JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Ho, S. N.
Right arrow Articles by Crabtree, G. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Ho, S. N.
Right arrow Articles by Crabtree, G. R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 34, Issue of August 25, pp. 19898-19907, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
NFATc3, a Lymphoid-specific NFATc Family Member That Is Calcium-regulated and Exhibits Distinct DNA Binding Specificity (*)

(Received for publication, May 3, 1995; and in revised form, June 13, 1995)

Steffan N. Ho (1), (§),  Daryl J. Thomas (1),  Luika A. Timmerman (1),  Xu Li (2),  Uta Francke (2),  Gerald R. Crabtree (1)(¶)

From the  (1)Departments of Developmental Biology and (2)Genetics, Howard Hughes Medical Institute, Stanford University Medical School, Stanford, California 94305

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Signals transduced by the T cell antigen receptor (TCR) regulate developmental transitions in the thymus and also mediate the immunologic activation of mature, peripheral T cells. In both cases TCR stimulation leads to the assembly of the NFAT transcription complex as a result of the calcium-dependent nuclear translocation of cytosolic subunits, NFATc, and the Ras/protein kinase C-dependent induction of a nuclear subunit, NFATn. To further understand the diverse roles of antigen receptor signaling throughout T cell development, we have identified a new NFATc family member, NFATc3, that is expressed at highest levels in the thymus. NFATc3 is the product of a gene on murine chromosome 8 that is not linked to the other NFATc genes. NFATc3, like other NFATc family members, contains a conserved rel similarity domain, and also defines a region conserved among NFATc family members, the SP repeat region, characterized by the repeated motif SPxxSPxxSPrxsxx(D/E)(D/E)swl. NFATc3 activates NFAT site-dependent transcription when overexpressed, yet exhibits a pattern of DNA site specificity distinct from other NFATc proteins. Additionally, thymic NFATc3 undergoes modifications in response to agents that mimic T cell receptor signaling, including a decrease in apparent molecular mass upon elevation of intracellular calcium that is inhibited by the immunosuppressant FK506. Given the preferential expression of NFATc3 in the thymus, NFATc family members may regulate distinct subsets of genes during T cell development.

INTRODUCTION

The antigen receptor of T lymphocytes subserves diverse functions during development. In the thymus, signals from the antigen receptor rescue from death those cells that have low avidity receptors for self-antigens bound to major histocompatability complex molecules (positive selection), whereas high avidity self-antigens induce programmed cell death (negative selection)(1) . In mature, peripheral T cells, interaction with foreign antigen leads to immunologic activation. In each case characteristic sets of genes are activated or repressed by signals emanating from the antigen receptor. For example, antigen receptor-induced repression of the RAG-1 and RAG-2 genes (2) and activation of the CD69 gene (3) are hallmarks of thymic selection. In mature T cells, antigen receptor-induced expression of growth factor genes such as IL-2 (^1)and genes that encode cell-cell interaction molecules, such as the CD40 ligand, are essential for immunologic function and proliferation. How these diverse cell fates and functions are initiated by the T cell antigen receptor (TCR) is not understood, but likely involve the use of distinct antigen receptor response elements to activate genes essential for specific developmental transitions.

T cell antigen receptor response elements (ARREs) were initially described in the IL-2 gene of mature T cells(4) . The protein complex that binds to one of these elements, designated nuclear factor of activated T cells (NFAT; (5) ), appears to integrate Ras- and calcium-dependent signals initiated by the antigen receptor through the assembly of cytosolic (NFATc) and nuclear (NFATn) components. NFATc is present in the cytosol of resting lymphocytes in a transcriptionally active form and translocates to the nucleus within 5 min of T cell activation(6) . This translocation event, as well as NFAT complex formation and NFAT site-dependent transcription, is calcium- and calcineurin-dependent and completely blocked by the immunosuppressive drugs FK506 and cyclosporin A(6, 7, 8, 9) . NFATn is synthesized within 20 min of T cell activation by a Ras/protein kinase C-dependent pathway and can be replaced by high levels of AP1(6, 10, 11) . In addition to the NFAT site within the IL-2 gene promoter, putative NFAT DNA binding sites have been identified in the promoters of several genes that are transcriptionally induced upon antigen receptor activation in a CsA/FK506-sensitive manner, including IL-3/GM-CSF(12) , IL-4(13, 14, 15) , TNFalpha(16) , CD40L(17, 18) , and granzyme B(19) . Thus, NFAT represents a multicomponent transcription factor complex that integrates signals transduced by the TCR through the use of constituents that are the targets of distinct signaling pathways.

In addition to its role in the transcriptional induction of cytokine genes in mature T lymphocytes, NFAT may also be involved in T cell ontogeny in the thymus. Although ARREs have not been defined for TCR signaling in the thymus, the ability of thymocytes to induce NFAT DNA binding activity to the IL-2 ARRE appears to be developmentally regulated. This conclusion is based upon results demonstrating that in short term thymocyte cultures, NFAT is inducible in CD4-CD8- cells, noninducible in CD4+CD8+ thymocytes, and inducible in the single-positive populations(20, 21) . A role for NFAT in thymic maturation is also suggested by the observations that cyclosporin A or FK506, which inhibits calcineurin and completely blocks transcription directed by the NFAT site(6, 8, 9) , blocks the development of the CD4+CD8- and CD4-CD8+ subpopulations of thymocytes(22, 23) . Thus, although a variety of studies suggest a role for the NFAT transcription factor complex in regulating development in the thymus, there is no clear understanding of the specific mechanism by which this occurs. This is due, in part, to a lack of understanding of the molecular characteristics of the NFAT complex in developing thymocytes and the lack of definition of ARREs for intrathymic signaling by the T lymphocyte receptor.

The purification and molecular cloning of the preexisting or cytosolic component of NFAT resulted in the identification of two distinct genes, NFATp (24) and NFATc(25) , both of which encode proteins that are capable of binding to NFAT DNA sites and are present in the NFAT gel shift complex. These proteins share a conserved region of limited similarity (20% amino acid identity) to the rel homology domain of dorsal/rel/NFkappaB transcription factors, and therefore appear to define a distinct family or subfamily of transcription factors(25) . Whether this family will also be characterized by other features shared by NFATc and NFATp, such as their function as targets of calcium-dependent signal transduction, is uncertain. (^2)To further investigate the role of the NFATc family of transcription factors in signal transduction and T cell development, a cDNA library derived from thymocytes induced to undergo negative selection (26) was screened for additional NFATc family members. An additional cDNA was isolated that encodes a novel NFATc family member, NFATc3. Characterization of this cDNA indicates that NFATc3 RNA is preferentially expressed in thymus, spleen, and lymph node and that NFATc3 exhibits DNA binding specificity distinct from that of other NFATc family members. Furthermore, thymic NFATc3 undergoes alterations in apparent molecular mass in response to increases in intracellular calcium that are reversed by the immunosuppressant FK506, suggesting that NFATc3 is regulated by calcineurin in a manner similar to the other NFATc family members. These results extend our understanding of the molecular characteristics of NFATc proteins and should permit a more rigorous analysis of the role of the NFATc family of transcription factors in thymic development and signal transduction.

MATERIALS AND METHODS

NFATc3 cDNA Cloning

A cDNA library (kindly provided by B. Osborne) was derived from T cell receptor transgenic murine thymus stimulated in vivo by inducing negative selection with injected antigen(26) . The library, constructed in the UNI-Zap XR vector (Stratagene), was screened using a radiolabeled DNA probe corresponding to the rel similarity domain of murine NFATc1 and NFATc2 (24) . The probe was labeled by PCR amplification, as described(27) . Oligonucleotides 5`-TGATCACCTCCAAGATATGGAAGACCAGTCC and 5`-GCGCGTCGACGGCAGAGCGCTGAGAGCA were used to amplify a fragment corresponding to nucleotides 434-1206 of the murine NFATc2 cDNA (24) ; oligonucleotides 5`-CGACACTCGAGTCAGTAAAAACCTCCTCTC and 5`-CTGCCCTCGAGTGGCAGCTCCCGTCACATTC were used to amplify a fragment corresponding to the homologous region of murine NFATc1. The murine NFATc1 cDNA clone used as a template in PCR reactions was obtained by low stringency screening of the same library using the full-length human NFATc1 clone (25) as a probe. (^3)Colonies that hybridized under low stringency conditions only were isolated. The clone containing the longest cDNA insert, clone 3, was sequenced in its entirety on both strands using the dideoxynucleotide chain termination method with Sequenase version 2.0 (U. S. Biochemical Corp.). Analysis of the NFATc3 sequence, including data base searches, alignments, and motif searches, employed both the GCG version 7.4 (Genetics Computer Group, Inc., Madison, WI) and the Intelligenetics Suite release 5.4 (Intelligenetics, Inc., Mountain View, CA) software packages.

Plasmid Constructs

The NFATc3 expression construct was made as follows: a 3215-bp NFATc3 fragment was obtained from clone 3 by XhoI digestion (an XhoI site was present in the vector at the 3` end of the clone), filling in of the 5` overhang with the Klenow fragment of DNA polymerase, and digestion with XbaI (site present at nucleotide 404). This fragment was inserted in frame into the 5` FLAG epitope-tagged expression vector pDF30 (kindly provided by D. Fiorentino) at the XbaI-MscI sites within the polylinker, resulting in the plasmid pSH250A. This vector is a derivative of the pBJ5 mammalian expression vector, which contains the SRalpha promoter(28) . The NFATc2 expression construct, pSH210, consists of a human NFATc2 cDNA fragment inserted into the pBJ5 vector. The human homolog of the murine NFATc2 cDNA (24) was cloned by low stringency hybridization of a Jurkat cell cDNA library using as a probe a fragment of the murine NFATc2 cDNA obtained by PCR amplification. (^4)The NFATc1 expression construct, pSH107c, contains the human NFATc1 cDNA (25) in the pBJ5 vector.

Chromosomal Localization of Nfatc3

Chromosomal localization of the Nfatc3 gene was performed by PCR analysis of DNAs from a mapping panel consisting of 19 mouse Chinese hamster and two mouse rat somatic cell hybrid lines as described(29) . Primers (forward: 5` TCAGCTGTGGGAAACGAG and reverse: 5` CTATGCAACCAGGTCACC) were designed from the 3`-untranslated region of the NFATc3 cDNA and gave rise to the expected 154-bp DNA fragment upon PCR amplification (95 °C for 5 min followed by 35 cycles of 94 °C for 30 s, 55 °C for 30 s, and 72 °C for 1 min with a final extension at 72 °C for 7 min). Fluorescence chromosomal in situ hybridization (FISH) was carried out as described previously(30) .

Ribonuclease Protection Assays

RNA was isolated from whole tissues or cell lines by guanidinium thiocyanate lysis and cesium chloride centrifugation(31) . A NFATc3 cDNA fragment (nucleotides 1191-1355) in pBluescriptIIKS+ and a 131-bp human -actin cDNA fragment in pSP64 (Promega) which cross-hybridizes to murine -actin were used as templates for the synthesis of antisense RNA labeled to high specific activity with [P]UTP. Full-length RNA probes were isolated on a denaturing acrylamide gel and hybridized in excess to 10 µg of total RNA overnight at 42 °C in 40 mM PIPES (pH 6.7), 400 mM NaCl, 1 mM EDTA, 80% formamide. Samples were incubated for 1 h at 42 °C with 300 µl of digestion buffer consisting of 10 mM Tris (pH 7.5), 5 mM EDTA, 300 mM NaCl, 35 units of RNase TI, 1 µg of RNase AIII. Proteinase K (40 µg) and sodium dodecyl sulfate (20 µl of 10% solution) were added and the incubation continued for 20 min. Samples were then extracted twice with phenol:chloroform (1:1, v:v), precipitated, resuspended in gel loading buffer, and analyzed by 6% denaturing polyacrylamide gel electrophoresis.

NFATc Antibodies

The NFATc3 antiserum was raised against a 74-amino acid peptide of NFATc3 extending from residues 321 to 395 (Fig. 2A). This peptide was selected for the generation of antisera, because it did not overlap with either the conserved rel similarity domain or the SP repeat region and therefore could be expected to give rise to antisera that would not cross-react with other NFATc family members. The protein used for immunization consisted of a bacterially produced glutathione S-transferase-NFATc3 fusion protein. The bacterial expression construct was prepared by in-frame ligation of the 227-bp ScaI-MscI fragment from the NFATc3 cDNA clone (nucleotides 958-1185) into the EcoRI site of pGex3X (Pharmacia Biotech Inc.). The glutathione S-transferase fusion protein was purified on glutathione-agarose as specified by the manufacturer (Pharmacia) and used to immunize rabbits (Josman Laboratories). Antisera was affinity-purified on protein A-Sepharose CL-4B (Pharmacia). The NFATc1 (NFATc) monoclonal antibody 7A6 was described previously(25) . The NFATc2 (NFATp) monoclonal antibody 5H8 was used as a hybridoma culture supernatant and will be described elsewhere. (^5)

Figure 2: NFATc family members are defined by the rel similarity domain and a region containing three SP repeat motifs. A, schematic comparison of NFATc1, NFATc2, and NFATc3. The rel similarity domain is shadedblack, and the SP repeat motifs are shaded gray. The schematic representations of the NFATc proteins are drawn to scale, relative to the length of the primary amino acid sequence. Thus, the relative differences in distances between different regions are accurate. The region of NFATc3 used to generate antisera is indicated by a thick line, and the region corresponding to the location of the ribonuclease protection probe is indicated by a thin line. The designations ``h'' and ``m'' refer to the human and murine cDNAs. B, sequence comparison of the SP repeat region and rel similarity domain of NFATc family members. The amino acid sequences of the NFATc proteins were aligned using the PileUp program and displayed using the Pretty program (Genetics Computer Group, Inc.). A dash indicates identity with the human NFATc1 sequence, and periods indicate inserted gaps. C, SP repeat motif consensus sequence. Uppercase letters represent residues conserved in each of the nine SP repeat motifs (three motifs present in each of the three NFATc proteins); lowercase letters represent residues conserved in at least five of the nine SP repeat motifs.


Cell Culture and Transfection

The Jurkat TAg (SV40 T antigen) cell line (10) and COS cells (obtained from ATCC) were grown in RPMI 1640 supplemented with 10% (v/v) fetal bovine serum, 100 units/ml penicillin G, 100 µg/ml streptomycin, and 2 mML-glutamine (complete media) in a 5% CO2, 95% air humidified atmosphere. Jurkat TAg cells (10^7) were transiently transfected with 3 µg of the indicated plasmid by electroporation in 0.4 ml of complete medium (Bio-Rad gene pulser; 960 µF, 250 V, 0.4-cm gap width). Cells were harvested after 24 h and aliquoted in triplicate into 96-well flat-bottom microtiter plates (2 10^5 cells/well in 100 µl of complete medium) and stimulated with various combinations of ionomycin (1 µM), phorbol myristate acetate (PMA, 20 ng/ml), or FK506 (2 ng/ml) in a final volume of 200 µl. Reporter gene activity was measured 12-24 h after stimulation. COS cells were grown to approximately 80% confluence in 150-mm^2 plastic tissue culture dishes (Falcon) and transiently transfected by electroporation (960 µF, 230 V, 0.4-cm gap width) in 0.4 ml of complete medium.

Reporter Gene Assay

Secreted alkaline phosphatase activity was measured 16-24 h after stimulation, as described previously(32, 33) . Briefly, microtiter plates were heated to 65 °C for 1.5-2 h, and 100-µl aliquots from each well were incubated with an equal volume of 2 M diethanolamine bicarbonate (pH 10.0), 1 mM methylumbelliferyl phosphate (Sigma) at 37 °C. Relative alkaline phosphatase activity was measured by quantitating the accumulation of fluorescent product using a Titertek Fluoroskan II (ICN) with an excitation wavelength of 355 nm and an emission wavelength of 460 nm.

Preparation of Cell Extracts

Nuclear extracts from Jurkat TAg and COS1 cells were prepared essentially as described previously (34) . Briefly, cells were washed once with cold phosphate-buffered saline, resuspended in buffer A (10 mM Hepes (pH 7.8), 15 mM KCl, 2 mM MgCl(2), 1 mM dithiothreitol, 0.1 mM EDTA), pelleted by low speed centrifugation (Eppendorf microcentrifuge, setting 3 for 3 min), and resuspended in buffer A + 0.05% Nonidet P-40. The resulting nuclei were pelleted by low speed centrifugation and resuspended in buffer C (50 mM Hepes at pH 7.8, 50 mM KCl, 1 mM dithiothreitol, 0.1 mM EDTA, 10% glycerol). The nuclei were lysed by addition of 0.10 volume of 3 M ammonium sulfate (pH 7.9) followed by rotation at 4 °C for 30 min. The nuclear debris was pelleted by high speed centrifugation at 100,000 rpm for 15 min (Beckman TL-100 tabletop ultracentrifuge, TLA 100.2 rotor). Protein in the supernatant was precipitated by addition of an equal volume of 3.0 M ammonium sulfate (pH 7.9), pelleted by centrifugation (50,000 rpm for 8 min), and resuspended in 50-100 µl of buffer C. All buffers were supplemented with protease inhibitors (1 µg/ml antipain, 1 µg/ml aprotinin, 1 mM benzamidine, 0.5 µg/ml leupeptin, 1 µg/ml pepstatin, and 1 mM phenylmethylsulfonyl fluoride). Extracts were stored at -75 °C. Protein concentration was determined by the Bradford dye assay (Bio-Rad). Thymus, spleen, and lymph node extracts were prepared as above from unfractionated cell suspensions. Thymus whole cell extracts were prepared from an unfractionated cell suspension treated with the indicated stimuli for 15 min. Cells were subsequently washed once with phosphate-buffered saline and lysed in 20 mM Tris-HCl, pH 7.7, 250 mM NaCl, 3 mM EDTA, 3 mM EGTA, 1 mM dithiothreitol, 0.5% Nonidet P-40, 10 mM beta-glycerophosphate, 100 µM sodium vanadate, 1 mM sodium fluoride, 1 mMp-nitrophenyl phosphate and protease inhibitors (listed above). Lysates were cleared by ultracentrifugation. COS whole cell extracts were similarly prepared.

Electrophoretic Mobility Shift Assay

DNA binding reactions were performed in a final volume of 15 µl containing 10 mM Tris (pH 7.5), 80 mM sodium chloride, 1 mM EDTA, 1 mM dithiothreitol, 5% glycerol, varying concentrations of poly(dI-dC) (Boehringer Mannheim), 10 µg of nuclear extract, and 0.1 ng of radiolabeled double-stranded oligonucleotide probe. After addition of nuclear extract, samples were incubated at room temperature for 45-60 min, loaded onto a prerun 4% polyacrylamide gel (acrylamide/bisacrylamide ratio of 30:0.8) cast in 1 Tris borate-EDTA (TBE), and electrophoresed at 180 V for 2-2.5 h using 0.5 TBE running buffer. Supershifts were performed by addition of 1 µL of a 1:10 dilution of an ascites preparation of the monoclonal antibody 7A6, or 2 µl of a hybridoma culture 5H8 supernatant, to the preformed gel shift complex and incubating for an additional 30 min on ice. Gel shift probes included: the murine IL-2 NFAT site, 5` ACTGACCCCAAAGAGGAAAATTTGTTTCATGATC; the murine IL-4 NFAT site, 5` CTTTACATTGGAAAATTTTAT(35) ; the murine TNFalpha k3 site, CTCGAGTACCCAAAGAGGTGG(16) ; and the IL-3/GM-CSF NFAT site (GM550), 5` TGACAGGAGGAAAGCAAGAGTCATATAGGCTGTC(12) .

Immunoprecipitation and Western Analysis

Protein A-Sepharose CL-4B (Pharmacia) was prebound with an excess of rabbit NFATc3 antiserum, washed three times with lysis buffer, and added to whole cell extracts. After a 1-h incubation on ice, the Sepharose was washed three times with lysis buffer and subject to SDS-polyacrylamide gel electrophoresis. Western blotting was performed using protein A-purified rabbit anti-NFATc3 antiserum (1:500 dilution) and protein A-peroxidase (Sigma) as the secondary (1:2500 dilution).

RESULTS

Molecular Cloning of NFATc3

DNA fragments encoding the rel similarity domains (RSD) of the murine NFATc1 and NFATc2 cDNA clones were used to screen a thymus cDNA library(26) . Low stringency hybridization and washing resulted in 220 positive plaques (approximately 9 10^5 plaques screened). All but 21 of these plaques were resistant to high stringency wash conditions. The 21 plaques that hybridized under low stringency conditions only were characterized and found to represent overlapping clones of a common cDNA sequence. The longest of these clones (#3) contained a cDNA sequence spanning 3619 nucleotides (Fig. 1). The cDNA encodes a protein of 1065 amino acids with a predicted molecular mass of 115 kilodaltons, and contains a putative polyadenlyation signal 16 bp upstream of the poly(A) tail. However, it lacks a 5` in-frame stop codon or translation initiation codon and therefore likely represents a partial cDNA clone. As expected, comparison of the cDNA sequence to sequences present in the Genbank

Figure 1: Nucleotide and predicted amino acid sequence of murine NFATc3. The SP repeat motifs are underlined, and the rel similarity domain is represented in italics.


The region of amino acid sequence similarity encompassed the RSD (Fig. 2, A and B), over which NFATc3 is 69% identical to NFATc1 and 65% identical to NFATc2 (NFATc1 is 70% identical to NFATc2 in this region). All three sequences exhibit greater similarity over a 170-amino acid region within the RSD (79-89% identical), consistent with this more conserved portion of the RSD functioning as the minimal DNA binding domain (36) . (^6)Although the COOH-terminal portion of the RSD is less conserved, a putative nuclear localization signal at residue 676 stands out as a stretch of amino acids that are conserved, suggesting that this may in fact represent a functional sequence. Furthermore, the location of the RSD within NFATc proteins differs. The RSD is located at the carboxyl terminus of NFATc1, whereas it is more centrally located within the linear amino acid sequence of NFATc2 and NFATc3. This is in contrast to proteins containing the rel homology domain, which is uniformly located at or near to the amino terminus of the protein(37) .

In addition to the RSD, NFATc3 also exhibits sequence similarity to NFATc1 and NFATc2 within a region extending 300 amino acids toward the NH(2) terminus (Fig. 2, A and B). The murine NFATc2 cDNA clone, being a partial cDNA, encompasses only approximately 220 amino acids of this domain. This region of similarity is 35% identical between NFATc3 and NFATc1, but is additionally unique in that it contains a conserved motif characterized by a serine/proline repeat consensus sequence SPxxSPxxSPrxsxt[D/E][D/E]swl, which is itself repeated three times (Fig. 2, A and C). Interestingly, the location of the three SP repeat motifs relative to each other and to the RSD is conserved among NFATc proteins, suggesting a functional relationship between these domains (Fig. 2A). The third repeat (SP repeat C) contains an additional, conserved four amino acid NH(2)-terminal extension consisting of another SPxx repeat, where x is histidine in NFATc2 and NFATc3 (Fig. 2C). Additionally, the SP repeat motifs in NFATc2 lack the conserved tryptophan that is present near the COOH terminus of the motif in both NFATc1 and NFATc3. No other proteins with this motif have been identified in searches of sequence data banks. Although the function of this domain remains unknown, the fact that it is conserved among NFATc family members suggests that it may have a function that is characteristic of this family.

Finally, the carboxyl-terminal portion of NFATc3 extending past the rel similarity region is relatively rich in glutamine, which represents 10% of the COOH-terminal 384 amino acids. This feature is also seen in the COOH-terminal portion of NFATc2. In contrast, the NFATc1 protein does not extend past the rel similarity region and contains no glutamine-rich regions. Additionally, NFATc3 is rich in serine and threonine (20%), contains two potential glycosylation sites (N-linked), and also contains a consensus sequence for a single tyrosine phosphorylation site (amino acids 133-140).

Chromosomal Localization of NFATc3

Genomic DNAs from a panel of 21 mouse hybrid cell lines were analyzed by PCR using primers that specifically amplified a Nfatc3 DNA fragment. The expected 154-bp PCR product was obtained from the hybrid cell lines that had retained moues chromosome 8 and from mouse 3T3 DNA. Under these PCR conditions no amplification was obtained with Chinese hamster and rat DNA. The results (Table 1) indicate that all mouse chromosomes were excluded except chromosome 8 by at least three discordant hybrids. Fluorescence in situ hybridization using murine NFATc3 cDNA as a probe further localized the Nfatc3 gene to mouse chromosome 8 band D (Fig. 3). Seventeen of 22 metaphase spreads analyzed exhibited a fluorescent signal on both chromatids of chromosome 8 at this site, and 10 of these had signals on both chromosome 8 homologs. No specific fluorescent hybridization signals were seen on other chromosomes.

Figure 3: Chromosomal mapping of Nfatc3 gene by fluorescence in situ hybridization. Left: arrows indicate specific hybridization signals is on both chromosome 8 homologs at band D. Right: G-banding ideogram of mouse chromosome 8 (42) with localization of Nfatc3. Comparison of the cytological map of human chromosome 16, bands q13-q24, and the linkage map of mouse chromosome 8, that corresponds to bands C-E, depicts several genes mapped to the conserved syntenic regions(43) . It is highly likely, therefore, that the human NFATc3 gene is located in that region as well.


Tissue Distribution of NFATc3 Expression

To quantitatively assess NFATc3 mRNA levels in different tissues we used a ribonuclease protection probe extending from nucleotide 1191 to 1355 (Fig. 1). Ribonuclease protection assays show that the NFATc3 gene is expressed at relatively high levels in thymus and spleen (Fig. 4A). NFATc3 is also expressed in lymph node, although at a lower level than that seen in thymus and spleen (Fig. 4B). Low levels of NFATc RNA are present in other tissues; however, this is likely a result of peripheral blood cells or lymph nodes present within these tissues. Ribonuclease protection assays using RNA from several cultured B cell lines representing various stages of B cell differentiation show significant, although variable levels of NFATc3 RNA that did not change upon stimulation with calcium ionophore and phorbol ester. Therefore, it appears that although NFATc3 is highly expressed in thymocytes, it is also expressed in the B cell lineage. The high level of expression observed in thymus is consistent with the high frequency of NFATc3 clones present in the thymic cDNA library.

Figure 4: NFATc3 is preferentially expressed in lymphoid tissues. Ribonuclease protection assays were performed using both NFATc3 and -actin RNA probes in the same protection assay. A, each sample represents protected RNA from 10 µg of total cellular RNA isolated from the indicated tissues. B, the indicated cell lines were either unstimulated(-) or stimulated with ionomycin (1 µM) and PMA (20 ng/ml) for 3 h. PD31 represents a pre-B cell line, BalI7 and 38C13 represent mature B cell lines, and MOPC represents a plasma cell line. The separated lanes are all from the same gel and exposure.


NFATc Family Members Bind DNA with Distinct Specificities

The DNA binding specificity of NFATc proteins was compared in gel mobility shift assays using nuclear extracts from COS cells transfected with expression vectors encoding NFATc1, NFATc2, or NFATc3 or with the expression vector alone as a negative control. Transfected cells were stimulated with ionomycin and phorbol ester for 3 h. Stimulation of the cells was required to obtain NFAT DNA binding activity, presumably to induce the expression of NFATn (e.g. AP1). Initially no binding to the IL-2 NFAT site could be detected in the extracts of cells transfected with NFATc3 under conditions used to define the NFAT complex by correlation between in vitro binding and in vivo transcriptional activation(4, 5) . However, upon lowering the concentration of the nonspecific competitor poly(dI-dC), NFATc3 binding was observed (Fig. 5A). The specificity of the DNA binding activity in extracts from cells transfected with either NFATc1, NFATc2, or NFATc3 was verified based on competition with an excess of the unlabeled NFAT site probe (Fig. 5B). In addition, the observed gel shift activity was also effectively eliminated by the addition of excess unlabeled AP1 site probe, indicating that NFATc3 binds to this DNA site as a complex containing AP1-related proteins, as has been observed for the NFAT complex(10) . Similar results were obtained using either the murine or the human distal IL-2 promoter NFAT sites (data not shown). The concentration of nonspecific competitor used to demonstrate NFATc3 binding to the IL-2 NFAT site in COS extracts overexpressing NFATc3 was significantly lower than that required to obtain specific binding of the endogenous NFAT complex to this site in primary cell extracts. Thus, the IL-2 NFAT site most likely does not represent a physiologic DNA binding site for NFATc3.

Figure 5: NFATc family members bind DNA with distinct specificities. Nuclear extracts used in gel shift assays were obtained from COS cells transfected with the indicated NFATc expression construct or with the plasmid vector as a negative control. A, titration of the nonspecific competitor poly(dI-dC) reveals that NFATc3, unlike NFATc1 or NFATc2, binds to the IL-2 NFAT site only at low poly(dI-dC) concentrations. Concentrations of poly(dI-dC) were 1, 0.5, and 0.25 µg/reaction (left-to-right), as shown schematically. B, binding of NFATc family members to the murine distal IL-2 NFAT site is inhibited by an excess of unlabeled NFAT or AP1 site DNA. Binding reactions were performed as described, using 0.25 µg of poly(dI-dC)/reaction. Competitor DNA was added at 50-fold excess over probe DNA. C, identical extracts were used in gel shift assays with either the murine IL-2 NFAT site, the murine IL-4 NFAT site, the murine TNFalpha kappa3 NFAT site, or the IL-3/GM-CSF NFAT site, GM550. All reactions were performed using the same conditions, which included 0.25 µg of poly(dI-dC)/reaction.


To further investigate the DNA site specificity of NFATc3, the binding of NFATc proteins to oligonucleotide probes corresponding to putative NFAT sites within other cytokine promoters was examined in gel shift assays under identical conditions, utilizing the same set of nuclear extracts from COS cells transfected with NFATc expression constructs. These extracts were examined under conditions of low poly(dI-dC) to permit detection of weak binding (perhaps of no physiologic significance). This approach was taken to reveal potential differences in DNA binding specificity of the NFATc-transfected extracts based on differences in the relative binding characteristics of the same set of extracts with different DNA binding sites. In addition to the distal murine IL-2 NFAT site, the sites used in binding assays include the NFAT site within the murine IL-4 promoter(35) , the kappa3 site within the TNFalpha promoter(16) , and the GM550 site within the IL-3/GM-CSF intergenic promoter(12) . In contrast to the IL-2 promoter NFAT site, which bound all three NFATc proteins, the IL-4 promoter NFAT site preferentially bound NFATc2 and NFATc3, whereas both the TNFalpha and IL-3/GM-CSF sites preferentially bound NFATc2, but not NFATc1 or NFATc3 (Fig. 5C). Thus, the three NFATc family members exhibit differences in binding specificity, since identical extracts and binding conditions were used to assay binding to the various DNA sites.

NFATc3 Activates Transcription via the Distal IL-2 NFAT DNA Binding Site

To determine whether NFATc3, in addition to binding to an NFAT DNA binding site in vitro, could also bind to and activate transcription from an NFAT site in vivo, an NFATc3 cDNA expression construct was cotransfected into Jurkat cells with a reporter gene construct containing the human IL-2 NFAT binding site within the IL-2 minimal promoter. The Jurkat cells used are stably transfected with SV40 T antigen, thereby permitting replication of plasmids containing an SV40 origin and, as a result, high level expression(10) , similar to COS cells. Parallel transfections were also performed with NFATc1 and NFATc2 cDNA expression constructs. Analysis of reporter gene expression (Fig. 6) showed that transfection of each of the NFATc family members resulted in an increase in the basal level of reporter gene expression in unstimulated Jurkat cells as compared with that in cells transfected with vector plasmid DNA as a control. Upon stimulation, cells transfected with the NFATc3 expression construct produced a significantly higher level of reporter gene product than control cells in which inducible reporter gene expression results from activation of endogenous NFATc. Transfection of the NFATc1 and NFATc2 expression constructs also resulted in an increase in the level of inducible reporter gene expression. Similar results were observed in transfections of COS cells, in which there is no endogenous NFATc activity (data not shown). The specificity of the enhanced NFAT site-dependent reporter gene expression resulting from transfection with the NFATc expression constructs was determined in parallel transfections with an alternative reporter gene construct containing five copies of the metallothionein AP1 site within the IL-2 minimal promoter. The level of AP1-dependent reporter gene expression induced upon stimulation is not significantly different in control cells as compared with cells transfected with the NFATc expression constructs. Thus, overexpression of NFATc3 by transient transfection results in the specific augmentation of NFAT DNA site-dependent gene expression.

Figure 6: NFATc3 activates NFAT DNA site-dependent transcription. Transiently transfected Jurkat cells were stimulated in triplicate with 1 µM ionomycin plus 20 ng/ml PMA 24 h after transfection. Culture supernatants were collected approximately 20 h after stimulation and assayed for secreted alkaline phosphatase activity. Results are expressed in arbitrary units of fluorescence intensity, reflecting relative alkaline phosphatase activity. All values are expressed relative to the alkaline phosphatase activity present in a control sample transfected with vector DNA alone, which was set to zero units of fluorescence intensity. Each point represents the mean of triplicate samples; error bars represent standard error of the mean. The data shown are representative of at least three independent experiments.


NFATc3 Is Not Present in the Endogenous NFAT Complex Formed on the Distal IL-2 NFAT Site

Since NFAT was overexpressed in these studies to a level that may permit nonphysiologic binding, we sought to determine if NFATc3 actually contributes to the DNA-protein complex seen in nuclear extracts from thymus, spleen, or lymph node. To determine if NFATc3 from murine lymphoid tissues actually contributes to the DNA protein complex on the IL-2 gene ARRE, we used monoclonal antibodies specific for NFATc1 and NFATc2 (see Fig. 8A) that produce supershifted DNA-protein-antibody complexes that can be readily distinguished on native polyacrylamide gels. As illustrated in Fig. 7, DNA-protein complexes from the thymus, spleen, and lymph node were entirely supershifted by antibodies to NFATc1 plus NFATc2. This indicates that even in the thymus where NFATc3 is expressed at high levels, there is no significant contribution of NFATc3 to binding to the IL-2 ARRE. Thus, although NFATc3 binds to the IL-2 ARRE when overexpressed by transfection ( Fig. 5and Fig. 6), the affinity of NFATc3 for this site is insufficient to permit binding at the endogenous levels of NFATc3 present in nuclear extracts. This raises the possibility that NFATc3 interacts with an ARRE distinct from the IL-2 ARRE.

Figure 8: NFATc3 is modified in response to agents that increase intracellular calcium and activate protein kinase C. A, replicate aliquots of extracts from COS cells transfected with the indicated NFATc expression construct were Western blotted with either the monoclonal antibody 7A6 (anti-NFATc1), the monoclonal antibody 5H8 (anti-NFATc2), or a rabbit anti-NFATc3 polyclonal antisera. B, freshly isolated unfractionated thymocytes were stimulated for 15 min with ionomycin (1 µM), PMA (20 ng/ml), and/or FK506 (2 ng/ml) in the indicated combinations. Immunoprecipitation and subsequent Western blotting were performed with the rabbit NFATc3 antiserum. NFATc3` refers to the slower migrating form of the protein that could be phosphorylated, whereas NFATc3 is the more rapidly migrating form. Both forms give a characteristic blurry band that is not a loading or running artifact since Ig (immunoglobulin) runs normally on the same gel.


Figure 7: NFATc3 does not substantially contribute to the NFAT gel shift complex on the IL-2 ARRE. Nuclear extracts prepared from unfractionated thymus, spleen, and lymph node cell suspensions stimulated with ionomycin and PMA were used in gel shift assays. The contribution of NFATc1 and NFATc2 to the NFAT gel shift complex was determined by supershifts using the NFATc1 monoclonal antibody 7A6 and the NFATc2 monoclonal antibody 5H8.


NFATc3 Is Modified by Agents That Increase Intracellular Calcium or Activate Protein Kinase C

To further characterize the functional properties of NFATc3, a rabbit antiserum was raised to a 74-amino acid NFATc3 peptide (Fig. 2A) produced in bacteria as a glutathione S-transferase fusion protein. The specificity of the antiserum for NFATc3 was determined by Western analysis of extracts from COS cells transfected with NFATc1, NFATc2, or NFATc3 cDNA expression constructs or with a control plasmid consisting of the vector alone. Replicate blots were incubated using monoclonal antibodies raised against NFATc1 (7A6) and NFATc2 (5H8), as well as the rabbit NFATc3 antiserum. The NFATc3 antiserum showed no cross-reactivity for NFATc1 or NFATc2 (Fig. 8A). Additionally, although the NFATc3 cDNA expression construct was predicted to give rise to a 110-kDa protein, the rabbit antiserum revealed a 185-kDa immunoreactive band, suggesting that NFATc3 is subject to significant post-translational modification.

The nature of the post-translational modification was investigated by using the NFATc3 antiserum to immunoprecipitate NFATc3 from whole cell thymic extracts, followed by Western blotting. The endogenous NFATc3 is a protein of approximately 190 kDa relative molecular mass, similar in size to the protein derived from the transfected cDNA (Fig. 8B). Thymus cells stimulated for 15 min with agents that increase intracellular calcium (ionomycin) or activate protein kinase C (PMA) demonstrate that NFATc3 undergoes regulated post-translational modification between a rapidly migrating form and a more slowly migrating form, NFATc3`, which could represent a phosphorylated form of the protein (Fig. 8B). Ionomycin treatment resulted in a slight reduction in the relative molecular mass of NFATc3 as compared with nonstimulated cells (lane 3 versus 1). The addition of the immunosuppressant FK506 reversed this change (lane 4 versus 3), causing in increase in the relative molecular mass. Phorbol ester also induced an apparent increase in mass relative to NFATc3 from nonstimulated cells (lane 5), which was partially reversed by the addition of ionomycin (lane 7). Finally, the addition of FK506 to cells stimulated with PMA plus ionomycin resulted in a reversal of the ionomycin-dependent changes in NFATc3 mobility (lane 7 versus 8). Thus, NFATc3 is subject to modification by agents that increase intracellular calcium or activate protein kinase C. Furthermore, the calcium-dependent modifications are sensitive to inhibition by the immunosuppressant FK506.

DISCUSSION

The NFATc family of transcription factors was originally defined by their binding to ARREs in the IL-2 gene(4) . This activity could be demonstrated in both T and B lymphocytes(38) , and the diffuse nature of the band on native gels suggested that the complex might be heterogeneous. Purification of the proteins that bound to the IL-2 ARRE from calf thymus led to the realization that the cytosolic component of NFAT consisted of two proteins, NFATc1 and NFATc2, that are 70% identical within the 280 amino acid DNA binding region, designated the RSD. Since genes activated as a result of antigen receptor signaling in the thymus are potentially different than those activated in mature T lymphocytes, we initiated a search for NFAT-related cDNAs in a cDNA library prepared from thymus induced to undergo negative selection in vivo (i.e. programmed cell death). A related cDNA clone was identified, which was designated NFATc3 in accord with the genome mapping nomenclature system. NFATc3 sequences were not identified in the proteins purified from calf thymus using the IL-2 ARRE as an affinity reagent(25) , implying that it does not interact with the IL-2 ARRE at as high an affinity as NFATc1 and NFATc2.

The rel similarity domain of NFATc3 is 69% and 65% identical to that of NFATc1 and NFATc2, respectively. Comparison of the RSD of NFATc proteins (Fig. 2B) shows that the NH(2)-terminal portion is more highly conserved than the COOH-terminal portion, exhibiting 79-89% amino acid identity within a 175-amino acid region, which represents the minimal DNA binding domain(36) .^6 Within this region there are three stretches of 10-25 amino acids of near identity, separated by areas in which amino acid differences between NFATc proteins appear to be clustered. These subdomains of conserved and variable regions, therefore, likely reflect those regions that are involved in maintaining the structural integrity of the DNA binding domain and those regions that might be involved in giving rise to the observed differences in DNA binding specificity.

The identification of a third member of the NFATc family permits further definition of another unique region of protein sequence similarity, designated the SP repeat region, which spans approximately 110 amino acids and is composed of a consensus SP repeat motif repeated three times (Fig. 3C). The SP repeat motifs within this region are not only conserved in their spacing relative to each other, but also relative to the RSD, suggesting that it is the combination of repeated motifs rather than a single motif that may subserve a function. While the function of the SP repeat region remains unknown, the observations that each of the NFATc family proteins undergo a calcium-dependent reduction in relative molecular mass that is reversed by immunosuppressive agents that inhibit calcineurin suggest that this region may be the site of regulatory, proline-directed kinase/phosphatase activity. The presence of three SP repeat motifs within the SP repeat region suggests that a requirement for multiple phosphorylation/dephosphorylation events may be a hallmark of the calcium-regulated function of NFATc proteins. Such a requirement for multiple modifications could function to set a threshold for NFATc activation such that low basal levels of a regulatory activity, i.e. calcineurin, that might exist under conditions of variable basal intracellular calcium concentrations, would be insufficient to activate NFATc. Such a threshold mechanism for the activation of proteins that undergo multiple phosphorylations has been proposed for the ternary complex factor proteins Elk-1 and SAP-1, which interact with serum response factor to regulate transcription from serum response elements(39) . Alternatively, the multiplicity of SP repeat motifs within this region may be required for specific protein interactions.

Analysis of the DNA binding specificity of NFATc family members by gel mobility shift assay demonstrates distinct differences in the binding specificity of the three NFATc proteins for different ``NFAT'' sites or antigen receptor response elements in T cell activation genes. While the observed differences in DNA binding specificity may reflect differences in the affinity of binding of each of the NFATc family members with a specific DNA site, it remains possible that the observed differences in DNA binding specificity may reflect differences in the specificity of interaction with other DNA-binding proteins that form the NFAT gel shift complex, i.e. different AP1-related proteins that may constitute the nuclear NFAT component. Our present data indicate that NFATc3 may not make a substantial contribution to the NFAT DNA binding complex at the IL-2 ARRE in extracts of cells from the spleen, thymus, and lymph node. Hence, NFATc3 may bind to the regulatory regions of as yet unidentified genes in response to T cell antigen receptor signaling. Given the prominent affects of the immunosuppresive agents FK506 and cyclosporin A in T cell development, such genes may play a central role in determining developmental pathways in the thymus.

The changes in the relative molecular mass of NFATc3 upon stimulation with agents that either increase intracellular calcium concentration or activate protein kinase C indicates that NFATc3, like NFATc1(25) , is the target of two distinct signaling pathways. The reversal by FK506 of changes induced by increasing intracellular calcium suggests that NFATc3 may be directly or indirectly regulated the calcium/calmodulin-dependent phosphatase calcineurin, as it is calcineurin that is the target of the complex between FK506 and FKBP12(40) . The calcium-dependent decrease in the apparent relative mass of NFATc3 is consistent with a dephosphorylation event, possibly mediated by calcineurin (11) or by a calcineurin-regulated phosphatase such as phosphatase 1(41) . The site of this phosphorylation/dephosphorylation is likely the SP repeat region, as this is the only region of similarity among NFATc proteins other than the DNA binding domain.

The Nfatc3 gene has been mapped by somatic hybrid cell lines and fluorescence in situ hybridization to mouse chromosome 8 band D within a region of conserved synteny with the long arm of human chromosome 16. We have previously mapped Nfatc1 to mouse chromosome 18 and Nfatc2 to mouse chromosome 2 into regions of known homology with human chromosomes 18 and 20, respectively(29) . These results indicate that the genes encoding the NFATc family are not clustered in the human genome. Nfatc3 maps in the vicinity of a mutant locus called Nan (neonatal anemia), which is characterized by lethality at day 10-11 gestation in homozygous embryos due to lack of hematopoiesis. As described above, although NFATc3 appears to be expressed predominantly in lymphoid tissues, a more detailed analysis of NFATc3 expression in hematopoietic tissues has not been performed. Thus, a role for NFATc3 in hematopoiesis and in the development of the Nan phenotype remains a tenable hypothesis.

The finding that NFATc3 is expressed at high levels in the thymus and is capable of activating transcription, yet does not appear to bind significantly to NFAT-dependent ARREs, suggests that it may play a role in regulating the transcription of genes with ARREs distinct from those that have been identified. The hypothesis that such genes regulated by NFATc3 are involved in T cell development in the thymus is supported by the finding that endogenous thymic NFATc3 undergoes post-translational modifications in response to the same intracellular signals that regulate developmentally important events in thymocyte maturation. Definition of the physiologically relevant binding sequence for NFATc3 and thymus-specific nuclear partners of NFATc3 will be essential to understand its role in the complex pathways directing lymphocyte development.

FOOTNOTES

*
This work was supported in part by National Institutes of Health Grants CA39612 (to G. R. C.) and HG00298 (to U. F.) and by the Howard Hughes Medical Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank[GenBank].

§
Recipient of a Walter V. and Idun Y. Berry Postdoctoral Fellowship.

To whom correspondence should be addressed: Beckman Center for Molecular and Genetic Medicine-B211, Stanford University Medical School, Stanford, CA 94305. Tel.: 415-723-8391; Fax: 415-725-5687; hf.grc{at}forysthe.stanford.edu.

(^1)
The abbreviations used are: IL, interleukin; NFAT, nuclear factor of activated T cells; NFATc, cytosolic component of NFAT; PMA, phorbol 12-myristate 13-acetate; TCR, T cell antigen receptor; ARRE, antigen receptor response element; GM-CSF, granulocyte-macrophage colony-stimulating factor; TNF, tumor necrosis factor; PCR, polymerase chain reaction; bp, base pair(s); PIPES, 1,4-piperazinediethanesulfonic acid; RSD, rel similarity domain(s).

(^2)
To facilitate study of these proteins, we have employed a system of nomenclature proposed by the Human Gene Nomenclature Committee (see footnote, (29) ) in which the family of NFATc- or NFATp-related transcription factor genes is designated NFATC (as known family members are cytosolic as originally described and to maintain the distinction between the separate components of the NFAT complex; (6) ), and each member of this family is numbered sequentially. Thus, NFATC1 and NFATC2 are used to indicate the NFATc and NFATp genes, respectively (Nfatc1 and Nfatc2 refer to the murine genes). Here we refer to the NFATC-encoded RNA/cDNA or protein as NFATc.

(^3)
L. A. Timmerman and G. R. Crabtree, unpublished data.

(^4)
S. N. Ho, D. J. Thomas, and G. R. Crabtree, unpublished results.

(^5)
L. Timmerman, manuscript in preparation.

(^6)
S. N. Ho, unpublished data.

ACKNOWLEDGEMENTS

We thank B. Osborne for providing the murine thymus cDNA library, J. Bock for help in generating the NFATc3 antisera, C. Kuo for help in making the NFATc2 antibody, and D. Spencer for helpful discussions.

REFERENCES

  1. Ashton-Rickardt, P. G., and Tonegawa, S. (1994) Immunol. Today. 15,362-366 [CrossRef][Medline] [Order article via Infotrieve]
  2. Turka, L. A., Schatz, D. G., Oettinger, M. A., Chun, J. J., Gorka, C., Lee, K., McCormack, W. T., and Thompson, C. B. (1991) Science 253,778-781 [Abstract/Free Full Text]
  3. Yamashita, I., Nagata, T., Tada, T., and Nakayama, T. (1993) Int. Immunol. 5,1139-1150 [Abstract/Free Full Text]
  4. Durand, D. B., Shaw, J. P., Bush, M. R., Replogle, R. E., Belagaje, R., and Crabtree, G. R. (1988) Mol. Cell. Biol. 8,1715-1724 [Abstract/Free Full Text]
  5. Shaw, J. P., Utz, P. J., Durand, D. B., Toole, J. J., Emmel, E. A., and Crabtree, G. R. (1988) Science 241,202-205 [Abstract/Free Full Text]
  6. Flanagan, W. M., Corthesy, B., Bram, R. J., and Crabtree, G. R. (1991) Nature 352,803-807 [CrossRef][Medline] [Order article via Infotrieve]
  7. Emmel, E. A., Verweij, C. L., Durand, D. B., Higgins, K. M., Lacy, E., and Crabtree, G. R. (1989) Science 246,1617-1620 [Abstract/Free Full Text]
  8. Clipstone, N. A., and Crabtree, G. R. (1992) Nature 357,695-697 [CrossRef][Medline] [Order article via Infotrieve]
  9. O'Keefe, S. J., Tamura, J., Kincaid, R. L., Tocci, M. J., and O'Neill, E. A. (1992) Nature 357,692-694 [CrossRef][Medline] [Order article via Infotrieve]
  10. Northrop, J. P., Ullman, K. S., and Crabtree, G. R. (1993) J. Biol. Chem. 268,2917-2923 [Abstract/Free Full Text]
  11. Jain, J., McCaffrey, P. G., Miner, Z., Kerppola, T. K., Lambert, J. N., Verdine, G. L., Curran, T., and Rao, A. (1993) Nature 365,352-355 [CrossRef][Medline] [Order article via Infotrieve]
  12. Cockerill, P. N., Shannon, M. F., Bert, A. G., Ryan, G. R., and Vadas, M. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,2466-2470 [Abstract/Free Full Text]
  13. Szabo, S. J., Gold, J. S., Murphy, T. L., and Murphy, K. M. (1993) Mol. Cell. Biol. 13,4793-4805 [Abstract/Free Full Text]
  14. Matsuda, I., Masuda, E. S., Tsuboi, A., Behnam, S., Arai, N., and Arai, K. (1994) Biochem. Biophys. Res. Commun. 199,439-446 [CrossRef][Medline] [Order article via Infotrieve]
  15. Rooney, J. W., Hodge, M. R., McCaffrey, P. G., Rao, A., and Glimcher, L. H. (1994) EMBO J. 13,625-633 [Medline] [Order article via Infotrieve]
  16. Goldfeld, A. E., McCaffrey, P. G., Strominger, J. L., and Rao, A. (1993) J. Exp. Med 178,1365-1379 [Abstract/Free Full Text]
  17. Fuleihan, R., Ramesh, N., Horner, A., Ahern, D., Belshaw, P. J., Alberg, D. G., Stamenkovic, I., Harmon, W., and Geha, R. S. (1994) J. Clin. Invest. 93,1315-1320
  18. Tsitsikov, E. N., Ramesh, N., and Geha, R. S. (1994) Mol. Immunol. 31,895-900 [CrossRef][Medline] [Order article via Infotrieve]
  19. Haddad, P., Wargnier, A., Bourge, J. F., Sasportes, M., and Paul, P. (1993) Eur. J. Immunol. 23,625-629 [Medline] [Order article via Infotrieve]
  20. Riegel, J. S., Richie, E. R., and Allison, J. P. (1990) J. Immunol. 144,3611-3618 [Abstract]
  21. Chen, D., and Rothenberg, E. V. (1993) Mol. Cell. Biol. 13,228-237 [Abstract/Free Full Text]
  22. Jenkins, M. K., Schwartz, R. H., and Pardoll, D. M. (1988) Science 241,1655-1658 [Abstract/Free Full Text]
  23. Gao, E. K., Lo, D., Cheney, R., Kanagawa, O., and Sprent, J. (1988) Nature 336,176-179 [CrossRef][Medline] [Order article via Infotrieve]
  24. McCaffrey, P. G., Luo, C., Kerppola, T. K., Jain, J., Badalian, T. M., Ho, A. M., Burgeon, E., Lane, W. S., Lambert, J. N., and Curran, T. (1993) Science 262,750-754 [Abstract/Free Full Text]
  25. Northrop, J. P., Ho, S. N., Chen, L., Thomas, D. J., Timmerman, L. A., Nolan, G. P., Admon, A., and Crabtree, G. R. (1994) Nature 369,497-502 [CrossRef][Medline] [Order article via Infotrieve]
  26. Liu, Z. G., Smith, S. W., McLaughlin, K. A., Schwartz, L. M., and Osborne, B. A. (1994) Nature 367,281-284 [CrossRef][Medline] [Order article via Infotrieve]
  27. Schowalter, D. B., and Sommer, S. S. (1989) Anal. Biochem. 177,90-94 [CrossRef][Medline] [Order article via Infotrieve]
  28. Takebe, Y., Seiki, M., Fujisawa, J., Hoy, P., Yokota, K., Arai, K., Yoshida, M., and Arai, N. (1988) Mol. Cell. Biol. 8,466-472 [Abstract/Free Full Text]
  29. Li, X., Ho, S. N., Luna, J., Giacalone, J., Thomas, D. J., Timmerman, L. A., Crabtree, G. R., and Francke, U. (1995) Cytogenet. Cell. Genet. 68,185-191 [Medline] [Order article via Infotrieve]
  30. Milatovich, A., Travis, A., Grosschedl, R., and Francke, U. (1991) Genomics 11,1040-1048 [CrossRef][Medline] [Order article via Infotrieve]
  31. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18,5294-5299 [CrossRef][Medline] [Order article via Infotrieve]
  32. Berger, J., Hauber, J., Hauber, R., Geiger, R., and Cullen, B. R. (1988) Gene (Amst.) 66,1-10 [CrossRef][Medline] [Order article via Infotrieve]
  33. Cullen, B. R., and Malim, M. H. (1992) Methods Enzymol. 216,362-368 [Medline] [Order article via Infotrieve]
  34. Fiering, S., Northrop, J. P., Nolan, G. P., Mattila, P. S., Crabtree, G. R., and Herzenberg, L. A. (1990) Genes & Dev. 4,1823-1834
  35. Todd, M. D., Grusby, M. J., Lederer, J. A., Lacy, E., Lichtman, A. H., and Glimcher, L. H. (1993) J. Exp. Med 177,1663-1674 [Abstract/Free Full Text]
  36. Jain, J., Burgeon, E., Badalian, T. M., Hogan, P. G., and Rao, A. (1995) J. Biol. Chem. 270,4138-4145 [Abstract/Free Full Text]
  37. Bose, H. R., Jr. (1992) Biochim. Biophys. Acta 1114,1-17 [Medline] [Order article via Infotrieve]
  38. Verweij, C. L., Guidos, C., and Crabtree, G. R. (1990) J. Biol Chem. 265,15788-15795 [Abstract/Free Full Text]
  39. Treisman, R. (1994) Curr. Opin. Genet. Dev. 4,96-101 [CrossRef][Medline] [Order article via Infotrieve]
  40. Liu, J., Farmer, J. D., Jr., Lane, W. S., Friedman, J., Weissman, I., and Schreiber, S. L. (1991) Cell 66,807-815 [CrossRef][Medline] [Order article via Infotrieve]
  41. Mulkey, R. M., Endo, S., Shenolikar, S., and Malenka, R. C. (1994) Nature 369,486-488 [CrossRef][Medline] [Order article via Infotrieve]
  42. Nesbitt, M. N., and Francke, U. (1973) Chromosoma (Berl.) 41,145-158 [CrossRef][Medline] [Order article via Infotrieve]
  43. Lyon, M. F., and Kirby, M. C. (1994) Mouse Genome 91,21-60
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 J. Neurosci.Home page
J. I. Luoma and L. Zirpel
Deafferentation-Induced Activation of NFAT (Nuclear Factor of Activated T-Cells) in Cochlear Nucleus Neurons during a Developmental Critical Period: A Role for NFATc4-Dependent Apoptosis in the CNS
J. Neurosci., March 19, 2008; 28(12): 3159 - 3169.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
A. H.-M. Tan, S. Y.-P. Goh, S.-C. Wong, and K.-P. Lam
T Helper Cell-specific Regulation of Inducible Costimulator Expression via Distinct Mechanisms Mediated by T-bet and GATA-3
J. Biol. Chem., January 4, 2008; 283(1): 128 - 136.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
O. Kaminuma, F. Kitamura, N. Kitamura, T. Hiroi, H. Miyoshi, A. Miyawaki, and S. Miyatake
Differential Contribution of NFATc2 and NFATc1 to TNF-{alpha} Gene Expression in T Cells
J. Immunol., January 1, 2008; 180(1): 319 - 326.
[Abstract] [Full Text] [PDF]

Home page
 J. Cell Sci.Home page
A. Vega, P. Chacon, J. Monteseirin, R. El Bekay, G. Alba, J. Martin-Nieto, and F. Sobrino
Expression of the transcription factor NFAT2 in human neutrophils: IgE-dependent, Ca2+- and calcineurin-mediated NFAT2 activation
J. Cell Sci., July 15, 2007; 120(14): 2328 - 2337.
[Abstract] [Full Text] [PDF]

Home page
 Am. J. Physiol. Cell Physiol.Home page
C. M. Alfieri, H. J. Evans-Anderson, and K. E. Yutzey
Developmental regulation of the mouse IGF-I exon 1 promoter region by calcineurin activation of NFAT in skeletal muscle
Am J Physiol Cell Physiol, May 1, 2007; 292(5): C1887 - C1894.
[Abstract] [Full Text] [PDF]

Home page
 J. Immunol.Home page
Z.-Y. Wang, S. Kusam, V. Munugalavadla, R. Kapur, R. R. Brutkiewicz, and A. L. Dent
Regulation of Th2 Cytokine Expression in NKT Cells: Unconventional Use of Stat6, GATA-3, and NFAT2
J. Immunol., January 15, 2006; 176(2): 880 - 888.
[Abstract] [Full Text] [PDF]

Home page
 BloodHome page
S. Z. Glud, A. B. Sorensen, M. Andrulis, B. Wang, E. Kondo, R. Jessen, L. Krenacs, E. Stelkovics, M. Wabl, E. Serfling, et al.
A tumor-suppressor function for NFATc3 in T-cell lymphomagenesis by murine leukemia virus
Blood, November 15, 2005; 106(10): 3546 - 3552.
[Abstract] [Full Text] [PDF]

Home page
 J. Exp. Med.Home page
M. Asagiri, K. Sato, T. Usami, S. Ochi, H. Nishina, H. Yoshida, I. Morita, E. F. Wagner, T. W. Mak, E. Serfling, et al.
Autoamplification of NFATc1 expression determines its essential role in bone homeostasis
J. Exp. Med., November 7, 2005; 202(9): 1261 - 1269.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.Home page
L. V. G. Bosc, J. J. Layne, M. T. Nelson, and D. C. Hill-Eubanks
Nuclear Factor of Activated T Cells and Serum Response Factor Cooperatively Regulate the Activity of an {alpha}-Actin Intronic Enhancer
J. Biol. Chem., July 15, 2005; 280(28): 26113 - 26120.
[Abstract] [Full Text] [PDF]

Home page
 J. Biol. Chem.