|
|
|
|||||||
|
|||||||||
(Received for publication, June 26, 1995) From the
The muscle creatine kinase gene enhancer contains two regulatory
elements (MCK-R and MCK-L) with the consensus E-box sequence (CAnnTG).
A myocyte specific protein complex, MEF1, binds the MCK-R site. MEF1
contains several basic H-L-H myogenic determination factors (MDFs),
each dimerized with ubiquitous members of the bH-L-H family (e.g. E12/E47). We now demonstrate that the ubiquitous bH-L-H factor
E2-2 is a major component of the endogenous MCK-R site specific
complex. Previous studies described the MCK-L site as a similar but
low affinity MDF/bH-L-H heterodimer binding site. However, we find that
the MCK-L site exhibits preferential binding of an unknown ubiquitous
factor which contains neither E12/E47 nor E2-2, and that it
exhibits differential transcriptional activity with muscle and
non-muscle cells. The differential behavior of the MCK-L and MCK-R
sites may be a general trait of E-box elements since one among several
E-boxes in the MLC 1/3 enhancer also binds preferentially to the MCK-L
factor. From our studies we now propose separate consensus sequences
for MCK-R and MCK-L E-box types: AACAc/gc/gTGCa/t and
GGa/cCANGTGGc/gNa/g. Our results suggest that while many muscle gene
E-boxes are capable of binding the previously characterized spectrum of
MDF/bH-L-H heterodimers in vitro, MCK-L type E-boxes probably
bind qualitatively different factors in vivo.
Skeletal muscle differentiation involves the coordinate
activation and regulation of many hundreds of muscle specific genes.
Muscle gene expression is thought to occur via the interaction of
muscle specific and ubiquitous transcription factors with a common
subset of cis regulatory elements(1) . Among the most widely
found muscle gene control elements are sequences containing the
canonical E-box motif CANNTG(2) . The study reported below
focuses on the analysis of two E-box elements within the enhancer
region of the muscle creatine kinase (MCK) ( The two E-box sequences in
the MCK enhancer are designated the MCK-L site and the MCK-R or MEF1
site(2, 3) . Similar E-box sequences are found in the
enhancers of the human, rat, and rabbit MCK
genes(4, 5, 6) . Mutation of either site in
the mouse MCK enhancer causes a dramatic decrease in the
transcriptional activity of reporter genes when tested in skeletal
muscle cells(2, 3) , and significantly smaller
decreases when tested in cardiac muscle cells(7) . In gel shift
assays the MCK-R site binds a myocyte specific complex called MEF1 (2) that contains the myogenic determination factors (MDFs),
MyoD, and/or myogenin(2, 8, 9) . All four
myogenic factors (MRF4, myf5, MyoD, and myogenin) can bind the MCK-R
site as homodimers in gel shift assays but they exhibit much greater
binding affinity as heterodimers with the ubiquitous H-L-H factor
products of the E2A gene, E12 and
E47(10, 11, 12, 13, 14) .
Studies using antibodies suggest that E12 and E47 are naturally
occurring participants in the MEF1 complex(15) . Based on gel
mobility shift studies using in vitro translated and
bacterially synthesized E-proteins such as E2-2 and HEB, it is
known that other ubiquitous E-proteins can also form heterodimers with
the MDFs and that these exhibit binding to
E-boxes(16, 17) . However, it was not known whether
any of the latter heterodimers were naturally occurring in muscle
nuclei. The participation of E2-2 as part of the MEF1 complex is
demonstrated in this study. Much less is known about the MCK-L site.
Studies with MyoD-glutathione S-transferase fusion protein and in vitro translated MyoD- or myogenin-E12 heterodimers have
been interpreted as indicating that the MCK-L site is a low affinity
MEF1 binding site(8, 9) . The finding that high level
constitutive expression of MyoD in non-muscle cells can activate a
thymidine kinase promoter reporter gene construct with four inserted
MCK-L sites has also been interpreted as indicating interaction between
MyoD and the MCK-L site(18, 19) . The possibility that
the MCK-L site might bind a ubiquitous factor was suggested by analysis
of the rat MCK enhancer(20) . However, the ubiquitous factor(s)
in that study bound a region containing the MCK-L site as well as the
adjacent A/T-rich site, which is known to bind both ubiquitous (21) and more restricted transcription factors(22) ,
thus the existence of a distinct MCK-L site binding factor was unclear. The CAnnTG E-box core is important for the regulation of both
muscle-specific genes, and non-muscle genes, such as the
immunoglobulins. Therefore, the mechanism of tissue specific gene
regulation via E-box sequences must also involve sequences flanking the
core CAnnTG and/or the internal undefined bases. A consensus sequence
for generic muscle E-box binding sites based on sequence comparisons of
the MCK-L and MCK-R sites as well as the E-boxes found in the
regulatory regions of other muscle genes was proposed several years ago (2) . Subsequent experimental evidence from polymerase chain
reaction based MDF/E2A protein binding site selection protocols
suggested very similar consensus sequences and confirmed the importance
of the flanking sequences for determining the unique binding sites for
MyoD/E2A and myogenin/E2A heterodimers(23, 24) .
Functional evidence for the effects of flanking sequence differences on
E-box activity was obtained by studies of the troponin I enhancer in
which the endogenous E-box and flanking sequences were replaced with
E-box and flanking sequences from both muscle and non-muscle
genes(25) . These studies are all consistent with the concept
that sequences flanking the core E-box in muscle-specific genes play an
important role in regulating gene expression. To better understand
the complexities of muscle-specific gene regulation, we have studied
differences between the MCK E-box sites with respect to their
transcriptional activities and their binding factor interactions. We
have also examined transcriptional differences between the MCK-L and
MCK-R sites in the absence of other muscle regulatory sequences. To
determine if the two E-box elements are simply low and high affinity
sites for the same nuclear factors we analyzed qualitative differences
in the factors which preferentially bind the two sites. Then by
examining the binding preferences of E-box sequences found in the
myosin light chain 1/3 enhancer we investigated whether factor binding
differences between the MCK E-boxes are specific to the MCK gene or
represent a more general mechanism of muscle gene regulation. The
results suggest that factor interaction at muscle E-box regulatory
sites is more complex than can be explained by the hypothesis of high
and low affinity MDF binding sites. We propose that E-box elements of
the MCK-L type interact with a ubiquitous binding complex that contains
none of the common MDF/E-protein heterodimers that bind E-boxes of the
MCK-R type.
NIH3T3 cells were grown and transfected as above except that the
cells were switched into conditioned media after glycerol shock.
Conditioned medium was F-10C, 1.5% horse serum that had been incubated
on confluent NIH3T3 cells until there was no apparent cell division
(typically 48 h after medium addition). Statistical analysis of
transfection results was done by ANOVA using the SAS computer program.
Figure 1:
Transcriptional differences between the
MCK-L and MCK-R sites. Transcriptional differences between the MCK
E-box sites were assessed by transfecting three cell types with CAT
reporter constructs driven by the tk promoter with and without four MCK
E-box sequences. A, mitogen-starved NIH 3T3 cultures; B, proliferating MM14 myoblast cultures; C,
differentiated mitogen-starved MM14 myocyte cultures. All cultures were
harvested 26 h after transfection. 95% of the cells in differentiated
MM14 myocyte cultures were myosin-positive as assessed by
immunostaining for myosin heavy chain at the time of harvest, whereas
less than 5% of the cells in proliferating myoblast cultures were
myosin-positive. Since the background of differentiated cells in the
proliferating myoblast cultures was not 0%, some or all the CAT
activity detected in 4RtkCAT-transfected myoblasts could be due to
expression of 4RtkCAT by the small number of differentiated muscle
cells in these cultures. Relative CAT activity was calculated as
follows: the CAT activity (minus background cpm) was divided by the
placental alkaline phosphatase activity to normalize for transfection
efficiency between plates. In all cases CAT activity was at least 2
times background. In each experiment CAT/placental alkaline phosphatase
values were normalized to those of the basal construct (tkCAT) which
was set at 1.0. n equals the total number of transfected
plates. Panels A, B, and C represent data from at
least two different plasmid preparations and three experiments. Error bars are standard deviations. p value as
determined by ANOVA was equal to p < 0.0001 for 4RtkCAT and
4LtkCAT compared to tkCAT in all cell types
tested.
The absolute activity levels
of tkCAT are similar in 3T3 cells myoblasts, and myocytes, but activity
differences are observed when MCK-L or MCK-R sites are combined with
the tk promoter. In 3T3 cells, the activity of 4LtkCAT is 2-fold higher
than that of the tk promoter alone while the 4RtkCAT construct is
4-fold lower than that of the tk promoter alone (Fig. 1A). This indicates that the MCK-L site is not
muscle-specific when removed from the context of the MCK enhancer. In
addition, the decreased activity of 4RtkCAT suggests that the MCK-R
site may bind factors in non-muscle cells that repress expression from
the ubiquitously active tk promoter (see ``Discussion''). Results from the myoblast transfection study are similar to those
with 3T3 cells: the activity of 4LtkCAT is 5-fold higher than that of
tkCAT while that of 4RtkCAT is 2-fold lower (Fig. 1B).
Since it is impossible to grow myoblast cultures without a low
background of differentiated myocytes (see Fig. 1legend), the
true relative repression of 4RtkCAT in myoblasts is probably
severalfold greater than the 2-fold repression level observed. In
contrast to their behavior in fibroblasts and myoblasts, both minimal
E-box promoters exhibit significantly elevated expression in
differentiated muscle cells (15-20-fold) over that of tkCAT alone (Fig. 1C). However, although both constructs have
similar absolute expression levels in myocytes, 4RtkCAT exhibits a
50-100-fold induction in activity during the transition from
myoblasts to myocytes, while the induction of 4LtkCAT during
differentiation is only 3-fold, since this construct is also expressed
at relatively high levels in myoblasts. Based on these results we
conclude that the MCK-L and MCK-R sites exhibit quantitatively distinct
transcriptional enhancements when tested in the absence of other muscle
regulatory elements. In addition, the MCK-R site appears to bind
factors that repress gene expression in non-muscle cells and in
replicating myoblasts.
Figure 2:
Detection of MCK-L and MCK-R site binding
complexes by gel mobility shift assays of an NIH3T3 nuclear extract. 2
µg of an NIH3T3 nuclear extract was incubated with labeled MCK-L or
MCK-R site oligomers and with unlabeled competitors (MCK enhancers with
mutations in either the MCK-L or MCK-R sites). A, partial
sequence of the wild type MCK enhancer and the mutations used in
competition assays. B, gel mobility shift assays demonstrated
that MCK-L (band 1) and MCK-R (band 2) specific
binding complexes exist in the fibroblast extract. The enhancer was in
35
Figure 3:
Partial purification of MCK-L and MCK-R
factors from a myocyte nuclear extract. A, 1 mg of MM14
myocyte nuclear extract protein was run over a heparin-agarose column
and eluted with a step gradient of increasing KCl concentrations (see
``Experimental Procedures''). 125-ml fractions were collected
and an aliquot was assayed for protein. The x axis represents
the fraction number, the y axis is an arbitrary value based on
the protein assay. Fractions were pooled as indicated by bars above peaks. B, column pools were analyzed for MCK-L and
MCK-R binding activities by gel mobility shift assays. 0.5 µg of
protein from each column pool plus 180 ng of poly(dI-C)
To
determine where potential MCK-L and MCK-R factors elute from the
heparin-agarose column, the pooled fractions were analyzed by gel
mobility shift assays using MCK-L or MCK-R site oligomers as probes (Fig. 3B). With the MCK-R probe, a binding activity
which is characteristic of the previously reported MEF1
complex(2) , is detected in fractions C and D as a broad region
containing at least two shifted complexes (Fig. 3B, lanes 7 and 8). Studies from our laboratory and by other
investigators suggest that the upper MEF1 band contains MyoD and the
lower band contains myogenin(16, 31) . The MCK-R probe
also exhibits binding to a broad band (complex 3), but this binding is
nonspecific (see Fig. 4B, lanes 4 and 5). A
similar nonspecific complex is observed when the heparin column
fractions are assayed with an MCK-L site probe. However, the MCK-L
probe also exhibits specific binding (complex 1). The complex 1 factor
is found predominately in fraction D, with smaller amounts in fraction
C (Fig. 3B, lanes 3 and 4). Complex 1 appears
to be MCK-L site-specific because it is not seen in fraction D when
examined with the MCK-R probe (compare Fig. 3B, lanes 4 and 8). Furthermore, under these conditions, MEF1 does
not bind the MCK-L probe (Fig. 3B, lanes 3 and 7).
Figure 4:
MCK-L
and MCK-R site binding specificity of heparin-agarose fractions C and
D. A, the specificity of the binding activities separated by
heparin-agarose column chromatography was determined with unlabeled
enhancer BamHI/HindIII fragments from pUC-E
containing mutations 1 or 2 in the MCK-L site or a mutation in the
MCK-R site. All three mutations decrease enhancer activity in myocyte
transient transfection assays. B, 0.5 µg of column
fraction protein was incubated with end-labeled oligonucleotide
corresponding to the MCK-L site (lanes 1-3) or the MCK-R
site (lanes 4 and 5). 35
The specificity of DNA binding activity detected in the
heparin-agarose column fractions was determined by competition gel
mobility shift assays using various unlabeled MCK enhancer fragments.
The DNA fragments used as competitors were the BamHI/HindIII fragments from pUC-E that contain
mutations in either the MCK-R or MCK-L site (Fig. 4A).
These mutations are known to decrease enhancer function in muscle cell
culture(2, 7, 8) . Competition with an
enhancer fragment containing a mutated MCK-L site (mt1) but a wild type
MCK-R site decreases binding of the MEF1 complex to the MCK-R probe (Fig. 4B, lane 5). However, an enhancer fragment with a
mutant MCK-R site but wild type MCK-L site does not compete for MEF1
binding to the MCK-R probe (Fig. 4B, compare lanes
4 and 5). This demonstrates that only wild type MCK-R
sites compete well for the MCK-R site binding activity (MEF1) in
fraction C. In contrast, an enhancer fragment containing a wild type
MCK-L site, but not enhancer fragments containing either a 5-bp MCK-L
mutation (mt1) or a 2-bp MCK-L mutation (mt2), competes for binding of
the MCK-L site complex-1 to the MCK-L site probe (Fig. 4B, compare lanes 1, 2, and 3).
These results indicate that complex-1 contains a MCK-L site-specific
binding factor. Significantly, it is not necessary to fractionate the
nuclear extract to detect MCK-L site binding, since high levels of this
activity are also detected in unfractionated myocyte nuclear extract
(data not shown).
Figure 5:
Methylation interference indicates the
core E-box CATGTG region is at the center of the MCK-L factor binding
site. A, the methylation interference pattern of the MCK-L
site with MCK-L factor complex-1 determined with labeled bottom strand (lanes 1-3) or top strand (lanes 4-6) is
indicated by the lines. B, the corresponding sites
are marked in the partial sequence of the enhancer by the open
arrow. The circle represents an under-methylated G
residue in the total probe.
Figure 6:
Tissue specificity of the MCK-L binding
site activity. Nuclear extracts from several mouse tissues were
incubated with end-labeled MCK-L oligomer. The competitor enhancer
fragments contained either MCK-L mutation 1 and a wild type MCK-R site,
or the wild type MCK-L site and a mutation in the MCK-R site. The
competitor was used at 35-fold molar excess. LIV, liver; SK, skeletal muscle; BR, brain; KID, kidney; HRT, heart; MB, myoblast cell culture; and FR-D, myocyte nuclear extract heparin column fraction
D.
Figure 7:
The
ubiquitous H-L-H proteins E12/E47 and E2-2 are not present in the
MCK-L complex but are present in the MCK-R complex, MEF1. A,
myocyte fractions C and D from the heparin-agarose column containing
MEF1 and the MCK-L factor were incubated with 1 µl of E12/E47
antiserum, lanes 1 and 3; or control sera, lanes
2 and 4. B, fractions C (lanes
1-4) and D (lanes 5 and 6) were incubated
with purified preimmune (C) or immune (I) IgGs raised
against mE2-2. The specificity of the supershifted complex (ss) in lane 1 was determined with enhancer fragments
that contained a mutant or wild type MCK-R site. The nonspecific
binding (ns) in the control lanes 3 and 4 was not competed with the enhancer
fragments.
To examine the presence of E2-2 in
the MCK-L site binding complex, we cloned a 1.4-kilobase cDNA from a
myocyte expression library that encodes roughly 75% of the murine
homolog of the human H-L-H factor, E2-2 (ITF2) (data not shown).
The predicted amino acid sequence includes the bH-L-H domains which are
very similar with those in E12. The predicted murine sequence of
mE2-2 is greater than 95% identical to the predicted sequence of
the human homolog(32) . A synthetic peptide (DAANHGQMM)
representing the C terminus of mE2-2 was then used to produce
polyclonal mE2-2 antiserum. The C terminus peptide has only a 33%
similarity to the corresponding E12/E47 peptide (EAHNPAGHM). Purified
IgGs from either the mE2-2 preimmune serum or E2-2
antiserum do not affect binding of the MCK-L factors to the MCK-L probe (Fig. 7B, lanes 5 and 6). However, incubation
of the MCK-R fraction with E2-2 IgGs causes a supershift (ss) of
the MCK-R factors (Fig. 7B, lane 1), and binding of the
supershift complex to the MCK-R site probe is competed by an enhancer
containing a wild type MCK-R site but not by an enhancer containing the
mutated MCK-R site (Fig. 7B, compare lanes 1 and 2). When control preimmune IgG was used, a band (NS)
with slightly faster mobility than the supershift is observed (Fig. 7B, lanes 3 and 4); however, the NS band
represents nonspecific binding of the IgG fraction since the NS complex
is not competed by the enhancer fragment. The mE2-2 IgGs did not
cross-react with pure E12 under gel mobility shift assay conditions
(data not shown). These results suggest that mE2-2 is not a
participant in the MCK-L complex, but that it is a substantial
component of the MCK-R complex, MEF1.
Figure 8:
E-box sites in the myosin light chain 1/3
enhancer preferentially bind the MCK-L and MCK-R binding complexes.
Double stranded oligo probes corresponding to the MCK-R (R),
MCK-L (L), MCL-A (A), MLC-B (B), and MLC-C (C) sites (see ``Experimental Procedures'' for
sequences) were labeled to the same specific activity and 5
Previous studies have shown that 10T1/2 cells transfected
with either of the minimal E-box ``muscle'' gene constructs
(4RtkCAT or 4LtkCAT) and co-transfected with constitutively active MyoD
exhibit elevated expression of both reporter
genes(18, 19) . However, these results do not prove
that elevated expression from either test gene is directly attributable
to increased MyoD or MyoD/E-protein interaction with the L or R
E-boxes. In this study we have expanded the concept of muscle gene
regulation via E-box sequences by demonstrating that E-box sites in two
muscle regulatory regions, the MCK and MLC 1/3 enhancers, exhibit
preferential binding for different transcription factors. The MEF1 type
E-box binds heterodimers containing MDFs dimerized with E12/E47, and as
shown in this report, E2-2. The MDFs participating in these
heterodimers are muscle-specific, whereas E12/E47 and E2-2 are
relatively ubiquitous. In contrast, the MCK-L type E-box exhibits
preferential binding for a different ubiquitous complex that contains
neither MDFs nor E12/E47 or E2-2. Based on a comparison of the highly
conserved MCK-L sites in the mouse, rat, human, and rabbit MCK
enhancers and the myosin light chain 1/3 enhancer MLC-B site, which
also appears to bind the MCK-L factor (Fig. 8), we propose a
``L'' site E-box consensus sequence, GGa/cCANGTGGc/gNa/g. We have also refined the consensus MCK-R
sequence by eliminating sequence comparisons to the MCK-L and MLC 1/3-B
sites and by including comparisons to the sequences identified as
optimal MyoD and myogenin/E-protein binding
sites(23, 24) . The newly proposed muscle-specific
E-box consensus sequence is AACAc/gc/gTGCa/t. Further analysis
of binding preferences of the E-box sites found in other muscle gene
regulatory regions will be necessary to refine these consensus
sequences: but the proposed MCK-R and MCK-L site consensus sequences
should serve as useful interim models for predicting qualitative
differences in muscle gene E-box/transcription factor interactions. Our binding studies show that the MCK-L site binds an apparently
ubiquitous factor. We have carried out extensive screening of both
skeletal and cardiac myocyte expression libraries with the MCK-L site
and have yet to identify a definitive MCK-L factor. Based on the
methylation interference pattern, the E-box (CATGTG) is at the core of
the MCK-L binding site. This suggests that the MCK-L factor may be a
ubiquitous H-L-H protein. However, neither E12, E47, nor E2-2
appear to be present in the MCK-L complex. Possible candidates that may
bind the MCK-L site include members of the basic
helix-loop-helix-leucine zipper protein family (bH-L-H-ZIP), such as
TFE3(35, 36) , AP4(37) , USF(38) , and
TFEB(39) . The core of the TFE3 binding site, µE3
(CATGTGGC), in the immunoglobulin heavy chain enhancer, is identical to
the MCK-L site core. Furthermore, the MCK-L site competes for TFE3
binding to the µE3 site while the MCK-R site does not(36) .
Interestingly, the H-L-H differentiation inhibiting protein Id is not
capable of forming heterodimers with the bH-L-H-ZIP family of
transcription factors(40) . Thus if the ubiquitous MCK-L factor
were a member of this family its activity would not be inhibited by the
Id present in myoblasts or fibroblasts. The two MCK enhancer E-box
sites have different transcriptional
activities(2, 7, 8) . The MCK-L site
increases the activity of a tk promoter in fibroblasts and replicating
myoblasts, while the MCK-R site represses expression from the tk
promoter in these cells (Fig. 1). The different transcriptional
activities of the MCK-L and MCK-R sites are consistent with the
findings of Yutzey et al.(1992) that E-box and flanking
sequences (referred to as the muscle E-box consensus sequence) are not
functionally equivalent. However, while the previous study proposed
that these E-box transcriptional differences could be accounted for by
low and high affinity MDF binding, we now provide evidence that the
differences are due to the preferential binding of distinct factors. One intriguing aspect of the MCK-L site's transcriptional
activity is that it appears to be regulated during the developmental
transition from proliferating skeletal muscle myoblasts to
differentiated myocytes. The activity of the MCK-L site in fibroblasts
and myoblasts is consistent with the ubiquitous distribution of the
MCK-L binding activity. However, after differentiation of myoblasts to
myocytes the total activity of the MCK-L site increases, suggesting a
qualitative and/or quantitative change in the MCK-L factor (Fig. 1). Several regulatory mechanisms could account for the
increase in MCK-L site activity, including increased levels of MCK-L
factor in myocytes versus myoblasts, changes in accessory
factors, or post-translational modification of the MCK-L factor (see
below). An alternative for E-box transcriptional regulation could
involve the competitive binding of repressor factors to certain E-box
motifs. This model is supported by our transcriptional studies of the
MCK-R site in 3T3 cells and myoblasts, in which the MCK-R site
represses the activity of the thymidine kinase promoter (Fig. 1, A and B). The possibility that repressors may
regulate the MEF1-type (MCK-R site) E-box activity is consistent with
two recent reports. First, mutations of a MEF1 type E-box in the Previous studies had shown that E12 forms
heterodimers with the MDFs and that E12 is part of the MEF1
complex(15) . It had also been shown that E2-2 forms
heterodimers with all MDFs in vitro and that the complexes can
bind muscle E-box sites when tested via gel mobility shift
assays(43) , However, it was not known whether E2-2 was a
component of the naturally occurring MCK-R site binding complex, MEF1.
The involvement of E2-2 has now been demonstrated by the antibody
studies shown in Fig. 7B. Participation of E2-2 in
MCK-R site binding complexes may help explain why disruption of the E2A
gene in embryonic stem cells has no effect on the ability of the cells
to form muscle colonies(44) , because under these circumstances
E2-2 may function in place of the missing E2A products, E12, E47, and
ITF1. Although our studies indicate the existence of a ubiquitous
nuclear factor that exhibits preferential binding to the MCK-L site,
this does not prove that the MCK-L factor is the exclusive occupant of
muscle control elements of the MCK-L site consensus type in
vivo. For example, since high levels of bacterially produced H-L-H
proteins exhibit MCK-L site binding activity(3) , it is
possible that one or more of the H-L-H heterodimers does interact with
the MCK-L consensus sequences in living cells. However, if this were
so, a regulatory mechanism which would enable the H-L-H heterodimers to
out-compete the MCK-L site factor for occupancy of these control
elements would also be necessary. For reasons of simplicity we thus
favor a model in which E-box control elements resembling the MCK-L site
and MLC 1/3 enhancer B site interact with a ubiquitous nuclear factor
that is qualitatively different from factors which bind the MCK-R and
MLC 1/3 enhancer A sites.
Volume 270,
Number 36,
Issue of September 08, pp. 21420-21427, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
EVIDENCE FOR QUANTITATIVELY DIFFERENT TRANSCRIPTIONAL ACTIVITIES
AND THE BINDING OF DISTINCT REGULATORY FACTORS (*)
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)gene, and
proposes that muscle genes contain at least two classes of E-boxes
with qualitatively different functions.
DNA Plasmids and Mutations
The plasmid pUC-E
used for mutagenesis has been described elsewhere(2) .
Oligonucleotides used to produce the mutations were made by the Howard
Hughes Medical Institute Chemical Synthesis facility at the University
of Washington. The mutagenesis was done by standard single stranded
mutagenesis protocols (26, 27) . pUC-E plasmids
containing the mutations were sequenced to confirm that only the
expected mutation was present. The reference plasmid
pUCSV
pap, a derivative of pSVpap, encodes human
placental alkaline phosphatase and was used to normalize for
transfection efficiency differences as described elsewhere(7) . Cell Culture and Transfection Assays
MM14
myoblasts were grown in Ham's F-10C, 15% horse serum, and 2 ng/ml
bovine fibroblast growth factor on collagen-coated plates as described
previously(28) . Cells were transfected at a density of 5
10
per 100-mm plate with 8 µg of test construct
and 2 µg of pUCSVpap (2, 7) . 4 h
after addition of DNA, cells were glycerol shocked and refed. In
myocyte experiments the cells were differentiated by replacing growth
media with differentiation media consisting of Ham's F-10C, 1.5%
horse serum, and 6 µg/ml insulin after glycerol shock. In myoblast
transfections the cells were refed growth media after glycerol shock to
maintain proliferation. Both differentiated myocytes and proliferating
myoblasts were harvested 26 h after transfection. Cells were harvested
and enzyme assays performed as described previously(7) . Nuclear Extracts
Nuclear extracts of MM14
myocytes, myoblasts, and NIH3T3 cells were made essentially as
described by Dignam et al.(29) and Buskin and
Hauschka(2) . Mouse tissue nuclear extracts were made following
the protocol of Zahradka et al.(30) . All solutions
used in the extraction protocol contained protease inhibitors at the
following concentration, 84 KIU/ml aprotinin, 1 µg/µl
pepstatin, 1 µg/µl leupeptin, and 1 mM phenylmethylsulfonyl fluoride.Heparin-Agarose Column Chromatography
0.5-1
mg of myocyte nuclear extract protein was loaded on a 1-ml
heparin-agarose (Sigma, Type 1) column equilibrated at 4 °C in 20
mM HEPES, pH 7.9, 100 mM KCl, 0.2 mM EDTA,
10% glycerol, and 0.5 mM dithiothreitol. The column was washed
with 2 volumes of loading buffer, and the wash was collected for
analysis by a gel mobility shift assay. Proteins were eluted with a
step gradient of increasing KCl concentrations in loading buffer. Steps
were 1.5 column volumes of 0.2, 0.3, 0.5, and 1.0 M KCl
collected in 125-µl fractions. A small aliquot from each fraction
was analyzed for protein. Fractions were pooled and concentrated with
Centricon-10 concentrators (Amicon), dialyzed against loading buffer
modified to 20% glycerol, quick frozen in aliquots in an ethanol dry
ice bath, and stored at -70 °C until analysis via gel
mobility shift assays.Gel Mobility Shift Assays
Gel shift assays were
performed essentially as described by Buskin and Hauschka(2) .
Briefly, 0.5-1 µg of column pools or 1-4 µg of
tissue extracts were incubated with end-labeled double stranded
oligomers representing various mouse MCK and rat MLC 1/3 gene E-box
sites plus immediate flanking DNA: MCK-L (ATTAACCCAGACATGTGGCTGCCCC),
MCK-R (GATCCCCCCAACACCTGCTGCCTGA), MLC-A (TCCATTTTTGCACCTGCTGCG ACTT),
MLC-B (GTTGCTTCGCCAGCTGGTGGGGATT), and MLC-C
(AGGAATTAGGCACCTGTTGCTTCGC), in 25 mM HEPES, pH 7.9, 50 mM KCl, 0.5 mM dithiothreitol, 0.5 mM EDTA, 10%
glycerol, and poly(dI-C)
(dI-C) in a final volume of 10 µl.
Samples were incubated on ice for 20 min, room temperature for 5 min,
and loaded onto a native 6% polyacrylamide gel. The gel was run at 4
°C in 50 mM Tris, pH 8.5, and 1 mM EDTA at 200 V
for 2 h, dried, and exposed to film. For competition experiments
proteins were incubated for 10 min on ice prior to the addition of
probe with 30-40-fold excess of the unlabeled 220-bp BamH/HindIII enhancer fragment from pUC-E vector
containing a mutation in the MCK-L or MCK-R site (previously described
in (7) and (8) ). In antibody studies protein
fractions were incubated on ice for 10 min prior to the addition of
probe with 1 µl of sera or IgGs purified by protein A
chromatography.Methylation Interference
pUC-E was linerized with
either HindIII or BamHI and labeled by filling in
with Klenow fragment. The enhancer fragment was then excised with BamHI or HindIII and the end was filled in with
Klenow fragment to blunt the end. The labeled enhancer fragment was
purified by running on a 6% acrylamide gel and cutting out the
appropriate band from the wet gel. The DNA was eluted from the gel
slice with 0.2 M NaCl, 0.02 M Tris, pH 7.5, and 1
mM EDTA. The eluted DNA was purified over an Elutip
(Schleicher and Schuell) column as described by the manufacturer and
ethanol-precipitated. 2 10
cpm (Cerenkov counting)
of probe was dissolved in 10 µl of water. The DNA was methylated by
addition of 1.5 µl of 1:40 dimethyl sulfate and incubation at 37
°C for 30 min. The methylated DNA was ethanol-precipitated and
resuspended in 10 µl of water. For a preparative gel mobility shift
5.0 10
cpm of methylated probe was incubated with 2
µg of protein from heparin column fractions and 360 ng of
poly(dI-C)(dI-C) as above. Bound and free probe were excised from
the wet gel and eluted and purified as above. The DNA pellet was
resuspended in 1 M piperidine and incubated at 90 °C for
30 min. Cleaved DNA was lyophilized. The pellet was resuspended in 80%
formamide Tris borate/EDTA buffer, and 1 10
cpm of
bound or free probe was loaded into each lane of a 6% denaturing
sequencing gel.
The MCK-R and MCK-L Sites Differ in Their
Transcriptional Activities
To determine whether the MCK-L and
MCK-R sites exhibit functional differences we examined the activity of
artificial genes containing four contiguous MCK-L or MCK-R sites fused
to the thymidine kinase promoter and chloramphenicol acetyltranferase
reporter gene (CAT). The experimental advantage of the 4RtkCAT and
4LtkCAT constructs is that they permit analysis of the MCK-R and MCK-L
sites independently of possible interactions with other sites within
the MCK enhancer. The transient expression of these constructs was
examined in replicating and differentiated skeletal muscle cells (MM14
myoblasts and myocytes) as well as in mitogen-deprived non-muscle (NIH
3T3 cells). The purpose of the latter comparison was to test the
expression of the L- and R-MCK E-boxes in a non-myogenic cell that had
been subjected to similar growth arrest conditions as those required
for converting replicating myoblasts to the differentiated state. Data
from these studies suggest transcriptional differences between the
MCK-R and MCK-L sites (Fig. 1).
Fibroblast Nuclear Extracts Contain Distinct MCK-L and
MCK-R Binding Complexes
The transcriptional enhancement of the
basal tk promoter by the MCK-L site and the repression of basal tk
promoter activity by the MCK-R site in fibroblasts provides strong
evidence that these E-boxes bind distinct factors. To determine whether
NIH3T3 cells contain MCK-L and MCK-R specific binding activities, 3T3
cell nuclear extracts were examined via gel mobility shift assays for
factors capable of binding labeled MCK-L and MCK-R oligomers. The
specificity of binding was determined by competing with unlabeled
206-bp enhancer fragments containing mutations in either the MCK-L or
MCK-R sites (Fig. 2A). The MCK-L probe exhibits several
shifted bands with 3T3 nuclear extract; one of these (labeled 1) is
competed with an enhancer containing a wild type MCK-L site and a
mutant MCK-R site, while an enhancer containing a wild type MCK-R site
and a mutant MCK-L site does not compete (Fig. 2B,
compare lanes 1 and 2). The complex migrating as band
1 thus appears to be MCK-L site-specific. The MCK-R probe also exhibits
several shifted bands. A component in one of the bands (labeled 2)
appears to be MCK-R site-specific as demonstrated by partial
competition of band 2 with the enhancer containing a wild type MCK-R
site (Fig. 2B, compare lanes 3 and 4). The MCK-L and MCK-R specific complexes (bands 1 and 2)
could represent the interaction of these sites with the MCK-L site
activators and MCK-R site repressors that are responsible for the
different transcriptional activities of the 4LtkCAT and 4RtkCAT
constructs in 3T3 cells.
molar excess compared to probe. Lanes 1 and 2, 2 µg of NIH3T3 nuclear extract was incubated with the
MCK-L probe and the indicated enhancer fragments. Lanes 3 and 4, 2 µg of the extract was incubated with the MCK-R probe
and indicated enhancer fragment.
Muscle Nuclear Extracts Contain Factors That Exhibit
Preferential Binding to the MCK-L and MCK-R Sites
The observed
transcriptional differences between the MCK-L and MCK-R sites in
non-myocytes and myocytes, as well as the apparent binding of distinct
complexes in 3T3 cell nuclear extracts, suggest these control elements
may also bind different factors in myocytes. To facilitate a more
detailed analysis of MCK-L and MCK-R binding factors, myocyte nuclear
extracts were partially purified by heparin-agarose column
chromatography. A typical chromatographic profile of a myocyte nuclear
extract eluted with a step gradient of increasing KCl concentrations is
shown in Fig. 3A. The elution profile is composed of
several major protein peaks (Fig. 3A), the fractions of
which were pooled as indicated by the horizontal bars, and then
concentrated. Approximately 50% of the total protein loaded on the
column was recovered in the concentrated pooled fractions.
(dI-C) as
a nonspecific competitor was mixed with either end-labeled MCK-L
oligomer (lanes 1-4) or end-labeled MCK-R oligomer (lanes 5-8). FP is free oligomer
probe.
molar excess of
unlabeled fragments were used as competitors; lanes 1 and 4, the competitor was the 206-bp MCK enhancer containing the
mutated MCK-R site and the wild type MCK-L site; lanes 2 and 5, the competitor was the same enhancer fragment containing
mutation 1 of the MCK-L site and the wild type MCK-R site; lane
3, the competitor was the same enhancer fragment containing
mutation 2 of the MCK-L site and the wild type MCK-R
site.
The MCK-L Factor Is an E-box Binding
Factor
Methylation interference was used to define the MCK-L
binding site and to determine if the MCK-L factor (complex 1) binds
within the consensus E-box region (Fig. 5). The interference
pattern generated by the MCK-L site factor is similar, but not
identical, to the pattern we have published with MyoD at the MCK-L
site(8) . For the top strand the G at position +1 and
+3 are important contact points while the G residue at position
+4 is not methylated in either the free probe lane or the bound
lane, suggesting that residue +3 is under-methylated in the probe.
On the bottom strand there is partial interference at positions
-3 and +5. Based on the overall pattern of methylation
interference with the MCK-L factor, a typical core E-box sequence,
CATGTG, is at the midpoint of the MCK-L site element. These results
coupled with the competition studies of mutations that disrupt the
E-box site suggest that the MCK-L factor is a unique E-box binding
factor which exhibits preferential binding to an E-box subclass that
differs from the MEF1 site.
The MCK-L Complex Is Present in Many Cell
Types
The tissue specificity of the MCK-L site complex was
determined by analyzing nuclear extracts from MM14 myoblasts and
various mouse tissues including, liver, skeletal muscle, brain, kidney,
and heart. Nuclear extracts from all cell types examined contain one or
more factors that bind the MCK-L probe (Fig. 6). One of these
factors runs with the same mobility as complex 1 from cultured skeletal
myocyte nuclear extracts (Fig. 6, compare lane 13 with lanes 1, 3, 5, 7, 9, and 11). In all extracts complex
1 is competed by the MCK enhancer fragment containing a wild type MCK-L
site and not with the enhancer fragment containing a wild type MCK-R
site (compare Fig. 6, odd numbered versus even numbered
lanes). Unlike the muscle-specific MCK-R site MEF1 complex, the
MCK-L site factor is thus found in many tissue types.
Ubiquitous Members of the H-L-H Family, E12/E47 or
E2-2, Are Not Present in the MCK-L Complex but Are Found in the
MCK-R Complex
Detection of the MCK-L complex in assays from many
tissues suggests that it may contain one or more of the ubiquitous
H-L-H proteins such as E12/E47. To test this possibility gel mobility
shift assays were done in the presence of polyclonal antiserum directed
against E12/47. MEF1 binding to the MCK-R probe is blocked with E12/E47
antiserum but not with control sera (Fig. 7A, compare lanes 1 and 2). This is consistent with published
results analyzing components of the MEF1 complex(15) . However,
the same antiserum has no effect on MCK-L binding (Fig. 7A,
lanes 3 and 4), thus suggesting that the MCK-L complex
does not contain E12/E47.
E-Box Sites Within the Muscle Regulatory Regions of Other
Muscle Genes Exhibit Preferential Binding of the MCK-R and MCK-L
Factors
The myosin light chain 1/3 (MLC 1/3) enhancer contains
three E-box sites that are important for enhancer regulation, MLC-A,
MLC-B, and MLC-C(33, 34) . Either of two pairs of
these E-boxes is necessary for full enhancer function (C+A or
C+B). All three MLC E-box sites bind MDF
heterodimers(33) . Oligomers of the MLC-A, MLC-B, and MLC-C
sites were used to determine if any of these sequences exhibit
preferential binding of components in the heparin chromatography
fractions containing the MCK-L or MCK-R factors. The intensity of the
putative MCK-R factor (MEF1) band observed with the MLC-A and MLC-C
E-boxes is similarly high (Fig. 8, lanes 2 and 4), whereas chromatographic fraction C exhibits virtually no
binding to the MLC-B site (Fig. 8, lane 3). In
contrast, the MLC-B and MLC-C sites exhibit comparable binding to the
putative MCK-L complex (Fig. 8, lanes 8 and 9), while no such binding is seen with the MLC-A site. Taken
together, the data suggest that the MLC-B site exhibits preferential
binding for the MCK-L factor (Fig. 8, compare lanes 3 and 8), that the MLC-A site exhibits preferential binding
for the MCK-R factor (Fig. 8, lanes 2 and 7),
and that the MLC-C site binds both factor types. These results indicate
that the preferential binding of different factors by the MCK-L and
MCK-R sites is common to the multiple E-boxes found in at least one
other muscle gene enhancer. This observation raises the possibility
that an E-box binding factor of the type that exhibits preferential
binding to the MCK-L and the MLC-B sites plays a distinct role in
regulating muscle genes.
10
cpm of each probe was incubated with equal amounts of
myocyte fraction C (lanes 1-5) or fraction D (lanes
6-10).
subunit of acetylcholine receptor (
AChR) promoter lead to higher
expression in fibroblasts and myoblasts compared to the wild type
promoter(41) . In addition, an E-box binding activity that may
be responsible for repression via the
AChR E-box was detected in
myoblast nuclear extracts(41) . The MCK-R site-specific binding
activity we detect in fibroblast nuclear extracts could represent the
same or similar repressor complex (Fig. 2). Second, mutation of
the µE5 site in the IgH enhancer renders the enhancer, which is
normally unresponsive to MyoD, sensitive to MyoD
transactivation(42) . The sequences responsible for the
repression of MyoD activation are four bases flanking the core E-box.
Interestingly, three of these four are present in the MCK-R site at the
same positions.
)
We thank Drs. David Eyre, Richard Palminter, Dan
Bowen-Pope, Jean Buskin, Mary Pat Wenderoth, and Margaret Shield for
their helpful discussion of this manuscript. Dr. Cornelius Murre and
our deceased collaborator and friend Dr. Hal Weintraub are thanked for
their generous gifts of the 4RtkCAT, 4LtkCAT plasmids, and the E12/E47
antiserum.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  L. O. Barrera, Z. Li, A. D. Smith, K. C. Arden, W. K. Cavenee, M. Q. Zhang, R. D. Green, and B. Ren Genome-wide mapping and analysis of active promoters in mouse embryonic stem cells and adult organs Genome Res., January 1, 2008; 18(1): 46 - 59. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. J. Cole, T. E. Hall, C. I. Martin, M. A. Chapman, A. Kobiyama, Y. Nihei, S. Watabe, and I. A. Johnston Temperature and the expression of myogenic regulatory factors (MRFs) and myosin heavy chain isoforms during embryogenesis in the common carp Cyprinus carpio L. J. Exp. Biol., November 15, 2004; 207(24): 4239 - 4248. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. S. Salerno, M. Thomas, D. Forbes, T. Watson, R. Kambadur, and M. Sharma Molecular analysis of fiber type-specific expression of murine myostatin promoter Am J Physiol Cell Physiol, October 1, 2004; 287(4): C1031 - C1040. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Aragno, R. Mastrocola, M. G. Catalano, E. Brignardello, O. Danni, and G. Boccuzzi Oxidative Stress Impairs Skeletal Muscle Repair in Diabetic Rats Diabetes, April 1, 2004; 53(4): 1082 - 1088. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. M. Wilson, J. Tureckova, and P. Rotwein Permissive Roles of Phosphatidyl Inositol 3-Kinase and Akt in Skeletal Myocyte Maturation Mol. Biol. Cell, February 1, 2004; 15(2): 497 - 505. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Q.-G. V. Nguyen, J. N. Buskin, C. L. Himeda, M. A. Shield, and S. D. Hauschka Differences in the Function of Three Conserved E-boxes of the Muscle Creatine Kinase Gene in Cultured Myocytes and in Transgenic Mouse Skeletal and Cardiac Muscle J. Biol. Chem., November 21, 2003; 278(47): 46494 - 46505. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bidder, J.-S. Shao, N. Charlton-Kachigian, A. P. Loewy, C. F. Semenkovich, and D. A. Towler Osteopontin Transcription in Aortic Vascular Smooth Muscle Cells Is Controlled by Glucose-regulated Upstream Stimulatory Factor and Activator Protein-1 Activities J. Biol. Chem., November 8, 2002; 277(46): 44485 - 44496. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Spiller, R. Kambadur, F. Jeanplong, M. Thomas, J. K. Martyn, J. J. Bass, and M. Sharma The Myostatin Gene Is a Downstream Target Gene of Basic Helix-Loop-Helix Transcription Factor MyoD Mol. Cell. Biol., October 15, 2002; 22(20): 7066 - 7082. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y.-H. Chen, M. D. Layne, M. Watanabe, S.-F. Yet, and M. A. Perrella Upstream Stimulatory Factors Regulate Aortic Preferentially Expressed Gene-1 Expression in Vascular Smooth Muscle Cells J. Biol. Chem., December 7, 2001; 276(50): 47658 - 47663. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. J. Perkins, E. A. Burton, and K. E. Davies The role of basal and myogenic factors in the transcriptional activation of utrophin promoter A: implications for therapeutic up-regulation in Duchenne muscular dystrophy Nucleic Acids Res., December 1, 2001; 29(23): 4843 - 4850. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Park, J. J. Lee, S. Yoon, J.-S. Lee, S. Y. Choe, J. Choe, E.-H. Park, and C. G. Kim Genomic cloning of the Hsc71 gene in the hermaphroditic teleost Rivulus marmoratus and analysis of its expression in skeletal muscle: identification of a novel muscle-preferred regulatory element Nucleic Acids Res., July 15, 2001; 29(14): 3041 - 3050. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Barradeau, T. Imaizumi-Scherrer, M. C. Weiss, and D. M. Faust Muscle-regulated expression and determinants for neuromuscular junctional localization of the mouse RIalpha regulatory subunit of cAMP- dependent protein kinase PNAS, April 5, 2001; (2001) 81393598. [Abstract] [Full Text]
|
|
|
|
|
|
O. Narumi, S. Mori, S. Boku, Y. Tsuji, N. Hashimoto, S.-I. Nishikawa, and Y. Yokota OUT, a Novel Basic Helix-Loop-Helix Transcription Factor with an Id-like Inhibitory Activity J. Biol. Chem., February 4, 2000; 275(5): 3510 - 3521. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Kataoka, T. Murayama, M. Yokode, S. Mori, H. Sano, H. Ozaki, Y. Yokota, S.-I. Nishikawa, and T. Kita A novel Snail-related transcription factor Smuc regulates basic helix-loop-helix transcription factor activities via specific E-box motifs Nucleic Acids Res., January 15, 2000; 28(2): 626 - 633. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. D. Johnson and G. K. Owens Differential activation of the SMalpha A promoter in smooth vs. skeletal muscle cells by bHLH factors Am J Physiol Cell Physiol, June 1, 1999; 276(6): C1420 - C1431. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Calvo, P. Venepally, J. Cheng, and A. Buonanno Fiber-Type-Specific Transcription of the Troponin I Slow Gene Is Regulated by Multiple Elements Mol. Cell. Biol., January 1, 1999; 19(1): 515 - 525. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. V. O'Mahoney, K. L. Guven, J. Lin, J. E. Joya, C. S. Robinson, R. P. Wade, and E. C. Hardeman Identification of a Novel Slow-Muscle-Fiber Enhancer Binding Protein, MusTRD1 Mol. Cell. Biol., November 1, 1998; 18(11): 6641 - 6652. [Abstract] [Full Text]
|
|
|
|
|
|
E. Dumonteil, B. Laser, I. Constant, and J. Philippe Differential Regulation of the Glucagon and Insulin I Gene Promoters by the Basic Helix-Loop-Helix Transcription Factors E47 and BETA2 J. Biol. Chem., August 7, 1998; 273(32): 19945 - 19954. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Chaudhary, A. S. Cupp, and M. K. Skinner Role of Basic-Helix-Loop-Helix Transcription Factors in Sertoli Cell Differentiation: Identification of an E-Box Response Element in the Transferrin Promoter Endocrinology, February 1, 1997; 138(2): 667 - 675. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. Fabre-Suver and S. D. Hauschka A Novel Site in the Muscle Creatine Kinase Enhancer Is Required for Expression in Skeletal but Not Cardiac Muscle J. Biol. Chem., March 1, 1996; 271(9): 4646 - 4652. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J.-J. Lee, Y.-A. Moon, J.-H. Ha, D.-J. Yoon, Y.-H. Ahn, and K.-S. Kim Cloning of Human Acetyl-CoA Carboxylase beta Promoter and Its Regulation by Muscle Regulatory Factors J. Biol. Chem., January 19, 2001; 276(4): 2576 - 2585. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. Marshall, N. Chartrand, and R. G. Worton The Mouse Dystrophin Enhancer Is Regulated by MyoD, E-box-binding Factors, and by the Serum Response Factor J. Biol. Chem., June 1, 2001; 276(23): 20719 - 20726. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Barradeau, T. Imaizumi-Scherrer, M. C. Weiss, and D. M. Faust Muscle-regulated expression and determinants for neuromuscular junctional localization of the mouse RIalpha regulatory subunit of cAMP- dependent protein kinase PNAS, April 24, 2001; 98(9): 5037 - 5042. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |