|
Volume 270,
Number 35,
Issue of September 01, pp. 20781-20786, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Role of
Glycine 1 and Lysine 2 in the Glycation of Bovine B-Crystallin
SITE-DIRECTED MUTAGENESIS OF LYSINE TO THREONINE (*)
(Received for publication, February
21, 1995; and in revised form, June 14, 1995)
Elisabeth B.
Casey
,
Hui-Ren
Zhao
,
Edathara C.
Abraham (§)
From the Department of Biochemistry and Molecular Biology,
Medical College of Georgia, Augusta, Georgia 30912-2100
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
To determine the role of Gly-1 and Lys-2 of bovine
B-crystallin in glycation and cross-linking, Lys-2 was changed to
Thr by site-directed mutagenesis. A polymerase chain reaction was used
to perform site-directed mutagenesis on the third codon (AAG
ACG) of bovine B-crystallin cDNA. The wild type and mutant cDNAs
were cloned into pMON5743 and expressed in JM101 Escherichia coli cells, and the identity of B-crystallin was confirmed by
Western blotting after purification by cation exchange high performance
liquid chromatography. Glycation of B-crystallin by
[ C]glucose was reduced significantly due to the
mutation of Lys-2, supporting the view that Lys-2 is a major glycation
site. Peptide mapping showed the presence of two major labeled peptides
containing N-terminal sequences, and in the mutant these peptides had
longer retention times and reduced radioactivity. Amino acid analysis,
after glycation with [ C]glucose, revealed
N-terminal glycine as the most predominant glycation site. Lys-2 was
glycated slower than Gly-1 but faster than Lys-163. Glycation with DL-glyceraldehyde showed an important role for both Gly-1 and
Lys-2 in the glycation-mediated B-crystallin cross-linking.
INTRODUCTION
Nonenzymatic glycosylation or glycation of proteins occurs by
the reaction between sugar aldehydes and -NH groups of
lysine residues or the amino terminus of a protein(1) . By the
glycation process three forms of products are formed: reversible
Schiff-base adducts, nearly irreversible Amadori products, and
completely irreversible advanced glycation end products (AGE) ( )which have fluorescence, brown color, and a cross-linking
property(1, 2, 3) . Extent of glycation
modification is dependent on sugar concentration and protein half-life (4) . Since lens proteins are long lived and turn over very
slowly or not at all (5) great opportunities exist for
posttranslational modifications such as glycation to occur. In fact,
the presence of early stage glycation products (Schiff-base adducts and
Amadori products) has been demonstrated to form on lens crystallins in vitro and in vivo(6, 7) . Steady
accumulation of AGE on lens crystallins has also been reported to occur
with normal aging and at an accelerated rate in
diabetes(6, 7, 8, 9) , suggesting a
possible etiological role for glycation in the pathogenesis of cataract
formation. Glycation alters the conformation of
crystallins(10, 11) , and this may increase their
susceptibility of sulfhydryl oxidation, resulting in the formation of
high molecular weight protein aggregates (12, 13, 14) . In addition, AGE itself can
cause cross-linking leading to aggregation of crystallins(13) .
These aggregated crystallins would scatter light and cause cataract. Cataract formation has often been linked to glycation, oxidation,
aggregation, and insolubility of -crystallin. It has been reported
that -crystallin is most readily glycated in diabetic rats and
during in vitro glycation as compared to all other
crystallins(15) , and the major constituent of the
water-insoluble fraction of the diabetic rat lens was also found to be
-crystallin (12, 16) . In addition,
-crystallin is the predominant crystallin that is attached to
cataractous lens membranes(14) . Recently, Luthra and
Balasubramanian (11) reported that glycation of
-crystallin leads to greater exposure of its aromatic side chains
to the medium and a reduced secondary structural content.
-Crystallin constitutes a group of very homologous proteins with a
molecular mass of about 20 kDa and isoelectric point between pH 7.1 and
8.1(17) . There are at least five homologous -crystallins
in bovine lens ( A to E)(18) . The complete sequence
of calf B-crystallin, the major species in the bovine lens, shows
that there are two lysine residues. -Crystallin is a cysteine-rich
protein and bovine B-crystallin contains 7 cysteine residues in a
total of 174 amino acids, and it has two symmetrical domains which fold
into two ``Greek key'' motifs which are composed of four
antiparallel -sheets(19, 20) . The sulfhydryl
groups are arranged in ways that could allow both intramolecular and
intermolecular cross-linking(20) . Glycation of
B-crystallin can occur at one or more of the following three
sites: the -amino group of the N-terminal glycine and the
-amino groups of the two lysines (Lys-2 and Lys-163). An earlier
study has indicted that glycation of -crystallin occurs primarily
at the N-terminal residues(21) . But it remains unclear whether
glycation of Gly-1, Lys-2, or both are involved and to what extent.
EXPERIMENTAL PROCEDURES
Subcloning and MutagenesisThe bovine B
cDNA clone was provided as a stab culture by Dr. Regine Hay (Department
of Ophthalmology, Washington University)(22) . The B cDNA
was originally cloned into the EcoRI site of the multiple
cloning site of the phagemid pBluescript KS-. Miniprep kits
(Wizard Miniprep, Promega Corp.) were used to isolate the plasmid DNA.
The multiple cloning site of pMON5743 expression vector (a gift from
Monsanto Co., St. Louis, MO) does contain an EcoRI site which
would facilitate direct cloning from the original pBluescript plasmid
into the pMON5743 vector. However, expression of proteins cloned into
this site would result in a protein fused with unwanted protein
sequence. Therefore, we decided to clone the cDNA into NcoI
and HindIII sites, and this would also facilitate directional
cloning. In order to clone B cDNA into the NcoI and HindIII sites of the expression vector pMON5743, corresponding
restriction enzyme sites were created by PCR, using 5`-end primer
(5`-TTTTTCCATGGGGA-AGATCACTTTTT-3`) containing NcoI site and
3`-end primer (5`-TTTTTAAGCTTCCTTTTTGTGCCAGAACAC-3`) containing HindIII site. Site-directed mutagenesis in B cDNA was
also generated by PCR using the same 3`-end primer as described above
and a mutagenic 5` end primer (TTTTTCCATGGGGACGATCACTTTTT) which
changes the third cordon from AAG (Lys) to ACG (Thr). Following PCR,
both the wild type and mutant cDNAs as well as the vector pMON5743 were
double-digested with NcoI and HindIII. The digested
cDNAs and vector were then ligated by DNA ligase. JM101 Escherichia
coli were transformed with 5 µl of the ligation mixture by the
heat shock method. The transformed JM101 E. coli cells were
spread on agarose plates containing 200 µg/ml ampicillin, and six
clones were picked out. After minipreps the plasmids were double
digested with NcoI and HindIII to confirm the
presence of the cDNA insert. Plasmid DNA was prepared from two of the
best cultures and stored at 4 °C and the remainder of the cells
were stored at -70 °C in 20% glycerol. The nucleotide
sequences of wild type and mutant B-crystallin cDNAs were checked
by the dideoxy chain termination method (23) using the U. S.
Biochemical Corp. sequencing kit. All primers used in this study were
prepared on an Applied Biosystems 380B synthesizer.
Expression and Purification of Recombinant
B-CrystallinExpression of bovine B-crystallin was
carried out according to the method of Olins and Rangwala(24) .
Briefly, cultured and stored E. coli cells (from a single
colony) were added to 500 ml of M9 minimal salt (Sigma) supplemented
with 0.8% (w/v) glucose, 1% (w/v) casamino acids, and 0.0005% (w/v)
thiamine in distilled water. The culture was grown at 37 °C with
vigorous aeration until it reached a density of approximately A = 0.5, and the recA promoter was induced by the addition of 50 µg/ml nalidixic
acid. Growth was continued for a further 4 h, then the cells were
harvested by centrifugation. A negative control (JM101 E. coli cells not containing the plasmid DNA but induced) was run
simultaneously. The collected cells were suspended in 100 ml of 300
mM Tris-HCl (pH 7.4), 10 mM NaCl, 5 mM EDTA,
and 0.5 mM phenylmethylsulfonyl fluoride. After incubation
with shaking for 8 h on ice, the supernatant was removed after
centrifugation and used for purification of B-crystallin. SDS-PAGE
and Western blotting were performed to confirm the expression of
B-crystallin. Purification was done by cation-exchange HPLC using
a 250 4.6-mm SynChropak CM300 column and a 50 4.6-mm
guard column (Synchrom Inc. Lafayette, IN), according to the method of
Siezen et al.(25) with minor modification. Before
each run, the column was equilibrated with buffer A (20 mM Tris acetate, pH 6.0, 1 mM EDTA, 0.1 mM
dithiotreitol, 0.02% NaN ) and the proteins were eluted with
0-40% linear gradient of buffer B (buffer A plus 0.5 M sodium acetate) for 40 min at a flow rate of 1 ml/min. About 150
µg to 3 mg of protein were loaded on the column.
Preparation of Total Calf -CrystallinCalf
lenses were decapsulated and homogenized in 50 mM phosphate
buffer (pH 7.0) containing 50 mM NaCl, and the homogenate was
then centrifuged at 10,000 g for 1 h at 4 °C. The
supernatant was loaded on a 100 1.5 cm Sephacryl-S-300-HR
(Sigma) column and developed isocratically with the same buffer. The
-crystallin peak which was eluted last was collected and used as a
control sample in all the studies.
SDS-PAGE and Western BlotThe expressed proteins
were analyzed on SDS-PAGE according to the method of Laemmli (26) under reducing conditions using a 12% separating gel and
4% stacking gel. For immunoblot analysis proteins were first resolved
by SDS-PAGE and then electroblotted to Millipore polyvinylidene
difluoride membrane using a Bio-Rad mini trans-blot electrophoretic
transfer cell according to the instruction of the manufacturers. After
blotting the membrane was washed with 20 mM Tris-HCl, pH 7.5,
150 mM NaCl, 0.05% NaN , and then incubated for 2 h
with 1:2000 diluted ascites fluid containing monoclonal antibody to rat
lens -crystallin(16) . The membrane was washed and
incubated with the second antibody (1:2000 diluted alkaline
phosphatase-linked goat anti-mouse antibody) for additional 2 h. The
-crystallins were visualized by incubation with the substrate
(Protoblot System, Promega) for about 15 min.
Isoelectric focusing of Recombinant
B-CrystallinIsoelectric focusing was carried out using
Resolve Omega isoelectric focusing Unit FR-2500 and pH 7-10
thin-layer agarose gel from Isolab, Inc. (Akron, OH) according to the
instruction of the manufacturer except that 0.25 M HEPES was
used as the anolyte.
Protein Sequence AnalysisManual micro-sequence
analysis was performed according to the DABITC/PITC degradation method (27) and the DABTH amino acids were detected by thin layer
chromatography with TLC-micropolyamide foils.
In Vitro Glycation of B-CrystallinThe
B-crystallin (1 mg/ml) solution in 20 mM Tris acetate, pH
7.4, 0.135 M sodium acetate, 1 mM EDTA, 0.1
mM dithiotreitol, 0.02% NaN was incubated at 37
°C in dark with 5 mM glucose, 40 µCi/ml
[ C]glucose (previously purified to remove fast
reacting impurities), and 100 mM sodium cynoborohydride. After
incubation, 50 µl of reaction mixture were spotted on ET-31 filter
paper and washed with at least 5 ml of 10% trichloroacetic acid, 5%
trichloroacetic acid (three changes), 1:1 ethanol:acetone, and acetone,
respectively, dried in a 55 °C oven, and counted.
Cross-linking of the Recombinant
-CrystallinsThe wild type and the mutant recombinant
B-crystallin preparations (1 mg/ml) in the Tris acetate, pH 7.4,
buffer were incubated with or without 5 mMDL-glyceraldehyde at 37 °C in dark for 10 days, and 5
µg of protein were analyzed by SDS-PAGE in reducing condition.
Peptide Mapping of Glycated B-CrystallinThe
glycated wild type and mutant B-crystallin as well as total calf
-crystallin were thoroughly dialyzed against 0.1 M NH HCO to remove extra
[ C]glucose. The dialyzed proteins were then
digested with chymotrypsin and the peptides were separated by
reverse-phase HPLC on a 4.6 250 mm Microsorb-MV C18 column
(Rainin Instrument Company). The developers consisted of 1%
trifluoroacetic acid in water (Solution A) and 1% trifluoroacetic acid
in acetonitrile (Solution B). The gradient system was as follows: 20
min 100% A followed by a linear gradient of 0-50% B in 120 min.
Each peak was collected and counted.
Amino Acid AnalysisTo determine the level of
glycation of Gly-1 versus Lys-2 or Lys-163 by amino acid
analysis, the wild type and mutant B-crystallins were glycated
with [ C]glucose and hydrolyzed for 24 h at 110
°C in evacuated sealed tubes with 6 M HCl containing 0.5%
(w/v) phenol. The hydrolysates were dried under vacuume followed by
derivatization with PITC. To get enough counts 10 µg of amino acid
was separated by reverse-phase HPLC on a Microsorb-MV C18 column (4.6
250 mm), and the effluent was counted in order to identify the
glycated glycine and lysine. Glycine and polylysine were incubated with
[ ]C-glucose in the presence of
NaCNBH . Glycated glycine and polylysine, after acid
hydrolysis, were reacted with PITC and separated as above by HPLC and
counted. The radio active peaks were used as standards to identify the
glycated glycine and lysine in the wild type and mutant
B-crystallins.
RESULTS
Cloning and MutagenesisAfter cloning the wild
type and the mutant cDNA into pMON5743 the plasmids were double
digested with NcoI and HindIII and run on 1% agarose
gel to confirm that the cDNA insert is present. On double digestion,
both wild type and mutant clone contained a 3.7-kb band (3613-bp
vector) and a 0.630-kb band (602-bp cDNA of B-crystallin), while
on single digestion, there was only one 4.3-kb band (4215 bp pMON5473
plus insert). The cDNA sequencing of wild type and mutant cDNA by the
dideoxy chain termination method confirmed the mutation of the third
codon AAG (Lys) to ACG (Thr). In addition, DNA sequencing did rule out
the presence of any random mutagenesis that could have occurred during
PCR mutagenesis and amplification.
Expression and Purification of Recombinant
B-CrystallinAfter induction the culture medium was
centrifuged and an aliquot of the supernatant was concentrated and
analyzed by SDS-PAGE. A band was seen at around 20 kDa corresponding to
the expected molecular mass of -crystallin. But the extracts from
the cell pellets contained much higher amounts of the 20-kDa
polypeptide comingrating with -crystallin (Fig. 1A). The wild type and mutant -crystallins
were purified by cation-exchange HPLC. Both wild type and mutant
-crystallins appeared as a single peak and the retention time of
wild type B-crystallin (27.51 min) was very close to that of calf
B-crystallin (27.87 min), while the mutant B-crystallin had a
retention time of 26.4 min which is about 1 min earlier than that of
wild type and calf B-crystallin. This difference in retention time
is consistent with a Lys Thr mutagenesis.
Figure 1:
Expression of wild type and mutant
B-crystallin in E. coli. A, SDS-PAGE of protein
in cell lysate. Lysates containing the wild type and the mutant
B-crystallin were run on 12% gel. They contain large amounts of
the 20-kDa polypeptide comigrating with the total calf
-crystallin. The cells containing pMON5743 with no cDNA were used
as control. STD, molecular mass standards. B,
SDS-PAGE and Western blot of purified recombinant B and total calf
-crystallin. Cation exchange HPLC purified wild type and mutant
B-crystallin and calf -crystallin were separated on SDS-PAGE,
eleceroblotted to polyvinylidene difluoride membrane, and then probed
with monoclonal antibody against rat -crystallin. The bands were
visualized by alkaline phosphatase
staining.
Characterization of Wild Type and Mutant
-CrystallinsSince the primary structure of rat and calf
-crystallins are similar(28) , immunological
cross-reaction was expected to exist between the two proteins. So the
monoclonal antibody against rat -crystallin was used in Western
blot to confirm that the 20-kDa polypeptide is -crystallin and, as
expected, distinct immunoreactive bands were observed (Fig. 1B). Both wild type and the mutant B showed
single bands on isoelectric focusing gel with a pI of 7.7 and 7.55,
respectively. This drop in pI was expected due to the mutation of Lys
to Thr.Since the mutation site is at the second amino acid position
from the N terminus of B-crystallin, it is convenient to use
manual sequencing method to verify the mutation and, at the same time,
to determine whether the N-terminal amino acid is glycine or
methionine. Sequential degradation revealed that the first amino acid
of both wild type and mutant are glycine and the second amino acids for
the wild type and the mutant are lysine and threonine, respectively.
Glycation of -CrystallinSince all calf
-crystallins have similar primary structure (28) and Lys-2
and Lys-163 are conserved amino acids which exist in all calf
-crystallins, we simply used total calf -crystallin as
control in our glycation experiment. Fig. 2shows the time
dependence of glycation of -crystallins during incubation with 5
mM [ C]glucose for a period of up to 5
days. After 5 days, extent of early glycation of wild type B is
similar to that of total calf -crystallin, while glycation of the
mutant B was about 50% lower. This suggests that glycation of
Lys-2 accounts for about half of the total glycation by all the sites.
Since Schiff-base was made irreversible by the presence of sodium
cyanoborohydride the data reflects only the early Schiff-base step and
not influenced by Amadori rearrangement or advanced glycation.
Figure 2:
Time course -crystallin glycation.
The wild type and mutant B-crystallins as well as total calf
-crystallin were incubated with [C]-glucose
for 5 days in the presence of sodium cyanoborohydride. An aliquot of
the reaction mixture was removed every 24 h and counted. Results are
means ± S.D. of three independent
experiments.
Cross-linking of Glycated Wild Type and Mutant
B-CrystallinsWild type and mutant B-crystallins were
incubated with or without glyceraldehyde for 10 days and then analyzed
by SDS-PAGE under reducing condition (Fig. 3). Glyceraldehyde
was chosen for this study because it is known to be a rapidly glycating
and cross-linking agent even at low concentration (13, 29) . With the glycated wild type B about
40-, 60-, 80-, 100-, and above 100-kDa bands were found, indicating the
existence of cross-linked aggregates of various sizes, while with
mutant B-crystallin the major bands were only at 40 and 60 kDa,
and these bands were significantly less dense in the mutant. Since the
SDS-PAGE was carried out under reducing condition, these polymers must
be the result of glycation and not the result of oxidation of
sulfhydryl groups.
Figure 3:
Cross-linking of the recombinant
B-crystallins. The expressed wild type and mutant
B-crystallins were incubated with/without 5 mM
glyceraldehyde (GD) for 10 days and 5 µg of protein were
analyzed by SDS-PAGE under reducing conditions. Cross-linking bands of
above 20 kDa were observed in the samples incubated with
glyceraldehyde.
Peptide Mapping of Glycated B-CrystallinTo
identify the sites that were glycated, chymotryptic peptides from
[ C]glucose-labeled B-crystallin were
separated by reverse phase-HPLC (Fig. 4). In total calf
-crystallin and wild type B-crystallin there were two labeled
fractions with the retention times of 94.71 and 99.45 min. In the
mutant B there were also two labeled fractions, but the retention
times increased to 96.99 and 101.14 min. In addition, the counts/min of
the second peak of the mutant B is much lower than that of the
wild type and calf -crystallins. Since it has been shown recently
that glycated (by glucose or ascorbic acid) and nonglycated peptides
having the same amino acid sequence comigrate on reverse-phase
HPLC(30, 31) , we were able to sequence the C-labeled peptides to determine the identity of the
glycated peptides. The sequences of the labeled peptides as determined
by the DABITC/PITC method were GKITF and GKITFY for the first and the
second labeled peptides, respectively, in the peptide maps of total
and the wild type (Fig. 5). In the mutant the only
difference was that Lys was replaced by Thr. Thus both the peptides
represent N-terminal sequences generated by chymotryptic cleavage at
Phe-5 and Tyr-6. Longer retention times for the two labeled peptides
from the mutant were expected from Lys to Thr mutation. Two minor
radioactivity peaks (a total of 25 and 50 cpm) were present, however,
they were not further analyzed.
Figure 4:
Peptide map of the glycated
-crystallins. The [C]glucose glycated wild
type and mutant B as well as total calf -crystallin were
digested with chymotrypsin and then the digested peptides were
separated by reverse phase-HPLC. Each peak was collected and counted.
Two radioactive peaks were identified in each sample, but the retention
times of the two peaks in mutant B were longer than that of wild
type B and total calf
-crystallins.
Figure 5:
Amino acid analysis of glycated
B-crystallin. [ C]Glucose-glycated wild type
and mutant B-crystallins (as in Fig. 2) were hydrolyzed,
derivatized with PITC, and separated on reverse phase-HPLC column and
the effluent was counted. To identify glycated glycine and lysine,
glycine and polylysine were incubated with
[ C]-glucose and reacted with PITC after acid
hydrolysis.
Glycation of Gly-1, Lys-2, and Lys-163: Results of Amino
Acid AnalysisGlycation sites were confirmed by amino acid
analyis of the wild type and the mutant B-crystallins after
incubation with [ C]glucose. Acid hydrolysates
were reacted with PITC and the amino acids separated by reverse-phase
HPLC. Fig. 5shows the amino acid separations including the C-labeled glycated glycine and lysine. The identity of the
labeled peaks was ascertained by using glycated glycine and glycated
lysine as standards. The following conclusions could be made from the
amino acid analyis data. 1) As expected from our previous
studies(32) , lysine, which was glycated at the -NH group and derivatized by PITC at the -NH group
generated two peaks both of which were eluted before the unmodified
lysine peak. 2) Glycated glycine, which is detectable only by the label
on it, was retained longer than phenylthiocarbamyl-Gly. 3) In the wild
type B, the total radioactivity counts under the glycated glycine
peak (or the level of glycation of the -NH group of
Gly-1) were nearly twice as that of the counts under the glycated
lysine peaks. 4) The data from the mutant showed about 50% reduction in
the lysine content, which was expected, and about 70% decrease in
glycated lysine radioactivity. The residual glycated lysine
radioactivity presumably came from glycation of Lys-163; however, Gly-1
was the major glycation site in the mutant B as well.
DISCUSSION
The present study shows that the -NH group
of Gly-1 is the most predominant glycation site of bovine
B-crystallin. Lys-2, on the other hand is glycated slower than
Gly-1 but significantly faster than Lys-163. About 50% decrease in the
level of glycation of the mutant B suggested an equal
participation by Gly-1 and Lys 2 (Fig. 2), but this was not
confirmed by the amino acid analysis data (Fig. 5). By
fructation (glycation by fructose) studies Pennington and Harding (33) concluded that glycation occurs exclusively at Gly-1. This
conclusion was based on amino acid analysis of glycated tryptic
peptides isolated by affinity chromatography. There are disadvantages
in relying on the analysis of tryptic peptides. Trypsin will not cleave
at Lys-2 if it is glycated and even if it is not glycated cleavage at
this Lys, being close to the N terminus, will be slow. In fact, the
preferred site for trypsin cleavage which is close to the N terminus
would be Arg-9 and it is surprising that these authors did not find a
glycated peptide containing this Arg and one or more glycated sites
(Gly-1 and/or Lys-2). Using peptide mapping we showed that there
were only two major glycated peptides in the native and wild type
-crystallin (Fig. 4). After mutation, the retention times
of these two peptides became longer and their radioactivities
decreased. These results implicate that 1) both the glycated peptides
came from the N-terminal but have different length and 2) both Gly-1
and Lys-2 were glycated. Sequencing by the DABITC/PITC method showed
both the labeled or glycated peptides (Fig. 4) as having the
N-terminal sequence. Abraham et al.(34) had attempted
to determine in vivo glycation sites of -crystallin
isolated from high molecular weight aggregates of a urea-soluble
fraction and showed significant glycation of the N-terminal sites (did
not differentiate between Gly-1 and Lys-2) and Lys-163. This difference
may be due to the fact B-crystallin from water-insoluble high
molecular weight aggregates may have been denatured in vivo,
and so all the potential glycation sites were exposed to all reducing
sugars during the entire time. In vitro glycation for a
relatively short period of time with physiological glucose
concentration showed site specificity at the N-terminal residues. Glycation in general takes place mainly at -amino groups of
lysine residues and N-terminal -amino groups. In the process of
protein glycation, some lysine residues are glycated and some are not.
There is little information regarding the specificity of glycation
sites of proteins. In hemoglobin the most reactive lysine residues
appear to be located adjacent to a carboxylate group in the primary or
three-dimensional structure of the protein(35) . In
B-crystallin Gly-1 and Lys-2 are adjacent to the carboxylate group
of Asp-38 in a three-dimensional structure(28) , and this could
influence glycation at these sites by facilitating Amadori
rearrangement. However, this argument may not be valid here because in vitro glycation was done in the presence of sodium
cyanoborohydride which traps the aldimine adducts preventing them from
going through the Amadori step. Since the pK of an -amino group is at least 2-2.5 units lower
than that of an -NH group, the propensity of the
former to form aldimine is expected to be considerably higher than that
of the latter. In protein glycation process the conformation of the
protein must be one of the important factors which determine if the
sugar is able to access to the - or -NH groups.
So it is important to know if expressed B-crystallin has the right
conformation. Hay et al.(36) have also expressed
B-crystallin in a similar bacterial expression system and showed
that both native and expressed -crystallin contained 50-60%
of the -sheet structure and low (5%) -helix content. Based on
tryptophan fluorescence and far-UV circular dichroism measurements,
there does not appear to be any conformational destabilization in the
wild type or mutant B-crystallin as compared to calf
B-crystallin. ( )After incubation of the wild type and
the mutant B-crystallins with glyceraldehyde, the wild type B
showed more cross-linking products than the mutant B-crystallin
and higher molecular species of 80, 100, and above 100 kDa appeared
only in the wild type B-crystallin. This implicates the important
role of Lys-2 in B-crystallin cross-linking and in the formation
of high molecular weight aggregates.
FOOTNOTES
- *
- This work
was supported by National Eye Institute Research Grant EY 07394. The
costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed.
Tel.: 706-721-9526; Fax: 706-721-6608.
- (
) - The
abbreviations used are: AGE, advanced glycation end products; PCR,
polymerase chain reaction, PAGE, polyacrylamide gel electrophoresis;
PITC, phenylisothiocynate; DABITC, dimethylaminoazobenzene
4`-isothiocynate; HPLC, high pressure liquid chromatography; bp, base
pair(s); kb, kilobase pair(s).
- (
) - A. J. Pande,
H.-R. Zhao, and E. C. Abraham, unpublished results.
ACKNOWLEDGEMENTS
We thank Dr. Regine Hay for the gift of bovine
B-crystallin cDNA clone. We are also grateful to Monsanto Company
for the gift of pMON5743 expression vector. We appreciate the helpful
comments from Dr. Terry Stoming and Dr. S. Swamy-Mruthinti during the
course of this study and the assistance of Joyce Hobson for the
preparation of this manuscript.
REFERENCES
- Monnier, V. M. (1989) in The Maillard Reaction in Aging, Diabetes and Nutrition (Baynes, J. W., and Monnier, V. M., eds) pp. 1-22, Alan R. Liss, New York
- Sell, D. R., and Monnier, V. M. (1989) J. Biol. Chem. 264,21597-21602
[Abstract/Free Full Text]
- Monnier, V. M., and Cerami, A. (1981) Science 211,491-493
[Abstract/Free Full Text]
- Abraham, E. C. (1985) Glycosylated Hemoglobins: Methods of Analysis and Clinical Applications , pp. 33-58, Marcel Dekker, New York
- Bloemendal, H. (1981) in Molecular and Cellular Biology of the Eye Lens (Bloemendal, H., ed) pp. 1-47, Wiley & Sons, New York
- Stevens, V. J., Rouzer, C. A., Monnier, V. M., and Cerami, A. (1978) Proc. Natl. Acad. Sci. U. S. A. 75,2918-2922
[Abstract/Free Full Text]
- Abraham, E. C., Swamy, M. S., and Perry R. E. (1989) in The Mailard Reaction in Aging Diabetes and Nutrition (Baynes, J. W., and Monnier, V. M., eds) pp. 123-139, Alan R. Liss, New York
- Araki, N., Ueno, N., Chakrabarti, B., Morino, Y., and Horiuchi, S. (1992) J. Biol. Chem. 267,10211-10214
[Abstract/Free Full Text]
- Nakayama, H., Mitruhashi, T., Kuwajima, S., Aoki, S., Kuroda, Y., Itoh, T., and Nakagawa, S. (1993) Diabetes 42,345-350
[Abstract]
- Beswick, H. T., and Harding, J. J. (1987) Biochem. J. 246,761-769
[Medline]
[Order article via Infotrieve]
- Luthra, M., and Balasubramanian, D. (1993) J. Biol. Chem. 268,18119-18127
[Abstract/Free Full Text]
- Swamy, M. S., and Abraham, E. C. (1987) Invest. Ophthalmol. Vis. Sci. 28,1693-1701
[Abstract/Free Full Text]
- Swamy, M. S., Tsai, C., Abraham, A., and Abraham, E. C. (1993) Exp. Eye Res. 56,177-185
[CrossRef][Medline]
[Order article via Infotrieve]
- Kodama, T., and Takemoto, L. (1988) Invest. Ophthalmol. Vis. Sci. 29,145-149
[Abstract/Free Full Text]
- Swamy, M. S., and Abraham, E. C. (1991) Exp. Eye Res. 52,439-444
[CrossRef][Medline]
[Order article via Infotrieve]
- Swamy, M. S., Shyamala, M., Abraham, J., Garver, F. A., and Abraham, E. C. (1989) Curr. Eye Res. 8,989-996
[Medline]
[Order article via Infotrieve]
- Harding, J. J., and Crabbe, M. J. C. (1984) in The Eye (Davson, H., ed) Vol. 1b, pp. 207-492, Academic Press, London
- Bloemendal, H., Piatigorsky, J., and Spector, A. (1989) Exp. Eye Res. 48,465-466
[CrossRef][Medline]
[Order article via Infotrieve]
- Wistow, G., Turnell, B., Summers, L., Slingsby, C., Moss, D., Miller, L., Lindley, P., and Blundell, T. (1983) J. Mol. Biol. 170,175-202
[CrossRef][Medline]
[Order article via Infotrieve]
- Blundell, T., Lindley, P., Miller, L., Moss, D., Slingsby, C., Tickle, I., Turnell, B., and Wistow, G. (1981) Nature 289,771-777
[CrossRef][Medline]
[Order article via Infotrieve]
- Harding, J. J., Ajiboy, R., Blakytny, R., and Lewis, B. (1987) in Proc. Int. Soc. Eye Res. 5,95 (abstr.)
- Hay, R. E., Woods, W. D., Church, R. L., and Petrash, J. M. (1987) Biochem. Biophys. Res. Commun. 146,332-338
[CrossRef][Medline]
[Order article via Infotrieve]
- Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467
[Abstract/Free Full Text]
- Olins, P. O., and Rangwala, S. H. (1990) Methods Enzymol. 185,115-119
[Medline]
[Order article via Infotrieve]
- Siezen, R. J., Kaplan, E. D., and Anello, R. D. (1985) Biochem. Biophys Res. Commun. 127,153-160
[CrossRef][Medline]
[Order article via Infotrieve]
- Laemmli, U. K. (1970) Nature 227,680-685
[CrossRef][Medline]
[Order article via Infotrieve]
- Chang, J. Y. (1983) Methods Enzymol. 91,455-466
[Medline]
[Order article via Infotrieve]
- Summers, L., Wistow, G., Narebor, M., Moss, D., Lindley, P., Slingsby, C., Blundell, T., Bartunik, H., and Bartels, K. (1984) Pept. Protein Rev. 3,147-168
- Acharya, A. S., Cho, Y. J., and Manjula, B. N. (1988) Biochemistry 27,4522-4529
[CrossRef][Medline]
[Order article via Infotrieve]
- Abraham, E. C., Cherian, M., and Smith, J. B. (1994) Biochem. Biophys. Res. Commun. 201,1451-1456
[CrossRef][Medline]
[Order article via Infotrieve]
- Ortwerth, B. J., Slight, S. H., Prabhakaram, M., Sun, Y., and Smith, J. B. (1992) Biochim. Biophys. Acta 1117,207-215
[Medline]
[Order article via Infotrieve]
- Swamy, M. S., and Abraham, E. C. (1992) Curr. Eye Res. 9,833-842
- Pennington, J., and Harding, J. J. (1994) Biochim. Biophys. Acta 1226,163-167
[Medline]
[Order article via Infotrieve]
- Abraham, E. C., Perry, R. E., Abraham, A., and Swamy, M. S. (1991) Exp. Eye Res. 52,107-112
[CrossRef][Medline]
[Order article via Infotrieve]
- Shapiro, R., McManus, M. J., Zabut, C., and Bunn, H. F. (1980) J. Biol. Chem. 255,3120-3127
[Free Full Text]
- Hay, R., Andley, U., and Petrash, J. M. (1994) Exp. Eye Res. 58,573-584
[CrossRef][Medline]
[Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
J. C. Aon, R. J. Caimi, A. H. Taylor, Q. Lu, F. Oluboyede, J. Dally, M. D. Kessler, J. J. Kerrigan, T. S. Lewis, L. A. Wysocki, et al.
Suppressing Posttranslational Gluconoylation of Heterologous Proteins by Metabolic Engineering of Escherichia coli
Appl. Envir. Microbiol.,
February 15, 2008;
74(4):
950 - 958.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. B. Johansen, L. Kiemer, and S. Brunak
Analysis and prediction of mammalian protein glycation
Glycobiology,
September 1, 2006;
16(9):
844 - 853.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Yang, B. Dixit, J. Wada, Y. Tian, E. I. Wallner, S. K. Srivastva, and Y. S. Kanwar
Identification of a renal-specific oxido-reductase in newborn diabetic mice
PNAS,
August 10, 2000;
(2000)
160266197.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
H.-R. Zhao, R. H. Nagaraj, and E. C. Abraham
The Role of alpha - and epsilon -Amino Groups in the Glycation-mediated Cross-linking of gamma B-crystallin. STUDY OF THREE SITE-DIRECTED MUTANTS
J. Biol. Chem.,
May 30, 1997;
272(22):
14465 - 14469.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Yang, B. Dixit, J. Wada, Y. Tian, E. I. Wallner, S. K. Srivastva, and Y. S. Kanwar
Identification of a renal-specific oxido-reductase in newborn diabetic mice
PNAS,
August 29, 2000;
97(18):
9896 - 9901.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|