|
Volume 270,
Number 38,
Issue of September 22, pp. 22406-22411, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification of
Kv1.1 Expression by Murine CD4 CD8 Thymocytes
A ROLE FOR VOLTAGE-DEPENDENT K CHANNELS IN MURINE
THYMOCYTE DEVELOPMENT (*)
(Received for publication, April 17, 1995; and in revised form, June 20, 1995)
Bruce D.
Freedman(§)
(1),
Bernd K.
Fleischmann
(2),
Jennifer A.
Punt
(3),
Glen
Gaulton
(1), (¶),
Yasuhiro
Hashimoto
(4), (**),
Michael I.
Kotlikoff
(2)(§§)From the
(1)Department of Pathology and Laboratory
Medicine, University of Pennsylvania School of Medicine, Philadelphia,
Pennsylvania 19104, the
(2)Department of Animal Biology, University of
Pennsylvania School of Veterinary Medicine, Philadelphia, Pennsylvania
19104, the
(3)Experimental Immunology Branch, NCI, National
Institutes of Health, Bethesda, Maryland 20892, and
(4)Syntex Institute of Immunology, Nihari, Ibaraki
300-41, Japan
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The patch-clamp recording technique and RNApolymerase chain
reaction were used to identify the voltage-dependent K channels expressed by murine fetal and adult
CD4 CD8 thymocytes. Two distinct
currents, encoded by the genes Kv1.1 and Kv1.3 were identified based
upon their biophysical and pharmacologic characteristics and confirmed
with RNA-polymerase chain reaction. Peptide blockers of Kv1.1 and Kv1.3
gene products were also applied to a murine fetal thymic organ culture
system to investigate the developmental role of these K channels. Dendrotoxin (DTX) and charybdotoxin (CTX), antagonists
of Kv1.1 and Kv1.3 channels, respectively, decreased thymocyte yields
in organ culture without affecting thymocyte viability. DTX-treated
thymi contained 56 ± 8% (n = 8 experiments), and
CTX-treated thymi contained 74 ± 4% (n = 7
experiments) as many thymocytes as untreated lobes. DTX and CTX also
altered the developmental progression of thymocytes in fetal organ
culture. These data provide the first evidence of Kv1.1 expression in a
lymphoid cell and indicate that thymocyte voltage-dependent
K channels are critical to thymocyte preclonal
expansion and/or maturation.
INTRODUCTION
Membrane potassium channels subserve important physiologic
functions of thymocytes and peripheral T lymphocytes. Although
lymphocytes are not electrically excitable cells, they express
potassium channels that are the primary determinants of the membrane
potential(1, 2) , and are critically important for
production of the requisite T cell growth factor
IL2( )(3, 4, 5) . Three
voltage-dependent potassium channels have been described in murine
thymic lymphocytes(6, 7) . These currents were
originally distinguished on the basis of their unique pharmacology and
kinetic behavior(6) . The most prevalent, n-type (Kv1.3 gene
product; (10) ), is expressed by immature
CD4 CD8 and
CD4 CD8 , and by mature
CD4 CD8 and
CD4 CD8 thymocytes. Two additional
voltage-gated K channels, the l-type (Kv3.1, 35) and
the n`-type currents (gene unknown), have been found in mature
CD4 CD8 thymocytes only(6) . Although the physiologic role of voltage-gated potassium channels
during normal thymocyte development (and preclonal expansion) has not
been characterized, the selective expression of specific K channel subtypes by thymocyte subpopulations suggests that these
channels may play a critical role in thymocyte development. We have
used the fetal thymic organ culture (FTOC) system to study thymic
development and have employed molecular biological and patch-clamp
recording techniques to determine the expression of thymocyte
K channels in CD4 CD8 thymocytes. We report the expression of Kv1.1 channels in
CD4 CD8 thymocytes; these channels
have not previously been reported in any lymphoid cell type. Both Kv1.1
and Kv1.3 channels are expressed by
CD4 CD8 thymocytes, and each of
these conductances appears to play a role in early thymocyte
development, specifically thymocyte proliferation.
MATERIALS AND METHODS
Cell IsolationVirus-free C57Bl/6 mice were
obtained from Jackson Laboratories or the National Cancer Institute and
were bred in the animal facility at the University of Pennsylvania.
Thymic lobes were removed from fetal mice at desired gestational ages
and were placed into RPMI medium containing 10% heat-inactivated fetal
bovine serum, 50 mM 2-mercaptoethanol, 10 mM HEPES
buffer, pH 7.4, 1 mML-glutamine, and 100 IU/ml
penicillin and streptomycin. Thymocytes were isolated by teasing apart
the lobes with sterile keratotomy knives.
Fetal Thymic Organ CultureFTOC (8) was
established in 24-well plates at 37 °C in a
5%CO /95%O environment. Surgical gel foam
(1-cm ; Upjohn) was soaked in complete RPMI medium to which
K blockers or additional reagents were added. Fetal
lobes were placed onto sterile circular nitrocellulose filters
(Millipore), which were supported by the gel foam. The fetal lobes
(3/filter) were maintained at the air/medium interface and were bathed
with medium daily. One half of the culture medium was changed on
alternate days.
Thymocyte Phenotype Determination2-5
10 cells were incubated with saturating
concentrations of appropriate antibodies in 0.05 ml of staining medium
(phosphate-buffered saline, 0.5% bovine serum albumin) for 15 min at 4
°C. Staining was performed as a one-step procedure with
phycoerythrin-conjugated L3T4 (anti-CD4, Pharmingen, San Diego, CA) and
fluorescein-conjugated anti Ly-2 (anti-CD8 , Pharmingen). Flow
cytometry was performed on a FACSscan instrument (Becton Dickinson, San
Jose, CA).
Electrophysiologic RecordingMurine fetal or adult
DN thymocytes stained with fluorescein (CD8)- or phycoerythrin
(CD4)-tagged monoclonal antibodies (see above) were placed in a
recording chamber (Brooks) mounted on an inverted fluorescent
microscope (Diaphot, Nikon) and CD4 CD8 (non-staining) cells were patched. Patch pipettes (4-6
M ) were back-filled with solution containing 150 µg/ml
nystatin (Sigma). Command potentials were generated and currents
acquired, stored, and analyzed on a Macintosh computer using an EPC-9
amplifier and associated software (Heka, Lambrecht, Germany). Liquid
junction potentials, capacitance, and series resistance were
compensated using the internal circuit of the EPC-9. Data were sampled
at 10 kHz, filtered at 1 kHz, and recorded on computer disk. Following
formation of gigaohm seals (5-30 G ), cells were lifted off
the chamber bottom and held at -80 mV; voltage clamp measurements
were initiated when the access resistance (R ) was
less than 50 M ( 5-10 min after seal formation). Unless
stated otherwise, macroscopic K currents were elicited
with step depolarizations to +50 mV and currents reported as peak
whole cell currents. Current density was calculated by dividing the
peak whole cell current by the cell capacitance, with the assumption
that 1 µm = 1 pF. Drugs were applied by direct
addition to the bath. The bath solution contained (in mM) 160
NaCl, 4.5 KCl, 2 MgCl , 1 CaCl , 5 Na-HEPES, and
5 glucose (pH 7.4). The pipette solution contained 134 KF, 11
K EGTA, 1.1 CaCl , 2 MgCl , and 10
K-Hepes (pH 7.2). Synthetic charybdotoxin (CTX) and kaliotoxin (KTX)
were obtained from Peptides International (Louisville, KY), and
dendrotoxin (DTX) from Calbiochem (San Diego, CA).
RNA Preparation and Reverse Transcriptase
PCRTotal cellular RNA was prepared according to the method of
Chomczinski and Saachi(9) . Contaminating genomic DNA was
removed from RNA preparations by treating them with DNase I (Boerhinger
Mannheim) before cDNA synthesis. The polymerase chain reaction was used
to amplify cDNA prepared from murine thymocyte RNA. Unique
oligonucleotide primer pairs were designed to 3` regions of the
K channel genes as follows: Kv1.1 (sense, cDNA clone
MK3, bases 979-1007, ATCTTCAAACTCTCCCGCCACTCCAAGGG; antisense, bases
1495-1476 of cDNA clone MK1, TTGCTTTTTAAACATCGCT; probe, bases
1292-1321 of MK1, CTTAGCCTCTGACAGTGACC ((10) )), Kv1.3
(sense, as above; antisense, bases 1558-1541 of cDNA clone KV3,
ACTTCAACTACTTCTACCACCG; probe, bases 1315-1336 of cDNA clone KV3,
TTGGGGTTATTGTTCGTG ((11) )). PCR products were separated by
electrophoresis in a 2% agarose gel (Life Technologies, Inc.) and
capillary blotted onto GeneScreen Plus nylon membrane (DuPont NEN) with
0.5 M NaOH and 1.5 M NaCl. Oligonucleotide probes
were 5`-end-labeled with [ - P]ATP using T4
polynucleotide kinase (Life Technologies, Inc.).
RESULTS
Pharmacological Characterization of Potassium Currents in
CD4 CD8 Thymocytes-To identify the voltage-dependent
K channels expressed by
CD4 CD8 (double negative, DN)
thymocytes, we employed K channel-selective peptide
blockers with the nystatin variation of the whole cell patch-clamp
technique. Immunocytochemically defined fetal (day 15 or 16) or adult
murine thymocytes were voltage-clamped and K currents
evoked by step depolarizations. Experiments were performed on both
fetal DN thymocytes, which are predominately TCR-negative, and adult DN
cells, which are both  TCR-positive and
-negative(16) . Current amplitudes were stable in these cells
for more than 45 min; the rate of current inactivation did accelerate
somewhat over time, however, and was dependent on the series resistance (R ) as previously reported(12) . Fig. 1shows a typical family of whole cell currents from an
adult CD4 CD8 thymocyte evoked by
step depolarizations to potentials between -40 and +40 mV
(20 mV steps). Potassium currents activated at approximately -40
mV and showed typical time-dependent activation and inactivation
characteristics, similar to previous recordings from
CD4 CD8 cells(6, 7) . Current inactivation was
incomplete, however, and a small non-inactivating current component was
a consistent feature of the currents in these cells. Total currents
found in fetal and adult murine CD4 CD8 thymocytes were comparable, but there was a substantially greater
current density in the adult cells. The current density was 262
± 25.2 µA/cm in adult (n = 29)
and 95.4 ± 8.5 µA/cm in fetal cells (n = 30) for a voltage step from -80 to +50 mV.
Figure 1:
Voltage-dependent potassium currents in
CD4 CD8 thymocytes. Top,
currents evoked from an immunocytochemically identified
CD4 CD8 murine thymocyte by 250 ms
voltage-clamp steps from -80 mV to from -40 to 40 mV (20 mV
steps). The cell was recorded using the nystatin method (Rs = 53
M ; Cm = 2.74 pF). Each trace represents the average of
currents from two consecutive voltage-clamp steps. Currents activated
and inactivated in a time and voltage-dependent manner. Bottom, the peak current/voltage relationship for the total
macroscopic currents shown above. Cell number
09089402.
Whole cell currents were pharmacologically characterized with
several potassium channel-selective peptidyl toxins; outward currents
were evoked by 250 or 500 ms depolarizing voltage steps from -80
to +50 mV before and after toxin addition. Previous reports have
indicated that CD4 CD8 thymocytes
express Kv1.3 channels, which are completely blocked by
CTX(6) , which blocks Kv1.2, Kv1.3 and Kv1.6 gene
products(11, 13, 36) . We consistently
observed a small, CTX-resistant (100 nM) current in fetal and
adult cells, as shown in Fig. 2A. The CTX-insensitive
current was 8.4 ± 2.7% (n = 6) of the original
peak current in adult and 17.9 ± 3.8% (n = 6) in
fetal cells. For adult CD4 CD8 thymocytes, the peak CTX-resistant current was 60.4 ± 12.9
pA (n = 6), whereas for fetal cells the current was
36.3 ± 5.2 pA (n = 6). The CTX-resistant current
was blocked by DTX (100 nM), an inhibitor of Kv1.1, Kv1.2, and
Kv1.6 channels(11) . The only gene known to encode a
CTX-insensitive, DTX-sensitive, voltage-gated K current similar to that observed in
CD4 CD8 thymocytes is Kv1.1. The
CTX-resistant current is also completely blocked by 0.8 mM tetraethylammonium (data not shown). Consistent with the presence
of a charybdotoxin-insensitive current other than Kv1.3, the initial
application of DTX to double negative thymocytes blocked a small
component of the peak current (74 ± 9.8 pA, n =
7, Fig. 2B); the DTX- resistant current was then
blocked by CTX (50 nM, Fig. 2B). Results from
a third subtype-specific toxin were also consistent with the presence
of a Kv1.1 channel current. KTX, which is selective for Kv1.3 at the
concentration used (10 nM, (13) ), did not block all
K current in CD4 CD8 thymocytes. As with experiments using CTX and DTX, a small
KTX-resistant current was observed (data not shown). Moreover, similar
to experiments with CTX, KTX completely blocked outward current in the
presence of DTX (Fig. 3). The KTX-resistant current was 18.5
± 2.5% for adult and 16.7 ± 2.0% for fetal thymocytes.
For adult CD4 CD8 thymocytes, the
peak KTX-resistant current was 115.4 ± 14.1 pA (n = 5), whereas for fetal cells the current was 40.3 ±
3.8 pA (n = 9). Thus subtype-specific toxins
demonstrate a DTX-sensitive and CTX/KTX-resistant current, consistent
with the expression of Kv1.1 channels, as suggested by the expression
of Kv1.1 mRNA (see below).
Figure 2:
Pharmacological separation of potassium
currents in CD4 CD8 thymocytes. The
sensitivity of voltage-dependent potassium currents to charybdotoxin
and dendrotoxin was determined. K currents were
elicited with 250 ms voltage-steps from a holding potential of
-80 mV to +50 mV. A, each curve represents the
average of two consecutive stimuli 30 s apart. Three superimposed
responses represent stable currents obtained from the same cell (from
largest to smallest current) in the absence of K blocker, in the presence of 50 nM CTX, and in the
presence of 50 CTX and 100 DTX. These data are representative of six
separate experiments, which demonstrate CTX-sensitive, and
CTX-resistant and DTX-sensitive components of the whole cell
K current. The experiment was conducted at 20-24
°C under standard conditions (see ``Materials and
Methods''). The capacitance of this cell was 1.8 pF. The peak
control current was 694 pA. The peak CTX-resistant K current was 98 pA, and no substantial current remained after
subsequent addition of DTX. Cell number 09220401. B, an adult
CD4 CD8 thymocyte was subjected to
voltage pulses from -80 mV holding potential to +50 mV. All
parameters were as described for the thymocyte above. The capacitance
of this thymocyte was 2.5 pF. The peak control K current was 543 pA. After the addition of DTX the peak current
was 472 pA. In this experiment a small residual K current was observed after addition of 100 nM CTX. Cell
number 08319404.
Figure 3:
DTX and KTX block the entire whole cell
K current of CD4 CD8 thymocytes. A day 15 fetal CD4 CD8 thymocyte was subjected to voltage pulses from -80 mV
holding potential to +50 mV. All parameters were as described for
the thymocyte in Fig. 2. The capacitance of this thymocyte was
2.8 pF. The peak control K current was 367 pA. A
combination of 100 mM DTX and 10 nM KTX completely
blocked the whole cell K current.
In addition to their unique
pharmacologies, Kv1.1 and Kv1.3 are biophysically distinct in that
Kv1.3 exhibits use-dependent inactivation, whereas Kv1.1 does
not(13) . As shown in Fig. 4, repeated depolarizations
at short intervals (4 Hz) resulted in the progressive inactivation of
one current component, which was DTX-insensitive. Conversely, a
non-cumulatively inactivating current component existed, which was
blocked by DTX. Similar to results with application of CTX, KTX, or
DTX, the inactivating current (presumably Kv1.3) was the predominant
current component.
Figure 4:
The DTX sensitive component of the whole
cell K current does not exhibit use-dependent
inactivation. An adult CD4 CD8 thymocyte was subjected to a single control voltage pulse (leftpanels) or a train of voltage-step pulses (200
ms, 50-ms interval) from -80 mV to +50 mV to induce
use-dependent inactivation of the K+ current (middle and righttraces). Control currents were evoked in the
absence (topleft) and presence (bottomleft) of 100 nM DTX. The peak K current in the absence of blocker was 293 pA and in the presence
of blocker was 260 pA. In the absence of DTX, a small use-independent
K current (peak = 64 pA) was observed (topright). 100 nM DTX blocked most of this current (bottomright). The capacitance of this thymocyte was
2.06 pF.
Identification of mRNA for KV1.1 and KV1.3 in Day 15 Fetal
ThymocytesRNA-PCR was used to confirm the presence of mRNA in
CD4 CD8 thymocytes for K channels. Fetal thymocytes from day 15 gestation were used
because they are almost exclusively
CD4 CD8 . Using channel
subtype-specific primers for Kv1.1 through Kv1.6, and for all members
of the Kv2, Kv3, and Kv4 families, only PCR products of the appropriate
size for Kv1.1 and Kv1.3 were obtained. Fig. 5is an
autoradiograph of a Southern blot of PCR products generated from Kv1.3 (lane1) and Kv1.1 (lane3) mRNA.
The identity of the amplified cDNA was confirmed by hybridization with
radiolabeled internal oligonucleotides specific for each of these genes
(see ``Materials and Methods''). Because these K channel genes are intronless (10) , we confirmed that
these PCR products were not amplified from contaminating K channel genomic DNA in the RNA samples. These data indicate that
no PCR products were obtained for Kv1.3 and Kv1.1 when PCR was
performed on untranscribed fetal thymocyte RNA (lanes2 and 4, respectively). We were unable to detect mRNA for
Kv1.2, Kv1.4, Kv1.5, Kv1.6, or the Kv2, Kv3 and Kv4 gene families in
CD4 CD8 thymocytes. Hence, fetal
CD4 CD8 thymocytes express Kv1.3 as
previously shown, but also Kv1.1.
Figure 5:
rtPCR confirms that Kv1.3 and Kv1.1 are
expressed by day 15 fetal thymocytes. Total cellular RNA was isolated
from day 15 fetal thymocytes, which comprise greater than 95%
CD4 CD8 thymocytes. The RNA was
treated with DNase I to remove contaminating genomic DNA (see
``Materials and Methods''). A portion of the RNA was used to
generate cDNA (+ lanes) and subjected to PCR with DNA primers
specific to the 3` translated and non-translated regions of Kv1.3 (firstlane) and Kv1.1 (thirdlane). A portion of the day 15 derived total cellular RNA
was treated identically as that subjected to cDNA synthesis except for
the omission of reverse transcriptase (- lanes) and was subjected
to PCR with the same DNA primers for Kv1.3 (secondlane) and Kv1.1 (fourthlane). Primary
identification of the PCR-amplified products was made on the basis of
their correct predicted sizes (Kv1.3, 550 base pairs; Kv1.1, 450 base
pairs). Secondary confirmation was obtained by hybridization with P-labeled unique internal DNA primers (see
``Materials and Methods'').
Potassium Channel Blockers Inhibit Proliferation of Fetal
ThymocytesCellular expansion is a dominant feature of thymocyte
development between days 15 and 17 of gestation, and cell cycle
activity may be requisite for subsequent development to the
CD4 CD8 phenotype(14) . To
determine whether Kv1.1 and/or Kv1.3 play a critical role during
development of thymocytes in situ, we characterized the
effects of K channel blockers on thymocyte development
in whole cultured day 15 fetal thymic explants. In situ blockade of Kv1.3 was achieved with CTX or KTX and of Kv1.1 with
DTX. To minimize variability within individual experiments, at least
two identically treated thymic lobes were pooled and used for yield
determinations and phenotype analysis.The most dramatic effect of
the blockers was on total thymocyte yields. The cell yields from
treated thymi were lower than in control thymi; however, the inhibitory
effect of CTX on yield was consistently less than that of the other
blockers (Table 1). Because cultured thymic explants do not
receive additional thymocyte progenitors, an observed increase in the
number of thymocytes within a lobe during culture must necessarily
result from proliferative expansion of those thymocytes already in the
thymus. Conversely, any decrease is indicative of either inhibition of
proliferation or toxicity. Apparent thymocyte viability was unaffected
by any of the blockers (>90% for all treatments). Moreover, neither
CTX or DTX were directly toxic and the viability and CD4/CD8 phenotype
of murine thymocytes incubated in suspension culture for 48 h with CTX
(200 nM) or DTX (200 nM) was not different from
control cultures (data not shown). Hence, the reduction in cell yield
is probably due to inhibition of proliferation.
In addition to the
effects of CTX and DTX on thymocyte yields, we observed an effect on
the CD4/CD8 phenotype of thymocytes in FTOC. Treatment of FTOC with
CTX, DTX, or both together caused an increase in the percentage of
CD4 CD8 and
CD4 CD8 immature thymocytes
(TCR-negative), both precursors of CD4 CD8 thymocytes(15) , and a decrease in the percentage of
CD4 CD8 thymocytes (Fig. 6).
However, as noted previously (Table 1), we consistently observed
CTX to have less effect than DTX on thymocyte yield. The reduction in
cell yield induced by DTX or DTX and CTX is primarily a reflection of a
reduction in the absolute number of CD4 CD8 thymocytes (Table 2). Even though the effect of CTX alone
on yield is less than DTX, its effect on phenotype is similar. Taken
together, our observations that CTX and DTX are not directly toxic to
thymocytes, that the number of CD4 CD8 thymocytes is decreased, and that
CD4 CD8 thymocytes are derived from
immature proliferating CD4 CD8 and
CD4 CD8 precursor pools suggest that
these drugs inhibit proliferation of thymocyte precursors and/or their
progression to the CD4 CD8 stage. That
the combination of CTX and DTX induces a greater decrease in yield and
the number of CD4 CD8 thymocytes by
day 2 than CTX or DTX alone suggests that they act synergistically.
Figure 6:
K channel blockers
inhibit fetal thymocyte development. Day 15 fetal thymic lobes were
cultured as described in methods in the absence of blocker, or in the
presence of 200 nM DTX, 200 nM CTX, or 200 nM DTX plus 200 nM CTX. Thymocytes isolated on day 2 of
culture were stained for surface CD4 and CD8 and analyzed on a flow
cytometer (Becton Dickinson). Plots are displayed with CD4 fluorescence
on the ordinate and CD8 fluorescence on the abscissa,
and the individual thymocyte subpopulations are enclosed within
rectangular gates. The percentage of thymocytes within each gate is
indicated in the outside corner. This is one of three similar
experiments showing that the percentage of
CD4 CD8 and
CD4 CD8 thymocytes is increased by
each of the blockers. However, each blocker also decreased thymocyte
yields compared with untreated controls. For this experiment, the total
number of thymocytes recovered per lobe was 384,300 for untreated thymi
and 253,000, 325,905, and 225,600 for thymi treated with DTX, CTX, and
DTX + CTX, respectively. These data are representative of at least
six separate experiments with each blocker.
DISCUSSION
We have identified a K conductance not
previously described in CD4 CD8 thymocytes, which is encoded by the Kv1.1 gene. Patch-clamp
studies demonstrated that the predominant channel in
CD4 CD8 thymocytes is Kv1.3, in
agreement with previous findings in which the n current
predominated(6, 7) . However, our studies also
indicate that Kv1.1 channels make up an appreciable current component.
Thus, a DTX-sensitive current component was approximately 10% of the
peak current. Unlike the Kv1.3 channel current, the Kv1.1 channel
current activated slowly and displayed little time- or use-dependent
inactivation. The extent to which the distinct kinetic and inactivation
properties of these channels determine the membrane potential and
calcium signaling in CD4 CD8 thymocytes is not known. We have also identified a
developmental role for thymocyte potassium channels. Blockers of each
of the identified voltage-dependent conductances inhibit proliferation
of thymocytes within the thymus, suggesting that voltage-dependent
potassium channels contribute to the signals that control early
developmental events of thymus cellularity. The decrease in the
absolute number of thymocytes by K channel toxins is
primarily due to a decrease in CD4 CD8 thymocytes. Since at least one proliferative cycle appears to be
necessary for maturation of DN thymocytes to the
CD4 CD8 stage(14) , by
blocking cell cycle progression, K channel toxins may
prevent maturation of some DN thymocytes to the
CD4 CD8 stage. The characteristics of
DTX and CTX mediated effects on the thymus are different, suggesting
that they interact with different targets. The action of DTX is
probably mediated by Kv1.1, although at the concentration used in FTOC
experiments, DTX would also block Kv1.3 by approximately 40%. Since
stromal cells are critical to thymocyte development(34) , we
cannot rule out the possibility that the effects of these blockers on
thymocyte development are mediated by stromal cells within the thymus.
However, the effects of DTX and CTX on thymocyte development that we
observe are consistent with their interaction with K channels expressed by thymocytes. It should be noted that,
whereas the electrophysiologic experiments indicate that CTX-sensitive
Kv1.3 channels constitute the major current at strongly depolarized
potentials, CTX, KTX, and DTX had similar effects on thymocyte yield (Table 1). This may indicate that the available current at
strongly depolarized potentials may not accurately reflect activity at
physiological membrane potentials, or that regulation of a particular
K channel in vivo is more relevant to its
physiological function. Several physiological roles have been
defined for potassium channels in lymphoid cells. Voltage-dependent
potassium channels are critical determinants of the transmembrane
electrical potential for both thymocytes and peripheral blood T
lymphocytes(17, 18, 19, 20) . For
peripheral T lymphocytes, production of the T cell requisite growth
factor (IL2) and the proliferative response to stimulation critically
depend upon the transmembrane potential defined by these potassium
channels(4, 5, 21) . It is unlikely, however,
that the inhibitory effect of potassium blockers on proliferation of
CD4 CD8 thymocytes is related to an
effect upon IL2 production, since the production of IL2 is not critical
for thymocyte development(22) . However, we have not determined
whether any cytokines elaborated in the thymus would decrease the
sensitivity of thymocytes to potassium channel blockers in
situ. In addition to a role in setting or controlling the membrane
potential, the plasma membrane K permeability is a
critical component of the volume regulatory behavior of
lymphocytes(1, 23, 24, 25, 26) .
Although the cell volume of thymocytes changes during development, a
physiological role for K channel-mediated volume
regulation has not been demonstrated. In conclusion, our data extend
the observations of Lewis and Cahalan (6) and support the
hypothesis that differential expression of potassium channel subtypes
may play an important role in development (4) . This could
occur by several mechanisms. For example, modulation of the lymphocyte
K permeability exerts a substantial effect on membrane
potential(1, 2) , receptor-mediated transmembrane flux
of
calcium(5, 19, 27, 28, 29, 30, 31, 32) ,
and cytokine
production(4, 5, 21, 33) . Future
efforts should be directed toward understanding why thymocytes have
evolved such a complex K channel phenotype and whether
this phenotype is critical to the functional requirements of other
thymocyte subpopulations during later developmental events such as T
cell repertoire selection.
FOOTNOTES
- *
- The costs of
publication of this article were defrayed in part by the payment of
page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- Supported by National Institutes of Health
Grant HD-01056. To whom correspondence should be addressed.
- ¶
- Supported by National Institutes of Health
Grant A132748. Scholar of the Leukemia Society of America.
- **
- Supported by National Institutes of Health
Grant AR-39910.
- §§
- Supported by National
Institutes of Health Grant HL-41084.
- (
) - The
abbreviations used are: IL2, interleukin 2; FTOC, fetal thymic organ
culture;
, ohm(s); F, farad(s); DN, double negative; CTX,
charybdotoxin; DTX, dendrotoxin; KTX, kaliotoxin; TCR, T cell receptor;
PCR, polymerase chain reaction.
ACKNOWLEDGEMENTS
We thank Dr. Richard Lewis for reading the manuscript
and for helpful suggestions.
REFERENCES
- Grinstein, S. and Smith, J. D. (1990) J. Gen. Physiol. 95,97-120
[Abstract/Free Full Text]
- Leonard, R. J., Garcia, M. L., Slaughter, R. S., and Reuben, J. P. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,10094-10098
[Abstract/Free Full Text]
- Price, M., Lee, S. C., and Deutsch, C. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,10171-10175
[Abstract/Free Full Text]
- Freedman, B. D., Price, M., and Deutsch, C. (1992) J. Immunol. 149,3784-3794
[Abstract]
- Lin, C. S., Boltz, R. C., Blake, J. T., Nguyen, M., Talento, A., Fischer, P. A., Springer, M. S., Sigal, N. H., Slaughter, R. S., Garcia, M. L., Kaczorowski, G. J., and Koo, G. C. (1993) J. Exp. Med. 177,637-645
[Abstract/Free Full Text]
- Lewis, R. S., and Cahalan, M. D. (1988) Science 239,771-775
[Abstract/Free Full Text]
- McKinnon, D., and Ceredig, R. (1986) J. Exp. Med. 164,1846-1861
[Abstract/Free Full Text]
- Jenkinson, E. J., van Ewijk, W., and Owen, J. J. T. (1981) J. Exp. Med. 153,280-292
[Abstract/Free Full Text]
- Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162,156-159
[Medline]
[Order article via Infotrieve]
- Chandy, K. G., Williams, C. B., Spencer, R. H., Aguilar, B. A., Ghanshani, S., Tempel, B. L., and Gutman, G. A. (1990) Science. 247,973-975
[Abstract/Free Full Text]
- Swanson, R., Marshall, J., Smith, J. S., Williams, J. B., Boyle, M. B., Folander, K., Luneau, C. J., Antanavage, J., Oliva, C., and Buhrow, S. A. (1990) Neuron 4,929-939
[CrossRef][Medline]
[Order article via Infotrieve]
- Oleson, D. R., DeFelice, L. J., and Donahoe, R. M. (1993) J. Membr. Biol. 132,229-241
[Medline]
[Order article via Infotrieve]
- Grissmer, S., Nguyen, A. N., Aiyar, J., Hanson, D. C., Mather, R. J., Gutman, G. A., Karmilowicz, M. J., Auperin, D. D., and Chandy, K. G. (1995) Mol. Pharmacol. 45,1227-1234
[Abstract]
- Takahama, Y., Letterio, J. J., Suzuki, H., Farr, A. G., and Singer, A. (1994) J. Exp. Med. 179,1495-1506
[Abstract/Free Full Text]
- Guidos, C. J., Weissman, I. L., and Adkins, B. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,7542-7546
[Abstract/Free Full Text]
- Takahama, Y., Kosugi, A., and Singer, A. (1991) J. Immunol. 146,1134-1141
[Abstract]
- Deutsch, C., Holian, A., Holian, S. K., Daniele, R. P., and Wilson, D. F. (1979) J. Cell. Physiol. 99,79-93
[CrossRef][Medline]
[Order article via Infotrieve]
- Rink, T. J., Montecucco, C., Hesketh, T. R., and Tsien, R. Y. (1980) Biochim. Biophys. Acta 595,15-30
[Medline]
[Order article via Infotrieve]
- Gelfand, E. W., Cheung, R. K., and Grinstein, S. (1984) J. Cell. Physiol. 121,533-539
[CrossRef][Medline]
[Order article via Infotrieve]
- Grinstein, S., and Smith, J. D. (1989) Am. J. Physiol. 257,C197-C206
- Negulescu, P. A., Shastri, N., and Cahalan, M. D. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,2873-2877
[Abstract/Free Full Text]
- Schorle, H., Holtschke, T., Hunig, T., Schimpl, A., and Horak, I. (1991) Nature 352,621-624
[CrossRef][Medline]
[Order article via Infotrieve]
- Lee, S. C., Price, M., Prystowsky, M. B., and Deutsch, C. (1988) Am. J. Physiol. 254,C286-C296
- Deutsch, C., and Chen, L. Q. (1994) Proc. Natl. Acad. Sci. U. S. A. 90,10036-10040
[Abstract/Free Full Text]
- Grinstein, S., Rothstein, A., Sakardi, B., and Gelfand, E. W. (1984) Am. J. Physiol. 246,C204-C215
- Grinstein, S., and Foskett, J. K. (1990) Annu. Rev. Physiol. 52,399-414
[CrossRef][Medline]
[Order article via Infotrieve]
- Gelfand., E. W., Cheung, R. K., Mills, G. B., and Grinstein, S. (1987) J. Immunol. 138,527-531
[Abstract]
- Lewis, R. S., and Cahalan, M. D. (1989) Cell Regul. 1,99-112
[Medline]
[Order article via Infotrieve]
- Hess, S. D., Oortgiesen, M., and Cahalan, M. D. (1993) J. Immunol. 150,2620-2633
[Abstract]
- Dolmetsch, R., and Lewis, R. S. (1994) J. Gen. Physiol. 103,365-388
[Abstract/Free Full Text]
- Oettgen, H. C., Terhorst, C., Cantley, L. C., and Rosoff, P. M. (1985) Cell 40,583-590
[CrossRef][Medline]
[Order article via Infotrieve]
- Gray, L. S., Gnarra, J. R., Russell, J. H., and Engelhard, V. H. (1987) Cell 50,119-127
[CrossRef][Medline]
[Order article via Infotrieve]
- Mills, G. B., Cheung, R. K., Grinstein, S., and Gelfand, E. W. (1985) J. Immunol. 134,1640-1643
[Abstract]
- Van Ewijk, W., Shores, E. W., and Singer, A. (1994) Immunol. Today 15,214-217
[CrossRef][Medline]
[Order article via Infotrieve]
- Yokoyama, S., Imoto, K., Kawamura, T., Higashida, H., Iwabe, N., Miyata, T., and Numa, S. (1989) FEBS Lett. 259,37-42
[CrossRef][Medline]
[Order article via Infotrieve]
- Garcia, M. L., Garcia-Calvo, M., Hidalgo, P., Lee, A., and MacKinnon, R. (1994) Biochemistry 33,6834-6839
[CrossRef][Medline]
[Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
L. E. Pereira, F. Villinger, H. Wulff, A. Sankaranarayanan, G. Raman, and A. A. Ansari
Pharmacokinetics, Toxicity, and Functional Studies of the Selective Kv1.3 Channel Blocker 5-(4-Phenoxybutoxy)Psoralen in Rhesus Macaques
Experimental Biology and Medicine,
November 1, 2007;
232(10):
1338 - 1354.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Beeton and K. G. Chandy
Potassium Channels, Memory T Cells, and Multiple Sclerosis
Neuroscientist,
December 1, 2005;
11(6):
550 - 562.
[Abstract]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Vicente, A. Escalada, M. Coma, G. Fuster, E. Sanchez-Tillo, C. Lopez-Iglesias, C. Soler, C. Solsona, A. Celada, and A. Felipe
Differential Voltage-dependent K+ Channel Responses during Proliferation and Activation in Macrophages
J. Biol. Chem.,
November 21, 2003;
278(47):
46307 - 46320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. A. Koni, R. Khanna, M. C. Chang, M. D. Tang, L. K. Kaczmarek, L. C. Schlichter, and R. A. Flavell
Compensatory Anion Currents in Kv1.3 Channel-deficient Thymocytes
J. Biol. Chem.,
October 10, 2003;
278(41):
39443 - 39451.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q.-H. Liu, B. K. Fleischmann, B. Hondowicz, C. C. Maier, L. A. Turka, K. Yui, M. I. Kotlikoff, A. D. Wells, and B. D. Freedman
Modulation of Kv Channel Expression and Function by TCR and Costimulatory Signals during Peripheral CD4+ Lymphocyte Differentiation
J. Exp. Med.,
October 7, 2002;
196(7):
897 - 909.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Guo, J. N. Rao, L. Liu, M. Rizvi, D. J. Turner, and J.-Y. Wang
Polyamines regulate beta -catenin tyrosine phosphorylation via Ca2+ during intestinal epithelial cell migration
Am J Physiol Cell Physiol,
September 1, 2002;
283(3):
C722 - C734.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Rao, L. Li, V. A. Golovina, O. Platoshyn, E. D. Strauch, J. X.-J. Yuan, and J.-Y. Wang
Ca2+-RhoA signaling pathway required for polyamine-dependent intestinal epithelial cell migration
Am J Physiol Cell Physiol,
April 1, 2001;
280(4):
C993 - C1007.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J.-Y. Wang, J. Wang, V. A. Golovina, L. Li, O. Platoshyn, and J. X.-J. Yuan
Role of K+ channel expression in polyamine-dependent intestinal epithelial cell migration
Am J Physiol Cell Physiol,
February 1, 2000;
278(2):
C303 - C314.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Wang, B. Xu, R. E. White, and L. Lu
Growth factor-mediated K+ channel activity associated with human myeloblastic ML-1 cell proliferation
Am J Physiol Cell Physiol,
November 1, 1997;
273(5):
C1657 - C1665.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. N. Rao, O. Platoshyn, L. Li, X. Guo, V. A. Golovina, J. X.-J. Yuan, and J.-Y. Wang
Activation of K+ channels and increased migration of differentiated intestinal epithelial cells after wounding
Am J Physiol Cell Physiol,
April 1, 2002;
282(4):
C885 - C898.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|