| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, March 2,
1995; and in revised form, June 15, 1995) From the
Using a biochemical approach, we have detected an activity in Saccharomyces cerevisiae extract that displays the same DNA
binding specificity as the mammalian E2F transcription factor and
interacts with TTTCGCGC promoter elements. Additional studies revealed
that this factor, termed SCELA (S. cerevisiae E2F-like
activity), also binds to the closely related SCB promoter sequences.
SCB sites (consensus: TTTCGTG) are involved in the cell cycle
regulation of several S. cerevisiae cyclin genes and have been
shown to interact with the heterodimeric yeast Swi4-Swi6 complex.
However, genetic studies clearly demonstrate that SCELA is not related
to Swi4 or Swi6. These experiments imply that SCB sites are able to
interact with at least two activities: Swi4-Swi6 and SCELA. Because SCB
sites are critical for the periodic activation of cell cycle genes, we
asked whether SCELA is regulated during yeast cell cycle. Employing a
temperature-sensitive strain, we were able to demonstrate that the DNA
binding activity of SCELA oscillates during the cell cycle and reaches
its maximum at the transition between the G
During the past decade, tremendous strides have been made toward
identifying the molecular mechanisms that govern the eucaryotic cell
cycle. Numerous studies clearly demonstrated that cyclin-dependent
kinases, in concert with various cyclins, are key elements of the
machinery that controls cell cycle progression (1) . Although
cyclin-dependent kinase/cyclin-mediated phosphorylation plays a pivotal
role in eucaryotic cell cycle regulation, it is clear that periodic
activation of transcription is equally crucial for the proper execution
of cell cycle events(2) . Although most genes are expressed at
approximately constant rates throughout the cell cycle, a limited
number of genes display a high degree of variation in their
transcription rate during the cell cycle. Genes that fall into the
latter category include those encoding products that control DNA
metabolism, structural proteins, and components of the basic cell cycle
regulatory machinery. Many of these genes are controlled by
promoter-specific transcription factors that are themselves subject to
cell cycle regulation. For example, the cell cycle-regulated
transcription of the mammalian histone H2B gene is mediated by
the Oct-1 transcription factor(3, 4) . Oct-1 activity
in turn is modulated during the cell cycle by a complex series of
phosphorylation events. Another well-documented example of
transcription factor fluctuation during the mammalian cell cycle
constitutes the E2F transcription factor(5) . E2F was
originally identified as an E1A-dependent activity that mediates
transcriptional activation of the adenoviral E2 early gene(6) .
Subsequent studies revealed that E2F also modulates the transcription
of several cellular target genes: dihydrofolate reductase, DNA
polymerase A
large body of evidence clearly shows that major aspects of cell cycle
control are conserved between mammals and yeast. For example,
cyclin-dependent kinases and cyclins are present in both species, and
the human cdc2 gene was cloned based on its ability to
complement a fission yeast cdc2 mutant(18) .
Furthermore, it is now clear that many transcription factors are
conserved throughout evolution(19, 20) . These
observations prompted us to ask whether there exists a yeast activity
that resembles E2F and carries out a similar cell cycle-related
function. An additional reason for selecting the yeast system is its
suitability for cell cycle investigations because of its powerful
genetic tools, vast array of cell cycle mutants, and almost effortless
accumulation of extracts for biochemical studies. Although approaches
to identify E2F-like factors in yeast based on sequence similarity have
not been successful(21) , we decided to take a biochemical
approach. This led to the identification of a 30-kDa fission yeast
protein that exhibits a number of E2F-like properties, including DNA
binding specificity and transcriptional activation(22) .
However, this factor is not cell cycle-regulated. We have now
continued our studies in budding yeast, Saccharomyces
cerevisiae. Using gel shift analysis, we have detected an activity
that displays a striking similarity to the mammalian E2F transcription
factor. That is, it recognizes the same DNA sequence, it interacts with
other cellular proteins, and it oscillates during the cell cycle. The
potential role of this activity in yeast cell cycle regulation is
discussed.
Figure 1:
Binding specificity
of SCELA. Gel shift reactions were initiated with 1 ng of radioactive
E2F oligonucleotide and 30 µg of heparin-agarose-purified yeast
extract in the presence of 1 µg of herring sperm DNA and 100-fold
molar excess of unlabeled oligonucleotides. The following unlabeled
oligonucleotides were used: lane 1, E2F (5`
ACTAGTTTCGCGCCCTTTCT 3`); lane 2, SCB (5` ACTAGTTTCGTGCCCTTTCT
3`); lane 3, MCB (5` ACTAGTGACGCGTCCTTTCT 3`); lane
4, none. The position of the shifted band is indicated by the arrow. In order to improve resolution of the DNA-protein
complex, the free probe was electrophoresed out of the
gel.
During the course of our studies, we noticed that the
utilized E2F site (TTTCGCGC) strongly resembles the consensus sequence
(TTTCGTC) of the SCB element family that are important promoter sites
involved in the cell cycle regulation of certain S. cerevisiae genes and that interact with the heterodimeric Swi4-Swi6
complex(25, 26) . In order to investigate whether
SCELA is also able to recognize SCB sites, we performed competition
experiments. As can be seen in Fig. 1, lane 2, the
DNA-binding protein identified in our laboratory not only interacts
with an authentic E2F site, but also recognizes an SCB element
(TTTCGTG). We have extended these DNA binding studies and summarized
the results in Table 1. As expected, the yeast E2F-like factor
interacts with oligonucleotides MYC and E2F, both of which contain
binding sites for the mammalian E2F transcription factor (TTTCCCGC and
TTTCGCGC, respectively). Furthermore, the factor is competed by
oligonucleotides SCB and SCB*, both of which contain well established
binding sites (TTTCGTG and TTTCGAG, respectively) for
Swi4-Swi6(27) . In addition, our yeast activity also binds to
oligonucleotides SCB
Finally, our data demonstrate that SCELA does
not interact with the MCB element (MluI cell cycle box,
consensus: TGACGCGT) ( Table 1and Fig. 1, lane
3). This promoter element is involved in the cell cycle regulation
of a set of S. cerevisiae genes controlled by the
heterodimeric Mbp1-Swi6 complex(28) . Our experiments suggest
that binding of SCELA is specific for the SCB-dependent genes.
Figure 2:
SCELA
is not related to Swi4 or Swi6. Gel shift reactions were performed as
outlined in the legend to Fig. 1. Extracts were prepared from
the following strains: BJ1991 (wild type, lane 1), JO34 (wild
type, lane 2), JO57-6B (devoid of Swi4, lane
3), and JO23 (devoid of Swi 6, lane 4). The position of
the gel shift is indicated by the arrow. wt, wild
type.
Figure 3:
Characterization of SCELA and associated
activities. A, gel shift reactions containing
heparin-agarose-purified material and labeled E2F oligonucleotide (5`
ACTAGTTTCGCGCCCTTTCT 3`) were subjected to UV light irradiation as
described under ``Experimental Procedures.'' Subsequently,
the material was analyzed on a 10% SDS-polyacrylamide gel. Competitions
were performed with 100-fold molar excess of unlabeled E2F
oligonucleotide (lane 3) or 100-fold molar excess of MCB
oligonucleotide (5` ACTAGTGACGCGTCCTTTCT 3`) (lane 2). Lane 1 shows the reaction without competitor. The positions of
protein markers are shown on the right. B, yeast
extract purified by sequential application of heparin-agarose and MonoQ
chromatography was layered onto a 15-45% (v/v) glycerol gradient.
Following centrifugation, fractions were collected and assayed by gel
shift as described in the legend to Fig. 1. The positions of
protein markers analyzed in parallel are depicted at the top.
The following markers were used:
Figure 4:
Cell cycle fluctuation of SCELA. A, a S. cerevisiae temperature-sensitive cdc15 mutant strain (W303-cdc15) was used to synchronize cells at
mid-anaphase by cultivating the cells at 37 °C for 5 h.
Subsequently, cells were shifted to the permissive temperature (30
°C), which releases the M phase block. Thereafter, aliquots of
cells were removed at 15-min intervals. Gel shifts were carried out as
described in the legend to Fig. 1with equal amounts of extracts
prepared from different time points. Budding analysis was performed in
parallel. B, yeast extract derived from heparin-agarose
chromatography was pretreated with agarose-immobilized calf intestinal
alkaline phosphatase (CIAP) for 30 min at 37 °C (lanes
2 and 5). After removal of the immobilized enzyme by
centrifugation, gel shift reactions were initiated as outlined under
``Experimental Procedures.'' The action of the phosphatase
can be blocked by addition of EDTA (lane 3). DNA binding of
the complex is partially restored by addition of the catalytic subunit
of kinase A (lane 6). Lanes 1 and 4 depict
reactions performed with phosphatase buffer
alone.
It is well established that
eucaryotic cells frequently use phosphorylation to execute cell cycle
control(1) . In a first attempt to determine the mechanism of
fluctuation for SCELA, we therefore investigated whether it is
sensitive to dephosphorylation. As can be seen in Fig. 4B, pretreatment of yeast extract with calf
intestinal alkaline phosphatase results in almost complete loss of the
DNA binding activity of SCELA (lanes 2 and 5). DNA
binding activity is partially restored by incubating calf intestinal
alkaline phosphatase-treated extract with the catalytic subunit of
kinase A (lane 6). We have repeated this experiment numerous
times and have always observed an increase of DNA binding activity upon
kinase A treatment. Furthermore, calf intestinal alkaline phosphatase
treatment in the presence of EDTA, which chelates zinc ions essential
for calf intestinal alkaline phosphatase activity, does not interfere
with DNA binding (lane 3). We have also shown that phosphatase
buffer alone has no effect on DNA binding (lanes 1 and 4). These control reactions clearly demonstrate that the loss
of DNA binding is a result of phosphatase action. In summary, we have identified and characterized a novel DNA
binding activity, termed SCELA, that is able to interact with several
members of the SCB site family in S. cerevisiae. It has been
demonstrated that in S. cerevisiae, SCB sites also interact
with the heterodimeric Swi4-Swi6 activity(25, 26) .
Our data clearly demonstrate that SCELA is distinct from these
activities and suggest that SCB sequences can bind to at least two
factors: Swi4-Swi6 and SCELA. Several lines of study strongly
implicate SCELA in the cell cycle regulation of yeast genes. Firstly,
the DNA binding activity of SCELA fluctuates during the cell cycle and
reaches its zenith in late G It is noteworthy that SCELA (S. cerevisiae E2F-like activity) exhibits an extraordinary degree of similarity
to the mammalian E2F transcription factor: 1) SCELA interacts with
several promoter elements that are also recognized by E2F. E2F sites
are transcriptionally active in S. cerevisiae, further
supporting our hypothesis that SCELA has transcriptional potential (32) . 2) In analogy to mammalian E2F, the DNA binding activity
of SCELA oscillates during the cell cycle and is affected by its
phosphorylation state(5, 33) . 3) Like E2F, SCELA
interacts with several cellular activities and forms a 300-kDa complex
in S. cerevisiae. E2F is known to interact with cyclins,
cyclin-dependent kinases, and members of the retinoblastoma gene
family(11, 12, 13) . At present, it is not
clear whether the 300-kDa SCELA-containing complex contains yeast
homologues of these mammalian proteins. However, the detection of such
activities bound to SCELA would considerably strengthen our notion that
SCELA carries out an E2F-like function in yeast. Experiments that will
provide answers to these questions and illuminate the role of SCELA in
cell cycle control have been initiated. Finally, a previous report
describes the identification of a 12-kDa activity in S. cerevisiae that also interacts with E2F elements(32) . This 12-kDa
factor does not fluctuate during the cell cycle and is not associated
with any other yeast proteins(32) . These results, combined
with the molecular mass discrepancy, clearly demonstrate that SCELA is
distinct from the 12-kDa protein.
Volume 270,
Number 35,
Issue of September 01, pp. 20724-20729, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
and S phases.
Preliminary studies suggest that this fluctuation is mediated by
phosphorylation/dephosphorylation events. Further characterization of
SCELA by UV cross-linking experiments indicate a molecular mass of 47
kDa for this activity. In addition, we present evidence strongly
suggesting that SCELA is actually the DNA binding moiety of a large
300-kDa protein complex. Together, these studies firmly indicate that
SCELA (as part of a larger complex) plays a critical role in cell cycle
regulation of SCB-containing genes, such as CLN cyclins and HO endonuclease. This hypothesis is consistent with other
studies that conclude that the SCB-mediated cell cycle oscillation of CLN cyclins and HO requires activities that are
distinct from Swi4-Swi6. Finally, it is worth mentioning that the
similarities between SCELA and E2F, which is a crucial component in
mammalian cell cycle regulation, extend well beyond the DNA binding
specificity. In analogy to E2F, SCELA oscillates during the cell cycle,
interacts with other cellular activities, and binds to promoter
elements that are known mediators of cell cycle control. We will
discuss possible functions for SCELA in yeast cell cycle regulation and
its relationship to E2F.
, cdc2, B-myb, all of which play an
important role in cell cycle progression and DNA
synthesis(7, 8, 9, 10) . In the case
of dihydrofolate reductase and B-myb, functional E2F binding
sites are essential for the cell cycle regulation of these
genes(7, 10) , establishing a direct link between E2F
and transcriptional oscillation during the mammalian cell cycle.
Furthermore, E2F forms a number of distinct complexes that contain
proteins known to be critical for proper cell cycle progression. Among
these proteins are the retinoblastoma anti-oncogene product, two
related activities (p107 and p130), cyclin A, cyclin E, and
cyclin-dependent kinase 2 (11, 12, 13) .
These E2F-containing complexes fluctuate during the cell cycle, again
suggesting that E2F plays an important role in this
process(13, 14) . E2F regulation is not limited to E2F
complexes, but it has been reported that the E2F-1 gene transcription
is induced during the late G phase of the cell
cycle(15) . Finally, a recent report describes that
microinjected E2F-1 protein is capable of driving quiescent cells back
into the S phase(16) . Together, these data establish E2F as a
pivotal player in cell cycle progression that links the cell cycle
machinery to the transcription apparatus. It is likely that E2F is also
involved in the cessation of cell growth that accompanies
differentiation, because E2F aggregates are regulated during P19 cell
differentiation along the neuroectodermal cell lineage (17) .
Mature neurons exit the cell cycle, and it is conceivable that the
observed fluctuation of E2F complexes participates in this event.
Yeast Strains
The following yeast strains were
used: BJ1991 (Genotype: prb1-1122 pep4-3 leu2
trp1 ura3-52 gal2), JO34 (Genotype: aTRP1
his3
124lacZ), JO57-6B (Genotype: aTRP1
his3124lacZ swi4 ura3-52 lys2-801 ade2-101
his3200 leu21), JO23 (Genotype: TRP1 swi6 ura3-52 lys2-801 ade2-101 his3200
leu21), and W303-cdc15 (Genotype: aade2-1
his3-11 his 3-15 leu2-3 leu2-112 trp1-1
ura3-1 cdc15-2).Preparation of Yeast Extract
The
protease-deficient S. cerevisiae strain BJ1991 obtained from
the Yeast Genetic Stock Center (University of California, Berkeley, CA)
was cultivated in YEPD medium (1% yeast extract, 2% Bacto-peptone, 2%
dextrose) at 30 °C. Yeast cells were washed in lysis buffer (10
mM Tris-HCl, pH 7.5, 5 mM KCl, 1.5 mM MgCl
, 1 mM DTT, ()0.5 mM phenylmethylsulfonyl fluoride) and pelleted by centrifugation
(1,000 g at 4 °C for 5 min with a Beckman AccuSpin
table top centrifuge). The cell pellet was resuspended in two volumes
of lysis buffer, and cells were broken by vortexing with acid-washed
glass beads 6 times for 30 s. The suspension of broken cells was
centrifuged (1,000
g at 4 °C for 5 min with a
Beckman AccuSpin table top centrifuge), and the supernatant was saved.
The sedimented cell debris was extracted with 20 mM Tris-HCl,
pH 7.5, 400 mM NaCl, 1 mM EDTA, 10% glycerol, 1
mM DTT, and 0.5 mM phenylmethylsulfonyl fluoride for
60 min at 4 °C on a rocker. The resulting extract was combined with
the glass bead-derived supernatant and dialyzed overnight at 4 °C
against an excess of dialysis buffer (20 mM Tris-HCl, pH 7.5,
50 mM NaCl, 1 mM EDTA, 10% glycerol, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride). Insoluble
materials were removed by a centrifugation step (10,000 rpm at 4 °C
for 30 min with a SS34 rotor), and the dialyzed extract was stored in
aliquots at -70 °C. Extracts from the other strains were
prepared via the same protocol.
Heparin-Agarose and MonoQ Chromatography
Yeast
cell extract (800 mg) was applied onto a 40-ml column of
heparin-agarose (Sigma) equilibrated with 20 mM Tris-HCl, pH
7.5, 100 mM NaCl, 1 mM EDTA, 10% glycerol, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride (abbreviated as
0.1A where 0.1 is the molarity of NaCl). The column was washed with 5
volumes of 0.1A, and protein was eluted using 4 volumes of a 0.1A-1.0A
gradient. Subsequently, individual fractions were analyzed by gel shift
assay as outlined below. Positive fractions were pooled and dialyzed
against dialysis buffer. Pooled heparin-agarose material was loaded
onto a 25-ml column of MonoQ (Pharmacia Biotech Inc.) that had been
equilibrated with 0.1A buffer. Subsequently, SCELA-containing material
was eluted with 4 volumes of 0.1A. Following dialysis, the material was
used for glycerol gradient fractionation or DNA affinity
chromatography.
Glycerol Gradients
3 ml of MonoQ-derived material
(5 mg/ml) was layered onto 35 ml of 15-45% glycerol gradients (20
mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA,
15-45% glycerol, 1 mM DTT, 0.5 mM
phenylmethylsulfonyl fluoride). Gradients were centrifuged in an SW28
rotor at 28,000 rpm for 48 h at 4 °C. At the end of the run, tubes
were punctured, and 1.3-ml fractions were collected from the bottom.
Individual fractions were analyzed by gel shift as described below.DNA Affinity Chromatography
Samples derived from
MonoQ chromatography or glycerol gradient fractionation were applied
onto a 2-ml column of DNA affinity matrix that contained ligated
double-stranded E2F oligonucleotides (strand 1, 5` ACTAGTTTCGCGCCCTTTCT
3`; strand 2, 5` AGAAAGGGCGCGAAACTAGT 3`) as outlined by Kadonaga and
Tjian(23) . The column was washed with 3 column volumes of 0.1A
and then eluted with 3 volumes of 0.5A. Following dialysis, the eluted
material was concentrated by ultrafiltration and used for gel shift
analysis or SDS-polyacrylamide gel electrophoresis.Gel Shift Assay and Oligonucleotides
Binding of
the SCELA-containing complex to DNA oligonucleotides was initiated by
mixing the following components: 1 ng of kinased double-stranded
oligonucleotide, binding buffer (20 mM Tris-HCl, pH 7.5, 5%
glycerol, 40 mM KCl, 1 mM MgCl, 0.5
mM DTT, 1 mM EDTA), 1 µg of sonicated and
denatured herring sperm DNA, and 30 µg of extract. The total
reaction mixture was 50 µl. After 30 min at room temperature, the
samples were loaded onto a 4% polyacrylamide gel
(acrylamide/bisacrylamide, 29:1). Electrophoresis was performed for
60-90 min at 150 V at room temperature. Subsequently, the gel was
dried and subjected to autoradiography. The following double-stranded
DNA oligonucleotides were employed (only one strand is shown): E2F, 5`
ACTAGTTTCGCGCCCTTTCT 3`; MYC, 5` ACTAGTTTCCCGCCCTTTCT 3`; SCB, 5`
ACTAGTTTCGTGCCCTTTCT 3`; SCB*, 5` ACTAGTTTCGAGCCCTTTCT 3`;
SCB, 5` ACATGATTTTCGTGGGATCA 3`; SCB-1, 5`
ACTAGTTTCGTTCCCTTTCT 3`; SCB-2, 5` ACTAGTTTCGTACCCTTTCT 3`; SCB3, 5`
(TTTTCGTGGATCGA)
3`; SCBm1, 5` ACTAGTTGCGTGCCCTTTCT 3`;
SCBm2, 5` ACTAGTTTTGTGCCCTTTCT 3`; and MCB, 5` ACTAGTGACGCGTCCTTTCT 3`. Phosphatase Treatment
BJ1991 extract purified by
heparin-agarose chromatography was incubated with agarose-bound calf
intestinal alkaline phosphatase (purchased from Sigma) at 37 °C in
20 mM Tris-HCl, pH 8.0, 1 mM MgSO
, 1
mM ZnSO. After 30 min, the immobilized calf
intestinal alkaline phosphatase was removed by centrifugation (1-min
spin in an Eppendorf centrifuge), and the treated extract was used for
gel shift reactions (cf. above). Inhibition of calf intestinal
alkaline phosphatase activity was accomplished by adding 20 mM EDTA to the reaction mixture. In order to restore the DNA binding
activity of SCELA, the pretreated extract (after removal of
agarose-bound calf intestinal alkaline phosphatase) was incubated with
100 units of the catalytic subunit of kinase A (Sigma) in the presence
of 5 mM ATP and 5 mM MgSO. After 30 min
at 37 °C, the extract was used to initiate gel shifts.UV Cross-linking
Photochemical cross-linking was
performed as described previously (22) with minor
modifications. The gel shift reaction mixture was placed onto parafilm
and subjected to UV irradiation (225-nm filter) for 10 min at a
distance of 8 cm. DNA-protein adducts were analyzed on a 10%
SDS-polyacrylamide gel following standard protocols(24) .
DNA Binding Specificity of SCELA
Using a gel
retardation assay, we have detected an activity in S. cerevisiae extract that recognizes an E2F binding site, TTTCGCGC, that is
present in several promoters of mammalian cell cycle-regulated genes (Fig. 1, lane 4). The gel shift can be competed out
with an excess of unlabeled E2F oligonucleotide (Fig. 1, lane 1) but is not affected by an unrelated DNA
oligonucleotide (Fig. 1, lane 3), indicating that the
yeast factor binds specifically to the E2F recognition site. We have
named this DNA binding factor S. cerevisiae E2F-like activity
(SCELA).
and SCB3 (contains three contiguous
SCB sites), both of which contain perfect SCB sites but have flanking
sequences that differ from the ones present in SCB and
SCB*(27) . We repeated these studies numerous times and always
detected competition with SCB site-containing oligonucleotides.
Together, this clearly shows that certain members of the SCB site
family are recognized by SCELA as well as Swi4-Swi6. However, we have
identified one authentic SCB site (27) , TTTCGTT (oligo SCB-1),
that does not interact with SCELA (Table 1). Another native SCB
site(27) , TTTCGTA (oligo SCB-2), recognizes SCELA only poorly (Table 1). In contrast, both SCB-1 and SCB-2 bind Swi4-Swi6 with
high affinity ( Table 1and (27) ). Conversely, two
mutated SCB family members that do not recognize Swi4-Swi6 (TTGCGTG in
oligo SCBm1 and TTTTGTG in oligo SCBm2) clearly bind SCELA ( Table 1and (27) ). These experiments unequivocally show
that although SCELA is able to recognize several members of the SCB
site family, its DNA binding specificity differs from the one displayed
by Swi4-Swi6. This is corroborated by the fact that Swi4-Swi6 is not
able to interact with an oligonucleotide that contains only a single
SCB site (27) . (
)SCELA, on the other hand, binds to
single as well as contiguous SCB sites (Table 1). Furthermore,
studies carried out by Andrews and Moore demonstrated that some SCB
family members are virtually identical to the E2F sequence (TTTCGCGC)
and are recognized by Swi4-Swi6 ( Table 1and (27) ).
Close inspection of the genes that are regulated by Swi4-Swi6 led to
the identification of two SCB sites in the HCS26 promoter and
one in the HO promoter that are perfect matches of the E2F
recognition site(27) . This suggests that the E2F binding site
is actually a member of the SCB element family and interacts with SCELA
as well as Swi4-Swi6.
SCELA Is Not Related to Swi4-Swi6
According to the
described experiments, we have identified a yeast activity, termed
SCELA, that is able to interact with DNA binding sites that are also
recognized by Swi4-Swi6. In order to rule out that the protein
identified in our laboratory is related to Swi4-Swi6, we performed gel
shift reactions with yeast mutant strains that are devoid of Swi4 or
Swi6, respectively. The experiment in Fig. 2unequivocally
demonstrates that SCELA is present in the absence of Swi4 or Swi6
protein, respectively (Fig. 2, lanes 3 and 4).
This observation clearly distinguishes the E2F-like activity from
Swi4-Swi6 and shows that SCB elements are able to interact with at
least two yeast activities: Swi4-Swi6 and SCELA. Further, we have
employed antibodies specific for Swi4 and Swi6. Although these reagents
react with DNA-bound Swi4-Swi6 heterodimers(26) , they do not
affect DNA-bound SCELA (not shown). It has been postulated that SCB
sequences are able to interact with proteins distinct from
Swi4-Swi6(29, 30) , a notion that is consistent with
our data.
SCELA Is an Integral Component of a 300-kDa
Complex
In order to characterize SCELA biochemically, we
initially determined its molecular mass by performing a UV
cross-linking experiment. Fig. 3A, lane 1 shows the DNA-protein complex formed between the E2F
oligonucleotide and SCELA. Subtraction of the molecular mass for the
oligonucleotide indicates a molecular mass of 47 kDa for the
DNA-binding protein. Again, competition experiments clearly show that
the interaction between the E2F oligonucleotide and the 47-kDa large
SCELA is specific (Fig. 3A, lanes 2 and 3). Additional characterization involved the use of glycerol
gradient centrifugations. DNA binding activity derived from sequential
application of heparin-agarose and MonoQ chromatography was analyzed on
a 15-45% glycerol gradient. Comparison with protein markers that
were sedimented in parallel suggested a molecular mass of approximately
300 kDa for the activity that interacts with E2F oligonucleotide (Fig. 3B). In order to confirm this result, we employed
an additional method for molecular mass determination. This technique
relies on non-denaturing polyacrylamide gel electrophoresis and has
been successfully used for the sizing of DNA-bound
activities(31) . Application of this method also yielded a
molecular mass of 300 kDa (not shown). One possible explanation for
this surprising outcome was that SCELA (47 kDa) oligomerizes under
certain conditions to form large (300 kDa) aggregates. Alternatively,
it is conceivable that SCELA is actually the DNA binding moiety of an
approximately 300-kDa large protein complex. Interestingly, this
possibility is reminiscent of the other two S. cerevisiae activities that interact with promoter elements involved in cell
cycle regulation, i.e. Swi4-Swi6 and
Mbp1-Swi6(25, 26, 28) . In both cases,
DNA-binding proteins (Swi4 and Mbp1) interact with another protein
(Swi6) to form a large DNA-bound aggregate. In order to reveal the
actual composition of the 300-kDa complex, glycerol gradient-derived
material was purified over a DNA affinity column harboring ligated E2F
oligonucleotides. The DNA affinity column was washed with low salt
buffer, and bound proteins were subsequently eluted in the presence of
0.5 M NaCl. The eluted material retains its DNA binding
activity and gives rise to the gel shift pattern typical of the 300-kDa
complex (not shown). In addition, analysis of the affinity column
material on SDS-polyacrylamide gels consistently revealed several major
protein bands (Fig. 3C). As expected, the column eluate
contains the 47-kDa large SCELA protein (Fig. 3C, band 4), which, according to our UV cross-linking studies (Fig. 3A), recognizes the E2F oligonucleotide. We have
performed this affinity purification numerous times and always detect
additional proteins with approximate molecular masses of 110, 90, and
65 kDa (Fig. 3C, bands 1, 2, and 3, respectively). In summary, these data are consistent with
SCELA being the DNA binding component of a large 300-kDa complex.
-amylase (200kD) and
apoferritin (440kD). C, glycerol
gradient-fractionated material was loaded onto a 2-ml DNA affinity
column. The column material consisted of ligated double-stranded E2F
oligonucleotides (5` ACTAGTTTCGCGCCCTTTCT 3`) covalently linked to an
agarose matrix. After washing, bound proteins were eluted with buffer
containing 0.5 M NaCl and analyzed on a 10% SDS-polyacrylamide
gel. The positions of protein markers are indicated on the left.
DNA Binding Activity of SCELA Is Cell
Cycle-regulated
According to the experiments summarized in Table 1, SCELA (as part of the 300-kDa complex) interacts with
oligonucleotides that contain E2F as well as SCB recognition sites.
Because SCB sequences are crucial elements for cell cycle control (25, 26, 27) , we asked whether SCELA
fluctuates during the yeast cell cycle. For this purpose, we arrested a
temperature-sensitive yeast cdc15 strain at the M phase by
cultivating yeast cells at the nonpermissive temperature. Subsequently,
the synchronized cells were released from the cell cycle block, and
aliquots prepared in 15-min intervals were assayed by gel shift. The
result of this experiment is depicted in Fig. 4A. The
gel shift pattern clearly shows that the DNA binding activity of SCELA
oscillates during the cell cycle. We have measured the DNA content of
the yeast cells by fluorescence-activated cell sorting (not shown).
This clearly confirmed that cell arrest took place in the M phase and
that the cells were synchronized following release. It also revealed
that the DNA binding activity of SCELA peaks at the G/S
transition phase. The timing of these cell cycle events is also
consistent with a budding analysis performed in our laboratory (cf.Fig. 4A).
or early S phase. It is likely
that this fluctuation is mediated by phosphorylation/dephosphorylation
events (cf.Fig. 4B). Secondly, SCELA binds to cis-acting promoter elements that are critical for cell cycle
fluctuation. The sites recognized by SCELA belong to the SCB element
family and reside in the promoters of cyclins (CLN1, CLN2, HCS26) and the HO gene(27) .
It is well established that mutation of the SCB sites disrupts cell
cycle regulation of the above genes. Furthermore, the three cyclins and
the HO gene attain their highest level around the G phase, which is consistent with SCELA being involved in their
cell cycle control. Thirdly, in the absence of Swi4 and/or Swi6, cell
cycle regulation of SCB-containing genes is impaired but not
eliminated(29, 30) . This observation has led to the
hypothesis that SCB-containing genes are not controlled only by
Swi4-Swi6, but another unidentified regulator is involved. It is
obvious that SCELA fulfills all the requirements for this putative
regulator. We therefore propose that the cell cycle fluctuation of CLN1, CLN2, HCS26, and HO is
controlled by at least two activities: Swi4-Swi6 and SCELA. According
to our results, the DNA binding specificities of SCELA and Swi4-Swi6
are not identical, and SCELA interacts only with a subset of the SCB
sites that are recognized by Swi4-Swi6 (cf.Table 1).
However, all the SCB elements that bind SCELA are found in the
promoters of the four above mentioned genes. This suggests that SCELA
and Swi4-Swi6 are not merely redundant activities but that they mediate
slightly different aspects of cell cycle regulation. Genetic studies
firmly indicate that the cell cycle regulation of CLN1, CLN2, and HO consists of at least three levels, two
of which are controlled by Swi4 and Swi6(30) . It is therefore
likely that SCELA is involved in the third level of cell cycle
fluctuation.
))
We are grateful to Joe Ogas and Bruce Futcher for
providing us with yeast strains. We are also indebted to Todd Sladek
for performing fluorescence-activated cell sorting analysis.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  A. K. Machado, B. A. Morgan, and G. F. Merrill Thioredoxin Reductase-dependent Inhibition of MCB Cell Cycle Box Activity in Saccharomyces cerevisiae J. Biol. Chem., July 4, 1997; 272(27): 17045 - 17054. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
R. S. Cuevo, S. Garrett, and J. M. Horowitz Detection and Functional Characterization of p180, a Novel Cell Cycle Regulated Yeast Transcription Factor That Binds Retinoblastoma Control Elements J. Biol. Chem., February 7, 1997; 272(6): 3813 - 3822. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
