Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stranick, K. S.
Right arrow Articles by Billah, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stranick, K. S.
Right arrow Articles by Billah, M. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 35, Issue of September 01, pp. 20575-20582, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Transcription of the Murine Interleukin 5 Gene Is Regulated by Multiple Promoter Elements (*)

(Received for publication, May 4, 1995; and in revised form, June 15, 1995)

Kimberly S. Stranick (§) Faribourz Payvandi Demetris N. Zambas Shelby P. Umland Robert W. Egan M. Motasim Billah

From the Department of Allergy, Schering-Plough Research Institute, Kenilworth, New Jersey 07033

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Cis-acting regions in the 5`-flank of the mouse interleukin 5 (IL-5) gene involved in the specific and inducible regulation of IL-5 transcription in an untransformed mouse T cell clone, D10.G4.1, have been identified. Transient transfection assays with a series of deletion IL-5 promoter reporter constructs indicate that multiple regulatory elements in the 5`-flanking region of the IL-5 promoter play a role in regulating IL-5 transcription in Th2 cells. Negatively acting elements, NRE I and NRE II, map to the regions between positions -431 and -392 and positions -300 and -261. A positive regulatory element has been mapped to the region between positions -224 and -81. The activity of these elements is dependent on activation of the cells. A 40-bp sequence within this region, termed the IL-5 PRE, has been shown to bind at least two specific nuclear protein complexes from unstimulated and stimulated D10.G4.1 cells. An additional protein complex specific for this site has been identified in nuclear fractions from cells stimulated in the presence of the protein synthesis inhibitor, cycloheximide. Proteins that bind to these elements are likely to be important inducible and specific factors essential for control of IL-5 transcription in response to T cell receptor-mediated signaling events.


INTRODUCTION

Interleukin 5 is a growth factor produced primarily by mature T helper 2 lymphocytes. IL-5 (^1)mRNA and protein are undetectable in resting T cells, but they are induced within a few hours when Th2 cells are stimulated with antigen presented by the appropriate APC or by antibody to the TCRbulletCD3 complex. Th2 cells provide help to B cells in antibody production and coordinately express the genes for IL-4, IL-5, IL-6, and IL-10 after antigen receptor-mediated stimulation. The appearance of IL-5 mRNA in activated Th2 cells reflects the induction of IL-5 gene transcription in response to a specific signaling event(1, 2, 3) . However, little is known about the intracellular events that lead to the selective and transient cytokine expression in these cells. IL-5 produced by Th2 cells selectively induces the growth and differentiation of eosinophils from bone marrow precursor cells. Eosinophils are prominent in parasitic infections and in certain allergic conditions (4) and may contribute to tissue damage in the late phase inflammatory response to allergen. In addition, IL-5 secreted by activated T helper cells and the resulting eosinophil infiltration of the bronchial mucosa play an important role in the pathogenesis of asthma(5, 6) .

One mechanism by which coordinate differential expression of cytokine genes in T cells is accomplished in vivo may involve differences in DNA sequence elements in the promoters of these genes (7, 8) . Another mechanism may involve alternative T cell activation pathways that can differentially regulate transcription factors that bind to the promoters of cytokine genes in Th cells(9, 10) . Alternatively, differential cytokine gene expression in T cell clones may be related to the generation of specific transacting regulatory factors by distinct subsets of cells(11) . The factors that confer specific transcriptional control of the IL-5 gene in untransformed T cells stimulated in an antigen-specific manner have not yet been identified. Most of the reported studies of cytokine gene regulation have involved cytokines other than IL-5 in transformed T cell lines or T cells stimulated by mitogens, ionophores, or cytokines(2, 3, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24) .

In this report, we present an analysis of the mouse IL-5 promoter in the mouse Th2 cell line, D10.G4.1, and identify critical sequences in the proximal promoter that mediate the IL-5 transcriptional response of Th2 cells to TCR-mediated stimulatory signals. This investigation extends the results reported by Bohjanen et al.(13) in which the differential expression of IL-4 and IL-5 mRNA by T cells after stimulation with anti-CD3 mAbs was compared. The transcriptional activity of the IL-5 gene promoter in transiently transfected D10.G4.1 cells was analyzed to look for IL-5 promoter regions that may contribute to the differential transcriptional control of IL-5 expression. The results of these studies indicate that the control of IL-5 promoter expression in response to TCR stimulation can be mapped to at least three newly identified regulatory elements in the 5`-flanking region of the IL-5 gene, and these regions can function as either positive or negative regulatory elements. In addition, at least one of the protein complexes that interacts with a newly identified positive regulatory element in the IL-5 promoter contains a nascent protein.


MATERIALS AND METHODS

T Cell Clones

The murine Th2 T cell clone D10.G4.1 (ATCC, Rockville, MD) is CD4, CD8, conalbumin-specific, and H-2 I-A^k-restricted. D10.G4.1 cells were maintained in Click's medium (Irvine Scientific, Santa Ana, CA) supplemented with 10% heat-inactivated fetal calf serum, 10 mM HEPES, 2 mML-glutamine, 50 units/ml penicillin, 50 mg/ml streptomycin, and 50 mM 2-mercaptoethanol. The cells were stimulated every 7-14 days with 100 mg/ml conalbumin antigen (Sigma) and irradiated (3000 rads) syngeneic AKR/J (Jackson Laboratories, Bar Harbor, ME) spleen cells as accessory APC. Concanavalin A-stimulated rat growth factor supernatant treated with alpha-methylmannoside (Collaborative Research Inc., Bedford, MA) was added at a concentration of 5% to maintain the D10.G4.1 cells. Where indicated, cells were pretreated for 10 min with 2 µg/ml cyclosporin A (Sandoz, E. Hanover, NJ), 10 µg/ml CHX (Sigma), or 20 mM anisomycin (Sigma) prior to antigen stimulation. IL-5 was undetectable by enzyme-linked immunosorbent assay (26) in the supernatant from unstimulated D10.G4.1 cells, but cells stimulated by conalbumin antigen and APC produced consistently detectable levels of IL-5. No interferon- secretion was detectable by enzyme-linked immunosorbent assay (Biosource, Camarillo, CA) in stimulated or unstimulated D10.G4.1 cells (data not shown).

