Cell adhesion molecules (CAMs) ()are essential for guiding tissue formation (1) and play key roles in the development of the nervous system. CAMs important in the nervous system include N-CAM-related molecules such as Ng-CAM(2, 3) , Nr-CAM (4, 5) , L1 (NILE)(6, 7) , neurofascin/ABGP(8, 9) , TAG-1/axonin-1/F3 (10, 11, 12) , and contactin(13) . Ng-CAM, L1, Nr-CAM, neurofascin/ABGP from vertebrates and neuroglian from Drosophila(14) comprise a subfamily of neural CAMs containing six immunoglobulin domains and five fibronectin type III repeats. Molecules of this Ng-CAM subfamily are expressed prominently in axonal pathways in both the central nervous system and peripheral nervous system and are involved in neurite fasciculation and outgrowth. Each of these neural CAMs has a characteristic spatial and temporal expression pattern during neural morphogenesis but the factors that restrict expression of Ng-CAM and other neural CAM genes to particular populations of neural cells are not well understood.

To define the sequences of DNA responsible for place-dependent expression of CAMs, we have focused on signals from homeobox and Pax gene products(15, 16, 17, 18) . An attractive hypothesis is that Ng-CAM and other neural CAMs are targets of homeodomain and Pax proteins(19) . During neural development, a number of transcriptional regulators encoded by the homeobox and Pax gene families appear in defined expression patterns along the anterior-posterior and dorsal-ventral axes of the embryo that correlate with the patterns of a variety of CAMs. Moreover, mutations in Pax genes are known to alter the programs of neural differentiation and migration, processes that are influenced by the activity of neural CAMs. For example, mutations in Pax-6 and Pax-3 genes lead to developmental defects of the nervous system as shown, respectively, in small eye and splotch mutant mice(20) . Some of these defects appear to be caused by aberrant neuronal migration(21, 22) , a process normally modulated by neural CAMs.

To examine the factors regulating Ng-CAM expression, we have isolated genomic clones containing the 5` end of the Ng-CAM gene, characterized its proximal promoter, and located two regulatory regions within a 305-base pair segment of the first intron. One region of the first intron was found to contain five neuron-restrictive silencer elements (NRSEs) which extinguished expression of the Ng-CAM gene in a fibroblast cell line, but not a neuroepithelial cell line. Another region contained GTTCC and ATTA sequences characteristic of binding sites for Pax proteins. This Pax motif was found to bind Pax-3 in gel mobility shift experiments; such binding was disrupted when specific mutations were introduced in the ATTA sequence within the Pax motif. In transfection experiments with both NIH3T3 and N2A cells, this Pax motif was found to be a negative regulator of Ng-CAM gene expression independent of the silencing imposed by NRSEs. Our studies suggest that the NRSEs and Pax motif may play critical roles in the place-dependent expression of Ng-CAM in the nervous system.

MATERIALS AND METHODS

Analysis of Ng-CAM Genomic DNA

Determination of the Transcription Initiation Site

Figure 2: DNA sequence of a 2536-base pair segment of the Ng-CAM gene starting at a position 447 base pairs upstream of the transcription start site and ending within the second exon, 2089 base pairs downstream from the RNA start site. The start of RNA transcription is indicated by a rightward pointing arrow. Potential regulatory motifs within the proximal promoter and the first intron of the gene are underlined. These sequences include the CRE, SP1, NRSE, and Pax motifs.

RNase protection analysis was performed using the RPA II kit (Ambion). The template for the RNA probe was made by polymerase chain reaction from the genomic DNA. The downstream primer used for the amplification was Ng-7/T3-, an oligonucleotide identical in sequence to oNg-7, but also containing the T3 RNA polymerase promoter at the 5` end. The upstream primer used in the polymerase chain reaction was an oligonucleotide designated oNg-6, derived from the sense strand of the Ng-CAM genomic sequence (Fig. 3, position -172 to -156). A labeled RNA probe was synthesized from the template using T3 RNA polymerase and [P]UTP. Template DNA was then digested with RNase-free DNase. Two fmol of probe in elution buffer was mixed with 1 µg of poly(A) RNA from 12 day embryonic chick brains and hybridized at 45 °C for 16 h. RNase protection analysis was performed using different dilutions of RNase to determine the optimal conditions for cleavage. The products of both primer extension and RNase protection analysis were resolved on an 8% polyacrylamide sequencing gel.

Figure 3: Activity of Ng-CAM constrcts in NIH3T3 and N2A cells. Top, diagram of the 5` end of the Ng-CAM gene showing the position of various restriction sites used to prepare deletion constructs. Sequences included in exons are indicated with boxes that are either solid black or cross-hatched. The cross-hatched region corresponds to the +82/+182 region of the first exon. The five NRSEs are represented by boxes numbered 1-5. The Pax motif is located immediately downstream from the NRSEs and is indicated by an open box. N2A or NIH3T3 cells were transfected with the promoterless CAT gene reporter vector (Bas) or 14 other constructs containing various segments from the 5` end of the Ng-CAM gene. Cell extracts were normalized to an internal reference standard of -galactosidase activity and assayed for CAT activity as described under ``Materials and Methods.'' CAT activity for all constructs was quantitated using a PhosphorImager from four separate experiments performed in duplicate in which the activity levels varied no more than 5%.

Construction of Reporter Plasmids

Cell Culture, Transfection Experiments, and Promoter Assays

Preparation of Nuclear Extracts, the Pax-3 Fusion Protein, and Gel Mobility Shift Assays

For binding reactions involving nuclear extracts, 5 fmol (approximately 20,000 cpm) of either +82/+182 or NRSE probe was mixed with 10 µg of protein from either NIH3T3 or N2A cells in a buffer containing 10 mM Hepes, 200 mM KCl, 0.5 mM dithiothreitol, 0.1% Nonidet P-40, 100 ng/ml poly(dI-dC) with 10 µg of bovine serum albumin. Competitors (either 10- or 100-fold excess of cold +82/+182 or NRSE DNAs) were included in some binding reactions. Binding components were incubated for 15 min at room temperature and subjected to electrophoresis on a 4% polyacrylamide gel in 0.25 TBE buffer at 400 V for 2 h at 4 °C.

For binding reactions involving the Pax-3 fusion protein, 200,000 cpm of probe was incubated with 0.5, 2.5, or 5 µg of GST/Pax-3 fusion protein. Binding reactions were performed in a volume of 20 µl containing 15 mM Tris-HCl, pH 7.5, 6.5% glycerol, 90 mM KCl, and 0.2 mM dithiothreitol. Bovine serum albumin (0.5 mg/ml) and sheared salmon sperm DNA (100 ng) were added to each binding reaction to reduce nonspecific binding. Reactions were incubated at room temperature for 30 min and subjected to electrophoresis on a 5% polyacrylamide gel in 0.5 TBE buffer at 200 V at 4 °C. Gels were dried and exposed to film at -70 °C.

RESULTS

Structure of the 5` End of the Ng-CAM Gene: Identification of the Proximal Promoter and Regulatory Sequences in the First Intron

Figure 1: Structure of the 5` end of the Ng-CAM gene. Top, diagram of the 20-kilobase insert from the chicken cosmid clone Cos-Ng containing the first seven exons of the Ng-CAM gene. The portions of exons 1 and 2 encoding 5`-untranslated sequences are indicated with an open box. Exons encoding translated mRNA sequence are indicated with black boxes.Bottom, nucleotide sequence of the borders for the first seven exons and introns of the Ng-CAM gene. The coding sequences of the exons are shown in upper case letters, while intronic sequences are indicated with lower case letters. The ATG codon is located in exon 2 and amino acids encoded by nucleotides 3` of this position are shown over the appropriate triplet codons. In some cases borders were inferred solely from comparison of the Ng-CAM genomic sequence to the published Ng-CAM cDNA sequence(3) .

To determine the site of transcription initiation within the Ng-CAM gene, we performed primer extension and RNase protection analyses of poly(A) RNA isolated from chick brain tissue at embryonic day 12. Extension of an antisense oligonucleotide primer (oNg-7) yielded a single radiolabeled band of 185 nucleotides in length (data not shown). Two prominent bands were observed in an RNase protection experiment using a radiolabeled RNA probe corresponding to the region from -300 to +185. Because the primer extension and the largest RNase protection products had termini at exactly the same upstream base pair in the genomic sequence, the nucleotide at this position was designated +1, the start of transcription initiation (see Fig. 2).

The DNA sequence of a 2536-base pair segment of the 5` end of the Ng-CAM gene including the 5`-flanking sequence, the first exon, the first intron, and the second exon was determined (Fig. 2). This sequence has been deposited in GenBank under accession number U31086. Several potential regulatory motifs were found in the 5`-flanking region immediately adjacent to and upstream of the RNA start site. They included two consensus binding sites for the SP1 transcription factor (28) located at -124 and -15 as well as a consensus cyclic AMP response element (CRE), located at -255, which is known to bind members of the CREB family of transcription factors(29) . After analyses of deletion constructs in transfection experiments, additional elements were located in a 178-base pair segment of the first intron (+1388 to +1566) that included five copies of a sequence similar to that of the NRSE. Further analysis also uncovered a 30-base pair element (+1679 to +1708) similar to that of a binding site for Pax gene products(20, 30, 31) . This Ng-CAM Pax motif contains GTTCC and ATTA core sequences characteristic of a target sequence recognized by those Pax proteins that contain two independent DNA binding domains, paired domain and a homeodomain(20, 32) .

Examination of Regulatory Elements in the Ng-CAM Gene by Cellular Transfection Experiments

The various Ng-CAM reporter constructs and observed CAT activities in N2A and NIH3T3 cells are summarized in Fig. 3. Five reporter constructs containing different lengths of 5`-flanking sequence (see Fig. 3, constructs Ng4, Ng1.5, Ng447, Ng200, Ng447/182) were constitutively active in both NIH3T3 and N2A cells. The Ng447 construct, containing 447 base pairs of 5`-flanking sequence and 61 base pairs of the first exon, was approximately 2-fold more active than Ng4 and Ng1.5 in N2A cells, but not in NIH3T3 cells. The proximal promoter region within this construct contained two consensus binding sites for the SP1 transcription factor and a CRE. The Ng200 construct, in which the promoter region between -447 and -200 containing the CRE sequence was deleted, showed 3-fold less activity in both NIH3T3 and N2A cells than the Ng447 construct. This result indicated that regulatory elements between -200 and -447 are required for basal promoter activity. The promoterless CAT vector, pCAT-Basic (Bas) showed little, if any, activity in both cell types.

A construct designated Ng447/182, containing the entire first exon was approximately 2-fold more active than the Ng447 construct in both NIH3T3 and N2A cells. These data suggested that the segment between +61 and +182 is a positive regulatory region of the Ng-CAM gene. A construct designated Ng447+I, containing the Ng-CAM proximal promoter together with the entire first exon, first intron, and a portion of the second exon was active in N2A cells but was completely silent in NIH3T3 cells. This finding suggested that sequences within the first intron of the Ng-CAM gene were capable of silencing the gene in non-neuronal cells.

NRSEs Within the First Intron Silence Ng-CAM Expression in NIH3T3 Cells, but Not in N2A Cells

Figure 4: Comparison of the five NRSEs (Ng-NRSE1-5) located between +1388 and +1566 in the first intron of the Ng-CAM gene with a consensus NRSE sequence derived from NRSEs found in several neural-specific genes(24) . The Ng-CAM NRSEs are in the orientation of the reverse complement from those found in other genes.

To examine whether the NRSEs were sufficient for silencing of the Ng-CAM proximal promoter, constructs were prepared in which the five NRSEs were placed upstream of the Ng447 region of the Ng-CAM gene linked to a CAT reporter. Two constructs were prepared in which the NRSEs were present either in the orientation normally found in the gene (SAS) or in the opposite orientation (SS). The SAS and SS constructs were both silent in NIH3T3 cells, showing CAT activities that were comparable to the Ng447+I and pCAT-Basic constructs (Fig. 3). However, in N2A cells, the SAS and SS constructs were highly active and showed no reduction of Ng-CAM proximal promoter activity. These studies suggest that, while the NRSEs are sufficient to silence Ng-CAM promoter activity in NIH3T3 cells, they do not show silencing in N2A cells.

The Pax Motif Negatively Regulates Ng-CAM Gene Expression in Both NIH3T3 and N2A Cells

Binding of Nuclear Proteins to Ng-CAM Regulatory Elements

Figure 5: The +82/+182 and NRSE regions of the Ng-CAM gene bind to nuclear factors prepared from NIH3T3 and N2A cells. Either the +82/+182 (panels A and B) or the NRSE (panels C and D) probe was mixed with nuclear extracts prepared from NIH3T3 cells (panels A and C) or from N2A cells (panels B and D). For binding reactions, probes were incubated without extract (all panels, lane 1) or with the appropriate nuclear extract (lanes 2-6). DNA-protein complexes formed between the +82/+182 and NRSE regions of the Ng-CAM gene with nuclear extracts are indicated with brackets labeled EX and NRSE, respectively. Competitor DNAs were added to some binding reactions (all panels, lanes 3-6). Competitors included either a 10- or 100-fold excess of the unlabeled DNA probe used in the specific binding reactions (all panels, lanes 3 and 4, respectively). To test whether the NRSE sequence could compete for binding of the +82/+182 probe to nuclear extracts, either a 10-fold or a 100-fold excess of cold NRSE DNA was added to the +82/+182 binding reactions (panels A and B, lanes 5 and 6, respectively). A similar test for cross-competition was performed by adding either a 10- or 100-fold excess of cold +82/+182 DNA to the NRSE binding reactions (panels C and D, lanes 5 and 6, respectively). Reactions were subjected to electrophoresis on a 4% polyacrylamide gel in 0.25 TBE buffer at 400 V for 2 h at 4 °C.

Binding experiments using the NRSE region as probe detected a clear cut DNA-protein complex with nuclear extracts prepared from NIH3T3 cells and a slight, but detectable complex with proteins from N2A cells (Fig. 5, panels C and D, lane 2). Formation of the NRSE-protein complex (particularly evident in NIH3T3 cells) was inhibited with an excess of cold NRSE competitor (Fig. 5C, lanes 3 and 4). Moreover, the +82/+182 segment did not compete for the formation of the NRSE-protein complex (Fig. 5, panels A-D, lanes 5 and 6). Similar competition experiments performed in N2A cells showed no diminution of the faint signal, regardless of the competitor used (Fig. 5D, compare the band intensities in lanes 5 and 6 with those in lanes 2, 3, and 4). These results suggested that proteins that bind to the NRSE are much more abundant in NIH3T3 cells than in N2A cells. Furthermore, the nuclear proteins bound by the +82/+182 and the NRSE regions of the Ng-CAM gene appear to be different.

Binding of Pax-3 to the Pax Motif

Four different probes were tested for binding to Pax-3 (Fig. 6). The Ng-wt probe contained the wild-type Pax motif (Fig. 3, the region between 1679 and 1708). The Ng-H variant contained 3-base pair substitutions that altered the ATTA motif. The Ng-P variant contained 11 base pair substitutions. Four substitutions destroyed the GTTCC motif which has been shown to be essential for the binding of the e5 DNA sequence to the paired domains of Pax-1 and Pax-3(30, 32, 35) . The seven other substitutions made in Ng-P were introduced after comparing the sequence of the Ng-CAM gene Pax motif to the consensus binding sequences for Pax proteins (31, 36, 37) and took account of critical base pair substitutions that may disrupt paired domain interactions with DNA. The third variant, Ng-HP (Fig. 6), contained the combination of mutations made in both Ng-H and Ng-P variants.

Figure 6: Binding of a Pax-3 fusion protein to the Pax motif in the first intron of the Ng-CAM gene. Top, sequences of four probes used in gel mobility shift experiments. The 5 base pairs at the 5` end of each sequence (lower-case letters) are BamHI cohesive ends. The remaining 30 base pairs (upper-case letters) are derived from the Pax motif (between +1679 and +1708 in the Ng-CAM gene). Ng-wt is the wild-type Ng-CAM Pax motif. GTTCC and ATTA motifs known to be important for binding of Pax proteins to DNA are boxed. Three variants of the Ng-wt sequence, designated Ng-HP, Ng-H, and Ng-P contain specific base pair substitutions which are highlighted in boldface type. Bottom, gel mobility shift assay showing binding of the GST/Pax-3 fusion protein to P-labeled Ng-wt, Ng-HP, Ng-H, and Ng-P probes. The individual probe used for binding is indicated at the bottom of each panel. Binding reactions contained the indicated probe either: without added protein (lanes marked 1), with 2.5 µg of GST control protein purified from E. coli NM522 cells transformed with pGEX-2T (lanes marked 2), or with 0.5, 2.5, or, 5 µg of GST/Pax-3 or GST/Pax-6 fusion (lanes marked 3-5, respectively. Binding reactions were subjected to electrophoresis on 6% polyacrylamide gels, dried, and autoradiographed for 4 h.

The Ng-wt probe showed binding to the GST/Pax-3 protein, but no binding to the GST control protein. Similar binding experiments using the Ng-HP and Ng-H variants showed little or no binding to Pax-3. The Ng-P variant showed no detectable decrease in binding to Pax-3 as compared to that of the Ng-wt. This result suggested that the GTTCC motif and other base pairs important for paired domain interactions were not necessary for Pax-3 binding. Rather, these experiments suggested that it was the ATTA motif that was important for Pax-3 binding to the Ng-CAM Pax motif.

DISCUSSION

In the chicken, Ng-CAM is first detected in the central nervous system at embryonic day 3 in cells of the ventral neural tube that are the precursors of motor neurons(38) . At later stages, Ng-CAM appears on a number of neurons and is distributed mainly on axons rather than cell bodies. In the cerebellum, Ng-CAM appears in Purkinje cells, is expressed by a number of different fibers, and plays a role in the migration of granule cell neurons on radial glia. The synthesis of Ng-CAM also shows dynamic changes during both myelination and during nerve regeneration. At the onset of myelination, Ng-CAM expression decreases in the central nervous system but not in the peripheral nervous system. Ng-CAM expression is increased after peripheral nerve injury in the spinal cord and in the nerve at the lesion site, but is decreased in dorsal root ganglia(39) . These dynamic patterns of Ng-CAM synthesis in the nervous system prompted us to identify factors that regulate Ng-CAM gene expression.

Structure of the 5` End of the Ng-CAM Gene

()

Figure 7: Location of DNA control elements in the 5` end of the Ng-CAM gene. The locations of putative regulatory elements in the proximal promoter are indicated with the appropriate symbol: , SP1 sites; , CRE. The +82/+182 region of the first exon showing positive regulation of the Ng-CAM constructs in both N2A and NIH3T3 cells is represented with a cross-hatched box. The five NRSEs within the first intron showing cell type-specific silencing of Ng-CAM promoter activity in NIH3T3 cells are represented by leftward pointing arrows indicating that similarities to the NRSE consensus sequence (24) are found on the bottom strand. The Pax motif showing negative regulation of the Ng-CAM promoter in both cell types and binding to Pax-3 is indicated by an open box. The first and second exons of the Ng-CAM gene are labeled 1 and 2, respectively.

The Proximal Promoter

A region of 447 base pairs of 5`-flanking upstream sequence was sufficient for basal Ng-CAM promoter activity in cells; addition of up to 4 kilobases of Ng-CAM 5`-flanking sequence showed no further increases in this activity. Potential regulatory sequences located in the proximal promoter included an additional SP1 motif at -134 and a consensus CRE (TGACGTCA) at -255 (Fig. 7). In both NIH3T3 and N2A cells, a 3-fold decrease in expression was observed for constructs that had a deletion in the -200 to -447 region of the Ng-CAM proximal promoter. This region contained the CRE and thus, trans-factors of the CREB family (43, 44) may control Ng-CAM gene expression.

Inclusion of the region between +82 and +182 in the first exon of the Ng-CAM gene in constructs led to a 2-fold stimulation of Ng-CAM promoter activity in both NIH3T3 and N2A cells. It is likely that this sequence may impart either additional stability of Ng-CAM mRNAs or binds a transactivator important for transcription of the Ng-CAM gene. We found that the +82 to +182 region bound to nuclear proteins from both NIH3T3 and N2A cells.

Silencer Activity of NRSEs Located in the First Intron of the Ng-CAM Gene

In cellular transfection experiments, we found that the Ng-CAM NRSEs silenced the Ng-CAM proximal promoter in NIH3T3 cells. In contrast, NRSEs did not silence the promoter in N2A cells. Thus, the NRSEs silenced Ng-CAM gene expression in non-neuronal cells. The multiple copies of NRSEs in the Ng-CAM first intron suggest that they may bind proteins cooperatively. Recently, a neuron-restrictive silencer factor (NRSF, also called REST) has been identified which binds to the NRSE (48, 49) . The protein contains eight zinc fingers which are related to those found in proteins of the GLI-Krüppel family.

Consistent with their activity patterns, we found that the Ng-CAM NRSEs formed a more prominent DNA-protein complex with nuclear proteins from NIH3T3 cells than they did with proteins from N2A cells. It is therefore likely that the protein enriched in NIH3T3 cells which binds to the NRSEs and silences Ng-CAM gene expression is NRSF/REST or a related protein. Interestingly, constructs with deletions in the NRSEs also show slightly elevated expression in N2A cells when compared to constructs containing the NRSEs (see Fig. 3). Thus, in N2A cells a minor amount of NRSF/REST may contribute to silencing, but the predominance of positive factors may greatly override this activity. In a preliminary search of the published L1 gene sequence (40) we have located an NRSE with the sequence TCTGCTGTCCGTGGTGCTGGA within the first intron at position 277-297. The possibility must therefore be considered that NRSEs may be used in the negative regulatory programs of other neural CAM genes in the Ng-CAM family.

Function of the Pax Motif and Binding to Pax-3

Recently, a sequence containing an ATTA motif has been located at -170 in the promoter of the gene for the neural CAM L1(40) . While this motif has some similarities with the Ng-CAM Pax motif, it also shows some important differences. The two Pax motifs are similar in that they both contain ATTA motifs and share a few identities in the base pairs flanking this sequence. However, in contrast to the Ng-CAM Pax motif, the L1(-170) motif closely resembles the consensus binding site for Pax-6(31, 37) . L1(-170) has been shown to bind to Pax-6, but does not bind to Pax-3. Unlike the binding of the Ng-CAM Pax motif to Pax-3 which is eliminated when mutations are introduced into the ATTA sequence, the binding of L1(-170) to Pax-6 was eliminated by mutations disrupting sequences which interact with the paired domain(50) . The binding was unaffected by mutations in the ATTA motif that disrupt homeodomain interactions. It will be revealing to determine whether other genes encoding neural CAMs that are related to Ng-CAM and L1 at the amino acid level, such as Nr-CAM and neurofascin, also contain Pax motifs. Genes encoding this family of neural CAMs may all contain Pax motifs with subtle variations in sequence composition that may determine binding preferences and selective CAM gene control by different Pax proteins.

It will be necessary to determine in vivo what roles the DNA control elements described here play in the developmental expression pattern of Ng-CAM in the nervous system. It is likely that particular combinations of Ng-CAM regulatory elements identified in this study (see Fig. 7) are utilized to control specific contexts of Ng-CAM expression during neural development and regeneration. For example, the NRSEs and Pax motif and their bound proteins may act combinatorially to restrict Ng-CAM expression to particular classes of neural cells during development. This possibility may be explored in chicken embryos by using retroviral vectors(51) . Chicken Ng-CAM constructs can also be tested in transgenic mice, an approach has been used successfully across species to analyze the brain-specific expression directed by regulatory sequences from the chicken gene encoding the a2 neuronal acetylcholine receptor(52) . Such animal studies will be particularly useful in determining how the regulatory regions identified in the present study function to determine place-dependent expression of Ng-CAM.

FOOTNOTES

*

This work was supported by a United States Public Health Service Grant HD09635 and a grant from the G. Harold and Leila Y. Mathers Charitable Foundation (to G. M. E.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank[GenBank].

()

The abbreviations used are: CAM, cell adhesion molecule; NRSE, neuron-restrictive silencer elements; CAT, chloramphenicol acetyltransferase; GST, glutathione S-transferase; CRE, cAMP response element.

()

V. P. Mauro, G. M. Edelman, and F. S. Jones, unpublished data.

ACKNOWLEDGEMENTS

We are grateful for Madhu Katragadda and Brett Fenson for excellent technical assistance. We thank George L. Gabor Miklos, Michael Salbaum, and Vincent P. Mauro for critical reading of the manuscript.

---

REFERENCES

1. Edelman, G. M., and Crossin, K. L. (1991) Annu. Rev. Biochem. 60,155-190 [CrossRef][Medline] [Order article via Infotrieve]
2. Grumet, M., and Edelman, G. M. (1984) J. Cell Biol. 98,1746-1756 [Abstract/Free Full Text]
3. Burgoon, M. P., Grumet, M., Mauro, V., Edelman, G. M., and Cunningham, B. A. (1991) J. Cell Biol. 112,1017-1029 [Abstract/Free Full Text]
4. Grumet, M., Mauro, V., Burgoon, M. P., Edelman, G. M., and Cunningham, B. A. (1991) J. Cell Biol. 113,1399-1412 [Abstract/Free Full Text]
5. Mauro, V. P., Krushel, L. A., Cunningham, B. A., and Edelman, G. M. (1992) J. Cell Biol. 119,191-202 [Abstract/Free Full Text]
6. Moos, M., Tacke, R., Scherer, H., Teplow, D., Fruh, K., and Schachner, M. (1988) Nature 334,701-703 [CrossRef][Medline] [Order article via Infotrieve]
7. Prince, J. T., Milona, N., and Stallcup, W. B. (1989) J. Neurosci. 9,876-883 [Abstract]
8. Volkmer, H., Hassel, B., Wolff, J. M., Frank, R., and Rathjen, F. G. (1992) J. Cell Biol. 118,149-161 [Abstract/Free Full Text]
9. Davis, J. Q., McLaughlin, T., and Bennett, V. (1993) J. Cell Biol. 121,121-133 [Abstract/Free Full Text]
10. Furley, A. J., Morton, S. B., Manalo, D., Karagogeos, D., Dodd, J., and Jessel, T. M. (1990) Cell 61,157-170 [CrossRef][Medline] [Order article via Infotrieve]
11. Zuellig, R. A., Rader, C., Schroeder, A., Kalousek, M. B., vonBohlenundHalbach, F., Osterwalder, T., Inan, C., Stoeckli, E. T., Affolter, H. U., and Fritz, A. (1992) Eur. J. Biochem. 204,453-463 [Medline] [Order article via Infotrieve]
12. Gennarini, G., Cibelli, G., Rougon, G., Mattei, M.-G., and Goridis, C. (1989) J. Cell Biol. 109,775-788 [Abstract/Free Full Text]
13. Ranscht, B. (1988) J. Cell Biol. 107,1561-1573 [Abstract/Free Full Text]
14. Harrelson, A. L., and Goodman, C. S. (1988) Science 242,700-708 [Abstract/Free Full Text]
15. Jones, F. S., Prediger, E. A., Bittner, D. A., De Robertis, E. M., and Edelman, G. M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,2086-2090 [Abstract/Free Full Text]
16. Jones, F. S., Holst, B. D., Minowa, O., De Robertis, E. M., and Edelman, G. M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,6557-6561 [Abstract/Free Full Text]
17. Holst, B. D., Goomer, R. S., Wood, I. C., Edelman, G. M., and Jones, F. S. (1994) J. Biol. Chem. 269,22245-22252 [Abstract/Free Full Text]
18. Goomer, R. S., Holst, B. D., Wood, I. C., Jones, F. S., and Edelman, G. M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,7985-7989 [Abstract/Free Full Text]
19. Edelman, G. M., and Jones, F. S. (1993) J. Biol. Chem. 268,20683-20686 [Free Full Text]
20. Chalepakis, G., Stoykova, A., Wijnholds, J., Tremblay, P., and Gruss, P. (1993) J. Neurobiol. 24,1367-1384 [CrossRef][Medline] [Order article via Infotrieve]
21. Moase, C. E., and Trasler, D. G. (1991) Development 113,1049-1058 [Abstract]
22. Matsuo, T., Osumi-Yamashita, N., Noji, S., Ohuchi, H., Koyama, E., Myokai, F., Matsuo, N., Taniguchi, S., Doi, H., Iseki, S., and Ninomiya, Y. (1993) Nature Gen. 3,299-304 [CrossRef][Medline] [Order article via Infotrieve]
23. Tabor, S., and Richardson, C. C. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,4767-4771 [Abstract/Free Full Text]
24. Mori, N., Schoenherr, C., Vandenbergh, D. J., and Anderson, D. J. (1992) Neuron 9,45-54 [CrossRef][Medline] [Order article via Infotrieve]
25. Pearson, W. R., and Lipman (1988) Proc. Natl. Acad. Sci. U. S. A. 85,2444-2448 [Abstract/Free Full Text]
26. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (1989) Current Protocols in Molecular Biology , (Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., and Seidman, J. G., eds) John Wiley and Sons, New York
27. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989) Molecular Cloning : A Laboratory Manual , Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
28. Dynan, W. S., and Tjian, R. (1985) Nature 316,774-778 [CrossRef][Medline] [Order article via Infotrieve]
29. Meyer, T. E., and Habener, J. F. (1993) Endocr. Rev. 14,269-290 [CrossRef][Medline] [Order article via Infotrieve]
30. Chalepakis, G., Fritsch, R., Fickenscher, H., Deutsch, V., Goulding, M., and Gruss, P. (1991) Cell 66,873-884 [CrossRef][Medline] [Order article via Infotrieve]
31. Epstein, J., Cai, J., Glaser, T., Jepeal, L., and Maas, R. (1994) J. Biol. Chem. 269,8355-8361 [Abstract/Free Full Text]
32. Chalepakis, G., Jones, F. S., Edelman, G. M., and Gruss, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,12745-12749 [Abstract/Free Full Text]
33. Daniloff, J., Chuong, C.-M., Levi, G., and Edelman, G. M. (1986) J. Neurosci. 6,739-758 [Abstract]
34. Desplan, C., Theis, J., and O'Farrell, P. H. (1988) Cell 54,1081-1090 [CrossRef][Medline] [Order article via Infotrieve]
35. Chalepakis, G., Goulding, M., Read, A., Strachan, T., and Gruss, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 90,532-536 [Abstract/Free Full Text]
36. Zannini, M., Francis-Lang, H., Plachov, D., and DiLauro, R. (1992) Mol. Cell. Biol. 12,4230-4241 [Abstract/Free Full Text]
37. Czerny, T., Schaffner, G., and Busslinger, M. (1993) Genes & Dev. 7,2048-2061
38. Thiery, J.-P., Delouvée, A., Grumet, M., and Edelman, G. M. (1985) J. Cell Biol. 100,442-456 [Abstract/Free Full Text]
39. Daniloff, J. K., Levi, G., Grumet, M., Rieger, F., and Edelman, G. M. (1986) J. Cell Biol. 103,929-945 [Abstract/Free Full Text]
40. Kohl, A., Giese, K. P., Mohajeri, M. H., Montag, D., Moos, M., and Schachner, M. (1992) J. Neurosci. Res. 32,167-177 [CrossRef][Medline] [Order article via Infotrieve]
41. Edelman, G. M. (1987) Immunol. Rev. 100,11-45 [CrossRef][Medline] [Order article via Infotrieve]
42. Lu, J., Lee, W., Jiang, C., and Keller, E. B. (1994) J. Biol. Chem. 269,5391-5402 [Abstract/Free Full Text]
43. Sheng, M., McFadden, G., and Greenberg, M. (1990) Neuron 4,571-582 [CrossRef][Medline] [Order article via Infotrieve]
44. Sheng, M., Thompson, M. A., and Greenberg, M. E. (1991) Science 252,1427-1430 [Abstract/Free Full Text]
45. Maue, R. A., Kraner, S. D., Goodman, R. H., and Mandel, G. (1990) Neuron 4,223-231 [CrossRef][Medline] [Order article via Infotrieve]
46. Sauerwald, A., Hoesche, C., Oschwald, R., and Kilimann, M. W. (1990) J. Biol. Chem. 265,14932-14937 [Abstract/Free Full Text]
47. Timmusk, T., Palm, K., Metsis, M., Reintam, T., Paalme, V., Saarma, M., and Persson, H. (1993) Neuron 10,475-489 [CrossRef][Medline] [Order article via Infotrieve]
48. Schoenherr, C. J., and Anderson, D. J. (1995) Science 267,1360-1363 [Abstract/Free Full Text]
49. Chong, J. A., Tapia-Ram&ıacute;rez, J., Kim, S., Toledo-Aral, J. J., Zheng, Y., Boutros, M. C., Altshuller, Y. M., Frohman, M. A., Kraner, S. D., and Mandel, G. (1995) Cell 80,949-957 [CrossRef][Medline] [Order article via Infotrieve]
50. Chalepakis, G., Wijnholds, J., Giese, P., Schachner, M., and Gruss, P. (1994) DNA & Cell Biol. 13,891-900
51. Hughes, S. H., Greenhouse, J. J., Petropoulos, C. J., and Sutrave, P. (1987) J. Virol. 61,3004-3012 [Abstract/Free Full Text]
52. Daubas, P., Salmon, A.-M., Zoli, M., Geoffroy, B., Devillers-Thiéry, A., Bessis, A., Médevielle, F., and Changeux, J.-P. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,2237-2241 [Abstract/Free Full Text]

---

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike    Complore    Connotea    Del.icio.us    Digg    Reddit    Technorati    What's this?

This article has been cited by other articles:

				K. Wu, M. Liu, A. Li, H. Donninger, M. Rao, X. Jiao, M. P. Lisanti, A. Cvekl, M. Birrer, and R. G. Pestell Cell Fate Determination Factor DACH1 Inhibits c-Jun-induced Contact-independent Growth Mol. Biol. Cell, March 1, 2007; 18(3): 755 - 767. [Abstract] [Full Text] [PDF]

				C. S. Kim, C. K. Hwang, H. S. Choi, K. Y. Song, P.-Y. Law, L.-N. Wei, and H. H. Loh Neuron-restrictive Silencer Factor (NRSF) Functions as a Repressor in Neuronal Cells to Regulate the {micro} Opioid Receptor Gene J. Biol. Chem., November 5, 2004; 279(45): 46464 - 46473. [Abstract] [Full Text] [PDF]

				L.-J. Chew, X. Yuan, S. E. Scherer, L. Qie, F. Huang, W. P. Hayes, and V. Gallo Characterization of the Rat GRIK5 Kainate Receptor Subunit Gene Promoter and Its Intragenic Regions Involved in Neural Cell Specificity J. Biol. Chem., November 2, 2001; 276(45): 42162 - 42171. [Abstract] [Full Text] [PDF]

				A. J. Paquette, S. E. Perez, and D. J. Anderson Constitutive expression of the neuron-restrictive silencer factor (NRSF)/REST in differentiating neurons disrupts neuronal gene expression and causes axon pathfinding errors in vivo PNAS, October 24, 2000; 97(22): 12318 - 12323. [Abstract] [Full Text] [PDF]

				Y. Naruse, T. Aoki, T. Kojima, and N. Mori Neural restrictive silencer factor recruits mSin3 and histone deacetylase complex to repress neuron-specific target genes PNAS, November 23, 1999; 96(24): 13691 - 13696. [Abstract] [Full Text] [PDF]

				M. Shimojo, A. J. Paquette, D. J. Anderson, and L. B. Hersh Protein Kinase A Regulates Cholinergic Gene Expression in PC12 Cells: REST4 Silences the Silencing Activity of Neuron-Restrictive Silencer Factor/REST Mol. Cell. Biol., October 1, 1999; 19(10): 6788 - 6795. [Abstract] [Full Text] [PDF]

				N. Avisar, L. Shiftan, I. Ben-Dror, N. Havazelet, and L. Vardimon A Silencer Element in the Regulatory Region of Glutamine Synthetase Controls Cell Type-specific Repression of Gene Induction by Glucocorticoids J. Biol. Chem., April 16, 1999; 274(16): 11399 - 11407. [Abstract] [Full Text] [PDF]

				R. Meech, P. Kallunki, G. M. Edelman, and F. S. Jones A binding site for homeodomain and Pax proteins is necessary for L1 cell adhesion molecule gene expression by Pax-6 and bone morphogenetic proteins PNAS, March 2, 1999; 96(5): 2420 - 2425. [Abstract] [Full Text] [PDF]

				G. Thon, K. P. Bjerling, and I. S. Nielsen Localization and Properties of a Silencing Element Near the mat3-M Mating-Type Cassette of Schizosaccharomyces pombe Genetics, March 1, 1999; 151(3): 945 - 963. [Abstract] [Full Text]

				T. Timmusk, K. Palm, U. Lendahl, and M. Metsis Brain-derived Neurotrophic Factor Expression in Vivo Is under the Control of Neuron-restrictive Silencer Element J. Biol. Chem., January 8, 1999; 274(2): 1078 - 1084. [Abstract] [Full Text] [PDF]

				G. Thiel, M. Lietz, and M. Cramer Biological Activity and Modular Structure of RE-1-silencing Transcription Factor (REST), a Repressor of Neuronal Genes J. Biol. Chem., October 9, 1998; 273(41): 26891 - 26899. [Abstract] [Full Text] [PDF]

				P. T. Schwartz and M. Vallejo Differential Regulation of Basal and Cyclic Adenosine 3',5'-Monophosphate-Induced Somatostatin Gene Transcription in Neural Cells by DNA Control Elements That Bind Homeodomain Proteins Mol. Endocrinol., September 1, 1998; 12(9): 1280 - 1293. [Abstract] [Full Text]

				P. Kallunki, G. M. Edelman, and F. S. Jones The neural restrictive silencer element can act as both a repressor and enhancer of L1 cell adhesion molecule gene expression during postnatal development PNAS, March 17, 1998; 95(6): 3233 - 3238. [Abstract] [Full Text] [PDF]

				D. Kretzschmar, G. Hasan, S. Sharma, M. Heisenberg, and S. Benzer The Swiss Cheese Mutant Causes Glial Hyperwrapping and Brain Degeneration in Drosophila J. Neurosci., October 1, 1997; 17(19): 7425 - 7432. [Abstract] [Full Text] [PDF]

P. Kallunki, G. M. Edelman, and F. S. Jones Tissue-specific Expression of the L1 Cell Adhesion Molecule Is Modulated by the Neural Restrictive Silencer Element J. Cell Biol., September 22, 1997; 138(6): 1343 - 1354. [Abstract]