Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Casey, E. B.
Right arrow Articles by Abraham, E. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Casey, E. B.
Right arrow Articles by Abraham, E. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 35, Issue of September 01, pp. 20781-20786, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Role of Glycine 1 and Lysine 2 in the Glycation of Bovine B-Crystallin
SITE-DIRECTED MUTAGENESIS OF LYSINE TO THREONINE (*)

(Received for publication, February 21, 1995; and in revised form, June 14, 1995)

Elisabeth B. Casey Hui-Ren Zhao Edathara C. Abraham (§)

From the Department of Biochemistry and Molecular Biology, Medical College of Georgia, Augusta, Georgia 30912-2100

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

To determine the role of Gly-1 and Lys-2 of bovine B-crystallin in glycation and cross-linking, Lys-2 was changed to Thr by site-directed mutagenesis. A polymerase chain reaction was used to perform site-directed mutagenesis on the third codon (AAG ACG) of bovine B-crystallin cDNA. The wild type and mutant cDNAs were cloned into pMON5743 and expressed in JM101 Escherichia coli cells, and the identity of B-crystallin was confirmed by Western blotting after purification by cation exchange high performance liquid chromatography. Glycation of B-crystallin by [^14C]glucose was reduced significantly due to the mutation of Lys-2, supporting the view that Lys-2 is a major glycation site. Peptide mapping showed the presence of two major labeled peptides containing N-terminal sequences, and in the mutant these peptides had longer retention times and reduced radioactivity. Amino acid analysis, after glycation with [^14C]glucose, revealed N-terminal glycine as the most predominant glycation site. Lys-2 was glycated slower than Gly-1 but faster than Lys-163. Glycation with DL-glyceraldehyde showed an important role for both Gly-1 and Lys-2 in the glycation-mediated B-crystallin cross-linking.


INTRODUCTION

Nonenzymatic glycosylation or glycation of proteins occurs by the reaction between sugar aldehydes and -NH(2) groups of lysine residues or the amino terminus of a protein(1) . By the glycation process three forms of products are formed: reversible Schiff-base adducts, nearly irreversible Amadori products, and completely irreversible advanced glycation end products (AGE) (^1)which have fluorescence, brown color, and a cross-linking property(1, 2, 3) . Extent of glycation modification is dependent on sugar concentration and protein half-life (4) . Since lens proteins are long lived and turn over very slowly or not at all (5) great opportunities exist for posttranslational modifications such as glycation to occur. In fact, the presence of early stage glycation products (Schiff-base adducts and Amadori products) has been demonstrated to form on lens crystallins in vitro and in vivo(6, 7) . Steady accumulation of AGE on lens crystallins has also been reported to occur with normal aging and at an accelerated rate in diabetes(6, 7, 8, 9) , suggesting a possible etiological role for glycation in the pathogenesis of cataract formation. Glycation alters the conformation of crystallins(10, 11) , and this may increase their susceptibility of sulfhydryl oxidation, resulting in the formation of high molecular weight protein aggregates (12, 13, 14) . In addition, AGE itself can cause cross-linking leading to aggregation of crystallins(13) . These aggregated crystallins would scatter light and cause cataract.

Cataract formation has often been linked to glycation, oxidation, aggregation, and insolubility of -crystallin. It has been reported that -crystallin is most readily glycated in diabetic rats and during in vitro glycation as compared to all other crystallins(15) , and the major constituent of the water-insoluble fraction of the diabetic rat lens was also found to be -crystallin (12, 16) . In addition, -crystallin is the predominant crystallin that is attached to cataractous lens membranes(14) . Recently, Luthra and Balasubramanian (11) reported that glycation of -crystallin leads to greater exposure of its aromatic side chains to the medium and a reduced secondary structural content. -Crystallin constitutes a group of very homologous proteins with a molecular mass of about 20 kDa and isoelectric point between pH 7.1 and 8.1(17) . There are at least five homologous -crystallins in bovine lens (A to E)(18) . The complete sequence of calf B-crystallin, the major species in the bovine lens, shows that there are two lysine residues. -Crystallin is a cysteine-rich protein and bovine B-crystallin contains 7 cysteine residues in a total of 174 amino acids, and it has two symmetrical domains which fold into two ``Greek key'' motifs which are composed of four antiparallel beta-sheets(19, 20) . The sulfhydryl groups are arranged in ways that could allow both intramolecular and intermolecular cross-linking(20) .

Glycation of B-crystallin can occur at one or more of the following three sites: the alpha-amino group of the N-terminal glycine and the -amino groups of the two lysines (Lys-2 and Lys-163). An earlier study has indicted that glycation of -crystallin occurs primarily at the N-terminal residues(21) . But it remains unclear whether glycation of Gly-1, Lys-2, or both are involved and to what extent.


EXPERIMENTAL PROCEDURES

Subcloning and Mutagenesis

The bovine B cDNA clone was provided as a stab culture by Dr. Regine Hay (Department of Ophthalmology, Washington University)(22) . The B cDNA was originally cloned into the EcoRI site of the multiple cloning site of the phagemid pBluescript KS-. Miniprep kits (Wizard Miniprep, Promega Corp.) were used to isolate the plasmid DNA. The multiple cloning site of pMON5743 expression vector (a gift from Monsanto Co., St. Louis, MO) does contain an EcoRI site which would facilitate direct cloning from the original pBluescript plasmid into the pMON5743 vector. However, expression of proteins cloned into this site would result in a protein fused with unwanted protein sequence. Therefore, we decided to clone the cDNA into NcoI and HindIII sites, and this would also facilitate directional cloning. In order to clone B cDNA into the NcoI and HindIII sites of the expression vector pMON5743, corresponding restriction enzyme sites were created by PCR, using 5`-end primer (5`-TTTTTCCATGGGGA-AGATCACTTTTT-3`) containing NcoI site and 3`-end primer (5`-TTTTTAAGCTTCCTTTTTGTGCCAGAACAC-3`) containing HindIII site. Site-directed mutagenesis in B cDNA was also generated by PCR using the same 3`-end primer as described above and a mutagenic 5` end primer (TTTTTCCATGGGGACGATCACTTTTT) which changes the third cordon from AAG (Lys) to ACG (Thr). Following PCR, both the wild type and mutant cDNAs as well as the vector pMON5743 were double-digested with NcoI and HindIII. The digested cDNAs and vector were then ligated by DNA ligase. JM101 Escherichia coli were transformed with 5 µl of the ligation mixture by the heat shock method. The transformed JM101 E. coli cells were spread on agarose plates containing 200 µg/ml ampicillin, and six clones were picked out. After minipreps the plasmids were double digested with NcoI and HindIII to confirm the presence of the cDNA insert. Plasmid DNA was prepared from two of the best cultures and stored at 4 °C and the remainder of the cells were stored at -70 °C in 20% glycerol. The nucleotide sequences of wild type and mutant B-crystallin cDNAs were checked by the dideoxy chain termination method (23) using the U. S. Biochemical Corp. sequencing kit. All primers used in this study were prepared on an Applied Biosystems 380B synthesizer.

Expression and Purification of Recombinant B-Crystallin

Expression of bovine B-crystallin was carried out according to the method of Olins and Rangwala(24) . Briefly, cultured and stored E. coli cells (from a single colony) were added to 500 ml of M9 minimal salt (Sigma) supplemented with 0.8% (w/v) glucose, 1% (w/v) casamino acids, and 0.0005% (w/v) thiamine in distilled water. The culture was grown at 37 °C with vigorous aeration until it reached a density of approximately A = 0.5, and the recA promoter was induced by the addition of 50 µg/ml nalidixic acid. Growth was continued for a further 4 h, then the cells were harvested by centrifugation. A negative control (JM101 E. coli cells not containing the plasmid DNA but induced) was run simultaneously. The collected cells were suspended in 100 ml of 300 mM Tris-HCl (pH 7.4), 10 mM NaCl, 5 mM EDTA, and 0.5 mM phenylmethylsulfonyl fluoride. After incubation with shaking for 8 h on ice, the supernatant was removed after centrifugation and used for purification of B-crystallin. SDS-PAGE and Western blotting were performed to confirm the expression of B-crystallin. Purification was done by cation-exchange HPLC using a 250 4.6-mm SynChropak CM300 column and a 50 4.6-mm guard column (Synchrom Inc. Lafayette, IN), according to the method of Siezen et al.(25) with minor modification. Before each run, the column was equilibrated with buffer A (20 mM Tris acetate, pH 6.0, 1 mM EDTA, 0.1 mM dithiotreitol, 0.02% NaN(3)) and the proteins were eluted with 0-40% linear gradient of buffer B (buffer A plus 0.5 M sodium acetate) for 40 min at a flow rate of 1 ml/min. About 150 µg to 3 mg of protein were loaded on the column.