RNA Isolation and Northern Blot Analysis

For RNA preparation, D10.G4.1 cells (1-2 10^6 cells/group) were treated for 4 h in 75-cm^2 plastic tissue culture flasks with one of the treatments described in the legend to Fig. 1. Total cellular RNA was isolated from each group of cells in guanidinium isothiocyanate (RNAzol) (Biotecx Lab, Inc., Houston, TX) according to the manufacturer's instructions. 5-7 µg of total RNA from each group was separated by electrophoresis in 2.2 M formaldehyde, 1.4% agarose gels(27) , blotted to Hybond N nylon filters (Amersham Corp.), and UV-cross-linked to the membranes. cDNA fragments were P-labeled by nick translation (Amersham Corp.) or random priming (Boehringer Mannheim) and hybridized to the RNA filters in 50% formamide hybridization solution at 42 °C according to standard methods(27) . The filters were washed twice at 65 °C in 0.2 SSC, 0.1% SDS. cDNA fragments used as probes were isolated from plasmids received from the DNAX Research Institute (Palo Alto, CA) and consisted of the following: mouse IL-5, 1.7-kb BamHI fragment from pcDSRalpha-4G(28) ; mouse IL-4, 0.8-kb BamHI fragment from pcDSRalpha-2A-E3(29) ; mouse IL-10, 1.5-kb BamHI fragment from F115(30) ; mouse IL-3, 0.6-kb BamHI fragment from pcD69(31) ; mouse GM-CSF, 1-kb BamHI fragment from pcDE1-11(32) ; rat beta-actin, 1.2-kb BglI fragment(33) . After washing, the bound cDNA probes were visualized by autoradiography. To strip the damp filters for reprobing, a boiling solution of 0.1% SDS was poured on the filters and allowed to cool slowly to room temperature.


Figure 1: Differential induction of stimulation-dependent cytokine gene expression in Th2 cells in the presence of CsA or protein synthesis inhibitors. Northern blot analysis of total RNA isolated from unstimulated D10.G4.1 cells or cells stimulated 4 h with 100 µg/ml conalbumin and -irradiated I-A^k accessory cells with or without 10-min preincubation with 2 µg/ml CsA, 10 µg/ml CHX, or 20 mM anisomycin was performed as described under ``Materials and Methods.'' The blots were hybridized with P-labeled cDNA probes for mouse IL-5, IL-4, IL-10, IL-3, GM-CSF, or rat beta-actin as indicated.



IL-5 Promoter Cloning and Plasmid Construction

The DNA fragment extending from -546 to +39 relative to the start site of transcription of the murine IL-5 gene (34) was generated by PCR with D10.G4.1 genomic DNA as the template and two BglII-tailed oligonucleotides, IL5-5` and IL5-3`. Oligonucleotide IL5-5` extends from -546 to -523, and oligonucleotide IL5-3` extends from +39 to +16 relative to the start site of transcription of the murine IL-5 promoter. The sequence of the IL5-5` primer was GGAGATCTTGTACCTCCCACATCTGCTGGTGT, and the IL5-3` primer was GGAGATCTCTGAAGTCTTCAGCGCTGGCCTTC. Oligonucleotides were synthesized on a MilliGen/Biosearch 8750 DNA synthesizer (MilliGen/Biosearch, Burlington, MA) using beta-cyanoethyl phosphoramidite synthesis protocols according to the manufacturer's instructions. The resulting 584-bp PCR fragment was digested with BglII and cloned into the BglII site of the pGL2basic reporter plasmid (Promega Corp., Madison, WI) (35, 36) in the 5` to 3` direction upstream of the luciferase gene. A series of nested deletion constructs in which portions of the IL-5 promoter between positions -546 and -246 upstream of the transcription start site were deleted, as shown in Fig. 2, was generated from the original reporter construct by exonuclease III digestion of linearized plasmid DNA using the Erase-a-Base system (Promega Corp.). Additional deletion constructs corresponding to specific regions of the IL-5 promoter between positions -246 and -40 (Fig. 2) were generated by PCR amplification using primer IL5-3` and one of the following 5`-primers: IL5-224 (GGGAGCTCCATTCTTTTATGTTATAAGAAAATG), IL5-177 (GGGAGCTCGATGTTAACTATTATTAAAGAGCA), IL5-81 (GGGAGCTCAGGTGTCCTCTATCTGATTGTTAG), IL5-58 (GGGAGCTCGCAATTATTCATTTCCTCAGAGAG), or IL5-40 (GGGAGCTCAGAGAGAGAATAAATTGCTTGGGG). Each of the resulting PCR fragments was digested with SacI and BglII and subcloned into the SacI/BglII site of the pGL2basic reporter plasmid. All constructions were verified by DNA sequencing(27) . All constructs contain the IL-5 transcription initiation site (34) but not the IL-5 translation initiation codon to ensure that translation of the luciferase reporter gene must initiate at the AUG of the luciferase mRNA.


Figure 2: Chimeric IL-5 promoter-luciferase reporter gene plasmids constructed for transient transfection assays. The mouse IL-5 gene corresponding to positions -546 to +39 relative to the transcription initiation site was cloned by PCR and inserted upstream of the luciferase reporter gene in plasmid pGL2basic in the 5` to 3` orientation. A series of constructs in which the 5`-end of the IL-5 sequence was deleted between positions -431 and -40 while maintaining the same 3`-end at position +39 were cloned from this construct as described under ``Materials and Methods.'' The relative positions of the PRE and CLE 0 regions and the TATA box are noted.



Mutagenesis

The constructs CLE 0 mutant Mu-261 and CLE 0 mutant Mu-224 in which the CLE 0 regions of the IL-5 promoter in construct Mu-261 or Mu-224 were mutated to a random sequence were generated by in vitro site-directed mutagenesis with the Transformer Mutagenesis kit (Clontech, Palo Alto, CA) according to the manufacturer's instructions. The mutagenic primer consisted of the sequence GATTGTTAGCACGGCGGACGGGGAAGAAGAGAGAGAATAAATTGC and was synthesized as described above. The randomly mutated sequence that replaced the CLE 0 region is underlined. For selection of mutant plasmids, the ScaI/MluI selection primer (Pharmacia Biotech Inc.) was used to eliminate the unique ScaI site in the pGL2basic vector portion of the wild type constructs. The mutant constructs were verified by DNA sequencing(27) .

Transfection Assays

T cell clones were transfected using electroporation-mediated DNA transfer with the Gene Pulser (Bio-Rad). 100 µg of double CsCl-gradient-purified plasmid DNA (27) was added to 2 10^7 cells in 400 µl of RPMI 1640 medium supplemented with 2 mML-glutamine, 50 units/ml penicillin, and 50 µg/ml streptomycin in a 0.4-cm gap cuvette and electroporated at 320 V, 960 microfarads with an average time constant of 23-27 s. Following transfection, the cells were transferred into 6 ml of supplemented medium, split equally to two 25-cm dishes, and cultured at 37 °C in 5% CO(2). After overnight culture, one dish of cells from each group was stimulated with appropriate antigen and irradiated APC as described above and cultured for an additional 18-20 h. The remaining dish of cells from each group was left unstimulated during this culture period. Following the culture period, cell lysates were prepared, and luciferase activity was assayed in 20 µl of cell extracts with a chemiluminescent substrate according to the manufacturer's instructions (Promega Corp.). The luciferase activity was measured as relative light units produced in 20 s using a Berthold Lumat 9501 Luminometer (Wallac Inc., Gaithersburg, MD).

The pGL2control vector (Promega Corp.) was used as a positive control in each of the transfection experiments. The pGL2basic vector (Promega Corp.) was used as a negative control for background levels of luciferase activity in each transfection experiment. The luciferase activity of each transfected construct was compared with that of the pGL2control plasmid to obtain the relative luciferase activity for each construct expressed as a percentage of the positive control in each independent transfection experiment. The histograms and errorbars in Fig. 3represent the means and standard error of the means for n independent experiments with each construct, where n is the number in the center of each bar.


Figure 3: Transient transfection assay to measure IL-5 promoter activity in Th2 cells. Each IL-5 luciferase reporter gene construct was transiently transfected into D10.G4.1 cells by electroporation and cultured with or without antigen stimulation as described under ``Materials and Methods.'' The luciferase reporter gene activity was measured in the cell lysates as described. The results are presented as the mean ± S.E. luciferase activity relative to the pGL2control vector activity expressed by transfected D10.G4.1 cells. The number in each plasmid construct name corresponds to the position in the IL-5 5`-flanking region at which each clone is truncated. The number in the center of each histogrambar represents the number of independent transfection experiments with each construct.



Preparation of Nuclear Extracts

Nuclear extracts were isolated from unstimulated D10.G4.1 cells, cells stimulated by appropriate antigen and APC, or cells stimulated by plate bound anti-CD3 mAb (Pharmingen, San Diego, CA) in the presence or absence of 2 µg/ml CsA or 10 µg/ml CHX by a modification of the procedure described by Schreiber et al.(37) . In brief, 1-5 10^7 cells, washed with cold Tris-buffered saline, pH 7.9, were sedimented by centrifugation at 12,000 g for 1 min. The supernatant was discarded, and the pellet was resuspended in 500 µl of cold hypotonic buffer (10 mM HEPES, pH 7.9, 10 mM KCl, 0.1 mM EDTA, 0.1 mM EGTA, 1 mM dithiothreitol, 0.5 mM Pefabloc SC (Boehringer Mannheim), 0.5 µg/ml leupeptin (Boehringer Mannheim), 0.7 µg/ml pepstatin (Boehringer Mannheim) and allowed to swell on ice for 15 min. Cells were lysed by the addition of Nonidet P-40 to a final concentration of 0.5%. Nuclei were collected by centrifugation, and nuclear proteins were extracted in 50 µl of salt buffer (20 mM HEPES, pH 7.9, 400 mM NaCl, 1 mM EDTA, 1 mM EGTA, 1 mM dithiothreitol, 1 mM Pefabloc SC, 0.5 µg/ml leupeptin, 0.7 µg/ml pepstatin). Nuclear debris was removed by centrifugation, and the extracts were immediately stored at -70 °C. The protein content of the nuclear extracts was determined by the method of Bradford(38) . Nuclear extracts from mouse 3T3 fibroblasts were purchased from Santa Cruz Biotechnology (Santa Cruz, CA).

Electrophoretic Mobility Shift Assays

Complementary oligonucleotide pairs corresponding to IL-5 5`-flank sequences with 5`-GGG overhanging ends were synthesized (Oligo Therapeutics, Inc., Wilsonville, OR; Life Technologies, Inc.), annealed, and radiolabeled with [alpha-P]-dCTP using the Klenow fragment of DNA polymerase. The sequences of the probe pairs corresponded to the following regions of the mouse IL-5 promoter (numbered relative to the transcription start site at +1): CLE0, -59 to -36; A, -186 to -157; B, -176 to -147; C, -166 to -137; D, -156 to -127; E, -146 to -117. Labeled annealed oligonucleotides were purified from 12% acrylamide gels following electrophoresis(27) . Oligonucleotides containing the consensus binding site for NF-kB, AP-1, and Sp-1 were purchased from Promega Corp. The 10-µl EMSA binding reactions contained 5 µg of total nuclear protein in 4% (v/v) glycerol, 1 mM MgCl(2), 0.5 mM EDTA, 0.5 mM dithiothreitol, 50 mM NaCl, 10 mM TrisbulletCl, pH 7.5, 0.5 µg/ml poly(dI-dC) (Boehringer Mannheim). Reactions were incubated with approximately 50,000 cpm of P-labeled duplex oligonucleotide for 20 min at room temperature. Protein-DNA binding specificity was tested by competition assays in which the binding reactions were preincubated for 10 min at room temperature with excess unlabeled specific or nonspecific competitor duplex oligonucleotides prior to the addition of the labeled probe. Following binding, the DNA-protein complexes were resolved by electrophoresis on nondenaturing 6% acrylamide gels at 250 V for 2 h at room temperature in 0.5 TBE buffer (1 TBE: 89 mM Tris, 89 mM boric acid, and 2 mM EDTA). Gels were dried prior to autoradiography.


RESULTS

Differential Regulation of Cytokine Gene Expression

Steady state IL-5, IL-4, IL-10, IL-3, and GM-CSF mRNA levels were measured in unstimulated D10.G4.1 cells or cells stimulated with conalbumin antigen in the presence of I-A^k accessory cells by Northern blot analysis (Fig. 1). Unstimulated cells did not produce detectable levels of IL-5, IL-4, IL-3, or GM-CSF message (lane1). A low level of IL-10 mRNA was detected in unstimulated cells (lane1), but the level of IL-10 message increased significantly following stimulation (lane2). In addition, stimulation induced readily detectable levels of IL-5, IL-4, IL-3, and GM-CSF mRNA (lane2). No message for interferon- or any other Th1-specific cytokine was detected in these cells following either of these treatments (data not shown).

Because these cytokines appear to be produced coordinately after stimulation through an antigen-specific T cell receptor pathway, the patterns of expression of these genes in the presence of CsA, an inhibitor of NF-AT-mediated transcription in T cells(39) , and the protein synthesis inhibitors CHX and anisomycin were compared. CsA completely inhibited the expression of IL-4, IL-3, and GM-CSF mRNA induced by conalbumin antigen and accessory cells, but it only marginally inhibited the expression of IL-5 mRNA (lane3). In contrast, although the protein synthesis inhibitors CHX and anisomycin completely inhibited antigen-induced IL-5 gene expression, they did not inhibit the expression of IL-4, IL-3, or GM-CSF mRNA in these cells (lanes4 and 5). Like the expression of the IL-5 gene, the induction of IL-10 mRNA in response to antigen-specific stimulation was only marginally inhibited by CsA (lane3). Unlike the induction of IL-5 mRNA, however, the expression of IL-10 mRNA was not affected by the protein synthesis inhibitors (lanes4 and 5).

Functional Analysis of the 5`-Flanking Region of the Murine IL-5 Gene

To identify the cis elements within the promoter that are functionally important for the regulation of IL-5 expression, a sequence homology analysis was performed using 546 bp upstream of the murine IL-5 gene. Several sequences that completely or partially matched the binding sites of previously characterized transcription factors were identified by computer homology searches, based on a compilation of vertebrate-encoded transcription factors (40) (data not shown). The importance of the various consensus sequences in the regulation of IL-5 gene expression remains to be determined. The functional significance of these sites cannot be determined from their presence alone.

To determine the minimal IL-5 promoter fragment that could direct expression of a reporter gene, approximately 550 bp of the immediate upstream region of the mouse IL-5 gene (34) was cloned into the pGL2basic luciferase plasmid, and a series of 5` to 3` deletion mutants was generated (Fig. 2). All deletion constructs had identical 3`-ends that included the IL-5 sequence through +39 bp relative to the natural transcription initiation site at +1. The activity of these mouse promoter-luciferase chimeric constructs containing varying lengths of the IL-5 gene promoter in unstimulated cells (openbars) and in cells stimulated by specific antigen and APC (shadedbars) was assayed following transient transfection by electroporation as shown in Fig. 3. D10.G4.1 cells transfected with the pGL2basic plasmid containing only the luciferase gene coding region and no regulatory sequences expressed consistently low levels of luciferase activity with or without antigen stimulation. The relative levels of luciferase activity detected with each chimeric IL-5 promoter construct were dependent on the length of the promoter sequences included in each of the constructs. In addition, the expression of these chimeric constructs was dependent on antigenic stimulation of the transfected cells. Unstimulated transfected cells expressed uniformly lower levels of luciferase activity compared with transfected cells stimulated with Ag and APC.

Identification of Negatively and Positively Acting Regulatory Regions

The maximal level of transient expression following stimulation was seen with constructs that contained 224 bp of 5`-flank (construct Mu-224) (Fig. 3). Thus, the critical 5` IL-5 promoter regions necessary for inducible expression in D10.G4.1 cells are located within 224 bp of the transcription initiation site. A negative regulatory element, IL-5 NRE I, was detected between positions -431 and -392. Deletion of this region consistently resulted in a significant increase in inducible luciferase activity. A second negative regulatory element, IL-5 NRE II, is apparently located between positions -300 and -261, as evidenced by the gain of luciferase activity with constructs in which this region had been partially or completely deleted. In contrast, the regions between positions -224 and -81 appears to include an important positive regulatory element (PRE), since lower luciferase activity was detected with constructs in which this region was deleted. Truncation of the promoter to -58 bp (construct Mu-58), which includes the CLE 0 region in addition to TATA, markedly diminished both inducible and uninducible luciferase expression in the transfectants. Further truncation of the IL-5 promoter to position -40 (construct Mu-40), which removes the CLE 0 region and includes only the TATA region, reduced the levels of inducible and uninducible expression to those seen with the promoterless vector alone.

Mutation of the CLE 0 Binding Site Does Not Prevent IL-5 Promoter Activity

To investigate the role of the CLE 0 region in the context of maximal inducible IL-5 promoter expression, the activity of two mutant CLE 0 constructs was measured in transient transfection experiments in D10.G4.1 cells. Multiple site-directed mutations that disrupted the entire CLE 0 region were introduced into constructs Mu-261 and Mu-224, constructs that each exhibit high promoter activity (Fig. 3). Disruption of this site reduced promoter activity of each mutant construct by only 25-50% compared with the wild type constructs (Fig. 4).


Figure 4: Effect of mutation of the CLE 0 region on the IL-5 promoter activity. The CLE 0 site was replaced by 14 randomly altered bases in each of the two reporter constructs, Mu-261 and Mu-224, to produce CLE 0 mutant Mu-261 and CLE 0 mutant Mu-224 as described under ``Materials and Methods.'' Each of the wild type and mutant constructs was transiently transfected into D10.G4.1 cells by electroporation, followed by antigen stimulation and assay as described above. The results are presented as the mean ± S.E. promoter activity of each mutant construct relative to the activity of the wild type construct (defined as 100%) in either 4 or 8 independent transfection experiments as indicated by the number in the center of each histogrambar.



Characterization of Sequence-specific Protein-DNA Interactions

To identify putative transcription factors that bind to regions of the mouse IL-5 promoter identified as functionally important in the transfection experiments, EMSAs were performed using labeled oligonucleotide probes spanning these regions and nuclear protein extracts from unstimulated D10.G4.1 cells and D10.G4.1 cells stimulated in the presence or absence of the inhibitors CsA and CHX. Two regions, CLE 0 and IL-5 PRE, were chosen as initial candidates for binding sites within the IL-5 promoter, which might interact with specific proteins and might play a role in the specific and inducible regulation of IL-5 transcription.

The CLE 0 region in the mouse GM-CSF gene has been shown previously to be recognized by two factors, NF-CLE0a and NF-CLE0b, in the transformed human T cell line, Jurkat(25) . These two factors have also been shown to be capable of interacting with the CLE 0 element of the mouse IL-5 and IL-4 genes. To investigate the role of similar factors present in D10.G4.1 T cells, which bind to the CLE 0 element of the IL-5 gene promoter, an oligonucleotide that contained sequences spanning the mouse IL-5 CLE 0 region was used in EMSAs with D10.G4.1 nuclear extracts. At least three major complexes were formed with the CLE 0 site probe and the D10.G4.1 nuclear extracts as shown in Fig. 5. No differences were seen in the pattern of complexes that formed with nuclear extracts from unstimulated or anti-CD3-stimulated D10.G4.1 cells (lanes1, 4, and 7). In addition, the same relative pattern of complexes was detected in extracts prepared from cells stimulated by either Ag and APC or plate-bound anti-CD3 mAb (lanes4 and 7), although the second protein-complex band migrated slightly slower in the lanes containing Ag and APC-stimulated nuclear extracts. The minor retardation of this complex may be attributable to cross-reactive proteins contributed by the antigen-presenting cells present in the stimulated cell preparation. The mobility of this complex is unchanged in the anti-CD3-stimulated extracts compared with the unstimulated cell extracts, which indicates that the retardation of this complex is not a function of the activation state of the cells. The inclusion of the inhibitor CsA or CHX during the stimulation period did not change the number or pattern of specific complexes detected with this probe (lanes10 and 13). The specificity of each of these protein-DNA interactions was confirmed in binding reactions where an excess of unlabeled specific competitor DNA was added to the reactions. The detection of all three specific CLE 0 complexes in the D10.G4.1 reactions was inhibited by unlabeled CLE0 probe (lanes2, 5, 8, 11, and 14) but not by the same amount of an unrelated IL-5 sequence-containing probe (lanes3, 6, 9, 12, and 15). The inhibition by a specific competitor oligonucleotide was concentration-dependent (data not shown). Despite sharing some homology to NF-kB, AP-1, and Sp-1 binding sites, oligonucleotides containing consensus binding sites for each of these transcription factors failed to inhibit the specific binding of the three complexes to the CLE 0 region (data not shown). Thus, none of the three complexes represents a known member of these families of molecules. No CLE 0-specific complexes were formed with 3T3 fibroblast cell nuclear extracts (data not shown).


Figure 5: Electrophoretic mobility shift assay with D10.G4.1 cell extracts and an oligonucleotide probe containing the CLE 0 binding site. Nuclear protein extracts were prepared from unstimulated cells, cells stimulated with Ag + APC, cells stimulated by plate-bound anti-CD3 mAbs, or cells stimulated in the presence of either CsA or CHX as described under ``Materials and Methods.'' Each binding reaction contained 5 µg of nuclear protein and the labeled double-stranded CLE 0 oligonucleotide probe. The protein-DNA complexes were resolved by PAGE on a nondenaturing 6% acrylamide gel. Excess unlabeled specific or unrelated nonspecific competitor oligonucleotide as noted was preincubated with the binding reactions. The specific retarded labeled complexes are indicated by openarrowheads. Free probe is indicated by the closedarrowheads.



To investigate the positive regulatory element of the IL-5 promoter, PRE, identified in the transient transfection experiments described above, a series of overlapping 30-bp oligonucleotide probes spanning the region between positions -196 and -76 were used in EMSAs with D10.G4.1 nuclear proteins. The results of the EMSAs with five of these probes, A-E, and three different D10.G4.1 nuclear fractions are shown in Fig. 6A. The relative positions of the oligonucleotide probes are depicted in Fig. 6B. Nuclear fractions from unstimulated D10.G4.1 cells (lanes1-5) and cells stimulated by plate bound anti-CD3 mAb (lanes6-10) consistently produced the two distinct retarded complexes marked with openarrowheads. These complexes bound only to the oligonucleotide probes C and D (lanes3, 4, 8, and 9). Binding reactions with overlapping probes A, B, and E (lanes1, 2, 5, 6, 7, and 10), which include sequences either upstream or downstream of the sequences contained in probes C and D, did not result in complexes with the same mobilities. Thus, the region to which these nuclear proteins bind can be mapped to the sequences included only in probes C and D, namely positions -166 to -127 in the IL-5 promoter. Lanes11-15 contain the results with the same overlapping series of oligonucleotide probes and nuclear proteins from D10.G4.1 cells that were stimulated in the presence of CHX. The pattern of retarded bands is similar in that at least two distinct complexes with mobilities similar to those noted previously are formed with probes C and D. However, an additional complex marked with the asterisk, which bound only to probes C and D, is evident in lanes13 and 14. No complexes with similar mobilities are evident binding to probes A, B, or E. The additional complex was not formed with nuclear extracts from unstimulated cells that were incubated in the presence of CHX (data not shown). Additional 30-bp overlapping oligonucleotides spanning 5`-sequences up to position -196 and 3`-sequences down to position -77 did not result in similar DNA-binding activities with any of the D10.G4.1 nuclear fractions used (data not shown).


Figure 6: A, electrophoretic mobility shift assay with D10.G4.1 cell extracts and oligonucleotides probes spanning the region between positions -186 and -117 in the IL-5 promoter. Nuclear protein extracts were prepared from unstimulated cells and cells stimulated by plate bound anti-CD3 mAbs in the absence or presence of CHX as described under ``Materials and Methods.'' Each binding reaction contained 5 µg of nuclear protein and one of the labeled probes A, B, C, D, or E as indicated. The protein-DNA complexes were resolved by native PAGE as described above. The specific retarded labeled complexes are indicated by openarrowheads. Free probe is indicated by the closedarrowhead. The novel complex unique to the nuclear fractions prepared in the presence of CHX is marked with an asterisk. B, overlapping oligonucleotide probes used in gel shift experiments. The mouse IL-5 genomic IL-5 sequence between positions -196 and -96 relative to the transcription start site is represented as a solidline with the relative location and positions of the overlapping double stranded oligonucleotides designated by boxes labeled ProbeA-E. The relative position of the IL-5 PRE defined by the gel shift analysis is indicated by the dashedline.



The specificity of each of these protein-DNA complexes unique to the binding sites included in probes C and D was tested by competition EMSAs (Fig. 7). The same protein-DNA complexes seen previously are detected in binding reactions with nuclear fractions from unstimulated D10.G4.1 cells (lanes1-6), stimulated D10.G4.1 cells (lanes7-12), and cells stimulated in the presence of CHX (lanes13-18) with labeled probes C (lanes1-3, 7-9, and 13-15) and D (lanes4-6, 10-12, and 16-18). The formation of each of these complexes was specifically inhibited by excess of the cognate oligonucleotide but was not inhibited by excess of an unrelated oligonucleotide of the same size. No binding activity with any of these oligonucleotide probes was detected in nuclear fractions from mouse 3T3 fibroblasts (data not shown).


Figure 7: Competition electrophoretic mobility shift assay with D10.G4.1 cell extracts and labeled oligonucleotide probes C and D as indicated in Fig. 6B. Nuclear protein extracts and binding reactions were as described in Fig. 6A. Excess unlabeled competitor oligonucleotides included in each binding reaction were as indicated. Specific complexes are as indicated in Fig. 6A.




DISCUSSION

Most functional studies on the mechanism of regulation of cytokine gene transcription have been undertaken with transformed T cell lines. An advantage to using transformed cells is the relative ease with which these cells can be grown and transfected with plasmid reporter gene constructs for functional activity measurements. A significant disadvantage to using transformed cells to study normal T cell biology is the consequence of the transformation event, which may alter the phenotype of the cell and may also alter the normal patterns of responses to signaling within the cell. Several examples of conflicting cytokine expression profiles induced in response to a variety of stimuli in primary lymphocytes, transformed T cell clones, or untransformed T cell clones have been reported, which suggests that differences in the mechanisms of cytokine gene induction in these types of cells may exist(2, 13, 19, 22, 23, 41, 42) . For this reason, the current investigation of the mechanism of IL-5 gene transcription was undertaken using an antigen-specific mouse cell line that expresses inducible cytokine profiles characteristic of mouse Th2 cells in response to specific stimulatory and costimulatory signals mediated through the TCR. Importantly, TCR stimulation closely mimics physiologic signal transduction (43, 44) and may provide a more accurate representation of what occurs in vivo.

