|
Volume 270,
Number 36,
Issue of September 08, pp. 21291-21298, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Silencer
Elements Modulate the Expression of the Gene for the Neuron-Glia Cell
Adhesion Molecule, Ng-CAM (*)
(Received for publication, June 5, 1995; and in revised form, July 10, 1995)
Pekka
Kallunki
,
Stephen
Jenkinson
,
Gerald M.
Edelman
,
Frederick S.
Jones
From the Department of Neurobiology, The Scripps Research Institute, La
Jolla, California 92037
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The combined factors that regulate the expression of cell
adhesion molecules (CAMs) during development of the nervous system are
largely unknown. To identify such factors for Ng-CAM, the neuron-glia
CAM, constructs containing portions of the 5` end of the Ng-CAM gene
were examined for activity after transfection into N2A neuroblastoma
and NIH3T3 cells. Positive regulatory elements active in both cell
types included an Ng-CAM proximal promoter with SP1 and cAMP response
element motifs extending 447 base pairs upstream of a single RNA start
site and a region within the first exon corresponding to
5`-untranslated sequences. Negative regulatory elements included five
neuron-restrictive silencer elements (NRSEs) and a binding site for Pax
gene products in a 305-base pair segment of the first intron.
Constructs containing the promoter together with the entire first
intron were active in N2A cells but were silenced in NIH3T3 cells. This
silencer activity was mapped to the NRSEs. In contrast, the Pax motif
inhibited activity of Ng-CAM constructs in both cell types. The DNA
elements defined in these transfection experiments were examined for
their ability to bind nuclear factors. The region within the first exon
formed a DNA-protein complex after exposure to nuclear extracts
prepared from both NIH3T3 and N2A cells. The NRSE region formed a more
prominent complex with proteins prepared from NIH3T3 cells than it did
with extracts from N2A cells. A member of the Pax protein family, Pax-3
bound to the Pax motif. Mutations introduced within the Pax motif in
its ATTA sequence eliminated this binding whereas mutations in its
GTTCC sequence did not, suggesting that paired homeodomain interactions
are important for the recognition of Pax-3 by this DNA target sequence.
The combined data suggest that negative regulation by NRSEs and Pax
proteins may play a key role in the place-dependent expression patterns
of Ng-CAM during development.
INTRODUCTION
Cell adhesion molecules (CAMs) ( )are essential for
guiding tissue formation (1) and play key roles in the
development of the nervous system. CAMs important in the nervous system
include N-CAM-related molecules such as Ng-CAM(2, 3) ,
Nr-CAM (4, 5) , L1 (NILE)(6, 7) ,
neurofascin/ABGP(8, 9) , TAG-1/axonin-1/F3 (10, 11, 12) , and contactin(13) .
Ng-CAM, L1, Nr-CAM, neurofascin/ABGP from vertebrates and neuroglian
from Drosophila(14) comprise a subfamily of neural
CAMs containing six immunoglobulin domains and five fibronectin type
III repeats. Molecules of this Ng-CAM subfamily are expressed
prominently in axonal pathways in both the central nervous system and
peripheral nervous system and are involved in neurite fasciculation and
outgrowth. Each of these neural CAMs has a characteristic spatial and
temporal expression pattern during neural morphogenesis but the factors
that restrict expression of Ng-CAM and other neural CAM genes to
particular populations of neural cells are not well understood. To
define the sequences of DNA responsible for place-dependent expression
of CAMs, we have focused on signals from homeobox and Pax gene
products(15, 16, 17, 18) . An
attractive hypothesis is that Ng-CAM and other neural CAMs are targets
of homeodomain and Pax proteins(19) . During neural
development, a number of transcriptional regulators encoded by the
homeobox and Pax gene families appear in defined expression
patterns along the anterior-posterior and dorsal-ventral axes of the
embryo that correlate with the patterns of a variety of CAMs. Moreover,
mutations in Pax genes are known to alter the programs of
neural differentiation and migration, processes that are influenced by
the activity of neural CAMs. For example, mutations in Pax-6 and Pax-3 genes lead to developmental defects of the
nervous system as shown, respectively, in small eye and splotch mutant mice(20) . Some of these defects appear
to be caused by aberrant neuronal migration(21, 22) ,
a process normally modulated by neural CAMs. To examine the factors
regulating Ng-CAM expression, we have isolated genomic clones
containing the 5` end of the Ng-CAM gene, characterized its proximal
promoter, and located two regulatory regions within a 305-base pair
segment of the first intron. One region of the first intron was found
to contain five neuron-restrictive silencer elements (NRSEs) which
extinguished expression of the Ng-CAM gene in a fibroblast cell line,
but not a neuroepithelial cell line. Another region contained GTTCC and
ATTA sequences characteristic of binding sites for Pax proteins. This
Pax motif was found to bind Pax-3 in gel mobility shift experiments;
such binding was disrupted when specific mutations were introduced in
the ATTA sequence within the Pax motif. In transfection experiments
with both NIH3T3 and N2A cells, this Pax motif was found to be a
negative regulator of Ng-CAM gene expression independent of the
silencing imposed by NRSEs. Our studies suggest that the NRSEs and Pax
motif may play critical roles in the place-dependent expression of
Ng-CAM in the nervous system.
MATERIALS AND METHODS
Analysis of Ng-CAM Genomic DNAA chicken genomic
DNA library in the cosmid vector pWE15 (Clontech) was screened using a
400-base pair P-labeled EcoRI-BstXI
fragment derived from the 5` end of the Ng-CAM cDNA
sequence(3) . A single cosmid clone (Cos-Ng) was isolated.
Sequencing of the 2536-base pair segment of Ng-CAM genomic DNA was
performed by the dideoxy chain termination method using Sequenase (U.
S. Biochemical Corp.) (23) and the data were compiled using the
GCG package (University of Wisconsin). The NRSEs and the Pax motif were
not revealed in conventional data base searches, but were found after
analysis of Ng-CAM constructs in transfection experiments. Ng-CAM NRSEs
were aligned with the consensus NRSE sequence (24) using the
fasta algorithm(25) . Oligonucleotides were made using a 392
DNA synthesizer (Applied Biosystems, Chatsworth, CA).
Determination of the Transcription Initiation
SiteThe transcription start site was determined through a
combination of primer extension and RNase protection analyses.
Poly(A) RNA was isolated from 12 day embryonic chick
brains using the Fast Track mRNA isolation kit (Invitrogen, San Diego,
CA). For primer extension, 4 µg of poly(A) RNA was
hybridized to a P-labeled oligonucleotide designated
oNg-7, derived from the antisense strand of the first exon of the
Ng-CAM gene (Fig. 2, from position +185 to +166).
Primer extension was performed using Superscript reverse transcriptase
(Life Technologies Inc.) at 42 °C for 1 h.
Figure 2:
DNA sequence of a 2536-base pair segment
of the Ng-CAM gene starting at a position 447 base pairs upstream of
the transcription start site and ending within the second exon, 2089
base pairs downstream from the RNA start site. The start of RNA
transcription is indicated by a rightward pointing arrow.
Potential regulatory motifs within the proximal promoter and the first
intron of the gene are underlined. These sequences include the
CRE, SP1, NRSE, and Pax motifs.
RNase protection
analysis was performed using the RPA II kit (Ambion). The template for
the RNA probe was made by polymerase chain reaction from the genomic
DNA. The downstream primer used for the amplification was Ng-7/T3-, an
oligonucleotide identical in sequence to oNg-7, but also containing the
T3 RNA polymerase promoter at the 5` end. The upstream primer used in
the polymerase chain reaction was an oligonucleotide designated oNg-6,
derived from the sense strand of the Ng-CAM genomic sequence (Fig. 3, position -172 to -156). A labeled RNA probe
was synthesized from the template using T3 RNA polymerase and
[ P]UTP. Template DNA was then digested with
RNase-free DNase. Two fmol of probe in elution buffer was mixed with 1
µg of poly(A) RNA from 12 day embryonic chick
brains and hybridized at 45 °C for 16 h. RNase protection analysis
was performed using different dilutions of RNase to determine the
optimal conditions for cleavage. The products of both primer extension
and RNase protection analysis were resolved on an 8% polyacrylamide
sequencing gel.
Figure 3:
Activity of Ng-CAM constrcts in NIH3T3 and
N2A cells. Top, diagram of the 5` end of the Ng-CAM gene
showing the position of various restriction sites used to prepare
deletion constructs. Sequences included in exons are indicated with boxes that are either solid black or cross-hatched. The cross-hatched region corresponds
to the +82/+182 region of the first exon. The five NRSEs are
represented by boxes numbered 1-5. The Pax motif is located
immediately downstream from the NRSEs and is indicated by an open
box. N2A or NIH3T3 cells were transfected with the promoterless
CAT gene reporter vector (Bas) or 14 other constructs containing
various segments from the 5` end of the Ng-CAM gene. Cell extracts were
normalized to an internal reference standard of -galactosidase
activity and assayed for CAT activity as described under
``Materials and Methods.'' CAT activity for all constructs
was quantitated using a PhosphorImager from four separate experiments
performed in duplicate in which the activity levels varied no more than
5%.
Construction of Reporter PlasmidsReporter gene
plasmids were constructed in the promoterless chloramphenicol
acetyltransferase (CAT) gene vector pCAT-basic (Promega, Madison, WI)
and pBluescript-II (Stratagene, La Jolla, CA) and are shown
schematically in Fig. 3. Ng447 and Ng447/182 plasmids were
constructed by polymerase chain reaction amplification of DNA segments
spanning the regions between -447 and +61 and -447 and
+182, respectively, and were inserted into the pCAT basic vector
(Promega). The Ng4, Ng1.5, and Ng200 plasmids containing 4 kilobases,
1.5 kilobases, and 200 base pairs of Ng-CAM gene 5`-flanking sequence,
respectively, were made by insertion of appropriate restriction
fragments into the pCAT-basic vector. The Ng447+I construct was
made by insertion of a 2536-base pair BamHI-PvuII
fragment into pBluescript and the CAT gene was inserted into the KpnI site immediately downstream. The constructs SgBsp, EE,
EA, ES, and AS constructs containing internal deletions of the first
intron were prepared by excision of SgrAI-BspMI, EcoRV-EcoRV, EcoRV-AatII, EcoRV-SmaI, and AatII-SmaI
restriction fragments, respectively, from the Ng447+I construct
followed by religation. Synthetic NRSE/Ng-CAM promoter constructs SS
and SAS were prepared by insertion of the Ng-CAM NRSEs (the region
between +1388 and +1566) in either orientation upstream of
the promoter in the Ng447 construct.
Cell Culture, Transfection Experiments, and Promoter
AssaysMouse neuroblastoma N2A cells were passaged in
Dulbecco's modified Eagle's medium supplemented with 10%
fetal bovine serum. Mouse NIH3T3 fibroblasts were passaged in
Dulbecco's modified Eagle's medium with 10% newborn calf
serum. 2 10 cells were seeded onto 6-well 60-mm
tissue culture plates (Corning) and grown until 50% confluency was
attained. Each well of cells was transfected with 2.5 µg of plasmid
DNA, in a mixture containing 6 µl of lipofectamine reagent in 1 ml
of Opti-MEM media (Life Technologies, Inc.). The plasmid RSV- gal
(0.5 µg) was co-transfected in all experiments and served as an
internal control to normalize the transfection efficiencies between
different cell types and experiments. The Opti-MEM media was replaced
after 6 h with Dulbecco's modified Eagle's medium
containing the appropriate serum. Cells were incubated for an
additional 48-72 h, collected, and resuspended in 150 µl of
0.25 M Tris, pH 7.5. Cell extracts were prepared by freezing
and thawing. -Galactosidase activity was assayed using the
Fluoreporter lacZ/galactosidase quantitation kit (Molecular Probes,
Eugene, OR). Levels of activity were measured using the Cytofluor 2350
fluorescence measurement system (Millipore). Cell extracts were assayed
for CAT activity as described(26) . Levels of CAT activity were
quantitated on a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).
The values for CAT activities reported for various Ng-CAM constructs
were derived from at least four separate experiments performed in
duplicate. Within such experiments, the activity levels for a given
construct varied no more than 5%.
Preparation of Nuclear Extracts, the Pax-3 Fusion
Protein, and Gel Mobility Shift AssaysNuclear extracts were
prepared from NIH3T3 and N2A cells as described
previously(26) . The mouse Pax-3 cDNA (kindly provided by G.
Chalepakis and P. Gruss of the Max-Planck Institute, Gottingen,
Germany) was inserted into the pGEX-2T vector. GST and GST/Pax-3 fusion
proteins were produced in Escherichia coli NM522 cells and
purified as described previously(17) . The DNA fragment
corresponding to the +82 to +182 region of the Ng-CAM gene
was prepared by restriction endonuclease cleavage with SgrAI
and BspMI. A 178-base pair DNA fragment containing the five
NRSEs was prepared by excision of a HindIII fragment from the
SS construct. The Pax motif probe was prepared by annealing 5 pmol of
complementary oligonucleotides derived from the Pax motif of the Ng-CAM
gene (+1679 to +1708). All probes were labeled using the
Klenow fragment of E. coli DNA polymerase I
[ P]dCTP (6000 Ci/mmol) (DuPont
NEN)(27) , and purified by electrophoresis on a 10%
polyacrylamide gel.For binding reactions involving nuclear
extracts, 5 fmol (approximately 20,000 cpm) of either
+82/+182 or NRSE probe was mixed with 10 µg of protein
from either NIH3T3 or N2A cells in a buffer containing 10 mM Hepes, 200 mM KCl, 0.5 mM dithiothreitol, 0.1%
Nonidet P-40, 100 ng/ml poly(dI-dC) with 10 µg of bovine serum
albumin. Competitors (either 10- or 100-fold excess of cold
+82/+182 or NRSE DNAs) were included in some binding
reactions. Binding components were incubated for 15 min at room
temperature and subjected to electrophoresis on a 4% polyacrylamide gel
in 0.25 TBE buffer at 400 V for 2 h at 4 °C. For binding
reactions involving the Pax-3 fusion protein, 200,000 cpm of probe was
incubated with 0.5, 2.5, or 5 µg of GST/Pax-3 fusion protein.
Binding reactions were performed in a volume of 20 µl containing 15
mM Tris-HCl, pH 7.5, 6.5% glycerol, 90 mM KCl, and
0.2 mM dithiothreitol. Bovine serum albumin (0.5 mg/ml) and
sheared salmon sperm DNA (100 ng) were added to each binding reaction
to reduce nonspecific binding. Reactions were incubated at room
temperature for 30 min and subjected to electrophoresis on a 5%
polyacrylamide gel in 0.5 TBE buffer at 200 V at 4 °C. Gels
were dried and exposed to film at -70 °C.
RESULTS
Structure of the 5` End of the Ng-CAM Gene:
Identification of the Proximal Promoter and Regulatory Sequences in the
First IntronA cosmid clone (designated Cos-Ng) was isolated
after screening with a P-labeled 400-base pair EcoRI-BstXI fragment derived from the 5` end of the
Ng-CAM cDNA sequence(3) . Cos-Ng contained an insert
approximately 20 kilobases in length. The borders for the first seven
exons and introns were located by restriction mapping and Southern
blotting and their sequences were determined using oligonucleotide
primers derived from the Ng-CAM cDNA sequence (Fig. 1).
Figure 1:
Structure of the 5` end of the Ng-CAM
gene. Top, diagram of the 20-kilobase insert from the chicken
cosmid clone Cos-Ng containing the first seven exons of the Ng-CAM
gene. The portions of exons 1 and 2 encoding 5`-untranslated sequences
are indicated with an open box. Exons encoding translated mRNA
sequence are indicated with black boxes.Bottom,
nucleotide sequence of the borders for the first seven exons and
introns of the Ng-CAM gene. The coding sequences of the exons are shown
in upper case letters, while intronic sequences are indicated
with lower case letters. The ATG codon is located in exon 2
and amino acids encoded by nucleotides 3` of this position are shown
over the appropriate triplet codons. In some cases borders were
inferred solely from comparison of the Ng-CAM genomic sequence to the
published Ng-CAM cDNA sequence(3) .
To
determine the site of transcription initiation within the Ng-CAM gene,
we performed primer extension and RNase protection analyses of
poly(A) RNA isolated from chick brain tissue at
embryonic day 12. Extension of an antisense oligonucleotide primer
(oNg-7) yielded a single radiolabeled band of 185 nucleotides in length
(data not shown). Two prominent bands were observed in an RNase
protection experiment using a radiolabeled RNA probe corresponding to
the region from -300 to +185. Because the primer extension
and the largest RNase protection products had termini at exactly the
same upstream base pair in the genomic sequence, the nucleotide at this
position was designated +1, the start of transcription initiation
(see Fig. 2). The DNA sequence of a 2536-base pair segment of
the 5` end of the Ng-CAM gene including the 5`-flanking sequence, the
first exon, the first intron, and the second exon was determined (Fig. 2). This sequence has been deposited in GenBank under
accession number U31086. Several potential regulatory motifs were found
in the 5`-flanking region immediately adjacent to and upstream of the
RNA start site. They included two consensus binding sites for the SP1
transcription factor (28) located at -124 and -15
as well as a consensus cyclic AMP response element (CRE), located at
-255, which is known to bind members of the CREB family of
transcription factors(29) . After analyses of deletion
constructs in transfection experiments, additional elements were
located in a 178-base pair segment of the first intron (+1388 to
+1566) that included five copies of a sequence similar to that of
the NRSE. Further analysis also uncovered a 30-base pair element
(+1679 to +1708) similar to that of a binding site for Pax
gene products(20, 30, 31) . This Ng-CAM Pax
motif contains GTTCC and ATTA core sequences characteristic of a target
sequence recognized by those Pax proteins that contain two independent
DNA binding domains, paired domain and a
homeodomain(20, 32) .
Examination of Regulatory Elements in the Ng-CAM Gene by
Cellular Transfection ExperimentsTo locate the regions
important for regulation of the Ng-CAM gene, 14 different reporter
constructs were prepared and tested in transient transfection
experiments in two mouse cell lines, N2A neuroblastoma cells and NIH3T3
fibroblasts. N2A cells express a number of neural CAMs including N-CAM
and L1, a property suggesting that they may be well suited for assaying
the expression of Ng-CAM constructs. NIH3T3 fibroblasts were selected
as cells in which Ng-CAM constructs were expected to show little or no
activity.The various Ng-CAM reporter constructs and observed CAT
activities in N2A and NIH3T3 cells are summarized in Fig. 3.
Five reporter constructs containing different lengths of 5`-flanking
sequence (see Fig. 3, constructs Ng4, Ng1.5, Ng447, Ng200,
Ng447/182) were constitutively active in both NIH3T3 and N2A cells. The
Ng447 construct, containing 447 base pairs of 5`-flanking sequence and
61 base pairs of the first exon, was approximately 2-fold more active
than Ng4 and Ng1.5 in N2A cells, but not in NIH3T3 cells. The proximal
promoter region within this construct contained two consensus binding
sites for the SP1 transcription factor and a CRE. The Ng200 construct,
in which the promoter region between -447 and -200
containing the CRE sequence was deleted, showed 3-fold less activity in
both NIH3T3 and N2A cells than the Ng447 construct. This result
indicated that regulatory elements between -200 and -447
are required for basal promoter activity. The promoterless CAT vector,
pCAT-Basic (Bas) showed little, if any, activity in both cell types. A construct designated Ng447/182, containing the entire first exon
was approximately 2-fold more active than the Ng447 construct in both
NIH3T3 and N2A cells. These data suggested that the segment between
+61 and +182 is a positive regulatory region of the Ng-CAM
gene. A construct designated Ng447+I, containing the Ng-CAM
proximal promoter together with the entire first exon, first intron,
and a portion of the second exon was active in N2A cells but was
completely silent in NIH3T3 cells. This finding suggested that
sequences within the first intron of the Ng-CAM gene were capable of
silencing the gene in non-neuronal cells.
NRSEs Within the First Intron Silence Ng-CAM Expression
in NIH3T3 Cells, but Not in N2A CellsTo pinpoint the sequences
that silenced Ng-CAM gene expression in NIH3T3 cells, we examined
various constructs having deletions of segments of the first intron of
the Ng-CAM gene for loss of silencing in transfection experiments.
Constructs with deletions of the NRSEs were tested in both NIH3T3 and
N2A cells (Fig. 3). The Ng-CAM NRSEs show a high degree of
similarity with the NRSE consensus sequence, but they are all in the
orientation of the reverse complement from that found in the other
genes (Fig. 4). Two constructs, designated EE and EA, which
eliminated NRSEs1-4 and NRSEs1-5, respectively, showed an
increase in activity (i.e. loss of silencer activity) as
compared to the 447+I construct. The same deletion constructs
showed only a slight increase in activity in N2A cells.
Figure 4:
Comparison of the five NRSEs
(Ng-NRSE1-5) located between +1388 and +1566 in the
first intron of the Ng-CAM gene with a consensus NRSE sequence derived
from NRSEs found in several neural-specific genes(24) . The
Ng-CAM NRSEs are in the orientation of the reverse complement from
those found in other genes.
To examine
whether the NRSEs were sufficient for silencing of the Ng-CAM proximal
promoter, constructs were prepared in which the five NRSEs were placed
upstream of the Ng447 region of the Ng-CAM gene linked to a CAT
reporter. Two constructs were prepared in which the NRSEs were present
either in the orientation normally found in the gene (SAS) or in the
opposite orientation (SS). The SAS and SS constructs were both silent
in NIH3T3 cells, showing CAT activities that were comparable to the
Ng447+I and pCAT-Basic constructs (Fig. 3). However, in N2A
cells, the SAS and SS constructs were highly active and showed no
reduction of Ng-CAM proximal promoter activity. These studies suggest
that, while the NRSEs are sufficient to silence Ng-CAM promoter
activity in NIH3T3 cells, they do not show silencing in N2A cells.
The Pax Motif Negatively Regulates Ng-CAM Gene Expression
in Both NIH3T3 and N2A CellsTo test whether the Pax motif had
an effect on Ng-CAM expression, three constructs were prepared and
examined for activity (Fig. 3). A construct designated AS,
having a 145-base pair deletion which removed the Pax motif, showed
increased activity (i.e. a release from silencing) as compared
to the Ng447+I construct. The AS deletion showed a release from
silencing in both NIH3T3 and N2A cells (Fig. 3, compare AS to
Ng447+I). The same effects were observed in a construct in which
the GTTCC and ATTA sequences within the Ng-CAM Pax motif were deleted
(see the construct designated Pax, Fig. 3). A construct
designated ES, in which both the NRSEs and the Pax motif were removed
was more active than all other deletion constructs in NIH3T3 cells. The
effects of the NRSEs and the Pax region were additive, i.e. the level of activity from the ES construct was approximately
equal to the sum of activities from the EA and AS constructs. The
combined data suggest that, in some contexts, the NRSEs and the Pax
motif may act together to regulate expression of the Ng-CAM gene.
Binding of Nuclear Proteins to Ng-CAM Regulatory
ElementsTo examine whether nuclear protein factors could bind
to the various regulatory regions of the Ng-CAM gene, we conducted a
series of gel mobility shift experiments using two segments of the
Ng-CAM gene shown in these studies to be important for regulation in
cellular co-transfection experiments: 1) the +82/+182 region,
and 2) the NRSE region. Using the +82/+182 probe, a
DNA-protein complex was detected using nuclear extracts prepared from
both NIH3T3 and N2A cells (Fig. 5, panels A and B,
lane 2). Formation of these complexes was inhibited when an excess
of cold +82/+182 competitor was added (Fig. 5, panels A and B, lanes 3 and 4), but not when
an excess of cold NRSE competitor was added (Fig. 5, panels
A and B, lanes 5 and 6) to binding reactions.
Figure 5:
The +82/+182 and NRSE regions of
the Ng-CAM gene bind to nuclear factors prepared from NIH3T3 and N2A
cells. Either the +82/+182 (panels A and B)
or the NRSE (panels C and D) probe was mixed with
nuclear extracts prepared from NIH3T3 cells (panels A and C) or from N2A cells (panels B and D). For
binding reactions, probes were incubated without extract (all panels, lane 1) or with the appropriate nuclear extract (lanes
2-6). DNA-protein complexes formed between the
+82/+182 and NRSE regions of the Ng-CAM gene with nuclear
extracts are indicated with brackets labeled EX and NRSE, respectively. Competitor DNAs were added to some binding
reactions (all panels, lanes 3-6). Competitors included
either a 10- or 100-fold excess of the unlabeled DNA probe used in the
specific binding reactions (all panels, lanes 3 and 4, respectively). To test whether the NRSE sequence could
compete for binding of the +82/+182 probe to nuclear
extracts, either a 10-fold or a 100-fold excess of cold NRSE DNA was
added to the +82/+182 binding reactions (panels A and B, lanes 5 and 6, respectively). A similar
test for cross-competition was performed by adding either a 10- or
100-fold excess of cold +82/+182 DNA to the NRSE binding
reactions (panels C and D, lanes 5 and 6,
respectively). Reactions were subjected to electrophoresis on a 4%
polyacrylamide gel in 0.25 TBE buffer at 400 V for 2 h at 4
°C.
Binding experiments using the NRSE region as probe detected a clear
cut DNA-protein complex with nuclear extracts prepared from NIH3T3
cells and a slight, but detectable complex with proteins from N2A cells (Fig. 5, panels C and D, lane 2). Formation of
the NRSE-protein complex (particularly evident in NIH3T3 cells) was
inhibited with an excess of cold NRSE competitor (Fig. 5C,
lanes 3 and 4). Moreover, the +82/+182 segment
did not compete for the formation of the NRSE-protein complex (Fig. 5, panels A-D, lanes 5 and 6). Similar
competition experiments performed in N2A cells showed no diminution of
the faint signal, regardless of the competitor used (Fig. 5D, compare the band intensities in lanes 5 and 6 with those in lanes 2, 3, and 4).
These results suggested that proteins that bind to the NRSE are much
more abundant in NIH3T3 cells than in N2A cells. Furthermore, the
nuclear proteins bound by the +82/+182 and the NRSE regions
of the Ng-CAM gene appear to be different.
Binding of Pax-3 to the Pax MotifTo date, no
target gene containing a binding sequence for Pax-3 has been identified
in vertebrates. To determine whether the Pax motif in the first intron
of the Ng-CAM gene could bind directly to Pax-3, we prepared a
GST/Pax-3 fusion protein in bacteria. We tested this protein in gel
mobility shift experiments for binding to the Ng-CAM Pax motif and to
variants of this motif containing substitutions in the base pairs
important for recognition of the DNA binding moieties of Pax proteins.
Pax-3 was chosen for these experiments for two reasons. First, Pax-3 is
known to be expressed during periods of neuronal differentiation and
migration that coincide with Ng-CAM expression by postmitotic
neurons(20, 33) . Second, the Pax motif in the first
intron of the Ng-CAM gene resembled a binding sequence for a particular
subset of Pax proteins that include Pax-3, namely those proteins that
contain both a paired domain and a homeodomain. The Ng-CAM Pax motif
contains a GTTCC sequence that, in other genes, has been shown to
interact with the 128-amino acid paired domain (30) and an ATTA
sequence that has been shown to interact with the paired-type
homeodomain (20, 32, 34) .Four different
probes were tested for binding to Pax-3 (Fig. 6). The Ng-wt
probe contained the wild-type Pax motif (Fig. 3, the region
between 1679 and 1708). The Ng-H variant contained 3-base pair
substitutions that altered the ATTA motif. The Ng-P variant contained
11 base pair substitutions. Four substitutions destroyed the GTTCC
motif which has been shown to be essential for the binding of the e5
DNA sequence to the paired domains of Pax-1 and
Pax-3(30, 32, 35) . The seven other
substitutions made in Ng-P were introduced after comparing the sequence
of the Ng-CAM gene Pax motif to the consensus binding sequences for Pax
proteins (31, 36, 37) and took account of
critical base pair substitutions that may disrupt paired domain
interactions with DNA. The third variant, Ng-HP (Fig. 6),
contained the combination of mutations made in both Ng-H and Ng-P
variants.
Figure 6:
Binding of a Pax-3 fusion protein to the
Pax motif in the first intron of the Ng-CAM gene. Top, sequences of four probes used in gel mobility shift experiments.
The 5 base pairs at the 5` end of each sequence (lower-case
letters) are BamHI cohesive ends. The remaining 30 base
pairs (upper-case letters) are derived from the Pax motif
(between +1679 and +1708 in the Ng-CAM gene). Ng-wt is the
wild-type Ng-CAM Pax motif. GTTCC and ATTA motifs known to be important
for binding of Pax proteins to DNA are boxed. Three variants
of the Ng-wt sequence, designated Ng-HP, Ng-H, and Ng-P contain
specific base pair substitutions which are highlighted in boldface
type. Bottom, gel mobility shift assay showing binding of the
GST/Pax-3 fusion protein to P-labeled Ng-wt, Ng-HP, Ng-H,
and Ng-P probes. The individual probe used for binding is indicated at
the bottom of each panel. Binding reactions contained the
indicated probe either: without added protein (lanes marked
1), with 2.5 µg of GST control protein purified from E.
coli NM522 cells transformed with pGEX-2T (lanes marked
2), or with 0.5, 2.5, or, 5 µg of GST/Pax-3 or GST/Pax-6
fusion (lanes marked 3-5, respectively. Binding
reactions were subjected to electrophoresis on 6% polyacrylamide gels,
dried, and autoradiographed for 4 h.
The Ng-wt probe showed binding to the GST/Pax-3 protein,
but no binding to the GST control protein. Similar binding experiments
using the Ng-HP and Ng-H variants showed little or no binding to Pax-3.
The Ng-P variant showed no detectable decrease in binding to Pax-3 as
compared to that of the Ng-wt. This result suggested that the GTTCC
motif and other base pairs important for paired domain interactions
were not necessary for Pax-3 binding. Rather, these experiments
suggested that it was the ATTA motif that was important for Pax-3
binding to the Ng-CAM Pax motif.
DISCUSSION
In the chicken, Ng-CAM is first detected in the central
nervous system at embryonic day 3 in cells of the ventral neural tube
that are the precursors of motor neurons(38) . At later stages,
Ng-CAM appears on a number of neurons and is distributed mainly on
axons rather than cell bodies. In the cerebellum, Ng-CAM appears in
Purkinje cells, is expressed by a number of different fibers, and plays
a role in the migration of granule cell neurons on radial glia. The
synthesis of Ng-CAM also shows dynamic changes during both myelination
and during nerve regeneration. At the onset of myelination, Ng-CAM
expression decreases in the central nervous system but not in the
peripheral nervous system. Ng-CAM expression is increased after
peripheral nerve injury in the spinal cord and in the nerve at the
lesion site, but is decreased in dorsal root ganglia(39) .
These dynamic patterns of Ng-CAM synthesis in the nervous system
prompted us to identify factors that regulate Ng-CAM gene expression.
Structure of the 5` End of the Ng-CAM GeneWe have
isolated the 5` end of the chicken Ng-CAM gene (Fig. 7). The
first seven exons encode Ng-CAM mRNA sequences which include the
5`-untranslated region, the initiator methionine, the signal peptide,
the amino terminus, and the first two immunoglobulin domains of Ng-CAM (Fig. 1). Comparison of the partial Ng-CAM gene structure to the
gene structures for other closely related neural CAMs such as L1 (40) and Nr-CAM ( )reveals a close correspondence in
how untranslated and coding sequences are partitioned into exons. The
immunoglobulin domains typical for these molecules are all encoded by
two exons, a feature that sets them apart from immunoglobulin genes,
consistent with an evolutionary divergence(41) . Chicken
Ng-CAM, mouse L1, and chicken Nr-CAM, and chicken neurofascin proteins
share approximately 40% identity in their amino acid
sequences(3, 4, 6) . It has been long debated
whether Ng-CAM and L1 are functional equivalents in the chicken and
mouse. Based on the comparison of the 5` gene structures of these
neural CAMs, it is still not possible to establish whether the Ng-CAM
and L1 genes are in the same evolutionary lineage. Further comparison
of the cis control elements of these neural CAM genes may
resolve the issue and may also reveal similarities and differences in
regulatory regions affecting expression of these genes for neural CAMs.
Figure 7:
Location of DNA control elements in the 5`
end of the Ng-CAM gene. The locations of putative regulatory elements
in the proximal promoter are indicated with the appropriate symbol:
, SP1 sites; , CRE. The +82/+182 region of the
first exon showing positive regulation of the Ng-CAM constructs in both
N2A and NIH3T3 cells is represented with a cross-hatched box.
The five NRSEs within the first intron showing cell type-specific
silencing of Ng-CAM promoter activity in NIH3T3 cells are represented
by leftward pointing arrows indicating that similarities to
the NRSE consensus sequence (24) are found on the bottom
strand. The Pax motif showing negative regulation of the Ng-CAM
promoter in both cell types and binding to Pax-3 is indicated by an open box. The first and second exons of the Ng-CAM gene are
labeled 1 and 2,
respectively.
The Proximal PromoterThe Ng-CAM gene was
determined to have a single RNA start site, yet the Ng-CAM promoter was
found not to contain a TATA box, a sequence typically contained in
promoters for genes having a single RNA start site. However, the
sequence GGGGCGGGGC, which matches a consensus binding site for the SP1
transcription factor (28) was found immediately upstream of
the RNA start site at -15. Thus, it is possible that SP1 and
associated proteins may be part of a mechanism controlling
transcription of the Ng-CAM gene(42) .A region of 447 base
pairs of 5`-flanking upstream sequence was sufficient for basal Ng-CAM
promoter activity in cells; addition of up to 4 kilobases of Ng-CAM
5`-flanking sequence showed no further increases in this activity.
Potential regulatory sequences located in the proximal promoter
included an additional SP1 motif at -134 and a consensus CRE
(TGACGTCA) at -255 (Fig. 7). In both NIH3T3 and N2A cells,
a 3-fold decrease in expression was observed for constructs that had a
deletion in the -200 to -447 region of the Ng-CAM proximal
promoter. This region contained the CRE and thus, trans-factors of the CREB family (43, 44) may
control Ng-CAM gene expression. Inclusion of the region between
+82 and +182 in the first exon of the Ng-CAM gene in
constructs led to a 2-fold stimulation of Ng-CAM promoter activity in
both NIH3T3 and N2A cells. It is likely that this sequence may impart
either additional stability of Ng-CAM mRNAs or binds a transactivator
important for transcription of the Ng-CAM gene. We found that the
+82 to +182 region bound to nuclear proteins from both NIH3T3
and N2A cells.
Silencer Activity of NRSEs Located in the First Intron of
the Ng-CAM GeneWe have located five NRSEs within the first
intron of the Ng-CAM gene (Fig. 4). Single copies of the NRSE
have been found in several neurally expressed genes including in the
SCG10 gene(24) , the gene for the rat type II sodium
channel(45) , and the gene encoding synapsin I(46) .
Five NRSEs appear in tandem within the first intron of the Ng-CAM gene
and a tandem arrangement of NRSEs has been observed, for example, in
the first intron of the rat brain derived neurotrophic factor
gene(47) , although so far no experiments have addressed
whether this sequence has silencer activity.In cellular
transfection experiments, we found that the Ng-CAM NRSEs silenced the
Ng-CAM proximal promoter in NIH3T3 cells. In contrast, NRSEs did not
silence the promoter in N2A cells. Thus, the NRSEs silenced Ng-CAM gene
expression in non-neuronal cells. The multiple copies of NRSEs in the
Ng-CAM first intron suggest that they may bind proteins cooperatively.
Recently, a neuron-restrictive silencer factor (NRSF, also called REST)
has been identified which binds to the NRSE (48, 49) .
The protein contains eight zinc fingers which are related to those
found in proteins of the GLI-Krüppel family. Consistent with their activity patterns, we found that the Ng-CAM
NRSEs formed a more prominent DNA-protein complex with nuclear proteins
from NIH3T3 cells than they did with proteins from N2A cells. It is
therefore likely that the protein enriched in NIH3T3 cells which binds
to the NRSEs and silences Ng-CAM gene expression is NRSF/REST or a
related protein. Interestingly, constructs with deletions in the NRSEs
also show slightly elevated expression in N2A cells when compared to
constructs containing the NRSEs (see Fig. 3). Thus, in N2A cells
a minor amount of NRSF/REST may contribute to silencing, but the
predominance of positive factors may greatly override this activity. In
a preliminary search of the published L1 gene sequence (40) we
have located an NRSE with the sequence TCTGCTGTCCGTGGTGCTGGA within the
first intron at position 277-297. The possibility must therefore
be considered that NRSEs may be used in the negative regulatory
programs of other neural CAM genes in the Ng-CAM family.
Function of the Pax Motif and Binding to Pax-3We
have previously suggested that cell adhesion molecules are likely to be
a major class of target genes regulated by homeobox and Pax
transcription factors during embryonic
development(15, 16, 17, 18, 19) .
In the present study, we were particularly interested in whether the
regulatory sequences of the Ng-CAM gene, encoding a CAM that is
restricted to the nervous system, are potential targets for Pax
proteins. The cellular transfection experiments showed that constructs
having deletions in either the region containing the Pax motif, or
site-directed mutations within the GTTCC and ATTA sequences in the Pax
motif, were more active than similar constructs containing the
unmutated Pax motif. Furthermore, in NIH3T3 cells, the combination of
NRSEs and the Pax motif was more effective in silencing than was the
NRSE region alone. We found using gel mobility shift experiments that
the Pax motif bound to Pax-3. This binding was disrupted by mutations
in the ATTA sequence, but not by mutations in the GTTCC sequence and
adjacent base pairs. These data demonstrate that Pax-3 binds directly
to the Pax motif in the Ng-CAM gene and that this interaction is
mediated primarily by the homeodomain and not by the paired domain of
Pax-3. Previous studies showing specific Pax-3 binding to DNA have
employed synthetic binding sequences derived from the even-skipped gene promoter from Drosophila(32, 35) .
The Pax motif in the Ng-CAM gene described in the present study
represents the first naturally occurring vertebrate target sequence
found for the Pax-3 gene product.Recently, a sequence containing an
ATTA motif has been located at -170 in the promoter of the gene
for the neural CAM L1(40) . While this motif has some
similarities with the Ng-CAM Pax motif, it also shows some important
differences. The two Pax motifs are similar in that they both contain
ATTA motifs and share a few identities in the base pairs flanking this
sequence. However, in contrast to the Ng-CAM Pax motif, the
L1(-170) motif closely resembles the consensus binding site for
Pax-6(31, 37) . L1(-170) has been shown to bind
to Pax-6, but does not bind to Pax-3. Unlike the binding of the Ng-CAM
Pax motif to Pax-3 which is eliminated when mutations are introduced
into the ATTA sequence, the binding of L1(-170) to Pax-6 was
eliminated by mutations disrupting sequences which interact with the
paired domain(50) . The binding was unaffected by mutations in
the ATTA motif that disrupt homeodomain interactions. It will be
revealing to determine whether other genes encoding neural CAMs that
are related to Ng-CAM and L1 at the amino acid level, such as Nr-CAM
and neurofascin, also contain Pax motifs. Genes encoding this family of
neural CAMs may all contain Pax motifs with subtle variations in
sequence composition that may determine binding preferences and
selective CAM gene control by different Pax proteins. It will be
necessary to determine in vivo what roles the DNA control
elements described here play in the developmental expression pattern of
Ng-CAM in the nervous system. It is likely that particular combinations
of Ng-CAM regulatory elements identified in this study (see Fig. 7) are utilized to control specific contexts of Ng-CAM
expression during neural development and regeneration. For example, the
NRSEs and Pax motif and their bound proteins may act combinatorially to
restrict Ng-CAM expression to particular classes of neural cells during
development. This possibility may be explored in chicken embryos by
using retroviral vectors(51) . Chicken Ng-CAM constructs can
also be tested in transgenic mice, an approach has been used
successfully across species to analyze the brain-specific expression
directed by regulatory sequences from the chicken gene encoding the a2
neuronal acetylcholine receptor(52) . Such animal studies will
be particularly useful in determining how the regulatory regions
identified in the present study function to determine place-dependent
expression of Ng-CAM.
FOOTNOTES
- *
- This work was
supported by a United States Public Health Service Grant HD09635 and a
grant from the G. Harold and Leila Y. Mathers Charitable Foundation (to
G. M. E.). The costs of publication of this article were defrayed in
part by the payment of page charges. This article must therefore by
hereby marked ``advertisement'' in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
The
nucleotide sequence(s) reported in this paper has been submitted to the
GenBank[GenBank]. - (
) - The
abbreviations used are: CAM, cell adhesion molecule; NRSE,
neuron-restrictive silencer elements; CAT, chloramphenicol
acetyltransferase; GST, glutathione S-transferase; CRE, cAMP
response element.
- (
) - V. P. Mauro, G. M. Edelman,
and F. S. Jones, unpublished data.
ACKNOWLEDGEMENTS
We are grateful for Madhu Katragadda and Brett Fenson
for excellent technical assistance. We thank George L. Gabor Miklos,
Michael Salbaum, and Vincent P. Mauro for critical reading of the
manuscript.
REFERENCES
- Edelman, G. M., and Crossin, K. L. (1991) Annu. Rev. Biochem. 60,155-190
[CrossRef][Medline]
[Order article via Infotrieve]
- Grumet, M., and Edelman, G. M. (1984) J. Cell Biol. 98,1746-1756
[Abstract/Free Full Text]
- Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., and Cunningham, B. A. (1991) J. Cell Biol. 112,1017-1029
[Abstract/Free Full Text]
- Grumet, M., Mauro, V., Burgoon, M. P., Edelman, G. M., and Cunningham, B. A. (1991) J. Cell Biol. 113,1399-1412
[Abstract/Free Full Text]
- Mauro, V. P., Krushel, L. A., Cunningham, B. A., and Edelman, G. M. (1992) J. Cell Biol. 119,191-202
[Abstract/Free Full Text]
- Moos, M., Tacke, R., Scherer, H., Teplow, D., Fruh, K., and Schachner, M. (1988) Nature 334,701-703
[CrossRef][Medline]
[Order article via Infotrieve]
- Prince, J. T., Milona, N., and Stallcup, W. B. (1989) J. Neurosci. 9,876-883
[Abstract]
- Volkmer, H., Hassel, B., Wolff, J. M., Frank, R., and Rathjen, F. G. (1992) J. Cell Biol. 118,149-161
[Abstract/Free Full Text]
- Davis, J. Q., McLaughlin, T., and Bennett, V. (1993) J. Cell Biol. 121,121-133
[Abstract/Free Full Text]
- Furley, A. J., Morton, S. B., Manalo, D., Karagogeos, D., Dodd, J., and Jessel, T. M. (1990) Cell 61,157-170
[CrossRef][Medline]
[Order article via Infotrieve]
- Zuellig, R. A., Rader, C., Schroeder, A., Kalousek, M. B., vonBohlenundHalbach, F., Osterwalder, T., Inan, C., Stoeckli, E. T., Affolter, H. U., and Fritz, A. (1992) Eur. J. Biochem. 204,453-463
[Medline]
[Order article via Infotrieve]
- Gennarini, G., Cibelli, G., Rougon, G., Mattei, M.-G., and Goridis, C. (1989) J. Cell Biol. 109,775-788
[Abstract/Free Full Text]
- Ranscht, B. (1988) J. Cell Biol. 107,1561-1573
[Abstract/Free Full Text]
- Harrelson, A. L., and Goodman, C. S. (1988) Science 242,700-708
[Abstract/Free Full Text]
- Jones, F. S., Prediger, E. A., Bittner, D. A., De Robertis, E. M., and Edelman, G. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,2086-2090
[Abstract/Free Full Text]
- Jones, F. S., Holst, B. D., Minowa, O., De Robertis, E. M., and Edelman, G. M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,6557-6561
[Abstract/Free Full Text]
- Holst, B. D., Goomer, R. S., Wood, I. C., Edelman, G. M., and Jones, F. S. (1994) J. Biol. Chem. 269,22245-22252
[Abstract/Free Full Text]
- Goomer, R. S., Holst, B. D., Wood, I. C., Jones, F. S., and Edelman, G. M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,7985-7989
[Abstract/Free Full Text]
- Edelman, G. M., and Jones, F. S. (1993) J. Biol. Chem. 268,20683-20686
[Free Full Text]
- Chalepakis, G., Stoykova, A., Wijnholds, J., Tremblay, P., and Gruss, P. (1993) J. Neurobiol. 24,1367-1384
[CrossRef][Medline]
[Order article via Infotrieve]
- Moase, C. E., and Trasler, D. G. (1991) Development 113,1049-1058
[Abstract]
- Matsuo, T., Osumi-Yamashita, N., Noji, S., Ohuchi, H., Koyama, E., Myokai, F., Matsuo, N., Taniguchi, S., Doi, H., Iseki, S., and Ninomiya, Y. (1993) Nature Gen. 3,299-304
[CrossRef][Medline]
[Order article via Infotrieve]
- Tabor, S., and Richardson, C. C. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,4767-4771
[Abstract/Free Full Text]
- Mori, N., Schoenherr, C., Vandenbergh, D. J., and Anderson, D. J. (1992) Neuron 9,45-54
[CrossRef][Medline]
[Order article via Infotrieve]
- Pearson, W. R., and Lipman (1988) Proc. Natl. Acad. Sci. U. S. A. 85,2444-2448
[Abstract/Free Full Text]
- Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1989) Current Protocols in Molecular Biology , (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., and Seidman, J. G., eds) John Wiley and Sons, New York
- Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989) Molecular Cloning : A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Dynan, W. S., and Tjian, R. (1985) Nature 316,774-778
[CrossRef][Medline]
[Order article via Infotrieve]
- Meyer, T. E., and Habener, J. F. (1993) Endocr. Rev. 14,269-290
[Abstract/Free Full Text]
- Chalepakis, G., Fritsch, R., Fickenscher, H., Deutsch, V., Goulding, M., and Gruss, P. (1991) Cell 66,873-884
[CrossRef][Medline]
[Order article via Infotrieve]
- Epstein, J., Cai, J., Glaser, T., Jepeal, L., and Maas, R. (1994) J. Biol. Chem. 269,8355-8361
[Abstract/Free Full Text]
- Chalepakis, G., Jones, F. S., Edelman, G. M., and Gruss, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,12745-12749
[Abstract/Free Full Text]
- Daniloff, J., Chuong, C.-M., Levi, G., and Edelman, G. M. (1986) J. Neurosci. 6,739-758
[Abstract]
- Desplan, C., Theis, J., and O'Farrell, P. H. (1988) Cell 54,1081-1090
[CrossRef][Medline]
[Order article via Infotrieve]
- Chalepakis, G., Goulding, M., Read, A., Strachan, T., and Gruss, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 90,532-536
[Abstract/Free Full Text]
- Zannini, M., Francis-Lang, H., Plachov, D., and DiLauro, R. (1992) Mol. Cell. Biol. 12,4230-4241
[Abstract/Free Full Text]
- Czerny, T., Schaffner, G., and Busslinger, M. (1993) Genes & Dev. 7,2048-2061
[CrossRef]
- Thiery, J.-P., Delouvée, A., Grumet, M., and Edelman, G. M. (1985) J. Cell Biol. 100,442-456
[Abstract/Free Full Text]
- Daniloff, J. K., Levi, G., Grumet, M., Rieger, F., and Edelman, G. M. (1986) J. Cell Biol. 103,929-945
[Abstract/Free Full Text]
- Kohl, A., Giese, K. P., Mohajeri, M. H., Montag, D., Moos, M., and Schachner, M. (1992) J. Neurosci. Res. 32,167-177
[CrossRef][Medline]
[Order article via Infotrieve]
- Edelman, G. M. (1987) Immunol. Rev. 100,11-45
[CrossRef][Medline]
[Order article via Infotrieve]
- Lu, J., Lee, W., Jiang, C., and Keller, E. B. (1994) J. Biol. Chem. 269,5391-5402
[Abstract/Free Full Text]
- Sheng, M., McFadden, G., and Greenberg, M. (1990) Neuron 4,571-582
[CrossRef][Medline]
[Order article via Infotrieve]
- Sheng, M., Thompson, M. A., and Greenberg, M. E. (1991) Science 252,1427-1430
[Abstract/Free Full Text]
- Maue, R. A., Kraner, S. D., Goodman, R. H., and Mandel, G. (1990) Neuron 4,223-231
[CrossRef][Medline]
[Order article via Infotrieve]
- Sauerwald, A., Hoesche, C., Oschwald, R., and Kilimann, M. W. (1990) J. Biol. Chem. 265,14932-14937
[Abstract/Free Full Text]
- Timmusk, T., Palm, K., Metsis, M., Reintam, T., Paalme, V., Saarma, M., and Persson, H. (1993) Neuron 10,475-489
[CrossRef][Medline]
[Order article via Infotrieve]
- Schoenherr, C. J., and Anderson, D. J. (1995) Science 267,1360-1363
[Abstract/Free Full Text]
- Chong, J. A., Tapia-Ram&ıacute;rez, J., Kim, S., Toledo-Aral, J. J., Zheng, Y., Boutros, M. C., Altshuller, Y. M., Frohman, M. A., Kraner, S. D., and Mandel, G. (1995) Cell 80,949-957
[CrossRef][Medline]
[Order article via Infotrieve]
- Chalepakis, G., Wijnholds, J., Giese, P., Schachner, M., and Gruss, P. (1994) DNA & Cell Biol. 13,891-900
- Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., and Sutrave, P. (1987) J. Virol. 61,3004-3012
[Abstract/Free Full Text]
- Daubas, P., Salmon, A.-M., Zoli, M., Geoffroy, B., Devillers-Thiéry, A., Bessis, A., Médevielle, F., and Changeux, J.-P. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,2237-2241
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
K. Wu, M. Liu, A. Li, H. Donninger, M. Rao, X. Jiao, M. P. Lisanti, A. Cvekl, M. Birrer, and R. G. Pestell
Cell Fate Determination Factor DACH1 Inhibits c-Jun-induced Contact-independent Growth
Mol. Biol. Cell,
March 1, 2007;
18(3):
755 - 767.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. S. Kim, C. K. Hwang, H. S. Choi, K. Y. Song, P.-Y. Law, L.-N. Wei, and H. H. Loh
Neuron-restrictive Silencer Factor (NRSF) Functions as a Repressor in Neuronal Cells to Regulate the {micro} Opioid Receptor Gene
J. Biol. Chem.,
November 5, 2004;
279(45):
46464 - 46473.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L.-J. Chew, X. Yuan, S. E. Scherer, L. Qie, F. Huang, W. P. Hayes, and V. Gallo
Characterization of the Rat GRIK5 Kainate Receptor Subunit Gene Promoter and Its Intragenic Regions Involved in Neural Cell Specificity
J. Biol. Chem.,
November 2, 2001;
276(45):
42162 - 42171.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Paquette, S. E. Perez, and D. J. Anderson
Constitutive expression of the neuron-restrictive silencer factor (NRSF)/REST in differentiating neurons disrupts neuronal gene expression and causes axon pathfinding errors in vivo
PNAS,
October 24, 2000;
97(22):
12318 - 12323.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Naruse, T. Aoki, T. Kojima, and N. Mori
Neural restrictive silencer factor recruits mSin3 and histone deacetylase complex to repress neuron-specific target genes
PNAS,
November 23, 1999;
96(24):
13691 - 13696.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Shimojo, A. J. Paquette, D. J. Anderson, and L. B. Hersh
Protein Kinase A Regulates Cholinergic Gene Expression in PC12 Cells: REST4 Silences the Silencing Activity of Neuron-Restrictive Silencer Factor/REST
Mol. Cell. Biol.,
October 1, 1999;
19(10):
6788 - 6795.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Avisar, L. Shiftan, I. Ben-Dror, N. Havazelet, and L. Vardimon
A Silencer Element in the Regulatory Region of Glutamine Synthetase Controls Cell Type-specific Repression of Gene Induction by Glucocorticoids
J. Biol. Chem.,
April 16, 1999;
274(16):
11399 - 11407.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Meech, P. Kallunki, G. M. Edelman, and F. S. Jones
A binding site for homeodomain and Pax proteins is necessary for L1 cell adhesion molecule gene expression by Pax-6 and bone morphogenetic proteins
PNAS,
March 2, 1999;
96(5):
2420 - 2425.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Thon, K. P. Bjerling, and I. S. Nielsen
Localization and Properties of a Silencing Element Near the mat3-M Mating-Type Cassette of Schizosaccharomyces pombe
Genetics,
March 1, 1999;
151(3):
945 - 963.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
T. Timmusk, K. Palm, U. Lendahl, and M. Metsis
Brain-derived Neurotrophic Factor Expression in Vivo Is under the Control of Neuron-restrictive Silencer Element
J. Biol. Chem.,
January 8, 1999;
274(2):
1078 - 1084.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Thiel, M. Lietz, and M. Cramer
Biological Activity and Modular Structure of RE-1-silencing Transcription Factor (REST), a Repressor of Neuronal Genes
J. Biol. Chem.,
October 9, 1998;
273(41):
26891 - 26899.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. T. Schwartz and M. Vallejo
Differential Regulation of Basal and Cyclic Adenosine 3',5'-Monophosphate-Induced Somatostatin Gene Transcription in Neural Cells by DNA Control Elements That Bind Homeodomain Proteins
Mol. Endocrinol.,
September 1, 1998;
12(9):
1280 - 1293.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. Kallunki, G. M. Edelman, and F. S. Jones
The neural restrictive silencer element can act as both a repressor and enhancer of L1 cell adhesion molecule gene expression during postnatal development
PNAS,
March 17, 1998;
95(6):
3233 - 3238.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Kretzschmar, G. Hasan, S. Sharma, M. Heisenberg, and S. Benzer
The Swiss Cheese Mutant Causes Glial Hyperwrapping and Brain Degeneration in Drosophila
J. Neurosci.,
October 1, 1997;
17(19):
7425 - 7432.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Kallunki, G. M. Edelman, and F. S. Jones
Tissue-specific Expression of the L1 Cell Adhesion Molecule Is Modulated by the Neural Restrictive Silencer Element
J. Cell Biol.,
September 22, 1997;
138(6):
1343 - 1354.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G.-Z. Yan and E. B. Ziff
Nerve Growth Factor Induces Transcription of the p21 WAF1/CIP1 and Cyclin D1 Genes in PC12 Cells by Activating the Sp1 Transcription Factor
J. Neurosci.,
August 15, 1997;
17(16):
6122 - 6132.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Bessis, N. Champtiaux, L. Chatelin, and J.-P. Changeux
The neuron-restrictive silencer element: A dual enhancer/silencer crucial for patterned expression of a nicotinic receptor gene in the brain
PNAS,
May 27, 1997;
94(11):
5906 - 5911.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Huang and V. Gallo
Gene Structure of the Rat Kainate Receptor Subunit KA2 and Characterization of an Intronic Negative Regulatory Region
J. Biol. Chem.,
March 28, 1997;
272(13):
8618 - 8627.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. S. Jones, C. Kioussi, D. W. Copertino, P. Kallunki, B. D. Holst, and G. M. Edelman
Barx2, a new homeobox gene of the Bar class, is expressed in neural and craniofacial structures during development
PNAS,
March 18, 1997;
94(6):
2632 - 2637.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Mieda, T. Haga, and D. W. Saffen
Expression of the Rat m4 Muscarinic Acetylcholine Receptor Gene Is Regulated by the Neuron-restrictive Silencer Element/Repressor Element 1
J. Biol. Chem.,
February 28, 1997;
272(9):
5854 - 5860.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Tapia-Ramirez, B. J. L. Eggen, M. J. Peral-Rubio, J. J. Toledo-Aral, and G. Mandel
A single zinc finger motif in the silencing factor REST represses the neural-specific type II sodium channel promoter
PNAS,
February 18, 1997;
94(4):
1177 - 1182.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. D. Holst, Y. Wang, F. S. Jones, and G. M. Edelman
A binding site for Pax proteins regulates expression of the gene for the neural cell adhesion molecule in the embryonic spinal cord
PNAS,
February 18, 1997;
94(4):
1465 - 1470.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. C. Wood, A. Roopra, and N. J. Buckley
Neural Specific Expression of the m4 Muscarinic Acetylcholine Receptor Gene Is Mediated by a RE1/NRSE-type Silencing Element
J. Biol. Chem.,
June 14, 1996;
271(24):
14221 - 14225.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. A. Seth and J. A. Majzoub
Repressor Element Silencing Transcription Factor/Neuron-restrictive Silencing Factor (REST/NRSF) Can Act as an Enhancer as Well as a Repressor of Corticotropin-releasing Hormone Gene Transcription
J. Biol. Chem.,
April 20, 2001;
276(17):
13917 - 13923.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Shimojo, J.-H. Lee, and L. B. Hersh
Role of Zinc Finger Domains of the Transcription Factor Neuron-restrictive Silencer Factor/Repressor Element-1 Silencing Transcription Factor in DNA Binding and Nuclear Localization
J. Biol. Chem.,
April 13, 2001;
276(16):
13121 - 13126.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. B. Edelman, R. Meech, and F. S. Jones
The Homeodomain Protein Barx2 Contains Activator and Repressor Domains and Interacts with Members of the CREB Family
J. Biol. Chem.,
July 7, 2000;
275(28):
21737 - 21745.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Koenigsberger, J. J. Chicca II, M.-C. Amoureux, G. M. Edelman, and F. S. Jones
Differential regulation by multiple promoters of the gene encoding the neuron-restrictive silencer factor
PNAS,
February 29, 2000;
97(5):
2291 - 2296.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|