Volume 270,
Number 39,
Issue of September 29, pp. 22747-22751, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
NAD
-dependent
ADP-ribosylation of T Lymphocyte Alloantigen RT6.1 Reversibly
Proceeding in Intact Rat Lymphocytes (*)
(Received for publication, March 20, 1995; and in revised form, July 10, 1995)
Tomohiko
Maehama
,
Hiroshi
Nishina
(1),
Shin-ichi
Hoshino
,
Yasunori
Kanaho
(1),
Toshiaki
Katada (§)
From the Department of Physiological Chemistry, Faculty of
Pharmaceutical Sciences, University of Tokyo, Tokyo 113 and the Department of Life Science, Tokyo Institute of Technology,
Nagatsuta, Yokohama 227, Japan
ABSTRACT
- INTRODUCTION
- EXPERIMENTAL PROCEDURES
- RESULTS
- DISCUSSION
- FOOTNOTES
- REFERENCES
ABSTRACT 
Rat T lymphocyte alloantigen 6.1 (RT6.1), which was synthesized
as the fusion protein with a maltose-binding protein in Escherichia
coli, displayed NAD
-dependent
auto-ADP-ribosylation in addition to an enzyme activity of
NAD glycohydrolase. Such ADP-ribosylation of RT6.1 was
also observed in lymphocytes isolated from rat tissues as follows. When
intact rat lymphocytes expressing RT6.1 mRNA were incubated with
[
-
P]NAD, its radioactivity
was incorporated into a cell surface protein with the M
of 31,000. The radiolabeled 31-kDa protein was released from the
cell surface by treatment of the cells with
phosphatidylinositol-specific phospholipase C and immunoprecipitated
with anti-RT6.1 antiserum. The radioactivity incorporated into the
31-kDa protein was recovered as 5`-[P]AMP upon
incubation with snake venom phosphodiesterase and also removed by
NH
OH treatment. These results suggested that the
NAD-dependent modification of the 31-kDa protein was
due to ADP-ribosylation of glycosylphosphatidylinositol-anchored RT6.1
at an arginine residue. When intact lymphocytes, in which RT6.1 had
been once modified by [P]ADP-ribosylation, were
further incubated in the absence of NAD, there was
reduction of the radioactivity in the
[P]ADP-ribosylated RT6.1. The reduced
radioactivity was recovered from the incubation medium as
[P]ADP-ribose. This reduction was effectively
inhibited by the addition of ADP-ribose to the reaction mixture.
Moreover, readdition of NAD caused the
ADP-ribosylation of RT6.1 again. Thus, the ADP-ribosylation of RT6.1
appeared to proceed reversibly in intact rat lymphocytes.
INTRODUCTION
ADP-ribosylation is one of the post-translational modifications
of cellular proteins, in which the ADP-ribose moiety of NAD is transferred to specific amino acid residues of mostly
GTP-binding proteins. This unique modification has been found in enzyme
reactions catalyzed by bacterial toxins such as diphtheria, cholera,
and pertussis toxins(1, 2, 3) . Enzyme
activities of bacterial ADP-ribosyltransferases have widely been
utilized to identify and characterize the substrate proteins, because
the protein functions are profoundly affected by ADP-ribosylation.
Besides these bacterial toxins, activities of ADP-ribosyltransferases
appeared to be present in several mammalian
cells(4, 5, 6, 7, 8) . One
of the mammalian enzymes, NAD:arginine
ADP-ribosyltransferase, of which ADP-ribose acceptor was initially
identified as the guanidino group of arginine or its related compounds,
was purified from rabbit skeletal muscle(5) . Zolkiewska et
al.(6) have recently cloned a cDNA encoding the enzyme
protein with a possible structure of glycosylphosphatidylinositol
(GPI(
))-anchored protein. An ecto-enzyme activity of
NAD:arginine ADP-ribosyltransferase was also found in
myogenically differentiated C2C12 cells, and its substrate was
identified as a cell surface adhesion molecule, integrin
7(7) . The NAD-dependent ADP-ribosylation
of integrin 7 was markedly reduced after treatment of the cells
with phosphatidylinositol-specific phospholipase C, indicating that the
enzyme was indeed anchored in the cell surface via GPI
linkage(7) . Based on a homology search with the amino acid
sequences of this type of mammalian enzymes, RT6 alloantigen was
expected to have a similar enzyme
activity(6, 8, 9, 10) .
RT6
alloantigen is specifically expressed in the cell surface of T
lymphocytes(11) , although it is not detected in thymocytes,
bone marrow cells, or B lymphocytes(11) , suggesting that its
expression is restricted to the final stages of post-thymic T
lymphocyte development. Although the physiological role of RT6 in a
specific cell function is still unknown, its defect in lymphocytes has
been implicated in disorders of diabetes and mercury-induced renal
autoimmunity in animal models(12, 13, 14) .
Recent biochemical analysis reveals that there are at least two types
of RT6 alloantigen, RT6.1 and RT6.2, and both are covalently anchored
in cell surface membranes via GPI linkage(15, 16) .
Takada et al.(9) have recently reported that RT6.2
exogenously expressed in rat adenocarcinoma cells is capable of
catalyzing the hydrolysis of NAD to ADP-ribose and
nicotinamide. Although intrinsic activity of NAD glycohydrolase was thus proven to be present in the molecule of
RT6.2, there is no report showing that RT6 alloantigen has an enzyme
activity of ADP-ribosyltransferase. We report here that a recombinant
RT6.1 fused with MBP, which was expressed in and purified from Escherichia coli, catalyzed not only NAD glycohydrolysis but also auto-ADP-ribosylation reaction.
Moreover, such ADP-ribosylation of RT6.1 effectively occurred in the
cell surface of intact rat lymphocytes in the presence of
NAD. The ADP-ribosylation reaction appeared to proceed
reversibly in intact rat lymphocytes.
EXPERIMENTAL PROCEDURES
Production and Purification of Recombinant RT6.1
Protein
Rat RT6.1 cDNA was isolated by reverse
transcriptase-polymerase chain reaction as follows. Total RNA was
isolated from rat lymphocytes as described previously(17) . To
synthesize single-strand cDNA, 1 µg of the total RNA was incubated
at 37 °C for 60 min in a reaction mixture (20 µl) consisting of
50 mM Tris-HCl (pH 7.5), 75 mM KCl, 3 mM
MgCl, 10 mM dithiothreitol, 0.5 mM deoxynucleotide triphosphates (dNTPs), 0.15 µg of random
hexamer, 40 units of RNase inhibitor (Promega), and 200 units of
Moloney murine leukemia virus reverse transcriptase (Life Technologies,
Inc.). Truncated RT6.1 (trRT6.1) cDNA was amplified by polymerase chain
reaction using the 5` primer of CCGGATCCATGCTAGACACGGCTCC (nucleotides
corresponding to amino acids 26-31 are underlined) and the 3`
primer of CCGGATCCCTAGCTGTATAAGCAATTGT (inverse complement of
nucleotides encoding amino acid 241-246 is underlined). The
amplification was performed in a reaction mixture (100 µl)
consisting of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5
mM MgCl, 50 pmol of primer, 0.01% gelatin, 200
µM dNTPs, and 2.5 units of Taq DNA polymerase
(Perkin-Elmer) with 25 cycles in a thermal cycler. The polymerase chain
reaction product (666 base pairs) was gel purified, smoothed, and
ligated to SmaI-digested pBluescript II SK(-) vector
(Stratagene). The trRT6.1 cDNA was digested with BamHI, gel
purified, and then ligated to BamHI-digested pMAL-cRI vector
(New England Biolabs). The MBP fusion protein of trRT6.1 (MBP-trRT6.1)
was expressed in E. coli HB101 cells with induction with 0.5
mM isopropyl 1-thio-
-D-galactopyranoside at 37
°C for 3 h in 2 liters of culture. The cells were harvested by
centrifugation at 7,000 
g for 10 min, and the pellet,
after being washed with phosphate-buffered saline, was frozen in liquid
N until use. The frozen pellet was thawed and dispersed
with sonication (10 s 6 times) in 30 ml of TEN buffer, which
consists of 50 mM Tris-HCl (pH 8.0), 1 mM EDTA, and
150 mM NaCl fortified with 20 kallikrein inhibitory units/ml
of aprotinin, 1 µM leupeptin, 0.1 mM
phenylmethylsulfonyl fluoride, and 0.5 mg/ml of lysozyme. Tween 20 was
added to the cell suspension at the final concentration of 0.25% (w/v),
followed by mixing for 5 min and centrifugation at 120,000 g for 20 min. The clear supernatant was applied to a column
(1.1 4 cm) of Amylose resin (New England Biolabs) that had been
equilibrated with TEN buffer. The column was washed with 20 ml of TEN
buffer, and MBP-trRT6.1 bound to the column was eluted with 10 ml of
TEN buffer containing 10 mM maltose. Approximately 4 mg of
MBP-trRT6.1 were purified from a 2-liter culture of E. coli cells under the present conditions.
Isolation of Rat Lymphocytes and Primary Culture of the
Isolated Cells
Rat lymphocytes were isolated from the cervical
lymph nodes of 4-5-week-old male rats (Wistar strain) by a method
similar to one described
previously(11, 12, 15) . The lymph node was
excised and minced finely with a scalpel blade in phosphate-buffered
saline. The minced tissue was allowed to settle for approximately 5
min, and lymphocyte-rich supernatant was filtered through a nylon mesh
(70-µm pore size). The isolated lymphocytes were washed twice with
RPMI 1640 culture medium containing 5% fetal bovine serum, 10 mM Na-Hepes (pH 7.4), 2 mML-glutamine, 100
units/ml of penicillin, and 100 µg/ml of streptomycin and seeded in
a culture flask at the density of 1 10
cells/ml.
Erythrocytes included in the lymphocyte preparation were removed by
hypotonic lysis with 0.87% NH
Cl. The above procedures were
all performed at room temperature. The isolated cells were primarily
cultured at 37 °C for 1-3 days before use. The cell viability
estimated by the trypan blue dye exclusion method was more than 90%.
ADP-ribosylation
ADP-ribosylation of the
recombinant RT6.1 was carried out in 15 µl of a mixture consisting
of 50 mM sodium phosphate (pH 6.5), 2 mM ADP-ribose,
0.5% Chaps, 10 µM [-P]NAD (0.2-0.5 TBq/mmol), and 100 µg/ml of the recombinant
RT6.1. After incubation at 37 °C for 1 h, the reaction was
terminated by the addition of 5 µl of 4-fold concentrated Laemmli
buffer and boiling for 2 min. The sample (15 µl) was subjected to
SDS-PAGE (13.5% of acrylamide gel). The gel was stained with Coomassie
Brilliant Blue R-250, destained, dried, and exposed to FUJI RX film for
48-96 h with an intensifying screen. For ADP-ribosylation of
intact RT6 protein present in cell surface, lymphocytes (2-8
10 cells/ml) were incubated with
[-P]NAD (0.5-10
TBq/mmol) at 37 °C in HBSS containing 2 mM ATP, 2 mM ADP-ribose, 1 mM FAD, 12.5 µM NADP, 1 mM MgCl, 0.1 mM MnCl, and 10 µM CaCl. The
concentration of NAD was 0.16 µM unless
otherwise specified. At indicated times, the cells were collected by
centrifugation at 800 g for 3 min and washed once with
HBSS. The washed cells were lysed in 20 µl of 10 mM Tris-HCl (pH 7.5), 1% Nonidet P-40, 0.1% deoxycholate, 0.1% SDS,
150 mM NaCl, 1 mM EDTA, 10 mM ADP-ribose, 1
µM leupeptin, and 20 kallikrein inhibitory units/ml of
aprotinin and then maintained at room temperature for 10 min. After
centrifugation at 15,000 g for 5 min, the clear
supernatant was mixed with 6.67 µl of 4-fold concentrated Laemmli
buffer and boiled for 2 min. The sample (15 µl) was subjected to
SDS-PAGE and autoradiography as described above. The SDS-PAGE was
performed under reducing conditions unless otherwise specified. For the
experiment shown in Fig. 5, radioactivity incorporated into
RT6.1 was analyzed by an imaging analyzer BAS 2000 (Fuji).
Figure 5:
Time course of
[P]ADP-ribosylation of RT6.1 in rat lymphocytes.
Lymphocytes (2 10 cells/ml) were incubated with
0.27 (open circles) or 1.1 (closed circles)
µM [-P]NAD as
described under ``Experimental Procedures.'' At the indicated
times, the cells were lysed and subjected to SDS-PAGE. The extent of
[P]ADP-ribosylated RT6.1 was measured by an
imaging analyzer, and the data are normalized and expressed as
percentages of the maximum value in the case of 1.1 µM NAD. Results are the average ± the range
of duplicate determination.
Preparation of Anti-RT6.1 Antiserum
Rabbit was
immunized with 1 mg of the recombinant RT6.1, which had been emulsified
with an equal volume of Freund's complete adjuvant and boostered
twice at intervals of 2 weeks with 0.5 mg of the recombinant RT6.1. The
immunized rabbit was sacrificed, and collected blood was allowed to
clot at room temperature for 2 h and at 4 °C for overnight.
Anti-RT6.1 antiserum was recovered from the clotted blood by
centrifugation at 1,500 g for 10 min and stored at
-80 °C until use.
Immunoprecipitation with Anti-RT6.1 Antiserum
Rat
lymphocytes (approximately 2 10 cells) that had
been radiolabeled with [-P]NAD at 37 °C for 1 h were solubilized with 500 µl of the
lysis buffer and maintained at room temperature for 10 min. After
centrifugation, the clear supernatant was mixed with 20 µl of
Sepharose CL-4B (Pharmacia-LKB) and incubated at room temperature for
10 min. After centrifugation, the prewashed supernatant was mixed with
20 µl of anti-RT6.1 antiserum or preimmune serum and incubated at
room temperature for 30 min. The reaction mixture, after being further
incubated with 20 µl of protein A-Sepharose CL-4B (Pharmacia-LKB)
for 30 min, was centrifuged again, and the immunoprecipitant was
dissolved in 20 µl of Laemmli buffer. The sample was boiled and
subjected to SDS-PAGE, followed by autoradiography as described above.
Sepharose CL-4B and protein A-Sepharose CL-4B was equilibrated with the
lysis buffer before use.
Miscellaneous
Nucleic acid sequence of RT6.1 and
truncated RT6.1 was determined by the dideoxynucleotide termination
method. Phosphatidylinositol-specific phospholipase C (Bacillus
thuringiensis) was purchased from TOAGOSEI. G
and
ADP-ribosylation factor were partially purified from bovine brain
membranes and cytosol, respectively, as described
previously(18) . Bovine brain G
(
subtype) was purified as described
previously(19) . Cholera toxin was purchased from Calbiochem.
ADP-ribosylation of G and G was performed as
described previously(20) . Protein transfer into a
polyvinylidene difluoride filter was performed as described previously (21) . Other materials and chemicals were obtained from
commercial sources. All experiments were repeated at least three times,
and the results were fully reproducible. Hence typical data are
illustrated in each figure.
RESULTS
NADGlycohydrolysis and
Auto-ADP-ribosylation Catalyzed by Recombinant RT6.1
A
recombinant RT6.1 protein fused with a maltose-binding protein
(MBP-trRT6.1) was expressed in E. coli and purified to
homogeneity for its characterization. Based on the matured form of
RT6.1 in lymphocytes(16, 22) , the hydrophobic region
of its amino terminus (amino acids 1-25) and the
carboxyl-terminal region (amino acids 247-275) were truncated in
the recombinant protein. When the purified MBP-trRT6.1 having the M of 66,000 (Fig. 1, lane 1) was
incubated with [-P]NAD,
the radiolabeled nucleotide was hydrolyzed into
[P]ADP-ribose and nicotinamide (data not shown),
as had been observed with RT6.2 exogenously expressed in rat
adenocarcinoma cells(9) . A kinetic analysis with the
recombinant RT6.1 revealed that K
and V
values were approximately 20 µM for NAD and 5 nmol of nicotinamide released per
min/mg of protein, respectively, under the present conditions. When
MBP-trRT6.1, which had been incubated with
[-P]NAD was separated by
SDS-PAGE (Fig. 1, lane 2), there was an incorporation
of the radioactivity into the 66-kDa protein probably due to its
auto-ADP-ribosylation. However, stoichiometry of this modification was
0.05-0.1 mol of ADP-ribose/mol of MBP-trRT6.1 (see
``Discussion''). Both NAD glycohydrolase
activity and auto-ADP-ribosylation of MBP-trRT6.1 were abolished by
treatment of the purified protein with heating at 95 °C for 5 min.
Thus, the recombinant RT6.1 appeared to exhibit not only NAD glycohydrolase but also ADP-ribosyltransferase activities. We
next investigated a possible occurrence of the ADP-ribosylation of
RT6.1 in intact lymphocytes expressing its mRNA.
Figure 1:
Recombinant RT6.1 purified as a
MBP-fusion protein and NAD-dependent
auto-ADP-ribosylation of the purified protein. Lane 1, the
recombinant RT6.1 purified as a MBP fusion protein (MBP-trRT6.1) was separated by SDS-PAGE and then stained with
Coomassie Brilliant Blue R-250. Lane 2, the purified protein
was incubated with [-P]NAD and subjected to SDS-PAGE and autoradiography as described under
``Experimental Procedures.'' The position of the recombinant
RT6.1 is indicated by an arrow.
NAD-dependent Modification
of 31-kDa RT6.1 in Rat Lymphocytes
It has been reported
that RT6 alloantigen is specifically expressed in the cell surface of T
lymphocytes but not in thymocytes(11) . Thus, we prepared rat
thymocytes and lymphocytes to analyze the expression of RT6 mRNA by
means of reverse transcriptase-polymerase chain reaction. RT6.1 mRNA
appeared to be expressed in lymphocytes isolated from lymph node and
peripheral blood but not in thymocytes (data not shown).
RT6.1-expressing lymphocytes isolated from rat lymph node were
incubated with [-P]NAD,
and then radiolabeled proteins were separated by SDS-PAGE. As shown in Fig. 2A, there was an incorporation of the
radioactivity of [-P]NAD into a 31-kDa protein. When lymphocytes isolated from rat
peripheral blood were incubated with
[-P]NAD and then analyzed
by SDS-PAGE, there was also a radiolabeled 31-kDa protein (data not
shown). However, such a radiolabeled protein was not observed in rat
thymocytes, in which RT6.1 mRNA had not been expressed (data not
shown). The radiolabeled 31-kDa protein in rat lymph node lymphocytes
exhibited a different mobility on SDS-PAGE under non-reducing
conditions (Fig. 2A). When rat lymphocytes, of which
the 31-kDa protein had been radiolabeled with
[-P]NAD, were treated with
phosphatidylinositol-specific phospholipase C and then subjected to a
rapid centrifugation, the radiolabeled protein was mostly recovered
from the supernatant fraction instead of the cell pellet (Fig. 2B). Moreover, the radiolabeled 31-kDa protein
solubilized from the lymphocytes with a detergent could be
immunoprecipitated with anti-RT6.1 antiserum (Fig. 2C).
These results indicated that the 31-kDa protein modified by
NAD was GPI-anchored RT6.1 expressed in rat
lymphocytes.
Figure 2:
Radiolabeling of 31-kDa protein by
[-P]NAD in rat lymphocytes
and identification of the 31-kDa protein as RT6.1. Lymphocytes (1
10 cells) were incubated with
[-P]NAD for 1 h and
subjected to the following treatments. A, cell lysates
obtained from the radiolabeled cells were mixed with Laemmli buffer
containing 2-mercaptoethanol or the buffer alone and subjected to
SDS-PAGE under reducing (lane 1) or non-reducing (lane
2) conditions. Autoradiography was obtained as described under
``Experimental Procedures.'' B, radiolabeled cells
were lysed in 40 µl of Laemmli buffer (lane 1) or
resuspended in 30 µl of HBSS containing 1 mM ADP-ribose.
The resuspended cells were further incubated with 2 µl of
phosphatidylinositol-specific phospholipase C (18.2 units/ml) at 37
°C for 20 min, and the reaction mixture was separated from the
cells by a rapid centrifugation. The cells in the pellet were lysed in
40 µl of Laemmli buffer (lane 2), and the supernatant
containing the reaction mixture was mixed with 10 µl of 4-fold
concentrated Laemmli buffer (lane 3). 20 µl of each of the
samples was subjected to SDS-PAGE and autoradiography. C, the
lysate of radiolabeled cells was subjected to immunoprecipitation with
preimmune serum (lane 1) or anti-RT6.1 antiserum (lane
2) as described under ``Experimental
Procedures.''
Auto-ADP-ribosylation of RT6.1 at Its Arginine
Residue
To examine whether the radioactivity of
[-P]NAD incorporated into
RT6.1 is caused by mono-ADP-ribosylation, the radiolabeled RT6.1 was
treated with snake venom phosphodiesterase, and then radioactive
materials released were analyzed by thin layer chromatography. As shown
in Fig. 3, the major material was identified as
5`-[P]AMP, suggesting that the
NAD-dependent modification of RT6.1 was due to
mono-ADP-ribosylation. The modified amino acid of RT6.1 was further
investigated by means of a chemical stability of the ADP-ribosyl bond
connected to amino acids. [P]ADP-ribosylated
RT6.1, after being separated by SDS-PAGE, was transferred into a
polyvinylidene fluoride filter, and then the filter was treated with
NHOH or HgCl (Fig. 4). There was a
marked decrease in the radioactivity of RT6.1 upon treatment of the
filter with NHOH, as observed in the
[P]ADP-ribosylated -subunit of
G, which had been induced by cholera toxin (Fig. 4B). Radiolabeled compound recovered after the
NHOH treatment was identified as
[P]ADP-ribose (data not shown). However, such a
decrease in the radiolabeled RT6.1 was not observed at all in
HgCl treatment under the conditions that
[P]ADP-ribose incorporated into
G- by pertussis toxin was eliminated (Fig. 4C). These results strongly suggested that the
mono-ADP-ribosylation occurred at an arginine residue of RT6.1.
Figure 3:
Release of
5`-[P]AMP by treatment of the radiolabeled RT6.1
with snake venom phosphodiesterase. Lymphocytes (2 10 cells) were incubated with
[-P]NAD for 1 h, washed,
and solubilized with 130 µl of lysis buffer. After centrifugation,
56 µl of 90% trichloroacetic acid was added to the lysate, followed
by standing on ice for 10 min. After centrifugation, the precipitate
was washed with 4% trichloroacetic acid and dissolved in 15 µl of
0.2 M Tris-HCl (pH 9.0). This sample was further incubated
with (PDE) or without (Cont) 0.5 units of snake venom
phosphodiesterase (Boehringer Mannheim) in the presence of 6 mM MgCl at 37 °C for 30 min. The reaction mixture (5
µl) was applied on a polyethyleneimine cellulose plate (Schleicher
& Schuell) and developed with 0.5 M formic acid/0.1 M lithium chloride (A) or 0.5 M guanidine
hydrochloride (B). Autoradiography was obtained as described
under ``Experimental
Procedures.''
Figure 4:
Treatment of
[P]ADP-ribosylated RT6.1 with hydroxylamine or
mercury chloride. [P]ADP-ribosylated RT6.1 (RT6.1) in rat lymphocytes (3 10 cells),
together with the -subunits of G (420 ng; 
) and G (215 ng; 
), which had been
[P]ADP-ribosylated by cholera and pertussis
toxins, respectively, was subjected to SDS-PAGE, and then the separated
proteins were transferred to a polyvinylidene difluoride filter as
described under ``Experimental Procedures.'' The filters were
incubated with 1 M NaCl (A), 1 M neutralized
NHOH (B), or 10 mM HgCl (C) at 45 °C for 2 h and then subjected to
autoradiography.
ADP-ribosylation of RT6.1 Reversibly Proceeding in
Intact Lymphocytes
Fig. 5shows time courses of the
ADP-ribosylation of RT6.1 in rat lymphocytes. Initial rate of
ADP-ribosylation was dependent on the concentration of NAD added in the reaction mixture. After the
[P]ADP-ribosylation reached a plateau level, the
cells were washed and followed by the incubation with unlabeled
ADP-ribose. By this treatment, radioactive materials that were
nonspecifically bound to the cell surface could be removed without the
reduction of the extent of [P]ADP-ribosylated
RT6.1. Therefore, [P]ADP-ribosylated RT6.1
comprised approximately 90% of total radioactivity in the cells (data
not shown). When the cells were further incubated in the absence of
[P]NAD, there was a marked
decrease in the radiolabeled RT6.1 (Fig. 6). There was no
proteolytic fragment of the radiolabeled RT6.1 (data not shown), and
the loss of the radioactivity was mostly recovered from the incubation
medium as [P]ADP-ribose (Fig. 6).
Moreover, the decrease in [P]ADP-ribosylated
RT6.1 observed in the absence of
[P]NAD was specifically
inhibited by the addition of ADP-ribose to the incubation medium. These
results suggested that there was an enzyme(s) responsible for the
removal of ADP-ribose from the modified RT6.1 (i.e. ADP-ribosylarginine glycohydrolase) in the cell surface of the
lymphocytes.
Figure 6:
Release of
[P]ADP-ribose from
[P]ADP-ribosylated RT6.1 in rat lymphocytes.
Lymphocytes (5 10
cells) were incubated with 0.27
µM [P]NAD for 1 h
as described under ``Experimental Procedures.'' The cells,
after being washed, were suspended in HBSS containing 2 mM ADP-ribose in order to remove radioactive material that
nonspecifically bound to the cell surface. After incubation at 37
°C for 10 min, the cells were resuspended in 200 µl of HBSS and
immediately lysed (lane 1) or further incubated at 37 °C
for 20 min with (lane 3) or without (lane 2) 2 mM ADP-ribose. A, the reaction mixture was analyzed by thin
layer chromatography as described in Fig. 4A. B, the cells were lysed and then subjected to SDS-PAGE and
autoradiography.
We further investigated whether RT6.1 once modified and
de-ADP-ribosylated was still capable of being
[P]ADP-ribosylated. After the first
ADP-ribosylation by incubation with NAD, the cells
were washed and incubated with or without ADP-ribose. By this
incubation without NAD, RT6.1 once modified was
expected to be de-ADP-ribosylated, and ADP-ribose inhibited the
de-ADP-ribosylation (see Fig. 6). Then the cells were washed and
subjected to [P]ADP-ribosylation (Fig. 7). RT6.1 on the cells that had been incubated without
ADP-ribose at the second incubation was still capable of being
[P]ADP-ribosylated (Fig. 7). However,
[P]ADP-ribosylation of RT6.1 on the cells that
had been incubated with ADP-ribose at the second incubation was not
observed (Fig. 7). The second incubation with ADP-ribose did not
affect following [P]ADP-ribosylation (data not
shown). Thus, the ADP-ribosylation of RT6.1 appeared to proceed
reversibly in intact rat lymphocytes if NAD was
supplied to the extracellular environment.
Figure 7:
ADP-ribosylation of RT6.1 reversibly
proceeding in rat lymphocytes. Lymphocytes (5 10 cells) were first incubated with 1.1 µM
non-radiolabeled NAD for 20 min as described under
``Experimental Procedures.'' The cells, after being washed,
were incubated at 37 °C for 20 min in 200 µl of HBSS in the
presence (lane 2) or absence (lane 1) of 2 mM ADP-ribose. The cells, after being washed, were incubated with
0.27 µM [P]NAD at
37 °C for 20 min. The cells were lysed and then subjected to
SDS-PAGE and autoradiography.
DISCUSSION
In the present study, we demonstrated that
NAD-dependent ADP-ribosylation of RT6.1 occurred in
intact lymphocytes. This ADP-ribosylation appeared to be catalyzed by
RT6.1 itself, because a recombinant RT6.1 that was expressed in E.
coli as a fusion protein with MBP also exhibited the same
modification upon incubation with NAD. However,
ADP-ribosyltransferase activity of this fusion protein was extremely
low. Moreover, such an ADP-ribosylation was not apparently observed
when the membrane fraction instead of intact lymphocytes was incubated
with [P]NAD (data not shown).
Zolkiewska and Moss (7) have recently reported that integrin
7 is ADP-ribosylated by a GPI-anchored ADP-ribosyltransferase in
differentiated C2C12 cells. They have showed that the ADP-ribosylation
of integrin occurs only in the intact cells and not in the membrane
fraction. Takada et al. (9) have reported that RT6.2
exogenously expressed in adenocarcinoma cells exhibits only
NAD glycohydrolase activity; the evidence for an
ADP-ribosylation of RT6.2 was not described in their report. These
results suggest that enzyme reactions catalyzed by these
ADP-ribosyltransferases proceed only when their substrates take certain
forms under physiological conditions.
In this report, we could
observe reversible ADP-ribosylation of RT6.1 in intact rat lymphocytes.
The reaction mixture of the ADP-ribosylation used in the present study
contained several nucleotides, such as ADP-ribose, FAD, and ATP, beside
the substrate of NAD. These compounds were very
effective in inhibiting the degradation of NAD added
and/or the reversal reaction of ADP-ribosylated RT6.1. Especially the
existence of ATP in the reaction mixture was essentially required for a
significant level of the ADP-ribosylation of RT6.1 in the cells. In the
previous study(20) , Maehama et al. indicate that ATP
could inhibit activity of a rat ADP-ribosylarginine glycohydrolase, of
which substrates included ADP-ribosylated GTP-binding proteins modified
by cholera and botulinum C toxins. Although the enzyme
responsible for the reversal reaction of modified RT6.1 has not been
extensively investigated in the present study, it can be assumed that
there is an enzyme(s) similar to the rat ADP-ribosylarginine
glycohydrolase in the cell surface. We observed that the
ADP-ribosylation of RT6.1 occurred in the presence of submicromolar
concentrations (0.1-0.2 µM) of NAD,
suggesting that this modification may be considerable under the
physiological conditions.
Recently, Wang et al. (23) have reported that an enzyme of GPI-anchored
NAD:arginine ADP-ribosyltransferase is present in
cultured cytotoxic T cells. Incubation of the T cells with
NAD caused ADP-ribosylation of the cell surface
proteins and suppressed the cell ability to lyse target cells. This
suppression appeared to be resultant from the failure of the cytotoxic
T cells to form specific conjugates with the target cells. It is thus
tempting to speculate that the ADP-ribosylation of RT6.1 similarly
exerts its influence on a cell function(s) of rat lymphocytes. Further
study on the possible cell function(s) linked to this unique
modification is currently under investigation in our laboratory.
FOOTNOTES
- *
- This work was supported by research grants from
the Scientific Research Fund of the Ministry of Education, Science, and
Culture of Japan. The costs of publication of this article were
defrayed in part by the payment of page charges. This article must
therefore by hereby marked ``advertisement'' in
accordance with 18 U.S.C. Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
Dept. of Physiological Chemistry, Faculty of Pharmaceutical Sciences,
University of Tokyo, Hongo, Tokyo 113, Japan. Tel.: 81-3-3812-2111,
Ext. 4750; Fax: 81-3-3815-9604.
- ()
- The
abbreviations used are: GPI, glycosylphosphatidylinositol; MBP,
maltose-binding protein; Chaps,
3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate;
PAGE, polyacrylamide gel electrophoresis; HBSS, Hanks' balanced
salt solution; G, GTP-binding protein that mediates
stimulation of adenylate cyclase; G, GTP-binding protein
that mediates inhibition of adenylate cyclase.
REFERENCES
- Collier, R. J. (1990) in ADP-ribosylating Toxins and G Proteins (Moss, J., and Vaughan, M., eds) pp. 3-19, American Society for Microbiology, Washington, D. C.
- Fishman, P. H. (1990) in ADP-ribosylating Toxins and G Proteins (Moss, J., and Vaughan, M., eds) pp. 127-140, American Society for Microbiology, Washington, D. C.
- Ui, M. (1990) in ADP-ribosylating Toxins and G Proteins (Moss, J., and Vaughan, M., eds) pp. 45-77, American Society for Microbiology, Washington, D. C.
- Tanuma, S., Kawashima, K., and Endo, H. (1988) J. Biol. Chem. 263,5485-5489
[Abstract/Free Full Text]
- Peterson, J. E., Larew, J. S.-A., and Graves, D. J. (1990) J. Biol. Chem. 265,17062-17069
[Abstract/Free Full Text]
- Zolkiewska, A., Nightingale, M. S., and Moss, J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,11352-11356
[Abstract/Free Full Text]
- Zolkiewska, A., and Moss, J. (1993) J. Biol. Chem. 268,25273-25276
[Abstract/Free Full Text]
- Okazaki, I. J., Zolkiewska, A., Nightingale, M. S., and Moss, J. (1994) Biochemistry 33,12828-12836
[CrossRef][Medline]
[Order article via Infotrieve]
- Takada, T., Iida, K., and Moss, J. (1994) J. Biol. Chem. 269,9420-9423
[Abstract/Free Full Text]
- Takada, T., Iida, K., and Moss, J. (1995) J. Biol. Chem. 270,541-544
[Abstract/Free Full Text]
- Thiele, H.-G., Koch, F., and Kashan, A. (1987) Transplant. Proc. 19,3157-3160
- Greiner, D. L., Handler, E. S., Nakano, K., Mordes, J. P., and Rossini, A. A. (1986) J. Immunol. 136,148-151
[Abstract]
- Crisá, L., Sarkar, P., Waite, D. J., Haag, F., Koch-Nolte, F., Rajan, T. V., Mordes, J. P., Handler, E. S., Thiele, H.-G., Rossini, A. A., and Greiner, D. L. (1993) Diabetes 42,688-695
[Abstract]
- Kosuda, L. L., Hosseinzadeh, H., Greiner, D. L., and Bigazzi, P. E. (1994) J. Toxicol. Environ. Health 42,303-321
[Medline]
[Order article via Infotrieve]
- Koch, F., Kashan, A., and Thiele, H.-G. (1988) Immunology 65,259-265
[Medline]
[Order article via Infotrieve]
- Koch, F., Haag, F., Kashan, A., and Thiele, H.-G. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,964-967
[Abstract/Free Full Text]
- Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162,156-159
[Medline]
[Order article via Infotrieve]
- Tsai, S.-C., Noda, M., Adamik, R., Chang, P. P., Chen, H.-C., Moss, J., and Vaughan, M. (1988) J. Biol. Chem. 263,1768-1772
[Abstract/Free Full Text]
- Katada, T., Oinuma, M., and Ui, M. (1986) J. Biol. Chem. 261,8182-8191
[Abstract/Free Full Text]
- Maehama, T., Nishina, H., and Katada, T. (1994) J. Biochem. (Tokyo) 116,1134-1138
[Abstract/Free Full Text]
- Kobayashi, I., Shibasaki, H., Takahashi, K., Kikkawa, S., Ui, M., and Katada, T. (1989) FEBS Lett. 257,177-180
[CrossRef][Medline]
[Order article via Infotrieve]
- Kashan, A., Buck, F., Haag, F., Koch, F., and Thiele, H.-G. (1989) Immunol. Lett. 23,133-138
[CrossRef][Medline]
[Order article via Infotrieve]
- Wang, J., Nemoto, E., Kots, A. Y., Kaslow, H. R., and Dennert, G. (1994) J. Immunol. 153,4048-4058
[Abstract]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
|
|
 
Z.-X. Liu, O. Azhipa, S. Okamoto, S. Govindarajan, and G. Dennert
Extracellular Nicotinamide Adenine Dinucleotide Induces T Cell Apoptosis In Vivo and In Vitro
J. Immunol.,
November 1, 2001;
167(9):
4942 - 4947.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
R. Bortell, J. Moss, R. C. McKenna, M. R. Rigby, D. Niedzwiecki, L. A. Stevens, W. A. Patton, J. P. Mordes, D. L. Greiner, and A. A. Rossini
Nicotinamide Adenine Dinucleotide (NAD) and Its Metabolites Inhibit T Lymphocyte Proliferation: Role of Cell Surface NAD Glycohydrolase and Pyrophosphatase Activities
J. Immunol.,
August 15, 2001;
167(4):
2049 - 2059.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Koch-Nolte, T. Duffy, M. Nissen, S. Kahl, N. Killeen, V. Ablamunits, F. Haag, and E. H. Leiter
A New Monoclonal Antibody Detects a Developmentally Regulated Mouse Ecto-ADP-Ribosyltransferase on T Cells: Subset Distribution, Inbred Strain Variation, and Modulation Upon T Cell Activation
J. Immunol.,
December 1, 1999;
163(11):
6014 - 6022.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
B. Weng, W. C. Thompson, H.-J. Kim, R. L. Levine, and J. Moss
Modification of the ADP-ribosyltransferase and NAD Glycohydrolase Activities of a Mammalian Transferase (ADP-ribosyltransferase 5) by Auto-ADP-ribosylation
J. Biol. Chem.,
November 5, 1999;
274(45):
31797 - 31803.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. J. Okazaki and J. Moss
Glycosylphosphatidylinositol-anchored and Secretory Isoforms of Mono-ADP-ribosyltransferases
J. Biol. Chem.,
September 11, 1998;
273(37):
23617 - 23620.
[Full Text]
[PDF]
|
|
|
|
|
|
|
E. Lesma, J. Moss, H. B. Brewer, R. Bortell, D. Greiner, J. Mordes, and A. A. Rossini
Characterization of High Density Lipoprotein-Bound and Soluble RT6 Released Following Administration of Anti-RT6.1 Monoclonal Antibody
J. Immunol.,
August 1, 1998;
161(3):
1212 - 1219.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
J. Moss, L. A. Stevens, E. Cavanaugh, I. J. Okazaki, R. Bortell, T. Kanaitsuka, J. P. Mordes, D. L. Greiner, and A. A. Rossini
Characterization of Mouse Rt6.1 NAD:Arginine ADP-ribosyltransferase
J. Biol. Chem.,
February 14, 1997;
272(7):
4342 - 4346.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
N. Hara, M. Tsuchiya, and M. Shimoyama
Glutamic Acid 207in Rodent T-cell RT6 Antigens Is Essential for Arginine-specific ADP-ribosylation
J. Biol. Chem.,
November 22, 1996;
271(47):
29552 - 29555.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
I. J. Okazaki, H.-J. Kim, and J. Moss
Cloning and Characterization of a Novel Membrane-associated Lymphocyte NAD:Arginine ADP-ribosyltransferase
J. Biol. Chem.,
September 6, 1996;
271(36):
22052 - 22057.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
M. Hara-Yokoyama, I. Kukimoto, H. Nishina, K. Kontani, Y. Hirabayashi, F. Irie, H. Sugiya, S. Furuyama, and T. Katada
Inhibition of NAD+ Glycohydrolase and ADP-ribosyl Cyclase Activities of Leukocyte Cell Surface Antigen CD38 by Gangliosides
J. Biol. Chem.,
May 31, 1996;
271(22):
12951 - 12955.
[Abstract]
[Full Text]
[PDF]
|
|
|
|
|
|
|
F. Koch-Nolte, D. Petersen, S. Balasubramanian, F. Haag, D. Kahlke, T. Willer, R. Kastelein, F. Bazan, and , H.-Gün. Thiele
Mouse T Cell Membrane Proteins Rt6-1 and Rt6-2 Are Arginine/Protein Mono(ADPribosyl)transferases and Share Secondary Structure Motifs with ADP-ribosylating Bacterial Toxins
J. Biol. Chem.,
March 29, 1996;
271(13):
7686 - 7693.
[Abstract]
[Full Text]
[PDF]
|
|
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
