|
|
|
|||||||
|
|||||||||
(Received for publication, April 10, 1995; and in revised form, June 10, 1995) From the
Oligonucleotides can be used to inhibit the binding of basic
fibroblast growth factor to cells. Though standard phosphodiester
oligonucleotides show a slight inhibition of binding, the
oligonucleotides with phosphorothioate internucleoside linkages have
inhibition levels equivalent to that of the polyanion heparin.
Variations in sequence of the oligonucleotides does lead to differences
in the inhibitory action of the oligonucleotides. This inhibition of
basic fibroblast growth factor by phosphorothioate oligonucleotides may
account for much of the published data on inhibition of various genes
by proposed antisense oligonucleotides and needs to be taken into
account when considering the mechanism of action of oligonucleotides in
biological systems.
Oligonucleotides have been used extensively in the past several
years to inhibit gene expression. Compounds are most often designed as
antisense agents and, as such, have shown efficacy in cell culture and
in some animal models of disease. Efficacious oligonucleotides have
been used against viruses, including human cytomegalovirus, herpes
simplex virus, human immunodeficiency virus, and papillomavirus, and
against various cellular targets, including the oncogenes
c-myc, c-myb, and
c-abl(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) .
In addition investigators have used anti-c-myc/-myb antisense oligonucleotides to prevent restenosis in animal
models(13, 14, 15) . Several of these
compounds are progressing into human drug trials based on their
proposed antisense inhibition of viral or oncogene targets in disease.
Oligonucleotide therapeutics are targeted to human cytomegalovirus in
retinitis, papillomavirus in genital warts, human immunodeficiency
virus in AIDS, c-abl in myelogenous leukemia, and c-myc and c-myb in restenosis. At the same time, increased
numbers of unexplained, nonspecific effects have been reported
especially for the phosphorothioate (PS) ( Our own studies
progressed from the initial use of oligonucleotides as anti-herpesvirus
agents on Vero and MRC-5 cells(9) . The action of
oligonucleotides against herpes simplex virus and human cytomegalovirus
have been reported previously(3, 8, 9) , but
the actual analysis of the data has been complicated by the ability of
the oligonucleotides to operate on the exterior of the cell as
inhibitors of viral adsorption. The binding of herpes simplex virus to
the cell involves an initial attachment to cell surface heparan sulfate
molecules and can be competed by the addition of heparin to the
media(21) . Phosphorothioate oligonucleotides are particularly
potent inhibitors of viral adsorption with effective concentrations in
the nanomolar range(9, 22) . Because basic fibroblast
growth factor (bFGF) binding, like herpes simplex virus adsorption,
involves interaction with cell surface heparan sulfate, we investigated
whether oligonucleotides would also inhibit the binding of bFGF to
cells. bFGF is a member of the heparin binding family of growth
factors(23, 24) . It is a widely distributed growth
factor found in all organs, solid tissues, tumors, and cultured cells
examined(25) . bFGF binds to high affinity protein receptors in
association with cellular matrix heparan sulfate. This association,
which is competed by the presence of exogenously added heparin, is
necessary for the high affinity and functional binding of bFGF.
Heparin-induced dimerization of the growth factor/receptor is required
for full activity of the growth factor (26) . Heparin and
heparin subfragments can be used to inhibit the biological activity of
FGF(27, 28) , although it may not be required for all
of the FGF effects(29) . The bFGF receptors are members of the
group of tyrosine kinase receptors capable of autophosphorylation and
dimerization; it is this dimerization that results in an increase in
receptor/ligand interaction and signal
transduction(30, 31) . In this model of bFGF receptor
activity, exogenously added heparin competes with cell surface heparan
sulfate and inhibits bFGF activity through the disruption of the
dimerization of the receptor. This is similar in concept to the
disruption of ligand binding to receptors by the uncoupling of the
receptor and the G protein complex for those receptors, which signal
through G protein complex formation(32, 33) . FGF
binding/dimerization and signaling results in a variety of cellular
responses including myc, fos, collagenase, and
platelet-derived growth factor receptor up-regulation, increases in
intracellular pH, hydrolysis of polyphosphoinositol, and
phosphorylation of cellular proteins. It induces growth in various cell
types including astrocytes, glioma cells, fibroblasts, and, in synergy
with hematopoietic growth factors, stem cells. In animal models it is
most directly connected with angiogenesis and wound healing. Our
studies show that oligonucleotides, especially PS oligonucleotides, are
able to inhibit bFGF binding to cells. These observations on bFGF and
oligonucleotides, taken together, indicate that although the
oligonucleotides studied to date may have therapeutic potential, their
level of biologic activity may not be due to the original rational
``antisense'' design.
bFGF binding to cells is assayed by the incubation of
radiolabeled bFGF with cell monolayers with subsequent wash conditions
able to distinguish the low affinity heparan sulfate binding from the
high affinity protein receptor-specific binding(29) . The bFGF
bound to the heparan sulfate is removed with 2 M NaCl at
neutral pH. This heparan sulfate binding is not saturated and is not
competed away at 100-fold concentrations of unlabeled bFGF. It is
however competed away by exogenous heparin or by the addition of other
polyanions such as pentosan polysulfate and suramin. Phosphorothioate
oligonucleotides can also act as appropriate polyanions and inhibit the
low affinity heparan sulfate binding of bFGF (Fig. 1A)
at submicromolar (0.6 µM) concentrations.
Figure 1:
Inhibition of
basic FGF binding to low and high affinity receptors. The binding of
The bFGF
bound to the high affinity receptors is then removed from the cells
with a subsequent low pH rinse. It is this high affinity binding that
is specific for the bFGF receptor proteins. This high affinity receptor
binding is effectively competed away with unlabeled bFGF (Fig. 1B). Heparan sulfate binding is necessary for the
dimerization of the bFGF receptor; therefore, an inhibition of the bFGF
low affinity heparan sulfate binding results in a change in the binding
to the high affinity protein receptor. The binding constant has been
reported to shift from 50 pM with heparan sulfate involvement
to 175 pM without such involvement (37) . If the bFGF
concentration is kept low, then only the high affinity receptor binding
resulting from dimerization is detected; the concentration of bFGF is
not sufficient for the receptor binding that occurs in the absence of
dimerization. Both heparin and PS oligonucleotides inhibit high
affinity binding under such conditions (Fig. 1B). When a standard saturation curve is plotted, the difference in
binding over an increasing range of bFGF concentrations is seen for
both the high and low affinity receptors (Fig. 2). The binding
to the high affinity receptors increases more slowly in the presence of
the oligonucleotides or heparin, approaching a plateau only at higher
concentrations. The concentrations are too low to saturate the binding
in the presence of heparin or PS oligonucleotides. At higher bFGF
concentrations the bFGF may bind in the presence of heparin, but this
binding is not expected to result in signal transduction due to the
inability of the receptors to dimerize. It has been shown that although
cell surface heparan sulfate is not required for receptor specific
binding, it does increase the affinity of basic bFGF for its receptor
and facilitates dimerization and activity of FGF (37, 38
Figure 2:
Inhibition of bFGF binding by
phosphorothioate oligonucleotides and heparin: saturation curves. Low (A) and high (B) affinity-specific FGF binding were
assayed as described. For high affinity-specific binding, background
values obtained from competition with 100-fold excess of unlabeled bFGF
were subtracted before plotting. Assays contained
Because a variation in the effect of
different antisense oligonucleotides is seen when they are assayed for
efficacy in the various systems employed, we tested a variety of
different oligonucleotides to determine if this variability could be
attributed to differences in bFGF binding inhibition. A series of
competition experiments was performed in which the concentration of
Figure 3:
Competitive inhibition of basic FGF
binding by phosphorothioate oligonucleotides and heparin: competitive
inhibition curves. Low (A) and high (B)
affinity-specific
In an effort to more closely mimic the
various antisense experiments, we also varied the time of addition and
incubation of the oligonucleotide. In the standard protocol, the
oligonucleotides were mixed with the bFGF prior to the addition to the
cells. If the oligonucleotide was preincubated with the cells, instead
of with the growth factor, the ID Inhibition of bFGF binding by phosphorothioate oligonucleotides may
account for some of the experimental results attributed in the
literature to antisense mechanisms. Antisense experiments often report
results using concentrations of PS oligonucleotides in the range of
0.1-50 µM, which we would expect to influence bFGF
binding. The 10-fold variation in the activity of the PS
oligonucleotides is in the same range as the specific/nonspecific
activity of antisense and control oligonucleotides reported for gene
disruption experiments. This would be especially true when the assays
are for those activities known to be influenced by bFGF, including myc and fos regulation, platelet-derived growth
factor and bFGF receptor regulation, hematopoiesis, and cell growth,
especially that of vascular smooth muscle cells. Other cellular factors
known to interact with polymers include granulocyte
macrophage-stimulating factor, interleukin-3, pleitrophin, and platelet
factor 4(39) , as well the entire family of heparin binding
growth factors. Any or all of these (and other factors) may be affected
in their interaction with cells by polyanions such as PS
oligonucleotides. Recently, it has been reported that at least some PS
oligonucleotides exert their effect by inhibiting the extracellular
binding of interferon gamma (40) or by inhibiting the
autophosphorylation of the bcr-abl tyrosine
kinase(41) . Interpretation of antisense data must be made in
light of this effect of polyanions on extracellular binding. In
particular, the inhibition of vascular smooth muscle cell growth by
antisense oligonucleotides has progressed rapidly into the effective
use of these molecules in animal models of restenosis. Although the
proposed mechanism of action of these compounds has been as antisense
inhibitors of myc or myb, the simpler explanation is
that they are acting, like heparin, as growth factor inhibitors.
Heparin and its low molecular weight subfragments have been shown to be
potent vascular smooth muscle cell growth inhibitors in
vitro(42) , are active in animal models of restenosis, and
have been used in human clinical trials (43, 44, 45) . The interpretation of the
results of these cell culture and animal trials of antisense
therapeutics for restenosis and other indications should be made in
light of the similarity in action between polyanions, heparin, and PS
oligonucleotides on the action of growth factors.
Volume 270,
Number 37,
Issue of September 15, pp. 21718-21721, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
)oligonucleotides(16, 17, 18, 19, 20) .
Phosphorothioate oligonucleotides contain internucleoside linkages in
which one of the nonbridging oxygen atoms has been replaced by a sulfur
atom in order to enhance nuclease resistance.
Materials
I-bFGF was obtained from
DuPont, unlabeled bFGF was obtained from Life Technologies Inc., Vero
cells were obtained from the ATCC, and heparin was obtained from Sigma.
Oligonucleotide Synthesis
Oligonucleotides were
synthesized on an Applied Biosystems Inc. DNA synthesizer model 380B or
394, using standard phosphoramidite methods. 5`-protected nucleoside
phosphoramidite monomers and other reagents were obtained from Milligen
with the exception of acetonitrile, which was obtained from Baxter. All
oligonucleotides were synthesized with a 3` Amino Modifier (Glen
Research), which results in the covalent attachment of a propanolamine
group to the 3`-hydroxl group(34, 35) .
Phosphorothioate-containing oligonucleotides were prepared using the
sulfurizing agent TETD, which produces a random mixture of R and S
isomers(36) . The purity of the oligonucleotides was confirmed
by analytical high pressure liquid chromatography, electrophoresis of P-labeled oligonucleotide on a polyacrylamide gel, or
capillary gel electrophoresis. The oligodeoxynucleotides (ODNs) used
were: ODN-1 (GTGGTGGTGGTGTTGGTGGTGGTTTGGGGGGTGGGG), ODN-3
(GATCCATGTCAGTGACACTGCGTAGATCCGATGATC), and ODN-4 (GGGTGGGTGGGG). ODN1,
ODN-3 and ODN-4 contain phosphorothioate linkages. ODN-2 has a sequence
identical to ODN-1 but contains phosphodiester linkages. ODN-5
(GsGsCsToGoCsCoAsToGoGoTsCsCsC) and ODN-6
(GsGsGsAoCoCsAoTsGoGoCoAsGsCsC) contain both phosphodiester and
phosphorothioate linkages (designated ``o'' and
``s'' in the sequence, respectively).
FGF Binding Assay
The binding of I-bFGF to Vero cell low and high affinity receptors was
assayed according to published protocols(29) . Briefly,
confluent monolayers of Vero cells in 24-well plates were incubated for
2 h at 4 °C with
I-bFGF. The cells were rinsed twice
with phosphate-buffered saline, and the low affinity bound bFGF was
removed with 2 M NaCl/20 mM Hepes, pH 7.5, and
counted in a Packard liquid scintillation counter. The high affinity
receptor bound bFGF was subsequently removed with 2 M NaCl/20
mM sodium acetate, pH 4, and counted. For competition
experiments,
I-bFGF was used at 2.5 ng/ml and mixed with
the desired amount of competitor approximately 30 min before addition
to cells. For saturation binding of
I-bFGF to Vero cells
in the presence of oligonucleotide and heparin, binding assays were
performed using varying amounts of
I-bFGF and 100
µg/ml heparin, 0.6 µM (7 µg/ml) ODN-1, or 20
µM (78 µg/ml) ODN-4. For high affinity-specific
binding, background values obtained from competition with a 100-fold
excess of unlabeled bFGF (mixed with
I-bFGF prior to the
addition to cells) were subtracted before further analysis.
I-bFGF to Vero cell low (A) and high (B) affinity receptors was assayed as described under
``Experimental Procedures.'' For the competition with cold
FGF, 100 ng/ml unlabeled bFGF was added. Heparin was used at 100
µg/ml; the phosphorothioate oligonucleotide ODN-1 was used at 0.6
µM (7 µg/ml). Each value is the average of duplicate
samples of a typical experiment. All points were assayed in at least
two separate experiments.
I-bFGF
alone (
) or in the presence of 100 µg/ml heparin (
), 20
µM (78 µg/ml) phosphorothioate ODN-4 (), or 0.6
µM (7 µg/ml) ODN-1
(
).
I-bFGF was kept constant while the dose of
oligonucleotide used in competition was varied. In this way the
relative binding affinities of the various oligonucleotides could be
compared. Representative results are shown (Fig. 3). Though
unlabeled bFGF competed for binding at only the high affinity
receptors, as expected, the oligonucleotides and heparin showed similar
competition at both the low and the high affinity binding sites.
Although the oligonucleotides varied in their ability to block bFGF
binding, we were unable to distinguish any sequence or structure that
was responsible. The concentration at which 50% of the high affinity
binding was inhibited (ID
) was calculated for several
representative oligonucleotides and in several conditions (Table 1). The PS oligonucleotides were consistently competitive
at lower concentrations than the phosphodiester or partial
phosphorothioate oligonucleotides, though the phosphodiester
oligonucleotides did have some effect at concentrations greater than 10
µM. A comparison of PS oligonucleotides of various lengths
(12-36 bases) showed no direct correlation of length to
ID
, but the exact sequence did influence bFGF binding
inhibition; two PS oligonucleotides (ODN-1 and ODN-3) of identical
length but different sequence both diminish bFGF binding, but the
ID
values differ by 10-fold. The oligonucleotides we used
that were composed of G's and T's were generally more
effective than mixed sequences, but no firm rules could be established
for predicting the relative binding inhibition of the
phosphorothioates. The oligonucleotides and heparin are both polymeric
anions, but the phosphorothioate modification of the oligonucleotide
backbone presumably causes a change in charge or secondary structure
that renders the oligonucleotides even more effective in their
inhibition of bFGF binding.
I-bFGF binding were assayed as
described. For high affinity-specific binding, background values
obtained from competition with 100-fold excess of unlabeled bFGF and
the highest concentration of each competitor were subtracted before
plotting. Assays contained 2.5 ng/ml
I-bFGF and the
indicated concentrations of unlabeled bFGF (
), heparin
(), phosphorothioate ODN-1 (
), phosphorothioate ODN-3
(), or phosphodiester ODN-2 (
).
was only slightly higher (Table 1). The ID
was significantly higher if the
oligonucleotide was removed prior to the addition of the bFGF but was
still less than 5 µM. Although there is some variation in
the extent of bFGF inhibition depending on whether the growth factor or
the cells are preincubated with oligonucleotide, there is a significant
level of activity against bFGF under the conditions of most antisense
assays. It should be kept in mind that many cell lines synthesize and
secrete bFGF and that endogenously produced bFGF may have significant
effect on cell growth and gene expression even in the absence of
exogenously added growth factor. Under such conditions there is no
possibility of separating the presence of oligonucleotide and bFGF by
washing, and the full effect of the binding inhibition may be seen.
)
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
ABSTRACT
This article has been cited by other articles:
|
|
 |
|
  N. Salamat-Miller, J. Fang, C. W. Seidel, A. M. Smalter, Y. Assenov, M. Albrecht, and C. R. Middaugh A Network-based Analysis of Polyanion-binding Proteins Utilizing Yeast Protein Arrays Mol. Cell. Proteomics, December 1, 2006; 5(12): 2263 - 2278. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. Dias and C. A. Stein Antisense Oligonucleotides: Basic Concepts and Mechanisms Mol. Cancer Ther., March 1, 2002; 1(5): 347 - 355. [Full Text] [PDF]
|
|
|
|
 |
|
 T.-C. Mou and D. M. Gray The high binding affinity of phosphorothioate-modified oligomers for Ff gene 5 protein is moderated by the addition of C-5 propyne or 2'-O-methyl modifications Nucleic Acids Res., February 1, 2002; 30(3): 749 - 758. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Takei, K. Kadomatsu, S. Matsuo, H. Itoh, K. Nakazawa, S. Kubota, and T. Muramatsu Antisense Oligodeoxynucleotide Targeted to Midkine, a Heparin-binding Growth Factor, Suppresses Tumorigenicity of Mouse Rectal Carcinoma Cells Cancer Res., December 1, 2001; 61(23): 8486 - 8491. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Benimetskaya, P. Miller, S. Benimetsky, A. Maciaszek, P. Guga, S. L. Beaucage, A. Wilk, A. Grajkowski, A. L. Halperin, and C. A. Stein Inhibition of Potentially Anti-Apoptotic Proteins by Antisense Protein Kinase C-alpha (Isis 3521) and Antisense bcl-2 (G3139) Phosphorothioate Oligodeoxynucleotides: Relationship to the Decreased Viability of T24 Bladder and PC3 Prostate Cancer Cells Mol. Pharmacol., December 1, 2001; 60(6): 1296 - 1307. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Lebedeva, R. Rando, J. Ojwang, P. Cossum, and C. A. Stein Bcl-xL in Prostate Cancer Cells: Effects of Overexpression and Down-Regulation on Chemosensitivity Cancer Res., November 1, 2000; 60(21): 6052 - 6060. [Abstract] [Full Text]
|
|
|
|
 |
|
 P. J. Bates, J. B. Kahlon, S. D. Thomas, J. O. Trent, and D. M. Miller Antiproliferative Activity of G-rich Oligonucleotides Correlates with Protein Binding J. Biol. Chem., September 10, 1999; 274(37): 26369 - 26377. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |