|
Volume 270,
Number 37,
Issue of September 15, pp. 21833-21838, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Role
of LFB3 in Cell-specific cAMP Induction of the Urokinase-type
Plasminogen Activator Gene (*)
(Received for publication, April 13, 1995; and in revised form, July 5, 1995)
René
Marksitzer
,
Aribert
Stief
,
Pierre-Alain
Menoud
,
Yoshikuni
Nagamine (§)
From the Friedrich Miescher Institute, P.O. Box 2543, CH-4002
Basel, Switzerland
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
In previous work we suggested that a kidney-specific
transcription factor LFB3 cooperates with cAMP-response element
(CRE)-binding proteins within a cAMP regulatory unit comprised of three
protein-binding domains and located 3.4 kilobase pairs upstream of the
urokinase-type plasminogen activator (uPA) gene in LLC-PK cells (Menoud, P.-A., Matthies, R., Hofsteenge, J., and Nagamine,
Y.(1993) Nucleic Acids Res. 21, 1845-1852). The two
domains contain a CRE-like sequence, and the third domain is recognized
by LFB3. The absolute requirement of LFB3 as well as the cooperation
among the three domains for cAMP regulation were confirmed by transient
transfection assays in F9 teratocarcinoma cells, in which the level of
LFB3 was negligible. Suspecting a possible feedback regulation of LFB3
mRNA expression during cAMP-dependent uPA gene induction in
LLC-PK cells, we measured LFB3 mRNA levels after cAMP
treatment and found a strong reduction. This reduction was not due to a
change in template activity of the LFB3 gene because run-on
transcription showed no significant change in LFB3 gene transcription.
RNA synthesis inhibitor-chase experiments indicated that the
down-regulation was post-transcriptional. Interestingly, when the
inhibitor was added at the same time as cAMP, the cAMP-induced decrease
in LFB3 mRNA levels was abrogated, suggesting that on-going RNA
synthesis is required for the decrease. Similar effects on LFB3 mRNA
metabolism were observed with all agents that induce uPA mRNA in
LLC-PK cells, including
12-O-tetradecanoylphorbol-13-acetate, okadaic acid,
colchicine, and cytochalasin. We discuss the significance of this
regulation in uPA gene expression.
INTRODUCTION
Signal transduction, a process of successive activation of
various molecules, is subject to various levels of regulation. In many
cases, for the sake of homeostasis, activated molecules are sequestered
from the pathway by desensitization of membrane-bound
receptors(1, 2) , degradation of activated
molecules(3, 4) , inactivation of activated molecules
by dephosphorylation(5, 6) , or by a feedback
mechanism(7) . Cross-talk between different signaling pathways
is also an important mechanism for bestowing flexible and versatile
regulation on a given pathway. This can be either positive or negative
and occurs at various steps in the pathway in a cell-specific manner
(for reviews, see (8, 9, 10) ). Therefore, in
addition to the identification of successively activated components of
a signaling pathway and the elucidation of the mechanism of activation
of each component, it is also very important to know how the activity
of each component is modulated by molecules not immediately upstream in
the pathway. In this way, the nature of a signaling pathway may be
understood in a more physiologically relevant context. We have been
studying urokinase-type plasminogen activator (uPA) ( )gene
regulation in LLC-PK cells, a cell line derived from pig
kidney epithelia(11) . In these cells, the uPA gene is induced
through independent signaling pathways by various signals such as
cAMP(12) , 12-O-tetradecanoylphorbol-13-acetate
(TPA)(13) , the protein phosphatase 1/2A inhibitor okadaic
acid(14, 15) , and cytoskeletal
reorganization(13, 16) . The pig uPA gene has a
cAMP-inducible enhancer located 3.4 kb upstream of the transcription
start site(12) . This enhancer is comprised of three
protein-binding domains, A, B, and C. Domains A and B contain a core
sequence of the cAMP response element (CRE) but require the adjoining C
domain to confer full cAMP responsiveness on a heterologous
promoter(12, 17) . The C domain has no CRE and cannot
mediate cAMP responsiveness when used in isolation. We have purified
the protein binding to the C domain (17) and found it to be the
pig equivalent of mouse LFB3(18) . It is also known as
HNF1 (19) or vHNF1(20) . LFB3 is a
tissue-specific transcription factor highly expressed in kidney cells (18) with a structure closely related to the liver-specific
transcription factor HNF1 . Both HNF1 and LFB3 recognize the
same DNA sequence, at least in
vitro(17, 21) , although the domain C sequence is
quite different from the consensus HNF1 recognition sequence. It
is still not known which genes besides the uPA gene are the targets of
LFB3 in kidney cells, or how the expression of LFB3 is regulated. As
LFB3 is apparently involved in cAMP-dependent uPA gene regulation in
LLC-PK cells, we were interested to know whether
cAMP-evoked signaling affected the expression of LFB3 in these cells.
Indeed, we have shown that cAMP treatment strongly reduces LFB3 mRNA
levels, suggesting a feedback mechanism via LFB3 in cAMP-dependent uPA
gene regulation in LLC-PK1 cells(17) . In the present study, we
verify the involvement of LFB3 in cAMP-induction of the uPA gene and
show that not only cAMP but also other agents that induce uPA gene
expression strongly reduce the amount of LFB3 mRNA. These agents are
12-O-tetradecanoylphorbol-13-acetate, okadaic acid,
colchicine, and cytochalasin B. Our results suggest the involvement of
LFB3 in uPA gene regulation by cAMP at different levels.
MATERIALS AND METHODS
ReagentsTPA, colchicine, and cytochalasin B
were obtained from Sigma;
5,6-dichloro-1- -D-ribofuranosylbenzimidazole (DRB) from
Fluka; 8-bromo-cAMP (Br-cAMP) from Boehringer Mannheim; and okadaic
acid from Anawa. [ - P]dATP (3000 Ci/mmol)
was obtained from Amersham Corp. The oligonucleotides used for
electromobility shift assays were (only upper strands given): domain A,
5`-AATTCTGTGCCTGACGCACAG-3`; domain B, 5`-AATTCGCCCATGACGAACACTGGG-3`;
domain C, 5`-GTGAATGAATAAAGGAATAAATGAATGATTTCACA-3`; mPEA3/AP1,
5`GATCCGTCCAAGGAATTCATGAGGTCATCCTG3`; and SP1,
5`-GATCCAGCCCTGGCCCCGCCCTAGCCTG-3`. The mPEA3/AP1 sequence is derived
from the PEA3/AP1 site of the uPA gene, and its PEA3 site is mutated (17) . The sequences of oligonucleotides used for the
construction of templates are shown in Fig. 1a.
Figure 1:
Cooperative
role of domain C with neighboring domains A and B in uPA gene induction
by cAMP signaling. a, luciferase gene constructs containing
different parts of a cAMP-inducible enhancer of the uPA gene which is
composed of domains A, B, and C. The positions of apparent protein
contacts as determined by methylation interference experiments are
indicated by stars. Mutated domains and sequences are
indicated by lowercase letters. b, Transient
transfection assays in LLC-PK cells. Luciferase constructs
(1 µg) were induced either by 1 mM 8-Br-cAMP or by
transfecting together with 0.5 µg of pCEV (CEV), a vector
expressing a catalytic subunit of the cAMP-dependent protein kinase. c, the role of LFB3 was tested by transient cotransfection
assays in F9 cells using luciferase constructs (pTATA or pABC-TATA; 1 µg) and LFB3 expression vector (1 µg)
with or without pCEV (CEV) (0.5 µg). Assays were done in
duplicate and mean values are shown with error
bars.
Cell CultureLLC-PK (11) and
F9 cells were cultured in Dulbecco's modified Eagle's
medium (Life Technologies, Inc.) supplemented with 10 and 5% (v/v),
respectively, fetal calf serum (AMIMED), 0.2 mg/ml streptomycin, and 50
units/ml penicillin at 37 °C in a humidified CO (5%)
incubator. LLC-PK cells were plated on plastic dishes and
F9 cells on gelatin-coated plastic dishes.
Expression VectorsIn pTATA (constructed and
provided by A. E. Sippel) the firefly luciferase gene is linked to a
minimal promoter of the thymidine kinase gene (-46 to +52)
containing only the TATA box and the transcription initiation site.
Mutated and nonmutated sequences derived from the cAMP-responsive
enhancer ABC site, which is located 3.4 kb upstream of the
transcription initiation site of the uPA gene, were inserted
immediately 5` of the TATA box of pTATA (Fig. 1a).
Similar constructs with nonmutated sequences, but with the SV40 early
gene promoter, and the pig LFB3 expression vector have been described
previously(17) .
Plasmids and ProbesThe cDNA clones for pig uPA,
pYN15 (22) , for pig actin, pACT4(23) , and for pig
LFB3 (17) have been described. The DNA insert from each plasmid
was labeled with [ - P]dATP using a random
oligo-primed reaction(24) .
Transient Transfection AssaysCells were seeded at
3 10 (LLC-PK ) or 2 10 (F9) per 35-mm plate the day before transfection. Cells were
transfected by calcium phosphate-mediated precipitation with 1-3
µg of DNA. When cells were to be induced, cells were treated 20 h
after transfection with 1 mM Br-cAMP for 6 h. Cell extracts
were assayed for luciferase activity as described elsewhere (17) using a Lumiometer (Autolumat LB 953, Berthold).
RNA Isolation and Northern Blot AnalysisTotal RNA
was isolated according to Chomczynski and Sacchi (25) and
analyzed for levels of specific mRNAs by Northern blot hybridization as
described(23) . To confirm the loading and transfer of similar
amounts of RNA, ribosomal RNA was visualized on nylon filters by
staining with methylene blue(26) . After hybridization, filters
were exposed to Kodak X-Omat AR film with an intensifying screen at
-70 °C. Levels of specific RNA were quantitated using a
Molecular Dynamics PhosphorImager.
Determination of mRNA StabilityRNA stability was
measured by the RNA synthesis inhibitor-chase method as
described(27) . Briefly, cells were treated with DRB (20
µg/ml) to inhibit transcription, and total RNA was isolated at
several subsequent time points. RNA was analyzed by Northern blot
hybridization. mRNA levels were plotted using SigmaPlot (Jandel
Scientific) and subjected to linear regression.
Nuclear TranscriptionThe isolation of nuclei,
nuclear run-on transcription, and quantitation of specific transcripts
by hybridization were performed as described previously(28) .
Nuclear Extracts and Electrophoretic Mobility Shift
AssaysNuclear extracts were prepared from LLC-PK cells and electrophoretic mobility shift assays were performed as
described previously(13) .
RESULTS
Cooperation of LFB3 in a cAMP-responsive
EnhancerA cAMP-inducible enhancer located 3.4 kb upstream of
the transcription initiation site of the uPA gene is composed of three
protein binding domains, A, B, and C; domain C lacks a CRE sequence and
is necessary together with domains A and B for full cAMP-inducible
activity(12) . Cooperation between domains A and B and domain C
was reevaluated in the context of the minimum thymidine kinase gene
promoter containing only a TATA box by transient transfection assays (Fig. 1b). To activate cAMP-dependent signaling, we
used Br-cAMP or an expression vector of the catalytic subunit of
cAMP-dependent protein kinase. As shown in Fig. 1b,
templates with domains A and B alone or domain C alone did not exhibit
significant inducibility compared with the control template, while the
template with all three domains (pABC-TATA) showed strong inducibility.
This inducibility was strongly reduced when the template pABC-TATA was
mutated in any of the three domains. The mutations were introduced to
the sites that had been shown to interact with nuclear proteins by
methylation interference experiments(12) . The induction with
Br-cAMP elicited a stronger response than with the catalytic subunit,
which may be due to a high concentration of free regulatory subunits in
LLC-PK cells.We previously cloned the domain C-binding
protein and found it to be the pig equivalent of mouse
LFB3(17) . We therefore examined the effect of LFB3 on the
above templates by transient coexpression assays in F9 cells, which
have a negligible level of endogenous LFB3. We used only the catalytic
subunit to activate the signaling because endogenous cAMP-dependent
protein kinase is not responsive to cAMP in F9 cells by an unknown
mechanism(29) . Fig. 1c shows that in F9 cells
pABC-TATA was strongly induced by the catalytic subunit only when LFB3
was coexpressed. The control pTATA was not affected. These results
unambiguously indicate the cooperation among three protein-binding
domains and the involvement of LFB3 in cAMP regulation through the ABC
site.
Effect of cAMP and Other uPA Inducers on LFB3 mRNA
LevelsTo confirm the previous observation that cAMP treatment
reduces LFB3 mRNA in LLC-PK cells, we compared Br-cAMP to
other agents shown to induce uPA mRNA in the same cells, TPA,
colchicine, cytochalasin B, and okadaic acid. The cells were incubated
for the time optimal for uPA mRNA induction, i.e. 2 h for
Br-cAMP and TPA and 4 h for the rest. As shown in Fig. 2,
Br-cAMP as well as other agents strongly reduced LFB3 mRNA levels; all
of them induced uPA mRNA. The greatest reduction in LFB3 mRNA levels
was obtained with TPA and okadaic acid (85% by 2 and 4 h) and the least
with cytochalasin B (60% by 4 h).
Figure 2:
LFB3 mRNA levels. Total RNA was prepared
from cells pretreated with 1 mM Br-cAMP or 100 ng/ml TPA for 2
h or 0.5 µM colchicine, 10 µM cytochalasin B,
or 125 nM okadaic acid for 4 h. Samples (5 µg each) were
analyzed for the levels of LFB3 and uPA mRNAs by Northern blot
hybridization.
With the exception of Br-cAMP, all
the other agents induce uPA gene via the activation of AP1, acting on
the PEA3/AP1 site located 2 kb upstream of the transcription initiation
site(13, 15) . Therefore, in the following experiments
we compared in particular Br-cAMP and TPA.
Effect of Br-cAMP and TPA on Domain C Binding
ActivityWe tested whether the reduction of LFB3 mRNA levels
after treatment with uPA inducers was reflected at the protein level.
As specific antibodies against pig LFB3 were not available, we measured
domain C binding activity in nuclear extracts. We performed
electrophoretic mobility shift assays using crude nuclear extracts
prepared from LLC-PK cells pretreated for 7 h with Br-cAMP
or TPA. Using a P-labeled domain C oligonucleotide as a
probe, we observed a single distinct band (Fig. 3), which could
be competed by excess of the identical unlabeled oligonucleotide but
not by an oligonucleotide carrying the same mutations as shown in Fig. 1a (data not shown). After treatment of the cells
with TPA, the binding activity was reduced to about 50%, with Br-cAMP
to 40% and with TPA and Br-cAMP added together to about 30%. These data
indicate that the LFB3 binding activity is reduced by Br-cAMP or TPA
treatment, suggesting that the reduced mRNA level affects the protein
level. To see whether the observed reduction is specific for domain C
binding, we tested other oligonucleotides recognized by different
transcription factors using the same nuclear extracts. Although domains
A and B were required for cAMP induction, proteins binding to these
sites were not affected by treatment of the cells with Br-cAMP or TPA.
With the SP1 oligonucleotide, two major specific bands were detected,
but they did not change in intensity after this treatment. In contrast,
with the mPEA3/AP1 oligonucleotide, which binds transcription factor
AP1(13) , the intensity of the shifted band markedly increased
on treatment with TPA and even more with Br-cAMP.
Figure 3:
Domain C binding activity. Domain C
binding activity in the nucleus was tested by electromobility shift
assays using crude nuclear extracts from LLC-PK cells
pretreated for 7 h with 1 mM Br-cAMP, 100 ng/ml TPA, or both.
As controls, the same extracts were tested for domains A and B,
mPEA3/AP1, and SP1 binding activities.
No Change in Transcription Rate of the LFB3
GeneThe mechanism leading to the reduction of LFB3 mRNA by uPA
inducers may involve either transcriptional or post-transcriptional
regulation of the LFB3 gene. To distinguish between these two
possibilities, we first performed nuclear run-on transcription to
assess changes in the LFB3 gene transcription rate. The results shown
in Fig. 4indicate that the transcription rate of the LFB3 gene
did not change when cells were treated with TPA, Br-cAMP, colchicine,
or cytochalasin B. As expected, these agents significantly enhanced the
uPA gene transcription rate. Thus, the decrease in LFB3 mRNA levels
seems not to be due to decreased de novo synthesis of LFB3
mRNA, suggesting that the reduction of LFB3 mRNA is a
post-transcriptional event.
Figure 4:
Nuclear run-on transcription. Nuclei were
isolated from LLC-PK cells untreated or pretreated with
various agents for 90 min. Nuclear transcription was performed in the
presence of a radioactive precursor and specific transcripts were
analyzed by filter hybridization.
Induced Instability of LFB3 mRNAIf a
post-transcriptional step is responsible for the induced decrease in
LFB3 mRNA level, the most obvious mechanism could be an effect on mRNA
stability. The stability of LFB3 mRNA was assessed by DRB-chase
experiments. Since DRB specifically inhibits the synthesis of
eukaryotic heterogeneous nuclear RNA and mRNA(30) , chase of
mRNA levels after its addition allows estimation of the decay rate of
the mRNA. Because inhibition of mRNA synthesis may have some indirect
influence on mRNA stability(31) , we did chase experiments
using two different schemes: in one experiment DRB was added at the
same time as Br-cAMP or TPA, and in the other DRB was added 1 h after
Br-cAMP or TPA treatment. The effect on LFB3 mRNA was independent of
the presence of Br-cAMP when DRB was added at the beginning of the
experiment (Fig. 5a). However, LFB3 mRNA decayed faster
in the presence of Br-cAMP when DRB was added 1 h after Br-cAMP (Fig. 5b). Similar results were obtained using TPA (Fig. 5, c and d). These results indicate that
the stability of LFB3 mRNA is reduced by uPA inducers, and that this
requires on-going RNA synthesis for at least 1 h at the beginning of
the treatment.
Figure 5:
Stability of LFB3 mRNA. Effects of Br-cAMP (a and b) and TPA (c and d) on the
stability of LFB3 mRNA were examined by RNA synthesis inhibitor chase
experiments. In a and c, Br-cAMP and TPA,
respectively, were added at the same time of DRB. In b and d, Br-cAMP and TPA, respectively, were added 1 h before DRB.
, DRB; , TPA or Br-cAMP; , DRB plus TPA or
Br-cAMP.
Effect of the Decrease in DNA Binding Activity of LFB3 on
cAMP InductionTPA and cAMP treatment reduced the DNA binding
activity of LFB3. To test the biological relevance of this decrease in
cAMP induction we asked whether TPA pretreatment could affect the
cAMP-induction of pABC-TATA. As shown in Fig. 6, TPA
pretreatment by itself had little effect on basal expression but
significantly reduced cAMP induction of the luciferase gene driven by
ABC sites.
Figure 6:
Effect of TPA pretreatment on cAMP
induction of pABC-TATA. LLC-PK cells were transfected with
pABC-TATA. At 20 h after transfection cells were treated with or
without TPA for 7 h, and then induced with or without 0.1 mM Br-cAMP for 4 h. Assays were done in duplicate and mean values are
shown with error bars.
DISCUSSION
LFB3 is an enhancer-binding protein augmenting basal
expression of a gene that contains its cognate cis-element. We
found in the induction of the uPA gene by cAMP in LLC-PK cells that LFB3 is a positive regulator cooperating with
CRE-binding proteins within a composite cAMP-responsive enhancer (17) (this work). Our results also suggest that LFB3 is
involved in a down-regulating phase of cAMP-induced uPA gene
expression. We have previously shown that uPA gene induction by cAMP is
transient; the rate of uPA gene transcription reaches optimal after
2-4 h of cAMP treatment but declines thereafter (32) . It
may be that in uPA gene regulation LFB3 acts as a negative feedback
regulator by decreasing its own concentration in response to cAMP. This
throws new light on LFB3, which has been implicated as a factor
coupling hormonal regulation and tissue-specific regulation of uPA gene
expression in kidney epithelial cells(17) . The decrease in
domain C binding activity seems to be due to a decrease in LFB3 protein
levels. The decrease was also observed with TPA, and it may also be the
case for colchicine, cytochalasin B, and okadaic acid, which all
decreased LFB3 mRNA levels (see below). These agents induce uPA gene
expression in LLC-PK1 cells via activation of the transcription factor
AP1, although the mechanism of AP1 activation by each agent is
different(13, 14, 15) . Thus, in addition to
the features mentioned above, LFB3 may mediate negative cross-talk
between cAMP-dependent signaling and AP1-activating signaling pathways
in uPA gene regulation. Indeed, pretreatment with TPA significantly
reduced cAMP induction of the luciferase gene driven by an enhancer
consisting of domains A, B, and C. The decrease in DNA binding by LFB3
in the cells seems to be due to the reduction in the protein levels. We
cannot formally exclude the possibility that the decrease is due to a
post-translational modification of the protein; however, this is in any
case not the main cause because we also detected a strong reduction in
LFB3 mRNA levels. The possible role of LFB3 in cAMP-dependent uPA gene
regulation through the ABC site revealed by this work is summarized in Fig. 7.
Figure 7:
Working model for the role of LFB3 in
cAMP-dependent uPA gene regulation through the ABC site. LFB3 is a
kidney-enriched transcription factor and plays a role as both positive
and negative regulator of cAMP induction of the uPA gene through the
ABC site. It allows cAMP induction by cooperating with CRE-binding
proteins (CRE-BP) on the ABC site of the uPA gene promoter.
But later on, it also mediates a negative feedback regulation by cAMP
and TPA by decreasing its protein levels, which is due to enhanced
degradation of LFB3 mRNA.
The decrease in DNA-binding activity evoked by
treatment with the uPA inducers in these cells was specific to the
domain C binding protein, LFB3, and not a general effect, because DNA
binding of the proteins recognizing domains A and B and of the
ubiquitous transcription factor SP1 remained constant. Furthermore, the
DNA-binding activity to the mutated PEA3/AP1-oligonucleotide, which
contains an active AP1 site mediating the action of TPA, colchicine,
cytochalasin and okadaic acid, was increased by Br-cAMP as well as by
TPA. We have not elaborated the mechanism of the increase in
PEA3/AP1-binding activity, i.e. whether it is transcriptional
or post-transcriptional. It is worthwhile to mention that the peptide
hormone calcitonin, which raises intracellular cAMP concentrations,
strongly enhances de novo synthesis of c-Fos and
c-Jun(13) , raising the interesting possibility of a
cross-regulation of the TPA-dependent signaling pathway by the
cAMP-dependent signaling pathway at the transcription step. The cAMP
signal by itself does not utilize the PEA3/AP1 site to increase uPA
gene expression(13) . We do not know yet whether the
enhancement of c-Fos together with c-Jun levels exerts positive effects
on PEA3/AP1 site-mediated uPA gene expression, because the
overexpression of c-Fos had no effect on uPA gene induction in NIH3T3
cells(33) . The decrease in LFB3 mRNA levels is mainly
attributable to induced mRNA instability. We did not detect changes in
the LFB3 gene transcription rate, but we did observe that LFB3 mRNA
degradation increased in the presence of TPA or Br-cAMP. Interestingly,
however, enhanced instability was observed only when DRB was added 1 h
after TPA or Br-cAMP treatment, suggesting that some RNA transcripts or
their translation products are involved in LFB3 mRNA metabolism. It may
be that TPA or Br-cAMP induces a factor, RNA or protein essential for
LFB3 mRNA degradation, or that an RNA or a protein of short half-life
is involved in LFB3 mRNA degradation, at least at an early stage. A
requirement for on-going RNA synthesis in mRNA degradation has been
reported for several mRNAs, such as those for
c-fos,(34) , c-myc(35) ,
collagenase(36) , and the transferrin receptor(37) . We
have shown that an RNA instability-regulating site in the 3`-UTR of uPA
mRNA requires on-going RNA synthesis for its activity (31) and
that the importance of this site in overall uPA mRNA degradation may
depend on cell type (38) . In none of these cases is it known
how on-going RNA synthesis contributes to mRNA degradation. Several
instability-determining sequences have been identified in many mRNAs.
These include sequences located in the 3`-untranslated region, such as
the iron-responsive element in the transferrin receptor
mRNA(37, 39) , sequences in the unstable yeast MFA2
mRNA (38) and AU-rich sequences in various oncogene and
lymphokine mRNAs (40, 41, 42, 43, 44) . But
instability-determining elements have also been identified in coding
regions, e.g. c-myc(35) and c-fos(45) mRNAs. We tested the 3`-UTR and protein-coding
regions of LFB3 mRNA in a system developed for the study of uPA mRNA
degradation by inserting these sequences in an otherwise stable globin
mRNA(31) ; however, the stability of recombinant globin mRNAs
was not affected by TPA or Br-cAMP. ( )It may be that
regulatory sequences reside in 5`-UTR or the 3` extreme which we have
not tested or that the globin mRNA context interfered with TPA- and
Br-cAMP-induced mRNA degradation. Whether the cAMP and TPA signals
utilize the same mechanism to induce LFB3 mRNA destabilization is not
yet established, although it is plausible considering that induced LFB3
mRNA instability by either agent requires ongoing RNA synthesis and
that signal transductions induced by the two agents are related. In the
cell, cAMP and TPA activate distinct signaling pathways but are
otherwise quite related. Both agents trigger signaling by activating
serine/threonine kinases, and the transcription factors that are
eventually activated by these signals are also related; the cAMP and
TPA signals activate CREB/ATF and AP1, respectively, which are highly
related transcription factors containing basic/leucine zipper domains,
recognize highly similar sequences, and can cross-dimerize (for
reviews, see (8) and (46) ). A protein responsible for
induced LFB3 mRNA degradation could be phosphorylated and regulated by
cAMP-dependent protein kinase as well as by protein kinase C.
Alternatively, the two different but related transcription factors may
exert their effects at a post-transcriptional step by interacting with
the same RNA sequence or RNA-binding protein. It should be remembered
that colchicine, cytochalasin B, and okadaic acid also reduce LFB3 mRNA (Fig. 2) and that these agents do not require protein kinase C
to activate AP1 and induce the uPA gene(13, 15) .
Identification of regulatory sequences in LFB3 mRNA and the
corresponding binding proteins should help answer these questions. We have shown that uPA inducers reduce LFB3 mRNA levels. Is there
any physiological significance in this apparent linkage, or is this
reverse regulation fortuitous, using very common signaling pathways?
uPA is a secreted protease which plays an important role in various
extracellular proteolytic processes (for reviews, see (47, 48, 49, 50) ), but its
unchecked expression may have deleterious effects on producing organs
or nearby organs(37) . As LFB3 is an abundant transcription
factor in kidney (18) ( )and is involved in uPA gene
regulation, it may have evolved so that the kidney cells use LFB3 as
one means to control the level of uPA expression.
FOOTNOTES
- *
- The costs of publication of this article were
defrayed in part by the payment of page charges. This article must
therefore by hereby marked ``advertisement'' in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed.
Tel.: 061-697-6669 or 061-697-4499; Fax: 061-697-3976.
- (
) - The abbreviations used are: uPA, urokinase-type
plasminogen activator; TPA,
12-O-tetradecanoylphorbol-13-acetate; CRE, cAMP response
element; DRB,
5,6-dichloro-1-
-D-ribofuranosylbenzimidazole; Br-cAMP,
8-bromo-cAMP; UTR, untranslated region; kb, kilobase pair(s). - (
) - R. Marksitzer, A. Stief, P.-A. Menoud, and Y.
Nagamine, unpublished data.
- (
) - P.-A. Menoud,
unpublished results.
ACKNOWLEDGEMENTS
We thank Patrick King, Patrick Matthias, Daniel
D'Orazio, and Mary Stewart for critical reading of the
manuscript. We thank Birgitta Kiefer for excellent technical
assistance.
REFERENCES
- Soderquist, A. M., and Carpenter, G. (1986) J. Membr. Biol. 90,97-105
[CrossRef][Medline]
[Order article via Infotrieve]
- Sibley, D. R., Benovic, J. L., Caron, M. G., and Lefkowitz, R. J. (1987) Cell 48,913-922
[CrossRef][Medline]
[Order article via Infotrieve]
- Young, S., Parker, P. J., Ullrich, A., and Stabel, S. (1987) Biochem. J. 244,775-779
[Medline]
[Order article via Infotrieve]
- Hemmings, B. A. (1986) FEBS Lett. 196,126-130
[CrossRef][Medline]
[Order article via Infotrieve]
- Hagiwara, M., Alberts, A., Brindle, P., Meinkoth, J., Feramisco, J., Deng, T., Karin, M., Shenolikar, S., and Montminy, M. (1992) Cell 70,105-113
[CrossRef][Medline]
[Order article via Infotrieve]
- Depaoli Roach, A. A., Park, I. K., Cerovsky, V., Csortos, C., Durbin, S. D., Kuntz, M. J., Sitikov, A., Tang, P. M., Verin, A., and Zolnierowicz, S. (1994) Adv. Enzyme Regul. 34,199-224
[CrossRef][Medline]
[Order article via Infotrieve]
- Beullens, M., Van Eynde, A., Bollen, M., and Stalmans, W. (1993) J. Biol. Chem. 268,13172-13177
[Abstract/Free Full Text]
- Delmas, V., Molina, C. A., Lalli, E., de Groot, R., Foulkes, N. S., Masquilier, D., and Sassone Corsi, P. (1994) Rev. Physiol. Biochem. Pharmacol. 124,1-28
[Medline]
[Order article via Infotrieve]
- Darnell, J. E., Jr., Kerr, I. M., and Stark, G. R. (1994) Science 264,1415-1421
[Abstract/Free Full Text]
- Hunter, T. (1995) Cell 80,225-236
[CrossRef][Medline]
[Order article via Infotrieve]
- Hull, R. N., Cherry, W. R., and Weaver, G. W. (1976) In Vitro 12,670-677
[Medline]
[Order article via Infotrieve]
- von der Ahe, D., Pearson, D., and Nagamine, Y. (1990) Nucleic Acids Res. 18,1991-1999
[Abstract/Free Full Text]
- Lee, J. S., von der Ahe, D., Kiefer, B., and Nagamine, Y. (1993) Nucleic Acids Res. 21,3365-3372
[Abstract/Free Full Text]
- Nagamine, Y., and Ziegler, A. (1991) EMBO J. 10,117-122
[Medline]
[Order article via Infotrieve]
- Lee, J. S., Favre, B., Hemmings, B. A., Kiefer, B., and Nagamine, Y. (1994) J. Biol. Chem. 269,2887-2894
[Abstract/Free Full Text]
- Botteri, F. M., Ballmer-Hofer, K., Rajput, B., and Nagamine, Y. (1990) J. Biol. Chem. 265,13327-13334
[Abstract/Free Full Text]
- Menoud, P.-A., Matthies, R., Hofsteenge, J., and Nagamine, Y. (1993) Nucleic Acids Res. 21,1845-1852
[Abstract/Free Full Text]
- De Simone, V., de Magistris, L., Lazzaro, D., Gerstner, J., Monaci, P., Nicosia, A., and Cortese, R. (1991) EMBO J. 10,1435-1443
[Medline]
[Order article via Infotrieve]
- Mendel, D. B., Hansen, L. P., Graves, M. K., Conley, P. B., and Crabtree, G. R. (1991) Genes & Dev. 5,1042-1056
- Rey-Campos, J., Chouard, T., Yaniv, M., and Cereghini, S. (1991) EMBO J. 10,1445-1457
[Medline]
[Order article via Infotrieve]
- Bach, I., Mattei, M. G., Cereghini, S., and Yaniv, M. (1991) Nucleic Acids Res. 13,3553-3559
- Nagamine, Y., Pearson, D., Altus, M. S., and Reich, E. (1984) Nucleic Acids Res. 12,9525-9541
[Abstract/Free Full Text]
- Ziegler, A., Knesel, J., Fabbro, D., and Nagamine, Y. (1991) J. Biol. Chem. 266,21067-21074
[Abstract/Free Full Text]
- Feinberg, A. P., and Vogelstein, B. (1983) Anal. Biochem. 132,6-13
[CrossRef][Medline]
[Order article via Infotrieve]
- Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162,156-159
[Medline]
[Order article via Infotrieve]
- Herrin, D. L., and Schmidt, G. W. (1988) BioTechniques 6,196-200
[Medline]
[Order article via Infotrieve]
- Ziegler, A., Hagmann, J., Kiefer, B., and Nagamine, Y. (1990) J. Biol. Chem. 265,21194-21201
[Abstract/Free Full Text]
- Andrus, L., Altus, M. S., Pearson, D., Grattan, M., and Nagamine, Y. (1988) J. Biol. Chem. 263,6183-6187
[Abstract/Free Full Text]
- Masson, N., Ellis, M., Goodbourn, S., and Lee, K. A. (1992) Mol. Cell. Biol. 12,1096-1106
[Abstract/Free Full Text]
- Tamm, I., and Sehgal, P. B. (1978) Adv. Virus Res. 22,187-258
[Medline]
[Order article via Infotrieve]
- Nanbu, R., Menoud, P.-A., and Nagamine, Y. (1994) Mol. Cell. Biol. 14,4920-4928
[Abstract/Free Full Text]
- Degen, J. L., Estensen, R. D., Nagamine, Y., and Reich, E. (1985) J. Biol. Chem. 260,12426-12433
[Abstract/Free Full Text]
- Besser, D., Presta, M., and Nagamine, Y. (1995) Cell Growth & Differ. , in press
- Shyu, A.-B., Greenberg, M. E., and Belasco, J. G. (1989) Genes & Dev. 3,60-72
- Wisdom, R., and Lee, W. (1991) Genes & Dev. 5,232-243
- Delany, A. M., and Brinckerhoff, C. E. (1992) J. Cell. Biochem. 50,400-410
[CrossRef][Medline]
[Order article via Infotrieve]
- Heckel, J. L., Sandgren, E. P., Degen, J. L., Palmiter, R. D., and Brinster, R. L. (1990) Cell 62,447-456
[CrossRef][Medline]
[Order article via Infotrieve]
- Stacey, K. J., Nagamine, Y., and Hume, D. A. (1994) FEBS Lett. 356,311-313
[CrossRef][Medline]
[Order article via Infotrieve]
- Casey, J. L., Koeller, D. M., Ramin, V. C., Klausner, R. D., and Harford, J. B. (1989) EMBO J. 12,3693-3699
[Medline]
[Order article via Infotrieve]
- Caput, D., Beutler, B., Hortog, K., Thayer, R., Brown-Shimer, S., and Cerami, A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,1670-1674
[Abstract/Free Full Text]
- Shaw, G., and Kamen, R. (1986) Cell 46,659-667
[CrossRef][Medline]
[Order article via Infotrieve]
- Jones, T. R., and Cole, M. D. (1987) Mol. Cell. Biol. 7,4513-4521
[Abstract/Free Full Text]
- Wilson, T., and Treisman, R. (1988) Nature 336,396-399
[CrossRef][Medline]
[Order article via Infotrieve]
- Akashi, M., Shaw, G., Gross, M., Saito, M., and Koeffler, H. P. (1991) Blood 78,2005-2012
[Abstract/Free Full Text]
- Shyu, A. B., Belasco, J. G., and Greenberg, M. E. (1991) Genes & Dev. 5,221-231
- Angel, P., and Karin, M. (1991) Biochim. Biophys. Acta 1072,129-157
[Medline]
[Order article via Infotrieve]
- Dano, K., Andreasen, P. A., Grondahl-Hansen, J., Kristensen, P., Nielsen, L. S., and Skriver, L. (1985) Adv. Cancer Res. 44,139-266
[Medline]
[Order article via Infotrieve]
- Blasi, F., Vassalli, J.-D., and Dano, K. (1987) J. Cell Biol. 104,801-804
[Free Full Text]
- Saksela, O., and Rifkin, D. B. (1988) Annu. Rev. Cell Biol. 4,93-126
[CrossRef]
- Kwaan, H. C. (1992) Cancer Metastasis Rev. 11,291-311
[CrossRef][Medline]
[Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y. Bai, M. Pontoglio, T. Hiesberger, A. M. Sinclair, and P. Igarashi
Regulation of kidney-specific Ksp-cadherin gene promoter by hepatocyte nuclear factor-1beta
Am J Physiol Renal Physiol,
October 1, 2002;
283(4):
F839 - F851.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. S. Streeper, C. A. Svitek, J. K. Goldman, and R. M. O'Brien
Differential Role of Hepatocyte Nuclear Factor-1 in the Regulation of Glucose-6-phosphatase Catalytic Subunit Gene Transcription by cAMP in Liver- and Kidney-derived Cell Lines
J. Biol. Chem.,
April 14, 2000;
275(16):
12108 - 12118.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Besser, J. F. Bromberg, J. E. Darnell Jr., and H. Hanafusa
A Single Amino Acid Substitution in the v-Eyk Intracellular Domain Results in Activation of Stat3 and Enhances Cellular Transformation
Mol. Cell. Biol.,
February 1, 1999;
19(2):
1401 - 1409.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. K. Soubt, R. Marksitzer, P.-A. Menoud, and Y. Nagamine
Role of Tissue-Specific Transcription Factor LFB3 in a Cyclic AMP-Responsive Enhancer of the Urokinase-Type Plasminogen Activator Gene in LLC-PK1 Cells
Mol. Cell. Biol.,
August 1, 1998;
18(8):
4698 - 4706.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. H. Heaton, M. Tillmann-Bogush, N. S. Leff, and T. D. Gelehrter
Cyclic Nucleotide Regulation of Type-1 Plasminogen Activator-Inhibitor mRNA Stability in Rat Hepatoma Cells. IDENTIFICATION OF cis-ACTING SEQUENCES
J. Biol. Chem.,
June 5, 1998;
273(23):
14261 - 14268.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Masse and P. T. Kelly
Overexpression of Ca2+/Calmodulin-Dependent Protein Kinase II in PC12 Cells Alters Cell Growth, Morphology, and Nerve Growth Factor-Induced Differentiation
J. Neurosci.,
February 1, 1997;
17(3):
924 - 931.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|