Preparation of Total Calf -Crystallin

Calf lenses were decapsulated and homogenized in 50 mM phosphate buffer (pH 7.0) containing 50 mM NaCl, and the homogenate was then centrifuged at 10,000 g for 1 h at 4 °C. The supernatant was loaded on a 100 1.5 cm Sephacryl-S-300-HR (Sigma) column and developed isocratically with the same buffer. The -crystallin peak which was eluted last was collected and used as a control sample in all the studies.

SDS-PAGE and Western Blot

The expressed proteins were analyzed on SDS-PAGE according to the method of Laemmli (26) under reducing conditions using a 12% separating gel and 4% stacking gel. For immunoblot analysis proteins were first resolved by SDS-PAGE and then electroblotted to Millipore polyvinylidene difluoride membrane using a Bio-Rad mini trans-blot electrophoretic transfer cell according to the instruction of the manufacturers. After blotting the membrane was washed with 20 mM Tris-HCl, pH 7.5, 150 mM NaCl, 0.05% NaN(3), and then incubated for 2 h with 1:2000 diluted ascites fluid containing monoclonal antibody to rat lens -crystallin(16) . The membrane was washed and incubated with the second antibody (1:2000 diluted alkaline phosphatase-linked goat anti-mouse antibody) for additional 2 h. The -crystallins were visualized by incubation with the substrate (Protoblot System, Promega) for about 15 min.

Isoelectric focusing of Recombinant B-Crystallin

Isoelectric focusing was carried out using Resolve Omega isoelectric focusing Unit FR-2500 and pH 7-10 thin-layer agarose gel from Isolab, Inc. (Akron, OH) according to the instruction of the manufacturer except that 0.25 M HEPES was used as the anolyte.

Protein Sequence Analysis

Manual micro-sequence analysis was performed according to the DABITC/PITC degradation method (27) and the DABTH amino acids were detected by thin layer chromatography with TLC-micropolyamide foils.

In Vitro Glycation of B-Crystallin

The B-crystallin (1 mg/ml) solution in 20 mM Tris acetate, pH 7.4, 0.135 M sodium acetate, 1 mM EDTA, 0.1 mM dithiotreitol, 0.02% NaN(3) was incubated at 37 °C in dark with 5 mM glucose, 40 µCi/ml [^14C]glucose (previously purified to remove fast reacting impurities), and 100 mM sodium cynoborohydride. After incubation, 50 µl of reaction mixture were spotted on ET-31 filter paper and washed with at least 5 ml of 10% trichloroacetic acid, 5% trichloroacetic acid (three changes), 1:1 ethanol:acetone, and acetone, respectively, dried in a 55 °C oven, and counted.

Cross-linking of the Recombinant -Crystallins

The wild type and the mutant recombinant B-crystallin preparations (1 mg/ml) in the Tris acetate, pH 7.4, buffer were incubated with or without 5 mMDL-glyceraldehyde at 37 °C in dark for 10 days, and 5 µg of protein were analyzed by SDS-PAGE in reducing condition.

Peptide Mapping of Glycated B-Crystallin

The glycated wild type and mutant B-crystallin as well as total calf -crystallin were thoroughly dialyzed against 0.1 M NH(4)HCO(3) to remove extra [^14C]glucose. The dialyzed proteins were then digested with chymotrypsin and the peptides were separated by reverse-phase HPLC on a 4.6 250 mm Microsorb-MV C18 column (Rainin Instrument Company). The developers consisted of 1% trifluoroacetic acid in water (Solution A) and 1% trifluoroacetic acid in acetonitrile (Solution B). The gradient system was as follows: 20 min 100% A followed by a linear gradient of 0-50% B in 120 min. Each peak was collected and counted.

Amino Acid Analysis

To determine the level of glycation of Gly-1 versus Lys-2 or Lys-163 by amino acid analysis, the wild type and mutant B-crystallins were glycated with [^14C]glucose and hydrolyzed for 24 h at 110 °C in evacuated sealed tubes with 6 M HCl containing 0.5% (w/v) phenol. The hydrolysates were dried under vacuume followed by derivatization with PITC. To get enough counts 10 µg of amino acid was separated by reverse-phase HPLC on a Microsorb-MV C18 column (4.6 250 mm), and the effluent was counted in order to identify the glycated glycine and lysine. Glycine and polylysine were incubated with [^14]C-glucose in the presence of NaCNBH(3). Glycated glycine and polylysine, after acid hydrolysis, were reacted with PITC and separated as above by HPLC and counted. The radio active peaks were used as standards to identify the glycated glycine and lysine in the wild type and mutant B-crystallins.


RESULTS

Cloning and Mutagenesis

After cloning the wild type and the mutant cDNA into pMON5743 the plasmids were double digested with NcoI and HindIII and run on 1% agarose gel to confirm that the cDNA insert is present. On double digestion, both wild type and mutant clone contained a 3.7-kb band (3613-bp vector) and a 0.630-kb band (602-bp cDNA of B-crystallin), while on single digestion, there was only one 4.3-kb band (4215 bp pMON5473 plus insert). The cDNA sequencing of wild type and mutant cDNA by the dideoxy chain termination method confirmed the mutation of the third codon AAG (Lys) to ACG (Thr). In addition, DNA sequencing did rule out the presence of any random mutagenesis that could have occurred during PCR mutagenesis and amplification.

Expression and Purification of Recombinant B-Crystallin

After induction the culture medium was centrifuged and an aliquot of the supernatant was concentrated and analyzed by SDS-PAGE. A band was seen at around 20 kDa corresponding to the expected molecular mass of -crystallin. But the extracts from the cell pellets contained much higher amounts of the 20-kDa polypeptide comingrating with -crystallin (Fig. 1A). The wild type and mutant -crystallins were purified by cation-exchange HPLC. Both wild type and mutant -crystallins appeared as a single peak and the retention time of wild type B-crystallin (27.51 min) was very close to that of calf B-crystallin (27.87 min), while the mutant B-crystallin had a retention time of 26.4 min which is about 1 min earlier than that of wild type and calf B-crystallin. This difference in retention time is consistent with a Lys Thr mutagenesis.


Figure 1: Expression of wild type and mutant B-crystallin in E. coli. A, SDS-PAGE of protein in cell lysate. Lysates containing the wild type and the mutant B-crystallin were run on 12% gel. They contain large amounts of the 20-kDa polypeptide comigrating with the total calf -crystallin. The cells containing pMON5743 with no cDNA were used as control. STD, molecular mass standards. B, SDS-PAGE and Western blot of purified recombinant B and total calf -crystallin. Cation exchange HPLC purified wild type and mutant B-crystallin and calf -crystallin were separated on SDS-PAGE, eleceroblotted to polyvinylidene difluoride membrane, and then probed with monoclonal antibody against rat -crystallin. The bands were visualized by alkaline phosphatase staining.



Characterization of Wild Type and Mutant -Crystallins

Since the primary structure of rat and calf -crystallins are similar(28) , immunological cross-reaction was expected to exist between the two proteins. So the monoclonal antibody against rat -crystallin was used in Western blot to confirm that the 20-kDa polypeptide is -crystallin and, as expected, distinct immunoreactive bands were observed (Fig. 1B). Both wild type and the mutant B showed single bands on isoelectric focusing gel with a pI of 7.7 and 7.55, respectively. This drop in pI was expected due to the mutation of Lys to Thr.

Since the mutation site is at the second amino acid position from the N terminus of B-crystallin, it is convenient to use manual sequencing method to verify the mutation and, at the same time, to determine whether the N-terminal amino acid is glycine or methionine. Sequential degradation revealed that the first amino acid of both wild type and mutant are glycine and the second amino acids for the wild type and the mutant are lysine and threonine, respectively.

Glycation of -Crystallin

Since all calf -crystallins have similar primary structure (28) and Lys-2 and Lys-163 are conserved amino acids which exist in all calf -crystallins, we simply used total calf -crystallin as control in our glycation experiment. Fig. 2shows the time dependence of glycation of -crystallins during incubation with 5 mM [^14C]glucose for a period of up to 5 days. After 5 days, extent of early glycation of wild type B is similar to that of total calf -crystallin, while glycation of the mutant B was about 50% lower. This suggests that glycation of Lys-2 accounts for about half of the total glycation by all the sites. Since Schiff-base was made irreversible by the presence of sodium cyanoborohydride the data reflects only the early Schiff-base step and not influenced by Amadori rearrangement or advanced glycation.


Figure 2: Time course -crystallin glycation. The wild type and mutant B-crystallins as well as total calf -crystallin were incubated with ^14[C]-glucose for 5 days in the presence of sodium cyanoborohydride. An aliquot of the reaction mixture was removed every 24 h and counted. Results are means ± S.D. of three independent experiments.



Cross-linking of Glycated Wild Type and Mutant B-Crystallins

Wild type and mutant B-crystallins were incubated with or without glyceraldehyde for 10 days and then analyzed by SDS-PAGE under reducing condition (Fig. 3). Glyceraldehyde was chosen for this study because it is known to be a rapidly glycating and cross-linking agent even at low concentration (13, 29) . With the glycated wild type B about 40-, 60-, 80-, 100-, and above 100-kDa bands were found, indicating the existence of cross-linked aggregates of various sizes, while with mutant B-crystallin the major bands were only at 40 and 60 kDa, and these bands were significantly less dense in the mutant. Since the SDS-PAGE was carried out under reducing condition, these polymers must be the result of glycation and not the result of oxidation of sulfhydryl groups.


Figure 3: Cross-linking of the recombinant B-crystallins. The expressed wild type and mutant B-crystallins were incubated with/without 5 mM glyceraldehyde (GD) for 10 days and 5 µg of protein were analyzed by SDS-PAGE under reducing conditions. Cross-linking bands of above 20 kDa were observed in the samples incubated with glyceraldehyde.



Peptide Mapping of Glycated B-Crystallin

To identify the sites that were glycated, chymotryptic peptides from [^14C]glucose-labeled B-crystallin were separated by reverse phase-HPLC (Fig. 4). In total calf -crystallin and wild type B-crystallin there were two labeled fractions with the retention times of 94.71 and 99.45 min. In the mutant B there were also two labeled fractions, but the retention times increased to 96.99 and 101.14 min. In addition, the counts/min of the second peak of the mutant B is much lower than that of the wild type and calf -crystallins. Since it has been shown recently that glycated (by glucose or ascorbic acid) and nonglycated peptides having the same amino acid sequence comigrate on reverse-phase HPLC(30, 31) , we were able to sequence the ^14C-labeled peptides to determine the identity of the glycated peptides. The sequences of the labeled peptides as determined by the DABITC/PITC method were GKITF and GKITFY for the first and the second labeled peptides, respectively, in the peptide maps of total and the wild type (Fig. 5). In the mutant the only difference was that Lys was replaced by Thr. Thus both the peptides represent N-terminal sequences generated by chymotryptic cleavage at Phe-5 and Tyr-6. Longer retention times for the two labeled peptides from the mutant were expected from Lys to Thr mutation. Two minor radioactivity peaks (a total of 25 and 50 cpm) were present, however, they were not further analyzed.


Figure 4: Peptide map of the glycated -crystallins. The ^14[C]glucose glycated wild type and mutant B as well as total calf -crystallin were digested with chymotrypsin and then the digested peptides were separated by reverse phase-HPLC. Each peak was collected and counted. Two radioactive peaks were identified in each sample, but the retention times of the two peaks in mutant B were longer than that of wild type B and total calf -crystallins.




Figure 5: Amino acid analysis of glycated B-crystallin. [^14C]Glucose-glycated wild type and mutant B-crystallins (as in Fig. 2) were hydrolyzed, derivatized with PITC, and separated on reverse phase-HPLC column and the effluent was counted. To identify glycated glycine and lysine, glycine and polylysine were incubated with [^14C]-glucose and reacted with PITC after acid hydrolysis.



Glycation of Gly-1, Lys-2, and Lys-163: Results of Amino Acid Analysis

Glycation sites were confirmed by amino acid analyis of the wild type and the mutant B-crystallins after incubation with [^14C]glucose. Acid hydrolysates were reacted with PITC and the amino acids separated by reverse-phase HPLC. Fig. 5shows the amino acid separations including the ^14C-labeled glycated glycine and lysine. The identity of the labeled peaks was ascertained by using glycated glycine and glycated lysine as standards. The following conclusions could be made from the amino acid analyis data. 1) As expected from our previous studies(32) , lysine, which was glycated at the -NH(2) group and derivatized by PITC at the alpha-NH(2) group generated two peaks both of which were eluted before the unmodified lysine peak. 2) Glycated glycine, which is detectable only by the label on it, was retained longer than phenylthiocarbamyl-Gly. 3) In the wild type B, the total radioactivity counts under the glycated glycine peak (or the level of glycation of the alpha-NH(2) group of Gly-1) were nearly twice as that of the counts under the glycated lysine peaks. 4) The data from the mutant showed about 50% reduction in the lysine content, which was expected, and about 70% decrease in glycated lysine radioactivity. The residual glycated lysine radioactivity presumably came from glycation of Lys-163; however, Gly-1 was the major glycation site in the mutant B as well.


DISCUSSION

The present study shows that the alpha-NH(2) group of Gly-1 is the most predominant glycation site of bovine B-crystallin. Lys-2, on the other hand is glycated slower than Gly-1 but significantly faster than Lys-163. About 50% decrease in the level of glycation of the mutant B suggested an equal participation by Gly-1 and Lys 2 (Fig. 2), but this was not confirmed by the amino acid analysis data (Fig. 5). By fructation (glycation by fructose) studies Pennington and Harding (33) concluded that glycation occurs exclusively at Gly-1. This conclusion was based on amino acid analysis of glycated tryptic peptides isolated by affinity chromatography. There are disadvantages in relying on the analysis of tryptic peptides. Trypsin will not cleave at Lys-2 if it is glycated and even if it is not glycated cleavage at this Lys, being close to the N terminus, will be slow. In fact, the preferred site for trypsin cleavage which is close to the N terminus would be Arg-9 and it is surprising that these authors did not find a glycated peptide containing this Arg and one or more glycated sites (Gly-1 and/or Lys-2).

Using peptide mapping we showed that there were only two major glycated peptides in the native and wild type -crystallin (Fig. 4). After mutation, the retention times of these two peptides became longer and their radioactivities decreased. These results implicate that 1) both the glycated peptides came from the N-terminal but have different length and 2) both Gly-1 and Lys-2 were glycated. Sequencing by the DABITC/PITC method showed both the labeled or glycated peptides (Fig. 4) as having the N-terminal sequence. Abraham et al.(34) had attempted to determine in vivo glycation sites of -crystallin isolated from high molecular weight aggregates of a urea-soluble fraction and showed significant glycation of the N-terminal sites (did not differentiate between Gly-1 and Lys-2) and Lys-163. This difference may be due to the fact B-crystallin from water-insoluble high molecular weight aggregates may have been denatured in vivo, and so all the potential glycation sites were exposed to all reducing sugars during the entire time. In vitro glycation for a relatively short period of time with physiological glucose concentration showed site specificity at the N-terminal residues.

Glycation in general takes place mainly at -amino groups of lysine residues and N-terminal alpha-amino groups. In the process of protein glycation, some lysine residues are glycated and some are not. There is little information regarding the specificity of glycation sites of proteins. In hemoglobin the most reactive lysine residues appear to be located adjacent to a carboxylate group in the primary or three-dimensional structure of the protein(35) . In B-crystallin Gly-1 and Lys-2 are adjacent to the carboxylate group of Asp-38 in a three-dimensional structure(28) , and this could influence glycation at these sites by facilitating Amadori rearrangement. However, this argument may not be valid here because in vitro glycation was done in the presence of sodium cyanoborohydride which traps the aldimine adducts preventing them from going through the Amadori step. Since the pK of an alpha-amino group is at least 2-2.5 units lower than that of an -NH(2) group, the propensity of the former to form aldimine is expected to be considerably higher than that of the latter. In protein glycation process the conformation of the protein must be one of the important factors which determine if the sugar is able to access to the alpha- or -NH(2) groups. So it is important to know if expressed B-crystallin has the right conformation. Hay et al.(36) have also expressed B-crystallin in a similar bacterial expression system and showed that both native and expressed -crystallin contained 50-60% of the beta-sheet structure and low (5%) alpha-helix content. Based on tryptophan fluorescence and far-UV circular dichroism measurements, there does not appear to be any conformational destabilization in the wild type or mutant B-crystallin as compared to calf B-crystallin. (^2)After incubation of the wild type and the mutant B-crystallins with glyceraldehyde, the wild type B showed more cross-linking products than the mutant B-crystallin and higher molecular species of 80, 100, and above 100 kDa appeared only in the wild type B-crystallin. This implicates the important role of Lys-2 in B-crystallin cross-linking and in the formation of high molecular weight aggregates.


FOOTNOTES

*
This work was supported by National Eye Institute Research Grant EY 07394. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed. Tel.: 706-721-9526; Fax: 706-721-6608.

(^1)
The abbreviations used are: AGE, advanced glycation end products; PCR, polymerase chain reaction, PAGE, polyacrylamide gel electrophoresis; PITC, phenylisothiocynate; DABITC, dimethylaminoazobenzene 4`-isothiocynate; HPLC, high pressure liquid chromatography; bp, base pair(s); kb, kilobase pair(s).

(^2)
A. J. Pande, H.-R. Zhao, and E. C. Abraham, unpublished results.


ACKNOWLEDGEMENTS

We thank Dr. Regine Hay for the gift of bovine B-crystallin cDNA clone. We are also grateful to Monsanto Company for the gift of pMON5743 expression vector. We appreciate the helpful comments from Dr. Terry Stoming and Dr. S. Swamy-Mruthinti during the course of this study and the assistance of Joyce Hobson for the preparation of this manuscript.


REFERENCES

  1. Monnier, V. M. (1989) in The Maillard Reaction in Aging, Diabetes and Nutrition (Baynes, J. W., and Monnier, V. M., eds) pp. 1-22, Alan R. Liss, New York
  2. Sell, D. R., and Monnier, V. M. (1989) J. Biol. Chem. 264,21597-21602 [Abstract/Free Full Text]
  3. Monnier, V. M., and Cerami, A. (1981) Science 211,491-493 [Abstract/Free Full Text]
  4. Abraham, E. C. (1985) Glycosylated Hemoglobins: Methods of Analysis and Clinical Applications , pp. 33-58, Marcel Dekker, New York
  5. Bloemendal, H. (1981) in Molecular and Cellular Biology of the Eye Lens (Bloemendal, H., ed) pp. 1-47, Wiley & Sons, New York
  6. Stevens, V. J., Rouzer, C. A., Monnier, V. M., and Cerami, A. (1978) Proc. Natl. Acad. Sci. U. S. A. 75,2918-2922 [Abstract/Free Full Text]
  7. Abraham, E. C., Swamy, M. S., and Perry R. E. (1989) in The Mailard Reaction in Aging Diabetes and Nutrition (Baynes, J. W., and Monnier, V. M., eds) pp. 123-139, Alan R. Liss, New York
  8. Araki, N., Ueno, N., Chakrabarti, B., Morino, Y., and Horiuchi, S. (1992) J. Biol. Chem. 267,10211-10214 [Abstract/Free Full Text]
  9. Nakayama, H., Mitruhashi, T., Kuwajima, S., Aoki, S., Kuroda, Y., Itoh, T., and Nakagawa, S. (1993) Diabetes 42,345-350 [Abstract]
  10. Beswick, H. T., and Harding, J. J. (1987) Biochem. J. 246,761-769 [Medline] [Order article via Infotrieve]
  11. Luthra, M., and Balasubramanian, D. (1993) J. Biol. Chem. 268,18119-18127 [Abstract/Free Full Text]
  12. Swamy, M. S., and Abraham, E. C. (1987) Invest. Ophthalmol. Vis. Sci. 28,1693-1701 [Abstract/Free Full Text]
  13. Swamy, M. S., Tsai, C., Abraham, A., and Abraham, E. C. (1993) Exp. Eye Res. 56,177-185 [CrossRef][Medline] [Order article via Infotrieve]
  14. Kodama, T., and Takemoto, L. (1988) Invest. Ophthalmol. Vis. Sci. 29,145-149 [Abstract/Free Full Text]
  15. Swamy, M. S., and Abraham, E. C. (1991) Exp. Eye Res. 52,439-444 [CrossRef][Medline] [Order article via Infotrieve]
  16. Swamy, M. S., Shyamala, M., Abraham, J., Garver, F. A., and Abraham, E. C. (1989) Curr. Eye Res. 8,989-996 [Medline] [Order article via Infotrieve]
  17. Harding, J. J., and Crabbe, M. J. C. (1984) in The Eye (Davson, H., ed) Vol. 1b, pp. 207-492, Academic Press, London
  18. Bloemendal, H., Piatigorsky, J., and Spector, A. (1989) Exp. Eye Res. 48,465-466 [CrossRef][Medline] [Order article via Infotrieve]
  19. Wistow, G., Turnell, B., Summers, L., Slingsby, C., Moss, D., Miller, L., Lindley, P., and Blundell, T. (1983) J. Mol. Biol. 170,175-202 [CrossRef][Medline] [Order article via Infotrieve]
  20. Blundell, T., Lindley, P., Miller, L., Moss, D., Slingsby, C., Tickle, I., Turnell, B., and Wistow, G. (1981) Nature 289,771-777 [CrossRef][Medline] [Order article via Infotrieve]
  21. Harding, J. J., Ajiboy, R., Blakytny, R., and Lewis, B. (1987) in Proc. Int. Soc. Eye Res. 5,95 (abstr.)
  22. Hay, R. E., Woods, W. D., Church, R. L., and Petrash, J. M. (1987) Biochem. Biophys. Res. Commun. 146,332-338 [CrossRef][Medline] [Order article via Infotrieve]
  23. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467 [Abstract/Free Full Text]
  24. Olins, P. O., and Rangwala, S. H. (1990) Methods Enzymol. 185,115-119 [Medline] [Order article via Infotrieve]
  25. Siezen, R. J., Kaplan, E. D., and Anello, R. D. (1985) Biochem. Biophys Res. Commun. 127,153-160 [CrossRef][Medline] [Order article via Infotrieve]
  26. Laemmli, U. K. (1970) Nature 227,680-685 [CrossRef][Medline] [Order article via Infotrieve]
  27. Chang, J. Y. (1983) Methods Enzymol. 91,455-466 [Medline] [Order article via Infotrieve]
  28. Summers, L., Wistow, G., Narebor, M., Moss, D., Lindley, P., Slingsby, C., Blundell, T., Bartunik, H., and Bartels, K. (1984) Pept. Protein Rev. 3,147-168
  29. Acharya, A. S., Cho, Y. J., and Manjula, B. N. (1988) Biochemistry 27,4522-4529 [CrossRef][Medline] [Order article via Infotrieve]
  30. Abraham, E. C., Cherian, M., and Smith, J. B. (1994) Biochem. Biophys. Res. Commun. 201,1451-1456 [CrossRef][Medline] [Order article via Infotrieve]
  31. Ortwerth, B. J., Slight, S. H., Prabhakaram, M., Sun, Y., and Smith, J. B. (1992) Biochim. Biophys. Acta 1117,207-215 [Medline] [Order article via Infotrieve]
  32. Swamy, M. S., and Abraham, E. C. (1992) Curr. Eye Res. 9,833-842
  33. Pennington, J., and Harding, J. J. (1994) Biochim. Biophys. Acta 1226,163-167 [Medline] [Order article via Infotrieve]
  34. Abraham, E. C., Perry, R. E., Abraham, A., and Swamy, M. S. (1991) Exp. Eye Res. 52,107-112 [CrossRef][Medline] [Order article via Infotrieve]
  35. Shapiro, R., McManus, M. J., Zabut, C., and Bunn, H. F. (1980) J. Biol. Chem. 255,3120-3127 [Free Full Text]
  36. Hay, R., Andley, U., and Petrash, J. M. (1994) Exp. Eye Res. 58,573-584 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Appl. Environ. Microbiol.Home page
J. C. Aon, R. J. Caimi, A. H. Taylor, Q. Lu, F. Oluboyede, J. Dally, M. D. Kessler, J. J. Kerrigan, T. S. Lewis, L. A. Wysocki, et al.
Suppressing Posttranslational Gluconoylation of Heterologous Proteins by Metabolic Engineering of Escherichia coli
Appl. Envir. Microbiol., February 15, 2008; 74(4): 950 - 958.
[Abstract] [Full Text] [PDF]


Home page
GlycobiologyHome page
M. B. Johansen, L. Kiemer, and S. Brunak
Analysis and prediction of mammalian protein glycation
Glycobiology, September 1, 2006; 16(9): 844 - 853.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Q. Yang, B. Dixit, J. Wada, Y. Tian, E. I. Wallner, S. K. Srivastva, and Y. S. Kanwar
Identification of a renal-specific oxido-reductase in newborn diabetic mice
PNAS, August 10, 2000; (2000) 160266197.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
H.-R. Zhao, R. H. Nagaraj, and E. C. Abraham
The Role of alpha - and epsilon -Amino Groups in the Glycation-mediated Cross-linking of gamma B-crystallin. STUDY OF THREE SITE-DIRECTED MUTANTS
J. Biol. Chem., May 30, 1997; 272(22): 14465 - 14469.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
Q. Yang, B. Dixit, J. Wada, Y. Tian, E. I. Wallner, S. K. Srivastva, and Y. S. Kanwar
Identification of a renal-specific oxido-reductase in newborn diabetic mice
PNAS, August 29, 2000; 97(18): 9896 - 9901.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Casey, E. B.
Right arrow Articles by Abraham, E. C.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Casey, E. B.
Right arrow Articles by Abraham, E. C.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement