JBC Origene Your Gene Company

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vemu, S.
Right arrow Articles by Reichel, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vemu, S.
Right arrow Articles by Reichel, R. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 35, Issue of September 01, pp. 20724-20729, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Cell Cycle Regulation of a Novel DNA Binding Complex in Saccharomyces cerevisiae with E2F-like Properties (*)

(Received for publication, March 2, 1995; and in revised form, June 15, 1995)

Sheela Vemu Ronald R. Reichel (§)

From the Department of Pharmacology and Molecular Biology, The Chicago Medical School, North Chicago, Illinois 60064

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Using a biochemical approach, we have detected an activity in Saccharomyces cerevisiae extract that displays the same DNA binding specificity as the mammalian E2F transcription factor and interacts with TTTCGCGC promoter elements. Additional studies revealed that this factor, termed SCELA (S. cerevisiae E2F-like activity), also binds to the closely related SCB promoter sequences. SCB sites (consensus: TTTCGTG) are involved in the cell cycle regulation of several S. cerevisiae cyclin genes and have been shown to interact with the heterodimeric yeast Swi4-Swi6 complex. However, genetic studies clearly demonstrate that SCELA is not related to Swi4 or Swi6. These experiments imply that SCB sites are able to interact with at least two activities: Swi4-Swi6 and SCELA. Because SCB sites are critical for the periodic activation of cell cycle genes, we asked whether SCELA is regulated during yeast cell cycle. Employing a temperature-sensitive strain, we were able to demonstrate that the DNA binding activity of SCELA oscillates during the cell cycle and reaches its maximum at the transition between the G(1) and S phases. Preliminary studies suggest that this fluctuation is mediated by phosphorylation/dephosphorylation events. Further characterization of SCELA by UV cross-linking experiments indicate a molecular mass of 47 kDa for this activity. In addition, we present evidence strongly suggesting that SCELA is actually the DNA binding moiety of a large 300-kDa protein complex. Together, these studies firmly indicate that SCELA (as part of a larger complex) plays a critical role in cell cycle regulation of SCB-containing genes, such as CLN cyclins and HO endonuclease. This hypothesis is consistent with other studies that conclude that the SCB-mediated cell cycle oscillation of CLN cyclins and HO requires activities that are distinct from Swi4-Swi6. Finally, it is worth mentioning that the similarities between SCELA and E2F, which is a crucial component in mammalian cell cycle regulation, extend well beyond the DNA binding specificity. In analogy to E2F, SCELA oscillates during the cell cycle, interacts with other cellular activities, and binds to promoter elements that are known mediators of cell cycle control. We will discuss possible functions for SCELA in yeast cell cycle regulation and its relationship to E2F.


INTRODUCTION

During the past decade, tremendous strides have been made toward identifying the molecular mechanisms that govern the eucaryotic cell cycle. Numerous studies clearly demonstrated that cyclin-dependent kinases, in concert with various cyclins, are key elements of the machinery that controls cell cycle progression (1) . Although cyclin-dependent kinase/cyclin-mediated phosphorylation plays a pivotal role in eucaryotic cell cycle regulation, it is clear that periodic activation of transcription is equally crucial for the proper execution of cell cycle events(2) . Although most genes are expressed at approximately constant rates throughout the cell cycle, a limited number of genes display a high degree of variation in their transcription rate during the cell cycle. Genes that fall into the latter category include those encoding products that control DNA metabolism, structural proteins, and components of the basic cell cycle regulatory machinery. Many of these genes are controlled by promoter-specific transcription factors that are themselves subject to cell cycle regulation. For example, the cell cycle-regulated transcription of the mammalian histone H2B gene is mediated by the Oct-1 transcription factor(3, 4) . Oct-1 activity in turn is modulated during the cell cycle by a complex series of phosphorylation events.

Another well-documented example of transcription factor fluctuation during the mammalian cell cycle constitutes the E2F transcription factor(5) . E2F was originally identified as an E1A-dependent activity that mediates transcriptional activation of the adenoviral E2 early gene(6) . Subsequent studies revealed that E2F also modulates the transcription of several cellular target genes: dihydrofolate reductase, DNA polymerase alpha, cdc2, B-myb, all of which play an important role in cell cycle progression and DNA synthesis(7, 8, 9, 10) . In the case of dihydrofolate reductase and B-myb, functional E2F binding sites are essential for the cell cycle regulation of these genes(7, 10) , establishing a direct link between E2F and transcriptional oscillation during the mammalian cell cycle. Furthermore, E2F forms a number of distinct complexes that contain proteins known to be critical for proper cell cycle progression. Among these proteins are the retinoblastoma anti-oncogene product, two related activities (p107 and p130), cyclin A, cyclin E, and cyclin-dependent kinase 2 (11, 12, 13) . These E2F-containing complexes fluctuate during the cell cycle, again suggesting that E2F plays an important role in this process(13, 14) . E2F regulation is not limited to E2F complexes, but it has been reported that the E2F-1 gene transcription is induced during the late G(1) phase of the cell cycle(15) . Finally, a recent report describes that microinjected E2F-1 protein is capable of driving quiescent cells back into the S phase(16) . Together, these data establish E2F as a pivotal player in cell cycle progression that links the cell cycle machinery to the transcription apparatus. It is likely that E2F is also involved in the cessation of cell growth that accompanies differentiation, because E2F aggregates are regulated during P19 cell differentiation along the neuroectodermal cell lineage (17) . Mature neurons exit the cell cycle, and it is conceivable that the observed fluctuation of E2F complexes participates in this event.

A large body of evidence clearly shows that major aspects of cell cycle control are conserved between mammals and yeast. For example, cyclin-dependent kinases and cyclins are present in both species, and the human cdc2 gene was cloned based on its ability to complement a fission yeast cdc2 mutant(18) . Furthermore, it is now clear that many transcription factors are conserved throughout evolution(19, 20) . These observations prompted us to ask whether there exists a yeast activity that resembles E2F and carries out a similar cell cycle-related function. An additional reason for selecting the yeast system is its suitability for cell cycle investigations because of its powerful genetic tools, vast array of cell cycle mutants, and almost effortless accumulation of extracts for biochemical studies. Although approaches to identify E2F-like factors in yeast based on sequence similarity have not been successful(21) , we decided to take a biochemical approach. This led to the identification of a 30-kDa fission yeast protein that exhibits a number of E2F-like properties, including DNA binding specificity and transcriptional activation(22) . However, this factor is not cell cycle-regulated.

We have now continued our studies in budding yeast, Saccharomyces cerevisiae. Using gel shift analysis, we have detected an activity that displays a striking similarity to the mammalian E2F transcription factor. That is, it recognizes the same DNA sequence, it interacts with other cellular proteins, and it oscillates during the cell cycle. The potential role of this activity in yeast cell cycle regulation is discussed.


EXPERIMENTAL PROCEDURES

Yeast Strains

The following yeast strains were used: BJ1991 (Genotype: alpha prb1-1122 pep4-3 leu2 trp1 ura3-52 gal2), JO34 (Genotype: aTRP1 his3Delta124lacZ), JO57-6B (Genotype: aTRP1 his3Delta124lacZ swi4Delta ura3-52 lys2-801 ade2-101 his3Delta200 leu2Delta1), JO23 (Genotype: alpha TRP1 swi6Delta ura3-52 lys2-801 ade2-101 his3Delta200 leu2Delta1), and W303-cdc15 (Genotype: aade2-1 his3-11 his 3-15 leu2-3 leu2-112 trp1-1 ura3-1 cdc15-2).

Preparation of Yeast Extract

The protease-deficient S. cerevisiae strain BJ1991 obtained from the Yeast Genetic Stock Center (University of California, Berkeley, CA) was cultivated in YEPD medium (1% yeast extract, 2% Bacto-peptone, 2% dextrose) at 30 °C. Yeast cells were washed in lysis buffer (10 mM Tris-HCl, pH 7.5, 5 mM KCl, 1.5 mM MgCl(2), 1 mM DTT, (^1)0.5 mM phenylmethylsulfonyl fluoride) and pelleted by centrifugation (1,000 g at 4 °C for 5 min with a Beckman AccuSpin table top centrifuge). The cell pellet was resuspended in two volumes of lysis buffer, and cells were broken by vortexing with acid-washed glass beads 6 times for 30 s. The suspension of broken cells was centrifuged (1,000 g at 4 °C for 5 min with a Beckman AccuSpin table top centrifuge), and the supernatant was saved. The sedimented cell debris was extracted with 20 mM Tris-HCl, pH 7.5, 400 mM NaCl, 1 mM EDTA, 10% glycerol, 1 mM DTT, and 0.5 mM phenylmethylsulfonyl fluoride for 60 min at 4 °C on a rocker. The resulting extract was combined with the glass bead-derived supernatant and dialyzed overnight at 4 °C against an excess of dialysis buffer (20 mM Tris-HCl, pH 7.5, 50 mM NaCl, 1 mM EDTA, 10% glycerol, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride). Insoluble materials were removed by a centrifugation step (10,000 rpm at 4 °C for 30 min with a SS34 rotor), and the dialyzed extract was stored in aliquots at -70 °C. Extracts from the other strains were prepared via the same protocol.

Heparin-Agarose and MonoQ Chromatography

Yeast cell extract (800 mg) was applied onto a 40-ml column of heparin-agarose (Sigma) equilibrated with 20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 10% glycerol, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride (abbreviated as 0.1A where 0.1 is the molarity of NaCl). The column was washed with 5 volumes of 0.1A, and protein was eluted using 4 volumes of a 0.1A-1.0A gradient. Subsequently, individual fractions were analyzed by gel shift assay as outlined below. Positive fractions were pooled and dialyzed against dialysis buffer. Pooled heparin-agarose material was loaded onto a 25-ml column of MonoQ (Pharmacia Biotech Inc.) that had been equilibrated with 0.1A buffer. Subsequently, SCELA-containing material was eluted with 4 volumes of 0.1A. Following dialysis, the material was used for glycerol gradient fractionation or DNA affinity chromatography.

Glycerol Gradients

3 ml of MonoQ-derived material (5 mg/ml) was layered onto 35 ml of 15-45% glycerol gradients (20 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA, 15-45% glycerol, 1 mM DTT, 0.5 mM phenylmethylsulfonyl fluoride). Gradients were centrifuged in an SW28 rotor at 28,000 rpm for 48 h at 4 °C. At the end of the run, tubes were punctured, and 1.3-ml fractions were collected from the bottom. Individual fractions were analyzed by gel shift as described below.

DNA Affinity Chromatography

Samples derived from MonoQ chromatography or glycerol gradient fractionation were applied onto a 2-ml column of DNA affinity matrix that contained ligated double-stranded E2F oligonucleotides (strand 1, 5` ACTAGTTTCGCGCCCTTTCT 3`; strand 2, 5` AGAAAGGGCGCGAAACTAGT 3`) as outlined by Kadonaga and Tjian(23) . The column was washed with 3 column volumes of 0.1A and then eluted with 3 volumes of 0.5A. Following dialysis, the eluted material was concentrated by ultrafiltration and used for gel shift analysis or SDS-polyacrylamide gel electrophoresis.

Gel Shift Assay and Oligonucleotides

Binding of the SCELA-containing complex to DNA oligonucleotides was initiated by mixing the following components: 1 ng of kinased double-stranded oligonucleotide, binding buffer (20 mM Tris-HCl, pH 7.5, 5% glycerol, 40 mM KCl, 1 mM MgCl(2), 0.5 mM DTT, 1 mM EDTA), 1 µg of sonicated and denatured herring sperm DNA, and 30 µg of extract. The total reaction mixture was 50 µl. After 30 min at room temperature, the samples were loaded onto a 4% polyacrylamide gel (acrylamide/bisacrylamide, 29:1). Electrophoresis was performed for 60-90 min at 150 V at room temperature. Subsequently, the gel was dried and subjected to autoradiography. The following double-stranded DNA oligonucleotides were employed (only one strand is shown): E2F, 5` ACTAGTTTCGCGCCCTTTCT 3`; MYC, 5` ACTAGTTTCCCGCCCTTTCT 3`; SCB, 5` ACTAGTTTCGTGCCCTTTCT 3`; SCB*, 5` ACTAGTTTCGAGCCCTTTCT 3`; SCB, 5` ACATGATTTTCGTGGGATCA 3`; SCB-1, 5` ACTAGTTTCGTTCCCTTTCT 3`; SCB-2, 5` ACTAGTTTCGTACCCTTTCT 3`; SCB3, 5` (TTTTCGTGGATCGA)(3) 3`; SCBm1, 5` ACTAGTTGCGTGCCCTTTCT 3`; SCBm2, 5` ACTAGTTTTGTGCCCTTTCT 3`; and MCB, 5` ACTAGTGACGCGTCCTTTCT 3`.

Phosphatase Treatment

BJ1991 extract purified by heparin-agarose chromatography was incubated with agarose-bound calf intestinal alkaline phosphatase (purchased from Sigma) at 37 °C in 20 mM Tris-HCl, pH 8.0, 1 mM MgSO(4), 1 mM ZnSO(4). After 30 min, the immobilized calf intestinal alkaline phosphatase was removed by centrifugation (1-min spin in an Eppendorf centrifuge), and the treated extract was used for gel shift reactions (cf. above). Inhibition of calf intestinal alkaline phosphatase activity was accomplished by adding 20 mM EDTA to the reaction mixture. In order to restore the DNA binding activity of SCELA, the pretreated extract (after removal of agarose-bound calf intestinal alkaline phosphatase) was incubated with 100 units of the catalytic subunit of kinase A (Sigma) in the presence of 5 mM ATP and 5 mM MgSO(4). After 30 min at 37 °C, the extract was used to initiate gel shifts.

UV Cross-linking

Photochemical cross-linking was performed as described previously (22) with minor modifications. The gel shift reaction mixture was placed onto parafilm and subjected to UV irradiation (225-nm filter) for 10 min at a distance of 8 cm. DNA-protein adducts were analyzed on a 10% SDS-polyacrylamide gel following standard protocols(24) .


RESULTS

DNA Binding Specificity of SCELA

Using a gel retardation assay, we have detected an activity in S. cerevisiae extract that recognizes an E2F binding site, TTTCGCGC, that is present in several promoters of mammalian cell cycle-regulated genes (Fig. 1, lane 4). The gel shift can be competed out with an excess of unlabeled E2F oligonucleotide (Fig. 1, lane 1) but is not affected by an unrelated DNA oligonucleotide (Fig. 1, lane 3), indicating that the yeast factor binds specifically to the E2F recognition site. We have named this DNA binding factor S. cerevisiae E2F-like activity (SCELA).


Figure 1: Binding specificity of SCELA. Gel shift reactions were initiated with 1 ng of radioactive E2F oligonucleotide and 30 µg of heparin-agarose-purified yeast extract in the presence of 1 µg of herring sperm DNA and 100-fold molar excess of unlabeled oligonucleotides. The following unlabeled oligonucleotides were used: lane 1, E2F (5` ACTAGTTTCGCGCCCTTTCT 3`); lane 2, SCB (5` ACTAGTTTCGTGCCCTTTCT 3`); lane 3, MCB (5` ACTAGTGACGCGTCCTTTCT 3`); lane 4, none. The position of the shifted band is indicated by the arrow. In order to improve resolution of the DNA-protein complex, the free probe was electrophoresed out of the gel.



During the course of our studies, we noticed that the utilized E2F site (TTTCGCGC) strongly resembles the consensus sequence (TTTCGTC) of the SCB element family that are important promoter sites involved in the cell cycle regulation of certain S. cerevisiae genes and that interact with the heterodimeric Swi4-Swi6 complex(25, 26) . In order to investigate whether SCELA is also able to recognize SCB sites, we performed competition experiments. As can be seen in Fig. 1, lane 2, the DNA-binding protein identified in our laboratory not only interacts with an authentic E2F site, but also recognizes an SCB element (TTTCGTG). We have extended these DNA binding studies and summarized the results in Table 1. As expected, the yeast E2F-like factor interacts with oligonucleotides MYC and E2F, both of which contain binding sites for the mammalian E2F transcription factor (TTTCCCGC and TTTCGCGC, respectively). Furthermore, the factor is competed by oligonucleotides SCB and SCB*, both of which contain well established binding sites (TTTCGTG and TTTCGAG, respectively) for Swi4-Swi6(27) . In addition, our yeast activity also binds to oligonucleotides SCB and SCB3 (contains three contiguous SCB sites), both of which contain perfect SCB sites but have flanking sequences that differ from the ones present in SCB and SCB*(27) . We repeated these studies numerous times and always detected competition with SCB site-containing oligonucleotides. Together, this clearly shows that certain members of the SCB site family are recognized by SCELA as well as Swi4-Swi6. However, we have identified one authentic SCB site (27) , TTTCGTT (oligo SCB-1), that does not interact with SCELA (Table 1). Another native SCB site(27) , TTTCGTA (oligo SCB-2), recognizes SCELA only poorly (Table 1). In contrast, both SCB-1 and SCB-2 bind Swi4-Swi6 with high affinity ( Table 1and (27) ). Conversely, two mutated SCB family members that do not recognize Swi4-Swi6 (TTGCGTG in oligo SCBm1 and TTTTGTG in oligo SCBm2) clearly bind SCELA ( Table 1and (27) ). These experiments unequivocally show that although SCELA is able to recognize several members of the SCB site family, its DNA binding specificity differs from the one displayed by Swi4-Swi6. This is corroborated by the fact that Swi4-Swi6 is not able to interact with an oligonucleotide that contains only a single SCB site (27) . (^2)SCELA, on the other hand, binds to single as well as contiguous SCB sites (Table 1). Furthermore, studies carried out by Andrews and Moore demonstrated that some SCB family members are virtually identical to the E2F sequence (TTTCGCGC) and are recognized by Swi4-Swi6 ( Table 1and (27) ). Close inspection of the genes that are regulated by Swi4-Swi6 led to the identification of two SCB sites in the HCS26 promoter and one in the HO promoter that are perfect matches of the E2F recognition site(27) . This suggests that the E2F binding site is actually a member of the SCB element family and interacts with SCELA as well as Swi4-Swi6.



Finally, our data demonstrate that SCELA does not interact with the MCB element (MluI cell cycle box, consensus: TGACGCGT) ( Table 1and Fig. 1, lane 3). This promoter element is involved in the cell cycle regulation of a set of S. cerevisiae genes controlled by the heterodimeric Mbp1-Swi6 complex(28) . Our experiments suggest that binding of SCELA is specific for the SCB-dependent genes.

SCELA Is Not Related to Swi4-Swi6

According to the described experiments, we have identified a yeast activity, termed SCELA, that is able to interact with DNA binding sites that are also recognized by Swi4-Swi6. In order to rule out that the protein identified in our laboratory is related to Swi4-Swi6, we performed gel shift reactions with yeast mutant strains that are devoid of Swi4 or Swi6, respectively. The experiment in Fig. 2unequivocally demonstrates that SCELA is present in the absence of Swi4 or Swi6 protein, respectively (Fig. 2, lanes 3 and 4). This observation clearly distinguishes the E2F-like activity from Swi4-Swi6 and shows that SCB elements are able to interact with at least two yeast activities: Swi4-Swi6 and SCELA. Further, we have employed antibodies specific for Swi4 and Swi6. Although these reagents react with DNA-bound Swi4-Swi6 heterodimers(26) , they do not affect DNA-bound SCELA (not shown). It has been postulated that SCB sequences are able to interact with proteins distinct from Swi4-Swi6(29, 30) , a notion that is consistent with our data.


Figure 2: SCELA is not related to Swi4 or Swi6. Gel shift reactions were performed as outlined in the legend to Fig. 1. Extracts were prepared from the following strains: BJ1991 (wild type, lane 1), JO34 (wild type, lane 2), JO57-6B (devoid of Swi4, lane 3), and JO23 (devoid of Swi 6, lane 4). The position of the gel shift is indicated by the arrow. wt, wild type.



SCELA Is an Integral Component of a 300-kDa Complex

In order to characterize SCELA biochemically, we initially determined its molecular mass by performing a UV cross-linking experiment. Fig. 3A, lane 1 shows the DNA-protein complex formed between the E2F oligonucleotide and SCELA. Subtraction of the molecular mass for the oligonucleotide indicates a molecular mass of 47 kDa for the DNA-binding protein. Again, competition experiments clearly show that the interaction between the E2F oligonucleotide and the 47-kDa large SCELA is specific (Fig. 3A, lanes 2 and 3). Additional characterization involved the use of glycerol gradient centrifugations. DNA binding activity derived from sequential application of heparin-agarose and MonoQ chromatography was analyzed on a 15-45% glycerol gradient. Comparison with protein markers that were sedimented in parallel suggested a molecular mass of approximately 300 kDa for the activity that interacts with E2F oligonucleotide (Fig. 3B). In order to confirm this result, we employed an additional method for molecular mass determination. This technique relies on non-denaturing polyacrylamide gel electrophoresis and has been successfully used for the sizing of DNA-bound activities(31) . Application of this method also yielded a molecular mass of 300 kDa (not shown). One possible explanation for this surprising outcome was that SCELA (47 kDa) oligomerizes under certain conditions to form large (300 kDa) aggregates. Alternatively, it is conceivable that SCELA is actually the DNA binding moiety of an approximately 300-kDa large protein complex. Interestingly, this possibility is reminiscent of the other two S. cerevisiae activities that interact with promoter elements involved in cell cycle regulation, i.e. Swi4-Swi6 and Mbp1-Swi6(25, 26, 28) . In both cases, DNA-binding proteins (Swi4 and Mbp1) interact with another protein (Swi6) to form a large DNA-bound aggregate. In order to reveal the actual composition of the 300-kDa complex, glycerol gradient-derived material was purified over a DNA affinity column harboring ligated E2F oligonucleotides. The DNA affinity column was washed with low salt buffer, and bound proteins were subsequently eluted in the presence of 0.5 M NaCl. The eluted material retains its DNA binding activity and gives rise to the gel shift pattern typical of the 300-kDa complex (not shown). In addition, analysis of the affinity column material on SDS-polyacrylamide gels consistently revealed several major protein bands (Fig. 3C). As expected, the column eluate contains the 47-kDa large SCELA protein (Fig. 3C, band 4), which, according to our UV cross-linking studies (Fig. 3A), recognizes the E2F oligonucleotide. We have performed this affinity purification numerous times and always detect additional proteins with approximate molecular masses of 110, 90, and 65 kDa (Fig. 3C, bands 1, 2, and 3, respectively). In summary, these data are consistent with SCELA being the DNA binding component of a large 300-kDa complex.


Figure 3: Characterization of SCELA and associated activities. A, gel shift reactions containing heparin-agarose-purified material and labeled E2F oligonucleotide (5` ACTAGTTTCGCGCCCTTTCT 3`) were subjected to UV light irradiation as described under ``Experimental Procedures.'' Subsequently, the material was analyzed on a 10% SDS-polyacrylamide gel. Competitions were performed with 100-fold molar excess of unlabeled E2F oligonucleotide (lane 3) or 100-fold molar excess of MCB oligonucleotide (5` ACTAGTGACGCGTCCTTTCT 3`) (lane 2). Lane 1 shows the reaction without competitor. The positions of protein markers are shown on the right. B, yeast extract purified by sequential application of heparin-agarose and MonoQ chromatography was layered onto a 15-45% (v/v) glycerol gradient. Following centrifugation, fractions were collected and assayed by gel shift as described in the legend to Fig. 1. The positions of protein markers analyzed in parallel are depicted at the top. The following markers were used: beta-amylase (200kD) and apoferritin (440kD). C, glycerol gradient-fractionated material was loaded onto a 2-ml DNA affinity column. The column material consisted of ligated double-stranded E2F oligonucleotides (5` ACTAGTTTCGCGCCCTTTCT 3`) covalently linked to an agarose matrix. After washing, bound proteins were eluted with buffer containing 0.5 M NaCl and analyzed on a 10% SDS-polyacrylamide gel. The positions of protein markers are indicated on the left.



DNA Binding Activity of SCELA Is Cell Cycle-regulated

According to the experiments summarized in Table 1, SCELA (as part of the 300-kDa complex) interacts with oligonucleotides that contain E2F as well as SCB recognition sites. Because SCB sequences are crucial elements for cell cycle control (25, 26, 27) , we asked whether SCELA fluctuates during the yeast cell cycle. For this purpose, we arrested a temperature-sensitive yeast cdc15 strain at the M phase by cultivating yeast cells at the nonpermissive temperature. Subsequently, the synchronized cells were released from the cell cycle block, and aliquots prepared in 15-min intervals were assayed by gel shift. The result of this experiment is depicted in Fig. 4A. The gel shift pattern clearly shows that the DNA binding activity of SCELA oscillates during the cell cycle. We have measured the DNA content of the yeast cells by fluorescence-activated cell sorting (not shown). This clearly confirmed that cell arrest took place in the M phase and that the cells were synchronized following release. It also revealed that the DNA binding activity of SCELA peaks at the G(1)/S transition phase. The timing of these cell cycle events is also consistent with a budding analysis performed in our laboratory (cf.Fig. 4A).


Figure 4: Cell cycle fluctuation of SCELA. A, a S. cerevisiae temperature-sensitive cdc15 mutant strain (W303-cdc15) was used to synchronize cells at mid-anaphase by cultivating the cells at 37 °C for 5 h. Subsequently, cells were shifted to the permissive temperature (30 °C), which releases the M phase block. Thereafter, aliquots of cells were removed at 15-min intervals. Gel shifts were carried out as described in the legend to Fig. 1with equal amounts of extracts prepared from different time points. Budding analysis was performed in parallel. B, yeast extract derived from heparin-agarose chromatography was pretreated with agarose-immobilized calf intestinal alkaline phosphatase (CIAP) for 30 min at 37 °C (lanes 2 and 5). After removal of the immobilized enzyme by centrifugation, gel shift reactions were initiated as outlined under ``Experimental Procedures.'' The action of the phosphatase can be blocked by addition of EDTA (lane 3). DNA binding of the complex is partially restored by addition of the catalytic subunit of kinase A (lane 6). Lanes 1 and 4 depict reactions performed with phosphatase buffer alone.



It is well established that eucaryotic cells frequently use phosphorylation to execute cell cycle control(1) . In a first attempt to determine the mechanism of fluctuation for SCELA, we therefore investigated whether it is sensitive to dephosphorylation. As can be seen in Fig. 4B, pretreatment of yeast extract with calf intestinal alkaline phosphatase results in almost complete loss of the DNA binding activity of SCELA (lanes 2 and 5). DNA binding activity is partially restored by incubating calf intestinal alkaline phosphatase-treated extract with the catalytic subunit of kinase A (lane 6). We have repeated this experiment numerous times and have always observed an increase of DNA binding activity upon kinase A treatment. Furthermore, calf intestinal alkaline phosphatase treatment in the presence of EDTA, which chelates zinc ions essential for calf intestinal alkaline phosphatase activity, does not interfere with DNA binding (lane 3). We have also shown that phosphatase buffer alone has no effect on DNA binding (lanes 1 and 4). These control reactions clearly demonstrate that the loss of DNA binding is a result of phosphatase action.


DISCUSSION

In summary, we have identified and characterized a novel DNA binding activity, termed SCELA, that is able to interact with several members of the SCB site family in S. cerevisiae. It has been demonstrated that in S. cerevisiae, SCB sites also interact with the heterodimeric Swi4-Swi6 activity(25, 26) . Our data clearly demonstrate that SCELA is distinct from these activities and suggest that SCB sequences can bind to at least two factors: Swi4-Swi6 and SCELA.

Several lines of study strongly implicate SCELA in the cell cycle regulation of yeast genes. Firstly, the DNA binding activity of SCELA fluctuates during the cell cycle and reaches its zenith in late G(1) or early S phase. It is likely that this fluctuation is mediated by phosphorylation/dephosphorylation events (cf.Fig. 4B). Secondly, SCELA binds to cis-acting promoter elements that are critical for cell cycle fluctuation. The sites recognized by SCELA belong to the SCB element family and reside in the promoters of cyclins (CLN1, CLN2, HCS26) and the HO gene(27) . It is well established that mutation of the SCB sites disrupts cell cycle regulation of the above genes. Furthermore, the three cyclins and the HO gene attain their highest level around the G(1) phase, which is consistent with SCELA being involved in their cell cycle control. Thirdly, in the absence of Swi4 and/or Swi6, cell cycle regulation of SCB-containing genes is impaired but not eliminated(29, 30) . This observation has led to the hypothesis that SCB-containing genes are not controlled only by Swi4-Swi6, but another unidentified regulator is involved. It is obvious that SCELA fulfills all the requirements for this putative regulator. We therefore propose that the cell cycle fluctuation of CLN1, CLN2, HCS26, and HO is controlled by at least two activities: Swi4-Swi6 and SCELA. According to our results, the DNA binding specificities of SCELA and Swi4-Swi6 are not identical, and SCELA interacts only with a subset of the SCB sites that are recognized by Swi4-Swi6 (cf.Table 1). However, all the SCB elements that bind SCELA are found in the promoters of the four above mentioned genes. This suggests that SCELA and Swi4-Swi6 are not merely redundant activities but that they mediate slightly different aspects of cell cycle regulation. Genetic studies firmly indicate that the cell cycle regulation of CLN1, CLN2, and HO consists of at least three levels, two of which are controlled by Swi4 and Swi6(30) . It is therefore likely that SCELA is involved in the third level of cell cycle fluctuation.

It is noteworthy that SCELA (S. cerevisiae E2F-like activity) exhibits an extraordinary degree of similarity to the mammalian E2F transcription factor: 1) SCELA interacts with several promoter elements that are also recognized by E2F. E2F sites are transcriptionally active in S. cerevisiae, further supporting our hypothesis that SCELA has transcriptional potential (32) . 2) In analogy to mammalian E2F, the DNA binding activity of SCELA oscillates during the cell cycle and is affected by its phosphorylation state(5, 33) . 3) Like E2F, SCELA interacts with several cellular activities and forms a 300-kDa complex in S. cerevisiae. E2F is known to interact with cyclins, cyclin-dependent kinases, and members of the retinoblastoma gene family(11, 12, 13) . At present, it is not clear whether the 300-kDa SCELA-containing complex contains yeast homologues of these mammalian proteins. However, the detection of such activities bound to SCELA would considerably strengthen our notion that SCELA carries out an E2F-like function in yeast. Experiments that will provide answers to these questions and illuminate the role of SCELA in cell cycle control have been initiated. Finally, a previous report describes the identification of a 12-kDa activity in S. cerevisiae that also interacts with E2F elements(32) . This 12-kDa factor does not fluctuate during the cell cycle and is not associated with any other yeast proteins(32) . These results, combined with the molecular mass discrepancy, clearly demonstrate that SCELA is distinct from the 12-kDa protein.


FOOTNOTES

*
This work was partially supported by a grant from the American Cancer Society (to R. R. R.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: The Chicago Medical School, Pharmacology & Molecular Biology, 3333 Green Bay Rd., North Chicago, IL 60064. Tel.: 708-578-3000, ext. 457; Fax: 708-578-3268.

(^1)
The abbreviation used is: DTT, dithiothreitol.

(^2)
B. J. Andrews, personal communication.


ACKNOWLEDGEMENTS

We are grateful to Joe Ogas and Bruce Futcher for providing us with yeast strains. We are also indebted to Todd Sladek for performing fluorescence-activated cell sorting analysis.


REFERENCES

  1. Murray, A., and Hunt, T. (1993) The Cell Cycle: An Introduction , W. H. Freeman and Company, New York
  2. McKinney, J. D., and Heintz, N. (1991) Trends Biochem. Sci. 16,430-435 [CrossRef][Medline] [Order article via Infotrieve]
  3. Roberts, S. B., Segil, N., and Heintz, N. (1991) Science 253,1022-1026 [Abstract/Free Full Text]
  4. Segil, N., Roberts, S. B., and Heintz, N. (1991) Science 254,1814-1816 [Abstract/Free Full Text]
  5. LaThangue, N. B. (1994) Trends Biochem. Sci. 19,108-114 [CrossRef][Medline] [Order article via Infotrieve]
  6. Kovesdi, I., Reichel, R., and Nevins, J. R. (1986) Cell 45,219-228 [CrossRef][Medline] [Order article via Infotrieve]
  7. Means, A. L., Slansky, J. E., McMahon, S. L., Knuth, M. W., and Farnham, P. J. (1992) Mol. Cell. Biol. 12,1054-1063 [Abstract/Free Full Text]
  8. Pearson, B. E., Nasheuer, H.-P., and Wang, T. S.-F. (1991) Mol. Cell. Biol. 11,2081-2095 [Abstract/Free Full Text]
  9. Dalton, S. (1992) EMBO J. 11,1797-1804 [Medline] [Order article via Infotrieve]
  10. Lam, E. W.-F., and Watson, R. J. (1993) EMBO J. 12,2705-2713 [Medline] [Order article via Infotrieve]
  11. Chellappan, S. P., Hiebert, S., Mudryi, M., Horowitz, J. M., and Nevins, J. R. (1991) Cell 65,1053-1061 [CrossRef][Medline] [Order article via Infotrieve]
  12. Lees, E., Faha, B., Dulic, V., Reed, S. I., and Harlow, E. (1992) Genes & Dev. 6,1874-1885
  13. Cobrinik, D., Whyte, P., Peeper, D. S., Jacks, T., and Weinberg, R. A. (1993) Genes & Dev. 7,2392-2404
  14. Shirodkar, S., Ewen, M., DeCaprio, J. A., Morgan, J., Livingston, D. M., and Chittenden, T. (1992) Cell 68,157-166 [CrossRef][Medline] [Order article via Infotrieve]
  15. Slansky, J. E., Li, Y., Kaelin, W. G., and Farnham, P. J. (1993) Mol. Cell. Biol. 13,1610-1618 [Abstract/Free Full Text]
  16. Johnson, D. G., Schwarz, J. K., Cress, W. D., and Nevins, J. R. (1993) Nature 365,349-352 [CrossRef][Medline] [Order article via Infotrieve]
  17. Reichel, R. R. (1992) Gene Expr. 2,259-271 [Medline] [Order article via Infotrieve]
  18. Lee, M. G., and Nurse, P. (1987) Nature 327,31-35 [CrossRef][Medline] [Order article via Infotrieve]
  19. Jones, R. H., and Jones, N. C. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,2176-2180 [Abstract/Free Full Text]
  20. Struhl, K. (1987) Cell 20,269-281
  21. Ohtani, K., and Nevins, J. R. (1994) Mol. Cell. Biol. 14,1603-1612 [Abstract/Free Full Text]
  22. Malhotra, P., Manohar, C. F., Swaminathan, S., Toyama, R., Dhar, R., Reichel, R., and Thimmapaya, B. (1993) J. Biol. Chem. 268,20392-20401 [Abstract/Free Full Text]
  23. Kadonaga, J. T., and Tjian, R. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,5889-5893 [Abstract/Free Full Text]
  24. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Smith, J. A., Seidman, J. G., and Struhl, K. (eds) (1987) Current Protocols in Molecular Biology , Section 10.2, John Wiley & Sons, New York
  25. Nasmyth, K., and Dirick, L. (1991) Cell 66,995-1013 [CrossRef][Medline] [Order article via Infotrieve]
  26. Ogas, J., Andrews, B. J., and Herskowitz, I. (1991) Cell 66,1015-1026 [CrossRef][Medline] [Order article via Infotrieve]
  27. Andrews, B. J., and Moore, L. (1992) Biochem. Cell Biol. 70,1073-1080 [Medline] [Order article via Infotrieve]
  28. Koch. C., Moll, T., Neuberg, M., Ahorn, H., and Nasmyth, K. (1993) Science 261,1551-1557 [Abstract/Free Full Text]
  29. Andrews, B. J., and Mason, S. W. (1993) Science 261,1543-1544 [Free Full Text]
  30. Breeden, L., and Mikesell, G. (1994) Genetics 138,1015-1024 [Abstract]
  31. Orchard, K., and May, G. E. (1993) Nucleic Acids Res. 21,3335-3336 [Free Full Text]
  32. Mai, B., and Lipp, M. (1993) FEBS Lett. 321,153-158 [CrossRef][Medline] [Order article via Infotrieve]
  33. Bagchi, S., Raychaudhuri, P., and Nevins, J. R. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,4352-4356 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
A. K. Machado, B. A. Morgan, and G. F. Merrill
Thioredoxin Reductase-dependent Inhibition of MCB Cell Cycle Box Activity in Saccharomyces cerevisiae
J. Biol. Chem., July 4, 1997; 272(27): 17045 - 17054.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. S. Cuevo, S. Garrett, and J. M. Horowitz
Detection and Functional Characterization of p180, a Novel Cell Cycle Regulated Yeast Transcription Factor That Binds Retinoblastoma Control Elements
J. Biol. Chem., February 7, 1997; 272(6): 3813 - 3822.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Vemu, S.
Right arrow Articles by Reichel, R. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Vemu, S.
Right arrow Articles by Reichel, R. R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.