The D10.G4.1 T cell clone used in this study has a distinct Th2 phenotype(11, 45) . Although coordinate induction of the Th2 cytokines was observed, three different patterns could be distinguished for the different gene transcripts induced in cells stimulated in the presence of the inhibitors CsA, CHX, and anisomycin. The different patterns of cytokine mRNA transcribed in the presence of these inhibitors demonstrate that more than one induction pathway may be responsible for the apparently coordinate expression of these cytokine genes. Protein synthesis is required only for the expression of IL-5 mRNA and not the other cytokine gene transcripts induced in the same cells. Thus, at least one protein critical for the induction of IL-5 gene transcription but not for transcription of the IL-4, IL-10, IL-3, or GM-CSF genes is newly synthesized in response to stimulation of the Th2 cells by Ag and APC.

Luciferase activity was readily detectable in antigen-stimulated cells following transfection with the mouse IL-5 promoter-luciferase chimeric constructs. The inducible levels of luciferase activity detected following transient transfection with the IL-5 reporter constructs indicate that the IL-5 promoter is capable of driving TCR-mediated transcription of the reporter gene in D10.G4.1 cells in a manner consistent with that of the endogenous IL-5 gene. Deletion analysis of the IL-5 promoter revealed several regions of the IL-5 gene that appear to contain cis-acting elements required for full activity of the IL-5 gene. The pattern of inducible expression with these deletion constructs transfected into the D10.G4.1 cells suggests that both negatively and positively acting regulatory elements function in the control of the IL-5 promoter. The region between positions -431 and -392, as well as that between positions -300 and -261, include negative regulatory elements. Conversely, the region between positions -224 and -81 contains a positive regulatory element. None of these putative regulatory elements in the IL-5 promoter have been reported previously.

Furthermore, the region between positions -58 and -40 corresponds to the previously identified CLE 0 element(25, 46) . The low levels of luciferase activity that result after transfection of either of the Mu-58 or Mu-40 constructs indicate that the 14-bp CLE 0 region in combination with the natural TATA and transcription initiation sites is not sufficient to induce IL-5 transcription in antigen stimulated D10.G4.1 cells. Additional functional cis-acting elements between positions -224 and -58 are critical for control of the IL-5 promoter. Further evidence that the CLE 0 region is not essential for inducible IL-5 promoter activity is provided by the transfection experiments with the CLE 0 mutant reporter constructs. These mutant CLE 0 constructs displayed only 25-50% less inducible promoter activity compared with the wild type constructs. Thus, the CLE 0 region appears to contribute to the activity of the IL-5 promoter, but it is not essential for promoter function. This finding is in contrast to the essential role the CLE 0 region plays in the induction of GM-CSF transcription in Jurkat cells stimulated with phorbol ester and calcium ionophore(47) . This difference between IL-5 and GM-CSF regulation may reflect alternative mechanisms of gene induction specific to the mode of stimulation, the species, or the biology of transformed and untransformed cells. Alternatively, it may reflect at least one independent pathway of inducible expression between the IL-5 and GM-CSF gene promoters. The latter possibility is supported by the differential inhibition of steady state GM-CSF and IL-5 mRNA levels in D10.G4.1 cells following antigen stimulation in the presence of CsA or CHX discussed above.

Nuclear binding factors present in stimulated and unstimulated Th2 cells and in cells stimulated in the absence of protein synthesis were compared to examine the CLE 0 binding factors, either constitutive or newly synthesized, that may contribute to the regulation of IL-5 transcription. No difference in the number or pattern of CLE 0-specific complexes was detected between unstimulated and stimulated cells or between cells that had been stimulated in the presence of either CsA or CHX. Thus, these protein complexes and the CLE 0 element to which they bind do not appear to play a role in the differential patterns of IL-5, IL-4, and GM-CSF message induced in D10.G4.1 cells stimulated by antigen and APC in the presence of these inhibitors. However, proteins that bind to this sequence were not detected in nuclear extracts from mouse fibroblasts, which suggests that the CLE 0-specific complexes may be restricted to T cells. This pattern of CLE 0 site binding proteins detected by gel shift is in contrast to the results of a similar investigation recently reported by Naora et al.(48) . These researchers used a gel shift analysis with extracts from D10.G4.1 cells treated with concanavalin A or phorbol ester and the inhibitors CsA or CHX to show that the TCATTT element in the mouse IL-5 gene, which is contained within the CLE 0 region previously defined, is recognized by a single nuclear protein complex identified as NFIL5A. This discrepancy in CLE 0 site binding complexes in D10.G4.1 cells may be attributable to the distinct signaling events and the associated nuclear signals triggered by the alternative activation methods used in these two studies. The nonequivalence of these stimulations is evident from the differential patterns of cytokine expression and inhibition that resulted from each of them. Additionally, the slight variation in sequence in the oligonucleotide probes used in the EMSAs may contribute to the disparate results. The probe used in the current study included the entire CLE 0 sequence previously defined to be functionally important in the GM-CSF promoter(25, 47) , while the previous study used a slightly shorter sequence, which did not include the 3`-end of the defined CLE 0 site(48) . It remains to be determined whether these different CLE 0 site binding factors are related and together contribute to a functional IL-5 transcription factor complex made up of both constitutive and inducible protein components.

To define the sequences within the previously unrecognized PRE of the IL-5 promoter that might function as transcription factor binding sites, a series of overlapping oligonucleotides that span the 120-bp PRE region identified in the transient transfection experiments were used as probes in EMSAs. Nuclear extracts from unstimulated and stimulated D10.G4.1 cells both contained activities that bound specifically to only two of these probes, which include the region between positions -166 and -127 in the IL-5 promoter. The loss of specific binding activities with overlapping probes that differ by only 10 bp either 5` or 3` to this region makes it possible to localize the binding site within the 40-bp region shared by these two probes, which we have termed the IL-5 PRE. Inspection of the DNA sequence of this 40-bp response element did not reveal significant homology with previously characterized transcription factor binding sites, which may indicate that this element is unique to the IL-5 gene. Additional evidence to suggest a unique role for these binding activities in the control of IL-5 transcription is provided by the pattern of specific protein binding complexes from cells stimulated in the absence of protein synthesis. The induction of IL-5 transcription can be differentiated from the coordinate induction of other cytokines in the same cell by the requirement for protein synthesis. The appearance of a unique retarded complex binding to the 40-bp IL-5 PRE only in nuclear extracts prepared from cells stimulated in the absence of protein synthesis suggests that at least one of the protein complexes recognizing this site interacts with a protein that is newly synthesized in response to stimulation. This postulated nascent regulatory protein may normally function to prevent binding of the complex to the PRE, which allows IL-5 transcription to proceed. In the absence of protein synthesis, the complex remains bound to the PRE, and IL-5 transcription is inhibited. Further characterization of this novel regulatory complex and the inducible and specific factors that interact with it to control IL-5 transcription is in progress.

Analysis of the contribution of elements that lie in the 5`-flanking region of the IL-5 gene by transfection of nested deletions of reporter gene chimeric constructs has provided valuable information on the location and influence of proximal cis-acting regulatory elements. However, additional mechanisms regulating gene expression may also play an important role. For example, alterations in gene accessibility due to DNA methylation, contributions of enhancer or suppressor sequences located 5` or 3` to the promoter of the gene of interest, or motifs in the 3`-untranslated region of the gene that have an effect on RNA stability or translation have all been shown to affect gene expression (21, 49, 50, 51) . In addition, the presence of specific binding activities in the nuclear fractions of unstimulated cells does not necessarily rule out a role for these proteins in transcription activation. Additional modifications, such as phosphorylation or differences in binding affinity not detectable by mobility shift assays, may be important. The contributions of these regulatory mechanisms to the control of IL-5 gene transcription in Th2 cells have yet to be defined.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Dept. of Allergy, Schering-Plough Research Inst., 2015 Galloping Hill Rd., Kenilworth, NJ 07033. Tel.: 908-298-7255; Fax: 908-298-7175.

(^1)
The abbreviations used are: IL-3, -4, -5, -6, -10, interleukin 3, 4, 5, 6, and 10, respectively; GM-CSF, granulocyte-macrophage colony-stimulating factor; Th1 and Th2, T helper type 1 and T helper type 2, respectively; APC, antigen-presenting cell; CsA, cyclosporin A; CHX, cycloheximide; TCR, T cell receptor; CLE 0, conserved lymphokine element 0; mAb, monoclonal antibody; EMSA, electrophoretic mobility shift assay; NF-AT, nuclear factor of activated T cells; kb, kilobase; bp, base pair(s); PCR, polymerase chain reaction; Ag, antigen; NRE, negative response element; PRE, positive response element.


ACKNOWLEDGEMENTS

We thank the investigators at the DNAX Research Institute for the gift of mouse cytokine cDNA clones. Carol Battle kindly provided assistance with the manuscript.


REFERENCES

  1. Krönke, M., Leonard, W. J., Depper, J. M., and Greene, W. C. (1985) J. Exp. Med. 161,1593-1598 [Abstract/Free Full Text]
  2. Naora, H., Altin, J. G., and Young, I. G. (1994) J. Immunol. 152,5691-5702 [Abstract]
  3. Naora, H., and Young, I. G. (1994) Blood 83,3620-3628 [Abstract/Free Full Text]
  4. Sanderson, C. J. (1992) Blood 79,3101-3109 [Free Full Text]
  5. Bousquet, J., Chanez, P., Lacoste, J. Y., Barnéon, G., Ghavanian, N., Enander, I., Venge, P., Ahlstedt, S., Simony-Lafontaine, J., Godard, P., and Michel, F.-B. (1990) N. Engl. J. Med. 323,1033-1039 [Abstract]
  6. Gleich, G. J., Adolphson, C. R., and Leiferman, K. M. (1993) Annu. Rev. Med. 44,85-101 [CrossRef][Medline] [Order article via Infotrieve]
  7. Bruhn, K. W., Nelms, K., Boulay, J.-L., Paul, W. E., and Lenardo, M. J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,9707-9711 [Abstract/Free Full Text]
  8. Henkel, G., and Brown, M. A. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,7737-7741 [Abstract/Free Full Text]
  9. Gajewski, T. F., Schell, S. R., Nau, G., and Fitch, F. W. (1989) Immunol. Rev. 11,79-110
  10. Tamura, T., Yanagida, T., and Nariuchi, H. (1993) J. Immunol. 151,6051-6061 [Abstract]
  11. Lederer, J. A., Liou, J. S., Todd, M. D., Glimcher, L. H., and Lichtman, A. H. (1994) J. Immunol. 152,77-86 [Abstract]
  12. Muñoz, E., Zubiaga, A., Olson, D., and Huber, B. T. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,9461-9464 [Abstract/Free Full Text]
  13. Bohjanen, P. R., Okajima, M., and Hodes, R. J. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,5283-5287 [Abstract/Free Full Text]
  14. Mathey-Prevot, B., Andrews, N. C., Murphy, H. S., Kreissman, S. G., and Nathan, D. G. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,5046-5050 [Abstract/Free Full Text]
  15. Nimer, S., Fraser, J., Richards, J., Lynch, M., and Gasson, J. (1990) Mol. Cell. Biol. 10,6084-6088 [Abstract/Free Full Text]
  16. Shoemaker, S. G., Hromas, R., and Kaushansky, K. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,9650-9654 [Abstract/Free Full Text]
  17. Staynov, D. Z., and Lee, T. H. (1992) Immunology 75,196-201 [Medline] [Order article via Infotrieve]
  18. Li-Weber, M., Eder, A., Krafft-Czepa, H., and Krammer, P. H. (1992) J. Immunol. 148,1913-1918 [Abstract]
  19. Park, J.-H., Kaushansky, K., and Levitt, L. (1992) J. Biol. Chem. 268,6299-6308 [Abstract/Free Full Text]
  20. Todd, M. D., Grusby, M. J., Lederer, J. A., Lacy, E., Lichtman, A. H., and Glimcher, L. H. (1993) J. Exp. Med. 177,1663-1674 [Abstract/Free Full Text]
  21. Li-Weber, M., Krafft, H., and Krammer, P. H. (1993) J. Immunol. 151,1371-1382 [Abstract]
  22. Szabo, S. J., Gold, J. S., Murphy, T. L., and Murphy, K. M. (1993) Mol. Cell. Biol. 13,4973-4805
  23. Lee, H. J., Koyano-Nakagawa, N., Naito, Y., Nishida, J., Arai, N., Arai, K.-I., and Yokota, T. (1993) J. Immunol. 151,6135-6142 [Abstract]
  24. Van Straaten, J. F. M., Dokter, W. H. A., Stulp, B. K., and Vellenga, E. (1994) Cytokine 6,229-234 [CrossRef][Medline] [Order article via Infotrieve]
  25. Miyatake, S., Shlomai, J., Arai, K.-I., and Arai, N. (1991) Mol. Cell. Biol. 11,5894-5901 [Abstract/Free Full Text]
  26. Abrams, J. S., Roncarolo, M.-G., Yssel, H., Andersson, U., Gleich, G. J., and Silver, J. E. (1992) Immunol. Rev. 127,5-24 [CrossRef][Medline] [Order article via Infotrieve]
  27. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  28. Yokota, T., Coffman, R. L., Hagiwara, H., Rennick, D. M., Takebe, Y., Yokota, K., Gemmell, L., Shrader, B., Yang, G., Meyerson, P., Luh, J., Hoy, P., Péne, J., Briére, F., Spits, H., Banchereau, J., deVries, J., Lee, F. D., Arai, N., and Arai, K.-I. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,7388-7392 [Abstract/Free Full Text]
  29. Lee, F., Yokota, T., Otsuka, T., Meyerson, P., Villaret, D., Coffman, R., Mosmann, T., Rennick, D., Roehm, N., Smith, C., Zlotnik, A., and Arai, K.-I. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,2061-2065 [Abstract/Free Full Text]
  30. Moore, K. W., Vieira, P., Fiorentino, D. F., Trounstine, M. L., Khan, T. A., and Mosmann, T. R. (1990) Science 248,1230-1233 [Abstract/Free Full Text]
  31. Yokota, T., Lee, F., Rennick, D., Hall, C., Arai, N., Mosmann, T., Nabel, G., Cantor, H., and Arai, K.-I. (1984) Proc. Natl. Acad. Sci. U. S. A. 81,1070-1074 [Abstract/Free Full Text]
  32. Miyatake, S., Otsuka, T., Yokota, T., Lee, F., and Arai, K. (1985) EMBO J. 4,2561-2568 [Medline] [Order article via Infotrieve]
  33. Nudel, U., Zakut, R., Shani, M., Neuman, S., Levy, Z., and Yaffe, D. (1983) Nucleic Acids Res. 11,1759-1771 [Abstract/Free Full Text]
  34. Campbell, H. D., Sanderson, C. J., Wang, Y., Hort, Y., Martinson, M. E., Tucker, W. Q. J., Stellwagen, A., Strath, M., and Young, I. G. (1988) Eur. J. Biochem. 174,345-352 [Medline] [Order article via Infotrieve]
  35. Ow, D. W., Wood, K. V., DeLuca, M., DeWet, J. R., Helinski, D. R., and Howell, S. H. Science 234,856-859
  36. DeWet, J. R., Wood, K. V., DeLuca, M., Helinski, D. R., and Subramani, S. (1987) Mol. Cell. Biol. 7,725-737 [Abstract/Free Full Text]
  37. Schreiber, E., Matthias, P., Müller, M. M., and Schaffner, W. (1989) Nucleic Acids Res. 17,6419 [Free Full Text]
  38. Bradford, M. M. (1976) Anal. Biochem. 72,248-254 [CrossRef][Medline] [Order article via Infotrieve]
  39. Schreiber, S. L., and Crabtree, G. R. (1992) Immunol. Today 13,136-142 [CrossRef][Medline] [Order article via Infotrieve]
  40. Faisst, S., and Meyer, S. (1992) Nucleic Acids Res. 20,3-26 [Free Full Text]
  41. McCaffrey, P. G., Kim, P. K., Valge-Archer, V. E., Sen, R., and Rao, A. (1994) Nucleic Acids Res. 22,2134-2142 [Abstract/Free Full Text]
  42. Van der Pouw-Kraan, T., Van Kooten, C., Rensink, I., and Aarden, L. (1992) Eur. J. Immunol. 22,1237-1241 [Medline] [Order article via Infotrieve]
  43. Frank, S. J., Niklinska, B. B., Orloff, D. G., Mercep, M., Ashwell, J. D., and Klausner, R. D. (1990) Science 249,174-177 [Abstract/Free Full Text]
  44. Wolff, C. H. J., Hong, S.-C., von Grafenstein, H., and Janeway, C. A., Jr. (1993) J. Immunol. 151,1337-1345 [Abstract]
  45. Mosmann, T. R., and Coffman, R. L. (1989) Annu. Rev. Immunol. 7,145-173 [CrossRef][Medline] [Order article via Infotrieve]
  46. Tokumitsu, H., Masuda, E. S., Tsuboi, A., Arai, K.-I., and Arai, N. (1993) Biochem. Biophys. Res. Commun. 196,737-744 [CrossRef][Medline] [Order article via Infotrieve]
  47. Masuda, E. S., Tokumitsu, H., Tsuboi, A., Shlomai, J., Hung, P., Arai, K.-I., and Arai, N. (1993) Mol. Cell. Biol. 13,7399-7407 [Abstract/Free Full Text]
  48. Naora, H., van Leeuwen, B. H., Bourke, P. F., and Young, I. G. (1994) J. Immunol. 153,3466-3475 [Abstract]
  49. Tate, P. H., and Bird, A. P. (1993) Curr. Opin. Genet. & Develop. 3,226-231 [CrossRef][Medline] [Order article via Infotrieve]
  50. Kruys, V., and Huez, G. (1994) Biochimie (Paris) 76,862-866 [Medline] [Order article via Infotrieve]
  51. Lund, P. K. (1994) Growth Regulation 4,Suppl. 1, 1-5

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Interv.Home page
P. H. Stern
The Calcineurin-NFAT Pathway and Bone: Intriguing New Findings
Mol. Interv., August 1, 2006; 6(4): 193 - 196.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
J. Wang, M. F. Shannon, and I. G. Young
A role for Ets1, synergizing with AP-1 and GATA-3 in the regulation of IL-5 transcription in mouse Th2 lymphocytes
Int. Immunol., February 1, 2006; 18(2): 313 - 323.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. T. F. Schwenger, C. C. Kok, E. Arthaningtyas, M. A. Thomas, C. J. Sanderson, and V. A. Mordvinov
Specific Activation of Human Interleukin-5 Depends on de Novo Synthesis of an AP-1 Complex
J. Biol. Chem., November 27, 2002; 277(49): 47022 - 47027.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Arima, H. Toyama, H. Ichii, S. Kojima, S. Okada, M. Hatano, G. Cheng, M. Kubo, T. Fukuda, and T. Tokuhisa
A Putative Silencer Element in the IL-5 Gene Recognized by Bcl6
J. Immunol., July 15, 2002; 169(2): 829 - 836.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. S. Stranick, D. N. Zambas, A. S. Uss, R. W. Egan, M. M. Billah, and S. P. Umland
Identification of Transcription Factor Binding Sites Important in the Regulation of the Human Interleukin-5 Gene
J. Biol. Chem., June 27, 1997; 272(26): 16453 - 16465.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Stranick, K. S.
Right arrow Articles by Billah, M. M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Stranick, K. S.
Right arrow Articles by Billah, M. M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement