|
|
|
|||||||
|
|||||||||
(Received for publication, May 4, 1995; and in revised form, June 15, 1995) From the
Cis-acting regions in the 5`-flank of the mouse interleukin 5
(IL-5) gene involved in the specific and inducible regulation of IL-5
transcription in an untransformed mouse T cell clone, D10.G4.1, have
been identified. Transient transfection assays with a series of
deletion IL-5 promoter reporter constructs indicate that multiple
regulatory elements in the 5`-flanking region of the IL-5 promoter play
a role in regulating IL-5 transcription in Th2 cells. Negatively acting
elements, NRE I and NRE II, map to the regions between positions
-431 and -392 and positions -300 and -261. A
positive regulatory element has been mapped to the region between
positions -224 and -81. The activity of these elements is
dependent on activation of the cells. A 40-bp sequence within this
region, termed the IL-5 PRE, has been shown to bind at least two
specific nuclear protein complexes from unstimulated and stimulated
D10.G4.1 cells. An additional protein complex specific for this site
has been identified in nuclear fractions from cells stimulated in the
presence of the protein synthesis inhibitor, cycloheximide. Proteins
that bind to these elements are likely to be important inducible and
specific factors essential for control of IL-5 transcription in
response to T cell receptor-mediated signaling events.
Interleukin 5 is a growth factor produced primarily by mature T
helper 2 lymphocytes. IL-5 ( One mechanism by
which coordinate differential expression of cytokine genes in T cells
is accomplished in vivo may involve differences in DNA
sequence elements in the promoters of these genes (7, 8) . Another mechanism may involve alternative T
cell activation pathways that can differentially regulate transcription
factors that bind to the promoters of cytokine genes in Th
cells(9, 10) . Alternatively, differential cytokine
gene expression in T cell clones may be related to the generation of
specific transacting regulatory factors by distinct subsets of
cells(11) . The factors that confer specific transcriptional
control of the IL-5 gene in untransformed T cells stimulated in an
antigen-specific manner have not yet been identified. Most of the
reported studies of cytokine gene regulation have involved cytokines
other than IL-5 in transformed T cell lines or T cells stimulated by
mitogens, ionophores, or
cytokines(2, 3, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24) . In this report, we present an analysis of the mouse IL-5 promoter in
the mouse Th2 cell line, D10.G4.1, and identify critical sequences in
the proximal promoter that mediate the IL-5 transcriptional response of
Th2 cells to TCR-mediated stimulatory signals. This investigation
extends the results reported by Bohjanen et al.(13) in which the differential expression of IL-4 and IL-5
mRNA by T cells after stimulation with anti-CD3 mAbs was compared. The
transcriptional activity of the IL-5 gene promoter in transiently
transfected D10.G4.1 cells was analyzed to look for IL-5 promoter
regions that may contribute to the differential transcriptional control
of IL-5 expression. The results of these studies indicate that the
control of IL-5 promoter expression in response to TCR stimulation can
be mapped to at least three newly identified regulatory elements in the
5`-flanking region of the IL-5 gene, and these regions can function as
either positive or negative regulatory elements. In addition, at least
one of the protein complexes that interacts with a newly identified
positive regulatory element in the IL-5 promoter contains a nascent
protein.
Figure 1:
Differential induction of
stimulation-dependent cytokine gene expression in Th2 cells in the
presence of CsA or protein synthesis inhibitors. Northern blot analysis
of total RNA isolated from unstimulated D10.G4.1 cells or cells
stimulated 4 h with 100 µg/ml conalbumin and
Figure 2:
Chimeric IL-5 promoter-luciferase reporter
gene plasmids constructed for transient transfection assays. The mouse
IL-5 gene corresponding to positions -546 to +39 relative to
the transcription initiation site was cloned by PCR and inserted
upstream of the luciferase reporter gene in plasmid pGL2basic in the 5`
to 3` orientation. A series of constructs in which the 5`-end of the
IL-5 sequence was deleted between positions -431 and -40
while maintaining the same 3`-end at position +39 were cloned from
this construct as described under ``Materials and Methods.''
The relative positions of the PRE and CLE 0 regions and the TATA box
are noted.
The
pGL2control vector (Promega Corp.) was used as a positive control in
each of the transfection experiments. The pGL2basic vector (Promega
Corp.) was used as a negative control for background levels of
luciferase activity in each transfection experiment. The luciferase
activity of each transfected construct was compared with that of the
pGL2control plasmid to obtain the relative luciferase activity for each
construct expressed as a percentage of the positive control in each
independent transfection experiment. The histograms and errorbars in Fig. 3represent the means and
standard error of the means for n independent experiments with
each construct, where n is the number in the center of each bar.
Figure 3:
Transient transfection assay to measure
IL-5 promoter activity in Th2 cells. Each IL-5 luciferase reporter gene
construct was transiently transfected into D10.G4.1 cells by
electroporation and cultured with or without antigen stimulation as
described under ``Materials and Methods.'' The luciferase
reporter gene activity was measured in the cell lysates as described.
The results are presented as the mean ± S.E. luciferase activity
relative to the pGL2control vector activity expressed by transfected
D10.G4.1 cells. The number in each plasmid construct name corresponds
to the position in the IL-5 5`-flanking region at which each clone is
truncated. The number in the center of each histogrambar represents the number of independent
transfection experiments with each
construct.
Because these cytokines appear to be produced coordinately
after stimulation through an antigen-specific T cell receptor pathway,
the patterns of expression of these genes in the presence of CsA, an
inhibitor of NF-AT-mediated transcription in T cells(39) , and
the protein synthesis inhibitors CHX and anisomycin were compared. CsA
completely inhibited the expression of IL-4, IL-3, and GM-CSF mRNA
induced by conalbumin antigen and accessory cells, but it only
marginally inhibited the expression of IL-5 mRNA (lane3). In contrast, although the protein synthesis
inhibitors CHX and anisomycin completely inhibited antigen-induced IL-5
gene expression, they did not inhibit the expression of IL-4, IL-3, or
GM-CSF mRNA in these cells (lanes4 and 5).
Like the expression of the IL-5 gene, the induction of IL-10 mRNA in
response to antigen-specific stimulation was only marginally inhibited
by CsA (lane3). Unlike the induction of IL-5 mRNA,
however, the expression of IL-10 mRNA was not affected by the protein
synthesis inhibitors (lanes4 and 5).
To determine the minimal IL-5
promoter fragment that could direct expression of a reporter gene,
approximately 550 bp of the immediate upstream region of the mouse IL-5
gene (34) was cloned into the pGL2basic luciferase plasmid, and
a series of 5` to 3` deletion mutants was generated (Fig. 2).
All deletion constructs had identical 3`-ends that included the IL-5
sequence through +39 bp relative to the natural transcription
initiation site at +1. The activity of these mouse
promoter-luciferase chimeric constructs containing varying lengths of
the IL-5 gene promoter in unstimulated cells (openbars) and in cells stimulated by specific antigen and APC (shadedbars) was assayed following transient
transfection by electroporation as shown in Fig. 3. D10.G4.1
cells transfected with the pGL2basic plasmid containing only the
luciferase gene coding region and no regulatory sequences expressed
consistently low levels of luciferase activity with or without antigen
stimulation. The relative levels of luciferase activity detected with
each chimeric IL-5 promoter construct were dependent on the length of
the promoter sequences included in each of the constructs. In addition,
the expression of these chimeric constructs was dependent on antigenic
stimulation of the transfected cells. Unstimulated transfected cells
expressed uniformly lower levels of luciferase activity compared with
transfected cells stimulated with Ag and APC.
Figure 4:
Effect of mutation of the CLE 0 region on
the IL-5 promoter activity. The CLE 0 site was replaced by 14 randomly
altered bases in each of the two reporter constructs, Mu-261 and
Mu-224, to produce CLE 0 mutant Mu-261 and CLE 0 mutant Mu-224 as
described under ``Materials and Methods.'' Each of the wild
type and mutant constructs was transiently transfected into D10.G4.1
cells by electroporation, followed by antigen stimulation and assay as
described above. The results are presented as the mean ± S.E.
promoter activity of each mutant construct relative to the activity of
the wild type construct (defined as 100%) in either 4 or 8 independent
transfection experiments as indicated by the number in the center of each histogrambar.
The CLE 0 region in the mouse
GM-CSF gene has been shown previously to be recognized by two factors,
NF-CLE0a and NF-CLE0b, in the transformed human T cell line,
Jurkat(25) . These two factors have also been shown to be
capable of interacting with the CLE 0 element of the mouse IL-5 and
IL-4 genes. To investigate the role of similar factors present in
D10.G4.1 T cells, which bind to the CLE 0 element of the IL-5 gene
promoter, an oligonucleotide that contained sequences spanning the
mouse IL-5 CLE 0 region was used in EMSAs with D10.G4.1 nuclear
extracts. At least three major complexes were formed with the CLE 0
site probe and the D10.G4.1 nuclear extracts as shown in Fig. 5.
No differences were seen in the pattern of complexes that formed with
nuclear extracts from unstimulated or anti-CD3-stimulated D10.G4.1
cells (lanes1, 4, and 7). In
addition, the same relative pattern of complexes was detected in
extracts prepared from cells stimulated by either Ag and APC or
plate-bound anti-CD3 mAb (lanes4 and 7),
although the second protein-complex band migrated slightly slower in
the lanes containing Ag and APC-stimulated nuclear extracts.
The minor retardation of this complex may be attributable to
cross-reactive proteins contributed by the antigen-presenting cells
present in the stimulated cell preparation. The mobility of this
complex is unchanged in the anti-CD3-stimulated extracts compared with
the unstimulated cell extracts, which indicates that the retardation of
this complex is not a function of the activation state of the cells.
The inclusion of the inhibitor CsA or CHX during the stimulation period
did not change the number or pattern of specific complexes detected
with this probe (lanes10 and 13). The
specificity of each of these protein-DNA interactions was confirmed in
binding reactions where an excess of unlabeled specific competitor DNA
was added to the reactions. The detection of all three specific CLE 0
complexes in the D10.G4.1 reactions was inhibited by unlabeled CLE0
probe (lanes2, 5, 8, 11,
and 14) but not by the same amount of an unrelated IL-5
sequence-containing probe (lanes3, 6, 9, 12, and 15). The inhibition by a specific
competitor oligonucleotide was concentration-dependent (data not
shown). Despite sharing some homology to NF-kB, AP-1, and Sp-1 binding
sites, oligonucleotides containing consensus binding sites for each of
these transcription factors failed to inhibit the specific binding of
the three complexes to the CLE 0 region (data not shown). Thus, none of
the three complexes represents a known member of these families of
molecules. No CLE 0-specific complexes were formed with 3T3 fibroblast
cell nuclear extracts (data not shown).
Figure 5:
Electrophoretic mobility shift assay with
D10.G4.1 cell extracts and an oligonucleotide probe containing the CLE
0 binding site. Nuclear protein extracts were prepared from
unstimulated cells, cells stimulated with Ag + APC, cells
stimulated by plate-bound anti-CD3 mAbs, or cells stimulated in the
presence of either CsA or CHX as described under ``Materials and
Methods.'' Each binding reaction contained 5 µg of nuclear
protein and the labeled double-stranded CLE 0 oligonucleotide probe.
The protein-DNA complexes were resolved by PAGE on a nondenaturing 6%
acrylamide gel. Excess unlabeled specific or unrelated nonspecific
competitor oligonucleotide as noted was preincubated with the binding
reactions. The specific retarded labeled complexes are indicated by openarrowheads. Free probe is indicated by the closedarrowheads.
To investigate the positive
regulatory element of the IL-5 promoter, PRE, identified in the
transient transfection experiments described above, a series of
overlapping 30-bp oligonucleotide probes spanning the region between
positions -196 and -76 were used in EMSAs with D10.G4.1
nuclear proteins. The results of the EMSAs with five of these probes,
A-E, and three different D10.G4.1 nuclear fractions are shown in Fig. 6A. The relative positions of the oligonucleotide
probes are depicted in Fig. 6B. Nuclear fractions from
unstimulated D10.G4.1 cells (lanes1-5) and
cells stimulated by plate bound anti-CD3 mAb (lanes6-10) consistently produced the two distinct
retarded complexes marked with openarrowheads. These
complexes bound only to the oligonucleotide probes C and D (lanes3, 4, 8, and 9). Binding
reactions with overlapping probes A, B, and E (lanes1, 2, 5, 6, 7, and 10), which include sequences either upstream or downstream of
the sequences contained in probes C and D, did not result in complexes
with the same mobilities. Thus, the region to which these nuclear
proteins bind can be mapped to the sequences included only in probes C
and D, namely positions -166 to -127 in the IL-5 promoter. Lanes11-15 contain the results with the same
overlapping series of oligonucleotide probes and nuclear proteins from
D10.G4.1 cells that were stimulated in the presence of CHX. The pattern
of retarded bands is similar in that at least two distinct complexes
with mobilities similar to those noted previously are formed with
probes C and D. However, an additional complex marked with the asterisk, which bound only to probes C and D, is evident in lanes13 and 14. No complexes with similar
mobilities are evident binding to probes A, B, or E. The additional
complex was not formed with nuclear extracts from unstimulated cells
that were incubated in the presence of CHX (data not shown). Additional
30-bp overlapping oligonucleotides spanning 5`-sequences up to position
-196 and 3`-sequences down to position -77 did not result
in similar DNA-binding activities with any of the D10.G4.1 nuclear
fractions used (data not shown).
Figure 6:
A, electrophoretic mobility shift assay
with D10.G4.1 cell extracts and oligonucleotides probes spanning the
region between positions -186 and -117 in the IL-5
promoter. Nuclear protein extracts were prepared from unstimulated
cells and cells stimulated by plate bound anti-CD3 mAbs in the absence
or presence of CHX as described under ``Materials and
Methods.'' Each binding reaction contained 5 µg of nuclear
protein and one of the labeled probes A, B, C, D, or E as indicated.
The protein-DNA complexes were resolved by native PAGE as described
above. The specific retarded labeled complexes are indicated by openarrowheads. Free probe is indicated by the closedarrowhead. The novel complex unique to the
nuclear fractions prepared in the presence of CHX is marked with an asterisk. B, overlapping oligonucleotide probes used
in gel shift experiments. The mouse IL-5 genomic IL-5 sequence between
positions -196 and -96 relative to the transcription start
site is represented as a solidline with the relative
location and positions of the overlapping double stranded
oligonucleotides designated by boxes labeled ProbeA-E. The relative position of the IL-5 PRE defined
by the gel shift analysis is indicated by the dashedline.
The specificity of each of these
protein-DNA complexes unique to the binding sites included in probes C
and D was tested by competition EMSAs (Fig. 7). The same
protein-DNA complexes seen previously are detected in binding reactions
with nuclear fractions from unstimulated D10.G4.1 cells (lanes1-6), stimulated D10.G4.1 cells (lanes7-12), and cells stimulated in the presence of CHX (lanes13-18) with labeled probes C (lanes1-3, 7-9, and 13-15)
and D (lanes4-6, 10-12, and 16-18). The formation of each of these complexes was
specifically inhibited by excess of the cognate oligonucleotide but was
not inhibited by excess of an unrelated oligonucleotide of the same
size. No binding activity with any of these oligonucleotide probes was
detected in nuclear fractions from mouse 3T3 fibroblasts (data not
shown).
Figure 7:
Competition electrophoretic mobility shift
assay with D10.G4.1 cell extracts and labeled oligonucleotide probes C
and D as indicated in Fig. 6B. Nuclear protein extracts
and binding reactions were as described in Fig. 6A.
Excess unlabeled competitor oligonucleotides included in each binding
reaction were as indicated. Specific complexes are as indicated in Fig. 6A.
Most functional studies on the mechanism of regulation of
cytokine gene transcription have been undertaken with transformed T
cell lines. An advantage to using transformed cells is the relative
ease with which these cells can be grown and transfected with plasmid
reporter gene constructs for functional activity measurements. A
significant disadvantage to using transformed cells to study normal T
cell biology is the consequence of the transformation event, which may
alter the phenotype of the cell and may also alter the normal patterns
of responses to signaling within the cell. Several examples of
conflicting cytokine expression profiles induced in response to a
variety of stimuli in primary lymphocytes, transformed T cell clones,
or untransformed T cell clones have been reported, which suggests that
differences in the mechanisms of cytokine gene induction in these types
of cells may
exist(2, 13, 19, 22, 23, 41, 42) .
For this reason, the current investigation of the mechanism of IL-5
gene transcription was undertaken using an antigen-specific mouse cell
line that expresses inducible cytokine profiles characteristic of mouse
Th2 cells in response to specific stimulatory and costimulatory signals
mediated through the TCR. Importantly, TCR stimulation closely mimics
physiologic signal transduction (43, 44) and may
provide a more accurate representation of what occurs in vivo. The D10.G4.1 T cell clone used in this study has a distinct Th2
phenotype(11, 45) . Although coordinate induction of
the Th2 cytokines was observed, three different patterns could be
distinguished for the different gene transcripts induced in cells
stimulated in the presence of the inhibitors CsA, CHX, and anisomycin.
The different patterns of cytokine mRNA transcribed in the presence of
these inhibitors demonstrate that more than one induction pathway may
be responsible for the apparently coordinate expression of these
cytokine genes. Protein synthesis is required only for the expression
of IL-5 mRNA and not the other cytokine gene transcripts induced in the
same cells. Thus, at least one protein critical for the induction of
IL-5 gene transcription but not for transcription of the IL-4, IL-10,
IL-3, or GM-CSF genes is newly synthesized in response to stimulation
of the Th2 cells by Ag and APC. Luciferase activity was readily
detectable in antigen-stimulated cells following transfection with the
mouse IL-5 promoter-luciferase chimeric constructs. The inducible
levels of luciferase activity detected following transient transfection
with the IL-5 reporter constructs indicate that the IL-5 promoter is
capable of driving TCR-mediated transcription of the reporter gene in
D10.G4.1 cells in a manner consistent with that of the endogenous IL-5
gene. Deletion analysis of the IL-5 promoter revealed several regions
of the IL-5 gene that appear to contain cis-acting elements required
for full activity of the IL-5 gene. The pattern of inducible expression
with these deletion constructs transfected into the D10.G4.1 cells
suggests that both negatively and positively acting regulatory elements
function in the control of the IL-5 promoter. The region between
positions -431 and -392, as well as that between positions
-300 and -261, include negative regulatory elements.
Conversely, the region between positions -224 and -81
contains a positive regulatory element. None of these putative
regulatory elements in the IL-5 promoter have been reported previously. Furthermore, the region between positions -58 and -40
corresponds to the previously identified CLE 0
element(25, 46) . The low levels of luciferase
activity that result after transfection of either of the Mu-58 or Mu-40
constructs indicate that the 14-bp CLE 0 region in combination with the
natural TATA and transcription initiation sites is not sufficient to
induce IL-5 transcription in antigen stimulated D10.G4.1 cells.
Additional functional cis-acting elements between positions -224
and -58 are critical for control of the IL-5 promoter. Further
evidence that the CLE 0 region is not essential for inducible IL-5
promoter activity is provided by the transfection experiments with the
CLE 0 mutant reporter constructs. These mutant CLE 0 constructs
displayed only 25-50% less inducible promoter activity compared
with the wild type constructs. Thus, the CLE 0 region appears to
contribute to the activity of the IL-5 promoter, but it is not
essential for promoter function. This finding is in contrast to the
essential role the CLE 0 region plays in the induction of GM-CSF
transcription in Jurkat cells stimulated with phorbol ester and calcium
ionophore(47) . This difference between IL-5 and GM-CSF
regulation may reflect alternative mechanisms of gene induction
specific to the mode of stimulation, the species, or the biology of
transformed and untransformed cells. Alternatively, it may reflect at
least one independent pathway of inducible expression between the IL-5
and GM-CSF gene promoters. The latter possibility is supported by the
differential inhibition of steady state GM-CSF and IL-5 mRNA levels in
D10.G4.1 cells following antigen stimulation in the presence of CsA or
CHX discussed above. Nuclear binding factors present in stimulated
and unstimulated Th2 cells and in cells stimulated in the absence of
protein synthesis were compared to examine the CLE 0 binding factors,
either constitutive or newly synthesized, that may contribute to the
regulation of IL-5 transcription. No difference in the number or
pattern of CLE 0-specific complexes was detected between unstimulated
and stimulated cells or between cells that had been stimulated in the
presence of either CsA or CHX. Thus, these protein complexes and the
CLE 0 element to which they bind do not appear to play a role in the
differential patterns of IL-5, IL-4, and GM-CSF message induced in
D10.G4.1 cells stimulated by antigen and APC in the presence of these
inhibitors. However, proteins that bind to this sequence were not
detected in nuclear extracts from mouse fibroblasts, which suggests
that the CLE 0-specific complexes may be restricted to T cells. This
pattern of CLE 0 site binding proteins detected by gel shift is in
contrast to the results of a similar investigation recently reported by
Naora et al.(48) . These researchers used a gel shift
analysis with extracts from D10.G4.1 cells treated with concanavalin A
or phorbol ester and the inhibitors CsA or CHX to show that the TCATTT
element in the mouse IL-5 gene, which is contained within the CLE 0
region previously defined, is recognized by a single nuclear protein
complex identified as NFIL5A. This discrepancy in CLE 0 site binding
complexes in D10.G4.1 cells may be attributable to the distinct
signaling events and the associated nuclear signals triggered by the
alternative activation methods used in these two studies. The
nonequivalence of these stimulations is evident from the differential
patterns of cytokine expression and inhibition that resulted from each
of them. Additionally, the slight variation in sequence in the
oligonucleotide probes used in the EMSAs may contribute to the
disparate results. The probe used in the current study included the
entire CLE 0 sequence previously defined to be functionally important
in the GM-CSF promoter(25, 47) , while the previous
study used a slightly shorter sequence, which did not include the
3`-end of the defined CLE 0 site(48) . It remains to be
determined whether these different CLE 0 site binding factors are
related and together contribute to a functional IL-5 transcription
factor complex made up of both constitutive and inducible protein
components. To define the sequences within the previously
unrecognized PRE of the IL-5 promoter that might function as
transcription factor binding sites, a series of overlapping
oligonucleotides that span the 120-bp PRE region identified in the
transient transfection experiments were used as probes in EMSAs.
Nuclear extracts from unstimulated and stimulated D10.G4.1 cells both
contained activities that bound specifically to only two of these
probes, which include the region between positions -166 and
-127 in the IL-5 promoter. The loss of specific binding
activities with overlapping probes that differ by only 10 bp either 5`
or 3` to this region makes it possible to localize the binding site
within the 40-bp region shared by these two probes, which we have
termed the IL-5 PRE. Inspection of the DNA sequence of this 40-bp
response element did not reveal significant homology with previously
characterized transcription factor binding sites, which may indicate
that this element is unique to the IL-5 gene. Additional evidence to
suggest a unique role for these binding activities in the control of
IL-5 transcription is provided by the pattern of specific protein
binding complexes from cells stimulated in the absence of protein
synthesis. The induction of IL-5 transcription can be differentiated
from the coordinate induction of other cytokines in the same cell by
the requirement for protein synthesis. The appearance of a unique
retarded complex binding to the 40-bp IL-5 PRE only in nuclear extracts
prepared from cells stimulated in the absence of protein synthesis
suggests that at least one of the protein complexes recognizing this
site interacts with a protein that is newly synthesized in response to
stimulation. This postulated nascent regulatory protein may normally
function to prevent binding of the complex to the PRE, which allows
IL-5 transcription to proceed. In the absence of protein synthesis, the
complex remains bound to the PRE, and IL-5 transcription is inhibited.
Further characterization of this novel regulatory complex and the
inducible and specific factors that interact with it to control IL-5
transcription is in progress. Analysis of the contribution of
elements that lie in the 5`-flanking region of the IL-5 gene by
transfection of nested deletions of reporter gene chimeric constructs
has provided valuable information on the location and influence of
proximal cis-acting regulatory elements. However, additional mechanisms
regulating gene expression may also play an important role. For
example, alterations in gene accessibility due to DNA methylation,
contributions of enhancer or suppressor sequences located 5` or 3` to
the promoter of the gene of interest, or motifs in the 3`-untranslated
region of the gene that have an effect on RNA stability or translation
have all been shown to affect gene expression (21, 49, 50, 51) . In addition, the
presence of specific binding activities in the nuclear fractions of
unstimulated cells does not necessarily rule out a role for these
proteins in transcription activation. Additional modifications, such as
phosphorylation or differences in binding affinity not detectable by
mobility shift assays, may be important. The contributions of these
regulatory mechanisms to the control of IL-5 gene transcription in Th2
cells have yet to be defined.
Volume 270,
Number 35,
Issue of September 01, pp. 20575-20582, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)mRNA and protein are
undetectable in resting T cells, but they are induced within a few
hours when Th2 cells are stimulated with antigen presented by the
appropriate APC or by antibody to the TCR
CD3 complex. Th2 cells
provide help to B cells in antibody production and coordinately express
the genes for IL-4, IL-5, IL-6, and IL-10 after antigen
receptor-mediated stimulation. The appearance of IL-5 mRNA in activated
Th2 cells reflects the induction of IL-5 gene transcription in response
to a specific signaling event(1, 2, 3) .
However, little is known about the intracellular events that lead to
the selective and transient cytokine expression in these cells. IL-5
produced by Th2 cells selectively induces the growth and
differentiation of eosinophils from bone marrow precursor cells.
Eosinophils are prominent in parasitic infections and in certain
allergic conditions (4) and may contribute to tissue damage in
the late phase inflammatory response to allergen. In addition, IL-5
secreted by activated T helper cells and the resulting eosinophil
infiltration of the bronchial mucosa play an important role in the
pathogenesis of asthma(5, 6) .
T Cell Clones
The murine Th2 T cell clone
D10.G4.1 (ATCC, Rockville, MD) is CD4,
CD8
, conalbumin-specific, and H-2
I-A
-restricted. D10.G4.1 cells were maintained in
Click's medium (Irvine Scientific, Santa Ana, CA) supplemented
with 10% heat-inactivated fetal calf serum, 10 mM HEPES, 2
mML-glutamine, 50 units/ml penicillin, 50 mg/ml
streptomycin, and 50 mM 2-mercaptoethanol. The cells were
stimulated every 7-14 days with 100 mg/ml conalbumin antigen
(Sigma) and irradiated (3000 rads) syngeneic AKR/J (Jackson
Laboratories, Bar Harbor, ME) spleen cells as accessory APC.
Concanavalin A-stimulated rat growth factor supernatant treated with
-methylmannoside (Collaborative Research Inc., Bedford, MA) was
added at a concentration of 5% to maintain the D10.G4.1 cells. Where
indicated, cells were pretreated for 10 min with 2 µg/ml
cyclosporin A (Sandoz, E. Hanover, NJ), 10 µg/ml CHX (Sigma), or 20
mM anisomycin (Sigma) prior to antigen stimulation. IL-5 was
undetectable by enzyme-linked immunosorbent assay (26) in the
supernatant from unstimulated D10.G4.1 cells, but cells stimulated by
conalbumin antigen and APC produced consistently detectable levels of
IL-5. No interferon- secretion was detectable by enzyme-linked
immunosorbent assay (Biosource, Camarillo, CA) in stimulated or
unstimulated D10.G4.1 cells (data not shown).
RNA Isolation and Northern Blot Analysis
For RNA
preparation, D10.G4.1 cells (1-2 10
cells/group) were treated for 4 h in 75-cm
plastic
tissue culture flasks with one of the treatments described in the
legend to Fig. 1. Total cellular RNA was isolated from each
group of cells in guanidinium isothiocyanate (RNAzol) (Biotecx Lab,
Inc., Houston, TX) according to the manufacturer's instructions.
5-7 µg of total RNA from each group was separated by
electrophoresis in 2.2 M formaldehyde, 1.4% agarose
gels(27) , blotted to Hybond N nylon filters (Amersham Corp.),
and UV-cross-linked to the membranes. cDNA fragments were P-labeled by nick translation (Amersham Corp.) or random
priming (Boehringer Mannheim) and hybridized to the RNA filters in 50%
formamide hybridization solution at 42 °C according to standard
methods(27) . The filters were washed twice at 65 °C in 0.2
SSC, 0.1% SDS. cDNA fragments used as probes were isolated from
plasmids received from the DNAX Research Institute (Palo Alto, CA) and
consisted of the following: mouse IL-5, 1.7-kb BamHI fragment
from pcDSR
-4G(28) ; mouse IL-4, 0.8-kb BamHI
fragment from pcDSR-2A-E3(29) ; mouse IL-10, 1.5-kb BamHI fragment from F115(30) ; mouse IL-3, 0.6-kb BamHI fragment from pcD69(31) ; mouse GM-CSF, 1-kb BamHI fragment from pcDE1-11(32) ; rat
-actin, 1.2-kb BglI fragment(33) . After washing,
the bound cDNA probes were visualized by autoradiography. To strip the
damp filters for reprobing, a boiling solution of 0.1% SDS was poured
on the filters and allowed to cool slowly to room temperature.
-irradiated
I-A
accessory cells with or without 10-min preincubation
with 2 µg/ml CsA, 10 µg/ml CHX, or 20 mM anisomycin
was performed as described under ``Materials and Methods.''
The blots were hybridized with P-labeled cDNA probes for
mouse IL-5, IL-4, IL-10, IL-3, GM-CSF, or rat
-actin as
indicated.
IL-5 Promoter Cloning and Plasmid Construction
The
DNA fragment extending from -546 to +39 relative to the
start site of transcription of the murine IL-5 gene (34) was
generated by PCR with D10.G4.1 genomic DNA as the template and two BglII-tailed oligonucleotides, IL5-5` and IL5-3`.
Oligonucleotide IL5-5` extends from -546 to -523, and
oligonucleotide IL5-3` extends from +39 to +16 relative
to the start site of transcription of the murine IL-5 promoter. The
sequence of the IL5-5` primer was
GGAGATCTTGTACCTCCCACATCTGCTGGTGT, and the IL5-3` primer was
GGAGATCTCTGAAGTCTTCAGCGCTGGCCTTC. Oligonucleotides were synthesized on
a MilliGen/Biosearch 8750 DNA synthesizer (MilliGen/Biosearch,
Burlington, MA) using -cyanoethyl phosphoramidite synthesis
protocols according to the manufacturer's instructions. The
resulting 584-bp PCR fragment was digested with BglII and
cloned into the BglII site of the pGL2basic reporter plasmid
(Promega Corp., Madison, WI) (35, 36) in the 5` to 3`
direction upstream of the luciferase gene. A series of nested deletion
constructs in which portions of the IL-5 promoter between positions
-546 and -246 upstream of the transcription start site were
deleted, as shown in Fig. 2, was generated from the original
reporter construct by exonuclease III digestion of linearized plasmid
DNA using the Erase-a-Base system (Promega Corp.). Additional deletion
constructs corresponding to specific regions of the IL-5 promoter
between positions -246 and -40 (Fig. 2) were
generated by PCR amplification using primer IL5-3` and one of the
following 5`-primers: IL5-224
(GGGAGCTCCATTCTTTTATGTTATAAGAAAATG), IL5-177
(GGGAGCTCGATGTTAACTATTATTAAAGAGCA), IL5-81
(GGGAGCTCAGGTGTCCTCTATCTGATTGTTAG), IL5-58
(GGGAGCTCGCAATTATTCATTTCCTCAGAGAG), or IL5-40
(GGGAGCTCAGAGAGAGAATAAATTGCTTGGGG). Each of the resulting PCR fragments
was digested with SacI and BglII and subcloned into
the SacI/BglII site of the pGL2basic reporter
plasmid. All constructions were verified by DNA
sequencing(27) . All constructs contain the IL-5 transcription
initiation site (34) but not the IL-5 translation initiation
codon to ensure that translation of the luciferase reporter gene must
initiate at the AUG of the luciferase mRNA.
Mutagenesis
The constructs CLE 0 mutant Mu-261 and
CLE 0 mutant Mu-224 in which the CLE 0 regions of the IL-5 promoter in
construct Mu-261 or Mu-224 were mutated to a random sequence were
generated by in vitro site-directed mutagenesis with the
Transformer Mutagenesis kit (Clontech, Palo Alto, CA) according to the
manufacturer's instructions. The mutagenic primer consisted of
the sequence GATTGTTAGCACGGCGGACGGGGAAGAAGAGAGAGAATAAATTGC and was
synthesized as described above. The randomly mutated sequence that
replaced the CLE 0 region is underlined. For selection of mutant
plasmids, the ScaI/MluI selection primer (Pharmacia
Biotech Inc.) was used to eliminate the unique ScaI site in
the pGL2basic vector portion of the wild type constructs. The mutant
constructs were verified by DNA sequencing(27) .Transfection Assays
T cell clones were transfected
using electroporation-mediated DNA transfer with the Gene Pulser
(Bio-Rad). 100 µg of double CsCl-gradient-purified plasmid DNA (27) was added to 2 10
cells in 400 µl
of RPMI 1640 medium supplemented with 2 mML-glutamine, 50 units/ml penicillin, and 50 µg/ml
streptomycin in a 0.4-cm gap cuvette and electroporated at 320 V, 960
microfarads with an average time constant of 23-27 s. Following
transfection, the cells were transferred into 6 ml of supplemented
medium, split equally to two 25-cm dishes, and cultured at 37 °C in
5% CO. After overnight culture, one dish of cells from each
group was stimulated with appropriate antigen and irradiated APC as
described above and cultured for an additional 18-20 h. The
remaining dish of cells from each group was left unstimulated during
this culture period. Following the culture period, cell lysates were
prepared, and luciferase activity was assayed in 20 µl of cell
extracts with a chemiluminescent substrate according to the
manufacturer's instructions (Promega Corp.). The luciferase
activity was measured as relative light units produced in 20 s using a
Berthold Lumat 9501 Luminometer (Wallac Inc., Gaithersburg, MD).
Preparation of Nuclear Extracts
Nuclear extracts
were isolated from unstimulated D10.G4.1 cells, cells stimulated by
appropriate antigen and APC, or cells stimulated by plate bound
anti-CD3 mAb (Pharmingen, San Diego, CA) in the presence or absence of
2 µg/ml CsA or 10 µg/ml CHX by a modification of the procedure
described by Schreiber et al.(37) . In brief,
1-5 10
cells, washed with cold Tris-buffered
saline, pH 7.9, were sedimented by centrifugation at 12,000 g for 1 min. The supernatant was discarded, and the pellet was
resuspended in 500 µl of cold hypotonic buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1
mM EGTA, 1 mM dithiothreitol, 0.5 mM Pefabloc SC (Boehringer Mannheim), 0.5 µg/ml leupeptin
(Boehringer Mannheim), 0.7 µg/ml pepstatin (Boehringer Mannheim)
and allowed to swell on ice for 15 min. Cells were lysed by the
addition of Nonidet P-40 to a final concentration of 0.5%. Nuclei were
collected by centrifugation, and nuclear proteins were extracted in 50
µl of salt buffer (20 mM HEPES, pH 7.9, 400 mM
NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM Pefabloc SC, 0.5 µg/ml
leupeptin, 0.7 µg/ml pepstatin). Nuclear debris was removed by
centrifugation, and the extracts were immediately stored at -70
°C. The protein content of the nuclear extracts was determined by
the method of Bradford(38) . Nuclear extracts from mouse 3T3
fibroblasts were purchased from Santa Cruz Biotechnology (Santa Cruz,
CA).
Electrophoretic Mobility Shift
Assays
Complementary oligonucleotide pairs corresponding to IL-5
5`-flank sequences with 5`-GGG overhanging ends were synthesized (Oligo
Therapeutics, Inc., Wilsonville, OR; Life Technologies, Inc.),
annealed, and radiolabeled with [-P]-dCTP
using the Klenow fragment of DNA polymerase. The sequences of the probe
pairs corresponded to the following regions of the mouse IL-5 promoter
(numbered relative to the transcription start site at +1): CLE0,
-59 to -36; A, -186 to -157; B, -176 to
-147; C, -166 to -137; D, -156 to -127;
E, -146 to -117. Labeled annealed oligonucleotides were
purified from 12% acrylamide gels following
electrophoresis(27) . Oligonucleotides containing the consensus
binding site for NF-kB, AP-1, and Sp-1 were purchased from Promega
Corp. The 10-µl EMSA binding reactions contained 5 µg of total
nuclear protein in 4% (v/v) glycerol, 1 mM MgCl
,
0.5 mM EDTA, 0.5 mM dithiothreitol, 50 mM NaCl, 10 mM TrisCl, pH 7.5, 0.5 µg/ml
poly(dI-dC) (Boehringer Mannheim). Reactions were incubated with
approximately 50,000 cpm of P-labeled duplex
oligonucleotide for 20 min at room temperature. Protein-DNA binding
specificity was tested by competition assays in which the binding
reactions were preincubated for 10 min at room temperature with excess
unlabeled specific or nonspecific competitor duplex oligonucleotides
prior to the addition of the labeled probe. Following binding, the
DNA-protein complexes were resolved by electrophoresis on nondenaturing
6% acrylamide gels at 250 V for 2 h at room temperature in 0.5
TBE buffer (1
TBE: 89 mM Tris, 89 mM boric
acid, and 2 mM EDTA). Gels were dried prior to
autoradiography.
Differential Regulation of Cytokine Gene
Expression
Steady state IL-5, IL-4, IL-10, IL-3, and GM-CSF mRNA
levels were measured in unstimulated D10.G4.1 cells or cells stimulated
with conalbumin antigen in the presence of I-A accessory
cells by Northern blot analysis (Fig. 1). Unstimulated cells did
not produce detectable levels of IL-5, IL-4, IL-3, or GM-CSF message (lane1). A low level of IL-10 mRNA was detected in
unstimulated cells (lane1), but the level of IL-10
message increased significantly following stimulation (lane2). In addition, stimulation induced readily detectable
levels of IL-5, IL-4, IL-3, and GM-CSF mRNA (lane2).
No message for interferon- or any other Th1-specific cytokine was
detected in these cells following either of these treatments (data not
shown).
Functional Analysis of the 5`-Flanking Region of the
Murine IL-5 Gene
To identify the cis elements within the
promoter that are functionally important for the regulation of IL-5
expression, a sequence homology analysis was performed using 546 bp
upstream of the murine IL-5 gene. Several sequences that completely or
partially matched the binding sites of previously characterized
transcription factors were identified by computer homology searches,
based on a compilation of vertebrate-encoded transcription factors (40) (data not shown). The importance of the various consensus
sequences in the regulation of IL-5 gene expression remains to be
determined. The functional significance of these sites cannot be
determined from their presence alone.Identification of Negatively and Positively Acting
Regulatory Regions
The maximal level of transient expression
following stimulation was seen with constructs that contained 224 bp of
5`-flank (construct Mu-224) (Fig. 3). Thus, the critical 5` IL-5
promoter regions necessary for inducible expression in D10.G4.1 cells
are located within 224 bp of the transcription initiation site. A
negative regulatory element, IL-5 NRE I, was detected between positions
-431 and -392. Deletion of this region consistently
resulted in a significant increase in inducible luciferase activity. A
second negative regulatory element, IL-5 NRE II, is apparently located
between positions -300 and -261, as evidenced by the gain
of luciferase activity with constructs in which this region had been
partially or completely deleted. In contrast, the regions between
positions -224 and -81 appears to include an important
positive regulatory element (PRE), since lower luciferase activity was
detected with constructs in which this region was deleted. Truncation
of the promoter to -58 bp (construct Mu-58), which includes the
CLE 0 region in addition to TATA, markedly diminished both inducible
and uninducible luciferase expression in the transfectants. Further
truncation of the IL-5 promoter to position -40 (construct
Mu-40), which removes the CLE 0 region and includes only the TATA
region, reduced the levels of inducible and uninducible expression to
those seen with the promoterless vector alone.Mutation of the CLE 0 Binding Site Does Not Prevent IL-5
Promoter Activity
To investigate the role of the CLE 0 region in
the context of maximal inducible IL-5 promoter expression, the activity
of two mutant CLE 0 constructs was measured in transient transfection
experiments in D10.G4.1 cells. Multiple site-directed mutations that
disrupted the entire CLE 0 region were introduced into constructs
Mu-261 and Mu-224, constructs that each exhibit high promoter activity (Fig. 3). Disruption of this site reduced promoter activity of
each mutant construct by only 25-50% compared with the wild type
constructs (Fig. 4).
Characterization of Sequence-specific Protein-DNA
Interactions
To identify putative transcription factors that
bind to regions of the mouse IL-5 promoter identified as functionally
important in the transfection experiments, EMSAs were performed using
labeled oligonucleotide probes spanning these regions and nuclear
protein extracts from unstimulated D10.G4.1 cells and D10.G4.1 cells
stimulated in the presence or absence of the inhibitors CsA and CHX.
Two regions, CLE 0 and IL-5 PRE, were chosen as initial candidates for
binding sites within the IL-5 promoter, which might interact with
specific proteins and might play a role in the specific and inducible
regulation of IL-5 transcription.
)
We thank the investigators at the DNAX Research
Institute for the gift of mouse cytokine cDNA clones. Carol Battle
kindly provided assistance with the manuscript.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  P. H. Stern The Calcineurin-NFAT Pathway and Bone: Intriguing New Findings Mol. Interv., August 1, 2006; 6(4): 193 - 196. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Wang, M. F. Shannon, and I. G. Young A role for Ets1, synergizing with AP-1 and GATA-3 in the regulation of IL-5 transcription in mouse Th2 lymphocytes Int. Immunol., February 1, 2006; 18(2): 313 - 323. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 G. T. F. Schwenger, C. C. Kok, E. Arthaningtyas, M. A. Thomas, C. J. Sanderson, and V. A. Mordvinov Specific Activation of Human Interleukin-5 Depends on de Novo Synthesis of an AP-1 Complex J. Biol. Chem., November 27, 2002; 277(49): 47022 - 47027. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Arima, H. Toyama, H. Ichii, S. Kojima, S. Okada, M. Hatano, G. Cheng, M. Kubo, T. Fukuda, and T. Tokuhisa A Putative Silencer Element in the IL-5 Gene Recognized by Bcl6 J. Immunol., July 15, 2002; 169(2): 829 - 836. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. S. Stranick, D. N. Zambas, A. S. Uss, R. W. Egan, M. M. Billah, and S. P. Umland Identification of Transcription Factor Binding Sites Important in the Regulation of the Human Interleukin-5 Gene J. Biol. Chem., June 27, 1997; 272(26): 16453 - 16465. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |