Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freedman, B. D.
Right arrow Articles by Kotlikoff, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freedman, B. D.
Right arrow Articles by Kotlikoff, M. I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 38, Issue of September 22, pp. 22406-22411, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification of Kv1.1 Expression by Murine CD4CD8 Thymocytes
A ROLE FOR VOLTAGE-DEPENDENT K CHANNELS IN MURINE THYMOCYTE DEVELOPMENT (*)

(Received for publication, April 17, 1995; and in revised form, June 20, 1995)

Bruce D. Freedman(§) (1) Bernd K. Fleischmann (2) Jennifer A. Punt (3) Glen Gaulton (1)(¶) Yasuhiro Hashimoto (4)(**) Michael I. Kotlikoff (2)(§§)

From the  (1)Department of Pathology and Laboratory Medicine, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania 19104, the (2)Department of Animal Biology, University of Pennsylvania School of Veterinary Medicine, Philadelphia, Pennsylvania 19104, the (3)Experimental Immunology Branch, NCI, National Institutes of Health, Bethesda, Maryland 20892, and (4)Syntex Institute of Immunology, Nihari, Ibaraki 300-41, Japan

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The patch-clamp recording technique and RNApolymerase chain reaction were used to identify the voltage-dependent K channels expressed by murine fetal and adult CD4CD8 thymocytes. Two distinct currents, encoded by the genes Kv1.1 and Kv1.3 were identified based upon their biophysical and pharmacologic characteristics and confirmed with RNA-polymerase chain reaction. Peptide blockers of Kv1.1 and Kv1.3 gene products were also applied to a murine fetal thymic organ culture system to investigate the developmental role of these K channels. Dendrotoxin (DTX) and charybdotoxin (CTX), antagonists of Kv1.1 and Kv1.3 channels, respectively, decreased thymocyte yields in organ culture without affecting thymocyte viability. DTX-treated thymi contained 56 ± 8% (n = 8 experiments), and CTX-treated thymi contained 74 ± 4% (n = 7 experiments) as many thymocytes as untreated lobes. DTX and CTX also altered the developmental progression of thymocytes in fetal organ culture. These data provide the first evidence of Kv1.1 expression in a lymphoid cell and indicate that thymocyte voltage-dependent K channels are critical to thymocyte preclonal expansion and/or maturation.


INTRODUCTION

Membrane potassium channels subserve important physiologic functions of thymocytes and peripheral T lymphocytes. Although lymphocytes are not electrically excitable cells, they express potassium channels that are the primary determinants of the membrane potential(1, 2) , and are critically important for production of the requisite T cell growth factor IL2(^1)(3, 4, 5) . Three voltage-dependent potassium channels have been described in murine thymic lymphocytes(6, 7) . These currents were originally distinguished on the basis of their unique pharmacology and kinetic behavior(6) . The most prevalent, n-type (Kv1.3 gene product; (10) ), is expressed by immature CD4CD8 and CD4CD8, and by mature CD4CD8 and CD4CD8 thymocytes. Two additional voltage-gated K channels, the l-type (Kv3.1, 35) and the n`-type currents (gene unknown), have been found in mature CD4CD8 thymocytes only(6) .

Although the physiologic role of voltage-gated potassium channels during normal thymocyte development (and preclonal expansion) has not been characterized, the selective expression of specific K channel subtypes by thymocyte subpopulations suggests that these channels may play a critical role in thymocyte development. We have used the fetal thymic organ culture (FTOC) system to study thymic development and have employed molecular biological and patch-clamp recording techniques to determine the expression of thymocyte K channels in CD4CD8 thymocytes. We report the expression of Kv1.1 channels in CD4CD8 thymocytes; these channels have not previously been reported in any lymphoid cell type. Both Kv1.1 and Kv1.3 channels are expressed by CD4CD8 thymocytes, and each of these conductances appears to play a role in early thymocyte development, specifically thymocyte proliferation.


MATERIALS AND METHODS

Cell Isolation

Virus-free C57Bl/6 mice were obtained from Jackson Laboratories or the National Cancer Institute and were bred in the animal facility at the University of Pennsylvania. Thymic lobes were removed from fetal mice at desired gestational ages and were placed into RPMI medium containing 10% heat-inactivated fetal bovine serum, 50 mM 2-mercaptoethanol, 10 mM HEPES buffer, pH 7.4, 1 mML-glutamine, and 100 IU/ml penicillin and streptomycin. Thymocytes were isolated by teasing apart the lobes with sterile keratotomy knives.

Fetal Thymic Organ Culture

FTOC (8) was established in 24-well plates at 37 °C in a 5%CO(2)/95%O(2) environment. Surgical gel foam (1-cm^2; Upjohn) was soaked in complete RPMI medium to which K blockers or additional reagents were added. Fetal lobes were placed onto sterile circular nitrocellulose filters (Millipore), which were supported by the gel foam. The fetal lobes (3/filter) were maintained at the air/medium interface and were bathed with medium daily. One half of the culture medium was changed on alternate days.

Thymocyte Phenotype Determination

2-5 times 10^5 cells were incubated with saturating concentrations of appropriate antibodies in 0.05 ml of staining medium (phosphate-buffered saline, 0.5% bovine serum albumin) for 15 min at 4 °C. Staining was performed as a one-step procedure with phycoerythrin-conjugated L3T4 (anti-CD4, Pharmingen, San Diego, CA) and fluorescein-conjugated anti Ly-2 (anti-CD8alpha, Pharmingen). Flow cytometry was performed on a FACSscan instrument (Becton Dickinson, San Jose, CA).

Electrophysiologic Recording

Murine fetal or adult DN thymocytes stained with fluorescein (CD8)- or phycoerythrin (CD4)-tagged monoclonal antibodies (see above) were placed in a recording chamber (Brooks) mounted on an inverted fluorescent microscope (Diaphot, Nikon) and CD4CD8 (non-staining) cells were patched. Patch pipettes (4-6 M) were back-filled with solution containing 150 µg/ml nystatin (Sigma). Command potentials were generated and currents acquired, stored, and analyzed on a Macintosh computer using an EPC-9 amplifier and associated software (Heka, Lambrecht, Germany). Liquid junction potentials, capacitance, and series resistance were compensated using the internal circuit of the EPC-9. Data were sampled at 10 kHz, filtered at 1 kHz, and recorded on computer disk. Following formation of gigaohm seals (5-30 G), cells were lifted off the chamber bottom and held at -80 mV; voltage clamp measurements were initiated when the access resistance (R(s)) was less than 50 M (5-10 min after seal formation). Unless stated otherwise, macroscopic K currents were elicited with step depolarizations to +50 mV and currents reported as peak whole cell currents. Current density was calculated by dividing the peak whole cell current by the cell capacitance, with the assumption that 1 µm^2 = 1 pF. Drugs were applied by direct addition to the bath. The bath solution contained (in mM) 160 NaCl, 4.5 KCl, 2 MgCl(2), 1 CaCl(2), 5 Na-HEPES, and 5 glucose (pH 7.4). The pipette solution contained 134 KF, 11 K(2)EGTA, 1.1 CaCl(2), 2 MgCl(2), and 10 K-Hepes (pH 7.2). Synthetic charybdotoxin (CTX) and kaliotoxin (KTX) were obtained from Peptides International (Louisville, KY), and dendrotoxin (DTX) from Calbiochem (San Diego, CA).

RNA Preparation and Reverse Transcriptase PCR

Total cellular RNA was prepared according to the method of Chomczinski and Saachi(9) . Contaminating genomic DNA was removed from RNA preparations by treating them with DNase I (Boerhinger Mannheim) before cDNA synthesis. The polymerase chain reaction was used to amplify cDNA prepared from murine thymocyte RNA. Unique oligonucleotide primer pairs were designed to 3` regions of the K channel genes as follows: Kv1.1 (sense, cDNA clone MK3, bases 979-1007, ATCTTCAAACTCTCCCGCCACTCCAAGGG; antisense, bases 1495-1476 of cDNA clone MK1, TTGCTTTTTAAACATCGCT; probe, bases 1292-1321 of MK1, CTTAGCCTCTGACAGTGACC ((10) )), Kv1.3 (sense, as above; antisense, bases 1558-1541 of cDNA clone KV3, ACTTCAACTACTTCTACCACCG; probe, bases 1315-1336 of cDNA clone KV3, TTGGGGTTATTGTTCGTG ((11) )). PCR products were separated by electrophoresis in a 2% agarose gel (Life Technologies, Inc.) and capillary blotted onto GeneScreen Plus nylon membrane (DuPont NEN) with 0.5 M NaOH and 1.5 M NaCl. Oligonucleotide probes were 5`-end-labeled with [-P]ATP using T4 polynucleotide kinase (Life Technologies, Inc.).


RESULTS

Pharmacological Characterization of Potassium Currents in CD4CD8Thymocytes-To identify the voltage-dependent K channels expressed by CD4CD8 (double negative, DN) thymocytes, we employed K channel-selective peptide blockers with the nystatin variation of the whole cell patch-clamp technique. Immunocytochemically defined fetal (day 15 or 16) or adult murine thymocytes were voltage-clamped and K currents evoked by step depolarizations. Experiments were performed on both fetal DN thymocytes, which are predominately TCR-negative, and adult DN cells, which are both alphabetaTCR-positive and -negative(16) . Current amplitudes were stable in these cells for more than 45 min; the rate of current inactivation did accelerate somewhat over time, however, and was dependent on the series resistance (R(s)) as previously reported(12) . Fig. 1shows a typical family of whole cell currents from an adult CD4CD8 thymocyte evoked by step depolarizations to potentials between -40 and +40 mV (20 mV steps). Potassium currents activated at approximately -40 mV and showed typical time-dependent activation and inactivation characteristics, similar to previous recordings from CD4CD8 cells(6, 7) . Current inactivation was incomplete, however, and a small non-inactivating current component was a consistent feature of the currents in these cells. Total currents found in fetal and adult murine CD4CD8 thymocytes were comparable, but there was a substantially greater current density in the adult cells. The current density was 262 ± 25.2 µA/cm^2 in adult (n = 29) and 95.4 ± 8.5 µA/cm^2 in fetal cells (n = 30) for a voltage step from -80 to +50 mV.


Figure 1: Voltage-dependent potassium currents in CD4CD8 thymocytes. Top, currents evoked from an immunocytochemically identified CD4CD8 murine thymocyte by 250 ms voltage-clamp steps from -80 mV to from -40 to 40 mV (20 mV steps). The cell was recorded using the nystatin method (Rs = 53 M; Cm = 2.74 pF). Each trace represents the average of currents from two consecutive voltage-clamp steps. Currents activated and inactivated in a time and voltage-dependent manner. Bottom, the peak current/voltage relationship for the total macroscopic currents shown above. Cell number 09089402.



Whole cell currents were pharmacologically characterized with several potassium channel-selective peptidyl toxins; outward currents were evoked by 250 or 500 ms depolarizing voltage steps from -80 to +50 mV before and after toxin addition. Previous reports have indicated that CD4CD8 thymocytes express Kv1.3 channels, which are completely blocked by CTX(6) , which blocks Kv1.2, Kv1.3 and Kv1.6 gene products(11, 13, 36) . We consistently observed a small, CTX-resistant (100 nM) current in fetal and adult cells, as shown in Fig. 2A. The CTX-insensitive current was 8.4 ± 2.7% (n = 6) of the original peak current in adult and 17.9 ± 3.8% (n = 6) in fetal cells. For adult CD4CD8 thymocytes, the peak CTX-resistant current was 60.4 ± 12.9 pA (n = 6), whereas for fetal cells the current was 36.3 ± 5.2 pA (n = 6). The CTX-resistant current was blocked by DTX (100 nM), an inhibitor of Kv1.1, Kv1.2, and Kv1.6 channels(11) . The only gene known to encode a CTX-insensitive, DTX-sensitive, voltage-gated K current similar to that observed in CD4CD8 thymocytes is Kv1.1. The CTX-resistant current is also completely blocked by 0.8 mM tetraethylammonium (data not shown). Consistent with the presence of a charybdotoxin-insensitive current other than Kv1.3, the initial application of DTX to double negative thymocytes blocked a small component of the peak current (74 ± 9.8 pA, n = 7, Fig. 2B); the DTX- resistant current was then blocked by CTX (50 nM, Fig. 2B). Results from a third subtype-specific toxin were also consistent with the presence of a Kv1.1 channel current. KTX, which is selective for Kv1.3 at the concentration used (10 nM, (13) ), did not block all K current in CD4CD8 thymocytes. As with experiments using CTX and DTX, a small KTX-resistant current was observed (data not shown). Moreover, similar to experiments with CTX, KTX completely blocked outward current in the presence of DTX (Fig. 3). The KTX-resistant current was 18.5 ± 2.5% for adult and 16.7 ± 2.0% for fetal thymocytes. For adult CD4CD8 thymocytes, the peak KTX-resistant current was 115.4 ± 14.1 pA (n = 5), whereas for fetal cells the current was 40.3 ± 3.8 pA (n = 9). Thus subtype-specific toxins demonstrate a DTX-sensitive and CTX/KTX-resistant current, consistent with the expression of Kv1.1 channels, as suggested by the expression of Kv1.1 mRNA (see below).


Figure 2: Pharmacological separation of potassium currents in CD4CD8 thymocytes. The sensitivity of voltage-dependent potassium currents to charybdotoxin and dendrotoxin was determined. K currents were elicited with 250 ms voltage-steps from a holding potential of -80 mV to +50 mV. A, each curve represents the average of two consecutive stimuli 30 s apart. Three superimposed responses represent stable currents obtained from the same cell (from largest to smallest current) in the absence of K blocker, in the presence of 50 nM CTX, and in the presence of 50 CTX and 100 DTX. These data are representative of six separate experiments, which demonstrate CTX-sensitive, and CTX-resistant and DTX-sensitive components of the whole cell K current. The experiment was conducted at 20-24 °C under standard conditions (see ``Materials and Methods''). The capacitance of this cell was 1.8 pF. The peak control current was 694 pA. The peak CTX-resistant K current was 98 pA, and no substantial current remained after subsequent addition of DTX. Cell number 09220401. B, an adult CD4CD8 thymocyte was subjected to voltage pulses from -80 mV holding potential to +50 mV. All parameters were as described for the thymocyte above. The capacitance of this thymocyte was 2.5 pF. The peak control K current was 543 pA. After the addition of DTX the peak current was 472 pA. In this experiment a small residual K current was observed after addition of 100 nM CTX. Cell number 08319404.




Figure 3: DTX and KTX block the entire whole cell K current of CD4CD8 thymocytes. A day 15 fetal CD4CD8 thymocyte was subjected to voltage pulses from -80 mV holding potential to +50 mV. All parameters were as described for the thymocyte in Fig. 2. The capacitance of this thymocyte was 2.8 pF. The peak control K current was 367 pA. A combination of 100 mM DTX and 10 nM KTX completely blocked the whole cell K current.



In addition to their unique pharmacologies, Kv1.1 and Kv1.3 are biophysically distinct in that Kv1.3 exhibits use-dependent inactivation, whereas Kv1.1 does not(13) . As shown in Fig. 4, repeated depolarizations at short intervals (4 Hz) resulted in the progressive inactivation of one current component, which was DTX-insensitive. Conversely, a non-cumulatively inactivating current component existed, which was blocked by DTX. Similar to results with application of CTX, KTX, or DTX, the inactivating current (presumably Kv1.3) was the predominant current component.


Figure 4: The DTX sensitive component of the whole cell K current does not exhibit use-dependent inactivation. An adult CD4CD8 thymocyte was subjected to a single control voltage pulse (leftpanels) or a train of voltage-step pulses (200 ms, 50-ms interval) from -80 mV to +50 mV to induce use-dependent inactivation of the K+ current (middle and righttraces). Control currents were evoked in the absence (topleft) and presence (bottomleft) of 100 nM DTX. The peak K current in the absence of blocker was 293 pA and in the presence of blocker was 260 pA. In the absence of DTX, a small use-independent K current (peak = 64 pA) was observed (topright). 100 nM DTX blocked most of this current (bottomright). The capacitance of this thymocyte was 2.06 pF.



Identification of mRNA for KV1.1 and KV1.3 in Day 15 Fetal Thymocytes

RNA-PCR was used to confirm the presence of mRNA in CD4CD8 thymocytes for K channels. Fetal thymocytes from day 15 gestation were used because they are almost exclusively CD4CD8. Using channel subtype-specific primers for Kv1.1 through Kv1.6, and for all members of the Kv2, Kv3, and Kv4 families, only PCR products of the appropriate size for Kv1.1 and Kv1.3 were obtained. Fig. 5is an autoradiograph of a Southern blot of PCR products generated from Kv1.3 (lane1) and Kv1.1 (lane3) mRNA. The identity of the amplified cDNA was confirmed by hybridization with radiolabeled internal oligonucleotides specific for each of these genes (see ``Materials and Methods''). Because these K channel genes are intronless (10) , we confirmed that these PCR products were not amplified from contaminating K channel genomic DNA in the RNA samples. These data indicate that no PCR products were obtained for Kv1.3 and Kv1.1 when PCR was performed on untranscribed fetal thymocyte RNA (lanes2 and 4, respectively). We were unable to detect mRNA for Kv1.2, Kv1.4, Kv1.5, Kv1.6, or the Kv2, Kv3 and Kv4 gene families in CD4CD8 thymocytes. Hence, fetal CD4CD8 thymocytes express Kv1.3 as previously shown, but also Kv1.1.


Figure 5: rtPCR confirms that Kv1.3 and Kv1.1 are expressed by day 15 fetal thymocytes. Total cellular RNA was isolated from day 15 fetal thymocytes, which comprise greater than 95% CD4CD8 thymocytes. The RNA was treated with DNase I to remove contaminating genomic DNA (see ``Materials and Methods''). A portion of the RNA was used to generate cDNA (+ lanes) and subjected to PCR with DNA primers specific to the 3` translated and non-translated regions of Kv1.3 (firstlane) and Kv1.1 (thirdlane). A portion of the day 15 derived total cellular RNA was treated identically as that subjected to cDNA synthesis except for the omission of reverse transcriptase (- lanes) and was subjected to PCR with the same DNA primers for Kv1.3 (secondlane) and Kv1.1 (fourthlane). Primary identification of the PCR-amplified products was made on the basis of their correct predicted sizes (Kv1.3, 550 base pairs; Kv1.1, 450 base pairs). Secondary confirmation was obtained by hybridization with P-labeled unique internal DNA primers (see ``Materials and Methods'').



Potassium Channel Blockers Inhibit Proliferation of Fetal Thymocytes

Cellular expansion is a dominant feature of thymocyte development between days 15 and 17 of gestation, and cell cycle activity may be requisite for subsequent development to the CD4CD8 phenotype(14) . To determine whether Kv1.1 and/or Kv1.3 play a critical role during development of thymocytes in situ, we characterized the effects of K channel blockers on thymocyte development in whole cultured day 15 fetal thymic explants. In situ blockade of Kv1.3 was achieved with CTX or KTX and of Kv1.1 with DTX. To minimize variability within individual experiments, at least two identically treated thymic lobes were pooled and used for yield determinations and phenotype analysis.

The most dramatic effect of the blockers was on total thymocyte yields. The cell yields from treated thymi were lower than in control thymi; however, the inhibitory effect of CTX on yield was consistently less than that of the other blockers (Table 1). Because cultured thymic explants do not receive additional thymocyte progenitors, an observed increase in the number of thymocytes within a lobe during culture must necessarily result from proliferative expansion of those thymocytes already in the thymus. Conversely, any decrease is indicative of either inhibition of proliferation or toxicity. Apparent thymocyte viability was unaffected by any of the blockers (>90% for all treatments). Moreover, neither CTX or DTX were directly toxic and the viability and CD4/CD8 phenotype of murine thymocytes incubated in suspension culture for 48 h with CTX (200 nM) or DTX (200 nM) was not different from control cultures (data not shown). Hence, the reduction in cell yield is probably due to inhibition of proliferation.



In addition to the effects of CTX and DTX on thymocyte yields, we observed an effect on the CD4/CD8 phenotype of thymocytes in FTOC. Treatment of FTOC with CTX, DTX, or both together caused an increase in the percentage of CD4CD8 and CD4CD8 immature thymocytes (TCR-negative), both precursors of CD4CD8 thymocytes(15) , and a decrease in the percentage of CD4CD8 thymocytes (Fig. 6). However, as noted previously (Table 1), we consistently observed CTX to have less effect than DTX on thymocyte yield. The reduction in cell yield induced by DTX or DTX and CTX is primarily a reflection of a reduction in the absolute number of CD4CD8 thymocytes (Table 2). Even though the effect of CTX alone on yield is less than DTX, its effect on phenotype is similar. Taken together, our observations that CTX and DTX are not directly toxic to thymocytes, that the number of CD4CD8 thymocytes is decreased, and that CD4CD8 thymocytes are derived from immature proliferating CD4CD8 and CD4CD8 precursor pools suggest that these drugs inhibit proliferation of thymocyte precursors and/or their progression to the CD4CD8 stage. That the combination of CTX and DTX induces a greater decrease in yield and the number of CD4CD8 thymocytes by day 2 than CTX or DTX alone suggests that they act synergistically.


Figure 6: K channel blockers inhibit fetal thymocyte development. Day 15 fetal thymic lobes were cultured as described in methods in the absence of blocker, or in the presence of 200 nM DTX, 200 nM CTX, or 200 nM DTX plus 200 nM CTX. Thymocytes isolated on day 2 of culture were stained for surface CD4 and CD8 and analyzed on a flow cytometer (Becton Dickinson). Plots are displayed with CD4 fluorescence on the ordinate and CD8 fluorescence on the abscissa, and the individual thymocyte subpopulations are enclosed within rectangular gates. The percentage of thymocytes within each gate is indicated in the outside corner. This is one of three similar experiments showing that the percentage of CD4CD8 and CD4CD8 thymocytes is increased by each of the blockers. However, each blocker also decreased thymocyte yields compared with untreated controls. For this experiment, the total number of thymocytes recovered per lobe was 384,300 for untreated thymi and 253,000, 325,905, and 225,600 for thymi treated with DTX, CTX, and DTX + CTX, respectively. These data are representative of at least six separate experiments with each blocker.






DISCUSSION

We have identified a K conductance not previously described in CD4CD8 thymocytes, which is encoded by the Kv1.1 gene. Patch-clamp studies demonstrated that the predominant channel in CD4CD8 thymocytes is Kv1.3, in agreement with previous findings in which the n current predominated(6, 7) . However, our studies also indicate that Kv1.1 channels make up an appreciable current component. Thus, a DTX-sensitive current component was approximately 10% of the peak current. Unlike the Kv1.3 channel current, the Kv1.1 channel current activated slowly and displayed little time- or use-dependent inactivation. The extent to which the distinct kinetic and inactivation properties of these channels determine the membrane potential and calcium signaling in CD4CD8 thymocytes is not known.

We have also identified a developmental role for thymocyte potassium channels. Blockers of each of the identified voltage-dependent conductances inhibit proliferation of thymocytes within the thymus, suggesting that voltage-dependent potassium channels contribute to the signals that control early developmental events of thymus cellularity. The decrease in the absolute number of thymocytes by K channel toxins is primarily due to a decrease in CD4CD8 thymocytes. Since at least one proliferative cycle appears to be necessary for maturation of DN thymocytes to the CD4CD8 stage(14) , by blocking cell cycle progression, K channel toxins may prevent maturation of some DN thymocytes to the CD4CD8 stage. The characteristics of DTX and CTX mediated effects on the thymus are different, suggesting that they interact with different targets. The action of DTX is probably mediated by Kv1.1, although at the concentration used in FTOC experiments, DTX would also block Kv1.3 by approximately 40%. Since stromal cells are critical to thymocyte development(34) , we cannot rule out the possibility that the effects of these blockers on thymocyte development are mediated by stromal cells within the thymus. However, the effects of DTX and CTX on thymocyte development that we observe are consistent with their interaction with K channels expressed by thymocytes. It should be noted that, whereas the electrophysiologic experiments indicate that CTX-sensitive Kv1.3 channels constitute the major current at strongly depolarized potentials, CTX, KTX, and DTX had similar effects on thymocyte yield (Table 1). This may indicate that the available current at strongly depolarized potentials may not accurately reflect activity at physiological membrane potentials, or that regulation of a particular K channel in vivo is more relevant to its physiological function.

Several physiological roles have been defined for potassium channels in lymphoid cells. Voltage-dependent potassium channels are critical determinants of the transmembrane electrical potential for both thymocytes and peripheral blood T lymphocytes(17, 18, 19, 20) . For peripheral T lymphocytes, production of the T cell requisite growth factor (IL2) and the proliferative response to stimulation critically depend upon the transmembrane potential defined by these potassium channels(4, 5, 21) . It is unlikely, however, that the inhibitory effect of potassium blockers on proliferation of CD4CD8 thymocytes is related to an effect upon IL2 production, since the production of IL2 is not critical for thymocyte development(22) . However, we have not determined whether any cytokines elaborated in the thymus would decrease the sensitivity of thymocytes to potassium channel blockers in situ. In addition to a role in setting or controlling the membrane potential, the plasma membrane K permeability is a critical component of the volume regulatory behavior of lymphocytes(1, 23, 24, 25, 26) . Although the cell volume of thymocytes changes during development, a physiological role for K channel-mediated volume regulation has not been demonstrated.

In conclusion, our data extend the observations of Lewis and Cahalan (6) and support the hypothesis that differential expression of potassium channel subtypes may play an important role in development (4) . This could occur by several mechanisms. For example, modulation of the lymphocyte K permeability exerts a substantial effect on membrane potential(1, 2) , receptor-mediated transmembrane flux of calcium(5, 19, 27, 28, 29, 30, 31, 32) , and cytokine production(4, 5, 21, 33) . Future efforts should be directed toward understanding why thymocytes have evolved such a complex K channel phenotype and whether this phenotype is critical to the functional requirements of other thymocyte subpopulations during later developmental events such as T cell repertoire selection.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Supported by National Institutes of Health Grant HD-01056. To whom correspondence should be addressed.

Supported by National Institutes of Health Grant A132748. Scholar of the Leukemia Society of America.

**
Supported by National Institutes of Health Grant AR-39910.

§§
Supported by National Institutes of Health Grant HL-41084.

(^1)
The abbreviations used are: IL2, interleukin 2; FTOC, fetal thymic organ culture; , ohm(s); F, farad(s); DN, double negative; CTX, charybdotoxin; DTX, dendrotoxin; KTX, kaliotoxin; TCR, T cell receptor; PCR, polymerase chain reaction.


ACKNOWLEDGEMENTS

We thank Dr. Richard Lewis for reading the manuscript and for helpful suggestions.


REFERENCES

  1. Grinstein, S. and Smith, J. D. (1990) J. Gen. Physiol. 95,97-120 [Abstract/Free Full Text]
  2. Leonard, R. J., Garcia, M. L., Slaughter, R. S., and Reuben, J. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,10094-10098 [Abstract/Free Full Text]
  3. Price, M., Lee, S. C., and Deutsch, C. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,10171-10175 [Abstract/Free Full Text]
  4. Freedman, B. D., Price, M., and Deutsch, C. (1992) J. Immunol. 149,3784-3794 [Abstract]
  5. Lin, C. S., Boltz, R. C., Blake, J. T., Nguyen, M., Talento, A., Fischer, P. A., Springer, M. S., Sigal, N. H., Slaughter, R. S., Garcia, M. L., Kaczorowski, G. J., and Koo, G. C. (1993) J. Exp. Med. 177,637-645 [Abstract/Free Full Text]
  6. Lewis, R. S., and Cahalan, M. D. (1988) Science 239,771-775 [Abstract/Free Full Text]
  7. McKinnon, D., and Ceredig, R. (1986) J. Exp. Med. 164,1846-1861 [Abstract/Free Full Text]
  8. Jenkinson, E. J., van Ewijk, W., and Owen, J. J. T. (1981) J. Exp. Med. 153,280-292 [Abstract/Free Full Text]
  9. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162,156-159 [Medline] [Order article via Infotrieve]
  10. Chandy, K. G., Williams, C. B., Spencer, R. H., Aguilar, B. A., Ghanshani, S., Tempel, B. L., and Gutman, G. A. (1990) Science. 247,973-975 [Abstract/Free Full Text]
  11. Swanson, R., Marshall, J., Smith, J. S., Williams, J. B., Boyle, M. B., Folander, K., Luneau, C. J., Antanavage, J., Oliva, C., and Buhrow, S. A. (1990) Neuron 4,929-939 [CrossRef][Medline] [Order article via Infotrieve]
  12. Oleson, D. R., DeFelice, L. J., and Donahoe, R. M. (1993) J. Membr. Biol. 132,229-241 [Medline] [Order article via Infotrieve]
  13. Grissmer, S., Nguyen, A. N., Aiyar, J., Hanson, D. C., Mather, R. J., Gutman, G. A., Karmilowicz, M. J., Auperin, D. D., and Chandy, K. G. (1995) Mol. Pharmacol. 45,1227-1234 [Abstract]
  14. Takahama, Y., Letterio, J. J., Suzuki, H., Farr, A. G., and Singer, A. (1994) J. Exp. Med. 179,1495-1506 [Abstract/Free Full Text]
  15. Guidos, C. J., Weissman, I. L., and Adkins, B. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,7542-7546 [Abstract/Free Full Text]
  16. Takahama, Y., Kosugi, A., and Singer, A. (1991) J. Immunol. 146,1134-1141 [Abstract]
  17. Deutsch, C., Holian, A., Holian, S. K., Daniele, R. P., and Wilson, D. F. (1979) J. Cell. Physiol. 99,79-93 [CrossRef][Medline] [Order article via Infotrieve]
  18. Rink, T. J., Montecucco, C., Hesketh, T. R., and Tsien, R. Y. (1980) Biochim. Biophys. Acta 595,15-30 [Medline] [Order article via Infotrieve]
  19. Gelfand, E. W., Cheung, R. K., and Grinstein, S. (1984) J. Cell. Physiol. 121,533-539 [CrossRef][Medline] [Order article via Infotrieve]
  20. Grinstein, S., and Smith, J. D. (1989) Am. J. Physiol. 257,C197-C206
  21. Negulescu, P. A., Shastri, N., and Cahalan, M. D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,2873-2877 [Abstract/Free Full Text]
  22. Schorle, H., Holtschke, T., Hunig, T., Schimpl, A., and Horak, I. (1991) Nature 352,621-624 [CrossRef][Medline] [Order article via Infotrieve]
  23. Lee, S. C., Price, M., Prystowsky, M. B., and Deutsch, C. (1988) Am. J. Physiol. 254,C286-C296
  24. Deutsch, C., and Chen, L. Q. (1994) Proc. Natl. Acad. Sci. U. S. A. 90,10036-10040 [Abstract/Free Full Text]
  25. Grinstein, S., Rothstein, A., Sakardi, B., and Gelfand, E. W. (1984) Am. J. Physiol. 246,C204-C215
  26. Grinstein, S., and Foskett, J. K. (1990) Annu. Rev. Physiol. 52,399-414 [CrossRef][Medline] [Order article via Infotrieve]
  27. Gelfand., E. W., Cheung, R. K., Mills, G. B., and Grinstein, S. (1987) J. Immunol. 138,527-531 [Abstract]
  28. Lewis, R. S., and Cahalan, M. D. (1989) Cell Regul. 1,99-112 [Medline] [Order article via Infotrieve]
  29. Hess, S. D., Oortgiesen, M., and Cahalan, M. D. (1993) J. Immunol. 150,2620-2633 [Abstract]
  30. Dolmetsch, R., and Lewis, R. S. (1994) J. Gen. Physiol. 103,365-388 [Abstract/Free Full Text]
  31. Oettgen, H. C., Terhorst, C., Cantley, L. C., and Rosoff, P. M. (1985) Cell 40,583-590 [CrossRef][Medline] [Order article via Infotrieve]
  32. Gray, L. S., Gnarra, J. R., Russell, J. H., and Engelhard, V. H. (1987) Cell 50,119-127 [CrossRef][Medline] [Order article via Infotrieve]
  33. Mills, G. B., Cheung, R. K., Grinstein, S., and Gelfand, E. W. (1985) J. Immunol. 134,1640-1643 [Abstract]
  34. Van Ewijk, W., Shores, E. W., and Singer, A. (1994) Immunol. Today 15,214-217 [CrossRef][Medline] [Order article via Infotrieve]
  35. Yokoyama, S., Imoto, K., Kawamura, T., Higashida, H., Iwabe, N., Miyata, T., and Numa, S. (1989) FEBS Lett. 259,37-42 [CrossRef][Medline] [Order article via Infotrieve]
  36. Garcia, M. L., Garcia-Calvo, M., Hidalgo, P., Lee, A., and MacKinnon, R. (1994) Biochemistry 33,6834-6839 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Exp. Biol. Med.Home page
L. E. Pereira, F. Villinger, H. Wulff, A. Sankaranarayanan, G. Raman, and A. A. Ansari
Pharmacokinetics, Toxicity, and Functional Studies of the Selective Kv1.3 Channel Blocker 5-(4-Phenoxybutoxy)Psoralen in Rhesus Macaques
Experimental Biology and Medicine, November 1, 2007; 232(10): 1338 - 1354.
[Abstract] [Full Text] [PDF]


Home page
NeuroscientistHome page
C. Beeton and K. G. Chandy
Potassium Channels, Memory T Cells, and Multiple Sclerosis
Neuroscientist, December 1, 2005; 11(6): 550 - 562.
[Abstract] [PDF]


Home page
J. Biol. Chem.Home page
R. Vicente, A. Escalada, M. Coma, G. Fuster, E. Sanchez-Tillo, C. Lopez-Iglesias, C. Soler, C. Solsona, A. Celada, and A. Felipe
Differential Voltage-dependent K+ Channel Responses during Proliferation and Activation in Macrophages
J. Biol. Chem., November 21, 2003; 278(47): 46307 - 46320.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. A. Koni, R. Khanna, M. C. Chang, M. D. Tang, L. K. Kaczmarek, L. C. Schlichter, and R. A. Flavell
Compensatory Anion Currents in Kv1.3 Channel-deficient Thymocytes
J. Biol. Chem., October 10, 2003; 278(41): 39443 - 39451.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
Q.-H. Liu, B. K. Fleischmann, B. Hondowicz, C. C. Maier, L. A. Turka, K. Yui, M. I. Kotlikoff, A. D. Wells, and B. D. Freedman
Modulation of Kv Channel Expression and Function by TCR and Costimulatory Signals during Peripheral CD4+ Lymphocyte Differentiation
J. Exp. Med., October 7, 2002; 196(7): 897 - 909.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
X. Guo, J. N. Rao, L. Liu, M. Rizvi, D. J. Turner, and J.-Y. Wang
Polyamines regulate beta -catenin tyrosine phosphorylation via Ca2+ during intestinal epithelial cell migration
Am J Physiol Cell Physiol, September 1, 2002; 283(3): C722 - C734.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. N. Rao, L. Li, V. A. Golovina, O. Platoshyn, E. D. Strauch, J. X.-J. Yuan, and J.-Y. Wang
Ca2+-RhoA signaling pathway required for polyamine-dependent intestinal epithelial cell migration
Am J Physiol Cell Physiol, April 1, 2001; 280(4): C993 - C1007.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J.-Y. Wang, J. Wang, V. A. Golovina, L. Li, O. Platoshyn, and J. X.-J. Yuan
Role of K+ channel expression in polyamine-dependent intestinal epithelial cell migration
Am J Physiol Cell Physiol, February 1, 2000; 278(2): C303 - C314.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
L. Wang, B. Xu, R. E. White, and L. Lu
Growth factor-mediated K+ channel activity associated with human myeloblastic ML-1 cell proliferation
Am J Physiol Cell Physiol, November 1, 1997; 273(5): C1657 - C1665.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
J. N. Rao, O. Platoshyn, L. Li, X. Guo, V. A. Golovina, J. X.-J. Yuan, and J.-Y. Wang
Activation of K+ channels and increased migration of differentiated intestinal epithelial cells after wounding
Am J Physiol Cell Physiol, April 1, 2002; 282(4): C885 - C898.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Freedman, B. D.
Right arrow Articles by Kotlikoff, M. I.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Freedman, B. D.
Right arrow Articles by Kotlikoff, M. I.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement