 (solidbars) or JMRD(3) (hatchedbars) cells were transfected with 20 µg of pGL2-(OC-VDRE)(2) (kindly provided by Dr. L. Freedman, Memorial Sloan-Kettering Cancer Center) and 1 µg of cytomegalovirus promoter/human growth hormone construct in the absence or presence of 50 nM VD(3). Fourteen hours after transfection luciferase activity was assayed, and growth hormone was measured from 100 µl of supernatant by radioimmunoassay techniques. Promoter activity is expressed as -fold induction of relative light units divided by growth hormone expression (normalized relative light units).



Because AP-1 binds to the OC-VDRE(22, 29) , it was suspected that other bands in the EMSA might contain Jun and Fos proteins. Experiments were undertaken to determine if the activity of AP-1 is modified during VD(3)-induced inhibition of proliferation using competition binding experiments with excess unlabeled oligonucleotides containing a consensus AP-1 binding site. Fig. 1(lanes4 and 9) shows that AP-1 binding activity is present in nuclear extracts of the sensitive and resistant cells but that AP-1 binding is increased by VD(3) treatment of the sensitive cells and is decreased by VD(3) treatment of the resistant cells. The slowest migrating band, seen only in VD(3)-treated RWLeu-4 cell extracts (lane6), is competed by the OC-VDRE (lane7), DR3-VDRE (lane8), AP-1 consensus sequences (lane9), as well as anti-VDR antibodies (data not shown) and therefore appears to contain both VDR and AP-1 associated with the same molecule. Binding specificity is indicated by the failure of oligonucleotides containing NFkappaB consensus sequences to block the binding of any bands.

EMSA supershifting experiments were performed to determine whether differences in AP-1 binding activity are due to the differential activation of specific members of the Jun and Fos families. Antibodies specific for the Jun and Fos family members were added after a preincubation of extracts with radiolabeled OC-VDRE as indicated in the legend for Fig. 3. Both RWLeu-4 (Fig. 3A) and JMRD(3) (Fig. 3B) express active JunD (supershifted band in lane4) and c-Fos (supershifted band in lane 5) proteins before treatment with VD(3). However, VD(3) treatment of the RWLeu-4 cells increases the DNA binding activity of JunD (Fig. 3A, compare lanes4 and 11) but decreases JunD DNA binding activity in JMRD(3) cells (Fig. 3B, compare lanes4 and 11). No consistent changes in other members of the Jun and Fos families are detected in extracts from either cell population using this technique. Fig. 4shows that the increase in JunD DNA binding in the sensitive cells (Fig. 4A) is dependent upon the length of treatment with VD(3) but that JunD participation in AP-1 binding complexes in the resistant cells (Fig. 4B) decreases over this period of treatment. Taken together these results indicate that VD(3) differentially regulates the DNA binding activity of AP-1 transcription factors, particularly those complexes containing JunD proteins.


Figure 3: EMSA supershifting of OC-VDRE binding bands in RWLeu-4 (A) or JMRD(3) (B) nuclear extracts. OC-VDRE binding by nuclear extracts from untreated cells (lanes 1-7) or cells treated for 72 h with 50 nM VD(3) (lanes 8-14) was performed as described in Fig. 1. Antibodies (0.1-1 µg) against Jun and Fos family members were then added, and the incubations continued for an additional 30 min. Reaction products were separated and visualized as described in Fig. 1. Lanes1 and 8 contain no antibodies; lanes2 and 9 contain anti-c-Jun; lanes3 and 10 contain anti-JunB; lanes4 and 11 contain anti-JunD; lanes5 and 12 contain anti-c-Fos; lanes6 and 13 contain anti-FosB; lanes7 and 14 contain anti-Fra2. SS, supershifted bands.




Figure 4: EMSA supershift of JunD and FosB in OC-VDRE complexes from extracts treated for 0-72 h with VD(3). Nuclear extracts were prepared from RWLeu-4 (A) or JMRD(3) (B) cells treated with 50 nM VD(3) for 0 (lanes1-3), 24 h (lanes 4-6), 48 h (lanes 7-9), or 72 h (lanes 10-12). EMSA supershift assays were performed with 15 µg of nuclear extract as described in Fig. 3. Lanes 1, 4, 7, and 10 contain no added antibodies; lanes 2, 5, 8, and 11 contain 1 µg of antibody against JunD proteins; lanes 3, 6, 9, and 12 contain 1 µg of antibody against FosB as an isotype-specific negative control. Lane13 contains 72-h extracts with 100-fold molar excess of unlabeled OC-VDRE added.



Western immunoblots, shown in Fig. 5, confirm that JunD protein in nuclear extracts increases in the sensitive cells after VD(3) treatment while the level of detectable JunD protein decreases in extracts from the resistant cells. Slight increases are seen in JunB, FosB, and Fra1 expression in RWLeu-4 cells, although differences in the participation of these proteins in AP-1 complexes that bind to the OC-VDRE have not been detected. In addition, this figure shows that extended treatment of RWLeu-4 cells with VD(3) causes JunD to form a doublet band on immunoblots (lanes3 and 4). This could be due to alterations in the structure of JunD, perhaps through changes in phosphorylation, that could modulate the activity or accumulation of the transcription factor(30, 31) .


Figure 5: Detection of AP-1 oncoproteins by Western immunoblotting. Nuclear extracts were prepared from RWLeu-4 (lanes 1-4) and JMRD(3) (lanes5-8) cells treated with 50 nM VD(3) for 0 h (lanes 1 and 5), 24 h (lanes 2 and 6), 48 h (lanes 3 and 7), and 72 h (lanes 4 and 8). Aliquots containing 10 µg of protein were separated on a 10% SDS-polyacrylamide gel and transferred to Hybond membranes (Amersham Corp.). Membranes were blocked, incubated with antibodies, and visualized by ECL as described under ``Experimental Procedures.'' Nonspecific binding was determined by omitting the first antibody or by blocking with a 10-fold excess of antibody-specific peptides.



These results show that both the VD(3)-sensitive RWLeu-4 and VD(3)-resistant JMRD(3) CML cell lines express active VDRs that are capable of binding to VDREs. The primary difference detected between the sensitive and resistant cell lines lies in the expression or activity of the AP-1 transcription factors. In particular, the DNA binding activity of JunD in AP-1 complexes is increased in the sensitive cells but is decreased in the resistant cells. This observation is particularly salient considering the results of Pfarr et al.(32) , which demonstrate that JunD can decrease the transforming ability of activated Ras proteins. In CML, the fusion of the bcr and abl proto-oncogenes results in the expression of a chimeric p210 tyrosine kinase that can circumvent the need for extracellular signals to activate the Ras signal transduction pathway, thus leading to uncontrolled proliferation (33, 34) or escape from apoptosis(35, 36) . Therefore, the increased JunD activity in response to VD(3) in the sensitive cells may indirectly inhibit the proliferative signals from p210 and lead to a cessation of proliferation and induction of differentiation.

The results presented here suggest that the anti-proliferative actions of VD(3) in these CML cells are mediated, at least in part, by alterations in the nature of the Jun and Fos family members in AP-1 transcription factors. These changes could differentially regulate the expression of specific subsets of genes that are integral to the process of proliferation.


FOOTNOTES

*
This work was supported by National Institutes of Health Grants CA13943 (to the Cancer Research Center at Roger Williams Medical Center/Brown University), CA50558 (to S. R. L.), and CA45148 (to A. L. M.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Roger Williams Medical Center, Experimental Pathology Section, 825 Chalkstone Ave., Providence, RI 02908. Tel.: 401-456-6572; Fax: 401-456-6569; StephenLasky{at}brown.edu.

(^1)
The abbreviations used are: VD(3), 1,25-dihydroxyvitamin D(3); VDR, 1,25-dihydroxyvitamin D(3) receptor; VDRE, 1,25-dihydroxyvitamin D(3)-response element; OC-VDRE, osteocalcin-VDRE; DR3-VDRE, direct repeat with 3-nucleotide spacer VDRE; AP-1, activator protein-1; CML, chronic myelogenous leukemia; EMSA, electrophoretic mobility shift assay(s).


REFERENCES

  1. Pols, H., Birkenhäger, J. C., Foekens, J. A., and Van, L. J. (1990) J. Steroid Biochem. Mol. Biol. 37,873-876 [CrossRef][Medline] [Order article via Infotrieve]
  2. Suda, T., Shinki, T., and Takahashi, N. (1990) Annu. Rev. Nutr. 10,195-211 [CrossRef][Medline] [Order article via Infotrieve]
  3. Koeffler, H. P. (1985) in Vitamin D: Myeloid Differentiation and Proliferation. Haematology and Blood Transfusion (Neth, O., Gallo, R. C., Greaves, M. F., and Janka, G. E., eds) Vol. 29, pp. 409-417, Springer-Verlag, Berlin/Heidelberg
  4. Studzinski, G. P., McLane, J. A., and Uskokovic, M. R. (1993) Crit. Rev. Eukaryotic Gene Expression 3,279-312 [Medline] [Order article via Infotrieve]
  5. Pike, J. W. (1991) Annu. Rev. Nutr. 11,189-216 [CrossRef][Medline] [Order article via Infotrieve]
  6. McDonnell, D., Pike, J. W., and O'Malley, B. W. (1988) J. Steroid Biochem. 30,41-46 [CrossRef][Medline] [Order article via Infotrieve]
  7. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell 65,1255-1266 [CrossRef][Medline] [Order article via Infotrieve]
  8. Liao, J., Ozono, K., Sone, T., McDonnell, D. P., and Pike, J. W. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,9751-9755 [Abstract/Free Full Text]
  9. Yu, V. C., Delsert, C., Andersen, B., Holloway, J. M., Devary, O. V., Näär, A. M., Kim, S. Y., Boutin, J. M., Glass, C. K., and Rosenfeld, M. G. (1991) Cell 67,1251-1266 [CrossRef][Medline] [Order article via Infotrieve]
  10. Pfahl, M. (1993) Endocr. Rev. 14,651-658 [Abstract/Free Full Text]
  11. Radler, P. A., Gebel, S., Sachsenmaier, C., König, H., Krämer, M., Oehler, T., Streile, M., Ponta, H., Rapp, U., Rahmsdorf, H. J., Cato, A., Angel, P., and Herrlich, P. (1993) Ann. N. Y. Acad. Sci. 684,127-148 [Medline] [Order article via Infotrieve]
  12. Angel, P., Allegretto, E. A., Okinko, S. T., Hattori, K., Boyle, W. J., Hunter, T., and Karin, M. (1988) Nature 332,166-171 [CrossRef][Medline] [Order article via Infotrieve]
  13. Vedeckis, W. V. (1992) Proc. Soc. Exp. Biol. Med. 199,1-12 [CrossRef][Medline] [Order article via Infotrieve]
  14. Deng, T., and Karin, M. (1993) Genes & Dev. 7,479-490 [CrossRef]
  15. Doucas, V., Spyrou, G., and Yaniv, M. (1991) EMBO J. 10,2237-2245 [Medline] [Order article via Infotrieve]
  16. Ryseck, R. P., Kovary, K., and Bravo, R. (1990) Oncogene 5,1091-1093 [Medline] [Order article via Infotrieve]
  17. Angel, P., and Karin, M. (1991) Biochim. Biophys. Acta 1072,129-157 [Medline] [Order article via Infotrieve]
  18. Bradley, M. O., Manam, S., Kraynak, A. R., Nichols, W. W., and Ledwith, B. J. (1992) Ann. N. Y. Acad. Sci. 660,124-135 [CrossRef][Medline] [Order article via Infotrieve]
  19. Curran, T., and Franza, B. R. J. (1988) Cell 55,395-397 [CrossRef][Medline] [Order article via Infotrieve]
  20. Lasky, S. R., Bell, W., Huhn, R. D., Posner, M. R., Wiemann, M., Calabresi, P., and Eil, C. (1990) Cancer Res. 50,3087-3094 [Abstract/Free Full Text]
  21. Kolla, S. S., and Studzinski, G. P. (1994) Cancer Res. 54,1418-1421 [Abstract/Free Full Text]
  22. Lian, J. B., Stein, G. S., Bortell, R., and Owen, T. A. (1991) J. Cell. Biochem. 45,9-14 [CrossRef][Medline] [Order article via Infotrieve]
  23. Lasky, S. R., Posner, M. R., Iwata, K., Santos, M. A., Yen, A., Samuel, V., Clark, J., and Maizel, A. L. (1994) Blood 84,4283-4294 [Abstract/Free Full Text]
  24. Feldman, D., and Malloy, P. J. (1990) Mol. Cell. Endocrinol. 72,C57-C62
  25. Hughes, M., Malloy, P., Kieback, D., Kesterson, R., Pike, J. W., Feldman, D., and O'Malley, B. (1988) Science 242,1702-1705 [Abstract/Free Full Text]
  26. Malloy, P., Hochberg, Z., Pike, J., and Feldman, D. (1989) J. Clin. Endocrinol. Metab. 68,263-269 [Abstract/Free Full Text]
  27. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds) (1988) Current Protocols in Molecular Biology , John Wiley & Sons, Inc., New York
  28. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11,1475-1489 [Abstract/Free Full Text]
  29. Schule, R., Umesono, K., Mangelsdorf, D. J., Bolado, J., Pike, J. W., and Evans, R. M. (1990) Cell 61,497-504 [CrossRef][Medline] [Order article via Infotrieve]
  30. Papavassiliou, A. G. (1993) Anticancer Res. 13,2213-2220 [Medline] [Order article via Infotrieve]
  31. Abate, C., Baker, S. J., Lees, M. S., Anderson, C. W., Marshak, D. R., and Curran, T. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,6766-6770 [Abstract/Free Full Text]
  32. Pfarr, C. M., Mechta, F., Spyrou, G., Lallemand, D., Carillo, S., and Yaniv, M. (1994) Cell 76,747-760 [CrossRef][Medline] [Order article via Infotrieve]
  33. Daley, G. Q., Van Etten, R. A., and Baltimore, D. (1991) Science 247,824-830
  34. Thomas, M., Kosciolek, B., Wang, N., and Rowley, P. (1994) Leuk. Res. 18,401-408 [CrossRef][Medline] [Order article via Infotrieve]
  35. Smetsers, T., Skorski, T., van de Locht, L., Wessels, H., Pennings, A., De, W. T., Calabretta, B., and Mensink, E. (1994) Leukemia (Baltimore) 8,129-140 [Medline] [Order article via Infotrieve]
  36. Bedi, A., Zehnbauer, B. A., Barber, J. P., Sharkis, S. J., and Jones, R. J. (1994) Blood 83,2038-2044 [Abstract/Free Full Text]
  37. Bradford, M. M. (1976) Anal. Biochem. 72,248-254 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Liu, N. Chen, A. Kaji, A. M. Bode, C. A. Ryan, and Z. Dong
Proteinase inhibitors I and II from potatoes block UVB-induced AP-1 activity by regulating the AP-1 protein compositional patterns in JB6 cells
PNAS, April 25, 2001; (2001) 101116298.
[Abstract] [Full Text]


Home page
PhysiologyHome page
T. D. Veenstra, M. R. Pittelkow, and R. Kumar
Regulation of Cellular Growth by 1,25-Dihydroxyvitamin D3-Mediated Growth Factor Expression
Physiology, February 1, 1999; 14(1): 37 - 40.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. R. Patel and J.-Y. Wang
Polyamine depletion is associated with an increase in JunD/AP-1 activity in small intestinal crypt cells
Am J Physiol Gastrointest Liver Physiol, February 1, 1999; 276(2): G441 - G450.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
F. Aslam, L. McCabe, B. Frenkel, A. J. van Wijnen, G. S. Stein, J. B. Lian, and J. L. Stein
AP-1 and Vitamin D Receptor (VDR) Signaling Pathways Converge at the Rat Osteocalcin VDR Element: Requirement for the Internal Activating Protein-1 Site for Vitamin D-Mediated Trans-Activation
Endocrinology, January 1, 1999; 140(1): 63 - 70.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
M. V. Chirayath, L. Gajdzik, W. Hulla, J. Graf, H. S. Cross, and M. Peterlik
Vitamin D increases tight-junction conductance and paracellular Ca2+ transport in Caco-2 cell cultures
Am J Physiol Gastrointest Liver Physiol, February 1, 1998; 274(2): G389 - G396.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Inoue, P. Santiago, W. C. Horne, and R. Baron
Identification of an Osteoclast Transcription Factor That Binds to the Human T Cell Leukemia Virus Type I-Long Terminal Repeat Enhancer Element
J. Biol. Chem., October 3, 1997; 272(40): 25386 - 25393.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
G. Liu, N. Chen, A. Kaji, A. M. Bode, C. A. Ryan, and Z. Dong
Proteinase inhibitors I and II from potatoes block UVB-induced AP-1 activity by regulating the AP-1 protein compositional patterns in JB6 cells
PNAS, May 8, 2001; 98(10): 5786 - 5791.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lasky, S. R.
Right arrow Articles by Maizel, A. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lasky, S. R.
Right arrow Articles by Maizel, A. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement