JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maehama, T.
Right arrow Articles by Katada, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maehama, T.
Right arrow Articles by Katada, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 39, Issue of September 29, pp. 22747-22751, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
NAD-dependent ADP-ribosylation of T Lymphocyte Alloantigen RT6.1 Reversibly Proceeding in Intact Rat Lymphocytes (*)

(Received for publication, March 20, 1995; and in revised form, July 10, 1995)

Tomohiko Maehama Hiroshi Nishina (1) Shin-ichi Hoshino Yasunori Kanaho (1) Toshiaki Katada (§)

From the Department of Physiological Chemistry, Faculty of Pharmaceutical Sciences, University of Tokyo, Tokyo 113 and the Department of Life Science, Tokyo Institute of Technology, Nagatsuta, Yokohama 227, Japan

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

Rat T lymphocyte alloantigen 6.1 (RT6.1), which was synthesized as the fusion protein with a maltose-binding protein in Escherichia coli, displayed NAD-dependent auto-ADP-ribosylation in addition to an enzyme activity of NAD glycohydrolase. Such ADP-ribosylation of RT6.1 was also observed in lymphocytes isolated from rat tissues as follows. When intact rat lymphocytes expressing RT6.1 mRNA were incubated with [alpha-P]NAD, its radioactivity was incorporated into a cell surface protein with the M(r) of 31,000. The radiolabeled 31-kDa protein was released from the cell surface by treatment of the cells with phosphatidylinositol-specific phospholipase C and immunoprecipitated with anti-RT6.1 antiserum. The radioactivity incorporated into the 31-kDa protein was recovered as 5`-[P]AMP upon incubation with snake venom phosphodiesterase and also removed by NH(2)OH treatment. These results suggested that the NAD-dependent modification of the 31-kDa protein was due to ADP-ribosylation of glycosylphosphatidylinositol-anchored RT6.1 at an arginine residue. When intact lymphocytes, in which RT6.1 had been once modified by [P]ADP-ribosylation, were further incubated in the absence of NAD, there was reduction of the radioactivity in the [P]ADP-ribosylated RT6.1. The reduced radioactivity was recovered from the incubation medium as [P]ADP-ribose. This reduction was effectively inhibited by the addition of ADP-ribose to the reaction mixture. Moreover, readdition of NAD caused the ADP-ribosylation of RT6.1 again. Thus, the ADP-ribosylation of RT6.1 appeared to proceed reversibly in intact rat lymphocytes.


INTRODUCTION

ADP-ribosylation is one of the post-translational modifications of cellular proteins, in which the ADP-ribose moiety of NAD is transferred to specific amino acid residues of mostly GTP-binding proteins. This unique modification has been found in enzyme reactions catalyzed by bacterial toxins such as diphtheria, cholera, and pertussis toxins(1, 2, 3) . Enzyme activities of bacterial ADP-ribosyltransferases have widely been utilized to identify and characterize the substrate proteins, because the protein functions are profoundly affected by ADP-ribosylation. Besides these bacterial toxins, activities of ADP-ribosyltransferases appeared to be present in several mammalian cells(4, 5, 6, 7, 8) . One of the mammalian enzymes, NAD:arginine ADP-ribosyltransferase, of which ADP-ribose acceptor was initially identified as the guanidino group of arginine or its related compounds, was purified from rabbit skeletal muscle(5) . Zolkiewska et al.(6) have recently cloned a cDNA encoding the enzyme protein with a possible structure of glycosylphosphatidylinositol (GPI(^1))-anchored protein. An ecto-enzyme activity of NAD:arginine ADP-ribosyltransferase was also found in myogenically differentiated C2C12 cells, and its substrate was identified as a cell surface adhesion molecule, integrin alpha7(7) . The NAD-dependent ADP-ribosylation of integrin alpha7 was markedly reduced after treatment of the cells with phosphatidylinositol-specific phospholipase C, indicating that the enzyme was indeed anchored in the cell surface via GPI linkage(7) . Based on a homology search with the amino acid sequences of this type of mammalian enzymes, RT6 alloantigen was expected to have a similar enzyme activity(6, 8, 9, 10) .

RT6 alloantigen is specifically expressed in the cell surface of T lymphocytes(11) , although it is not detected in thymocytes, bone marrow cells, or B lymphocytes(11) , suggesting that its expression is restricted to the final stages of post-thymic T lymphocyte development. Although the physiological role of RT6 in a specific cell function is still unknown, its defect in lymphocytes has been implicated in disorders of diabetes and mercury-induced renal autoimmunity in animal models(12, 13, 14) . Recent biochemical analysis reveals that there are at least two types of RT6 alloantigen, RT6.1 and RT6.2, and both are covalently anchored in cell surface membranes via GPI linkage(15, 16) . Takada et al.(9) have recently reported that RT6.2 exogenously expressed in rat adenocarcinoma cells is capable of catalyzing the hydrolysis of NAD to ADP-ribose and nicotinamide. Although intrinsic activity of NAD glycohydrolase was thus proven to be present in the molecule of RT6.2, there is no report showing that RT6 alloantigen has an enzyme activity of ADP-ribosyltransferase. We report here that a recombinant RT6.1 fused with MBP, which was expressed in and purified from Escherichia coli, catalyzed not only NAD glycohydrolysis but also auto-ADP-ribosylation reaction. Moreover, such ADP-ribosylation of RT6.1 effectively occurred in the cell surface of intact rat lymphocytes in the presence of NAD. The ADP-ribosylation reaction appeared to proceed reversibly in intact rat lymphocytes.


EXPERIMENTAL PROCEDURES

Production and Purification of Recombinant RT6.1 Protein

Rat RT6.1 cDNA was isolated by reverse transcriptase-polymerase chain reaction as follows. Total RNA was isolated from rat lymphocytes as described previously(17) . To synthesize single-strand cDNA, 1 µg of the total RNA was incubated at 37 °C for 60 min in a reaction mixture (20 µl) consisting of 50 mM Tris-HCl (pH 7.5), 75 mM KCl, 3 mM MgCl(2), 10 mM dithiothreitol, 0.5 mM deoxynucleotide triphosphates (dNTPs), 0.15 µg of random hexamer, 40 units of RNase inhibitor (Promega), and 200 units of Moloney murine leukemia virus reverse transcriptase (Life Technologies, Inc.). Truncated RT6.1 (trRT6.1) cDNA was amplified by polymerase chain reaction using the 5` primer of CCGGATCCATGCTAGACACGGCTCC (nucleotides corresponding to amino acids 26-31 are underlined) and the 3` primer of CCGGATCCCTAGCTGTATAAGCAATTGT (inverse complement of nucleotides encoding amino acid 241-246 is underlined). The amplification was performed in a reaction mixture (100 µl) consisting of 10 mM Tris-HCl (pH 8.3), 50 mM KCl, 1.5 mM MgCl(2), 50 pmol of primer, 0.01% gelatin, 200 µM dNTPs, and 2.5 units of Taq DNA polymerase (Perkin-Elmer) with 25 cycles in a thermal cycler. The polymerase chain reaction product (666 base pairs) was gel purified, smoothed, and ligated to SmaI-digested pBluescript II SK(-) vector (Stratagene). The trRT6.1 cDNA was digested with BamHI, gel purified, and then ligated to BamHI-digested pMAL-cRI vector (New England Biolabs). The MBP fusion protein of trRT6.1 (MBP-trRT6.1) was expressed in E. coli HB101 cells with induction with 0.5 mM isopropyl 1-thio-beta-D-galactopyranoside at 37 °C for 3 h in 2 liters of culture. The cells were harvested by centrifugation at 7,000 times g for 10 min, and the pellet, after being washed with phosphate-buffered saline, was frozen in liquid N(2) until use. The frozen pellet was thawed and dispersed with sonication (10 s times 6 times) in 30 ml of TEN buffer, which consists of 50 mM Tris-HCl (pH 8.0), 1 mM EDTA, and 150 mM NaCl fortified with 20 kallikrein inhibitory units/ml of aprotinin, 1 µM leupeptin, 0.1 mM phenylmethylsulfonyl fluoride, and 0.5 mg/ml of lysozyme. Tween 20 was added to the cell suspension at the final concentration of 0.25% (w/v), followed by mixing for 5 min and centrifugation at 120,000 times g for 20 min. The clear supernatant was applied to a column (1.1 times 4 cm) of Amylose resin (New England Biolabs) that had been equilibrated with TEN buffer. The column was washed with 20 ml of TEN buffer, and MBP-trRT6.1 bound to the column was eluted with 10 ml of TEN buffer containing 10 mM maltose. Approximately 4 mg of MBP-trRT6.1 were purified from a 2-liter culture of E. coli cells under the present conditions.

Isolation of Rat Lymphocytes and Primary Culture of the Isolated Cells

Rat lymphocytes were isolated from the cervical lymph nodes of 4-5-week-old male rats (Wistar strain) by a method similar to one described previously(11, 12, 15) . The lymph node was excised and minced finely with a scalpel blade in phosphate-buffered saline. The minced tissue was allowed to settle for approximately 5 min, and lymphocyte-rich supernatant was filtered through a nylon mesh (70-µm pore size). The isolated lymphocytes were washed twice with RPMI 1640 culture medium containing 5% fetal bovine serum, 10 mM Na-Hepes (pH 7.4), 2 mML-glutamine, 100 units/ml of penicillin, and 100 µg/ml of streptomycin and seeded in a culture flask at the density of 1 times 10^6 cells/ml. Erythrocytes included in the lymphocyte preparation were removed by hypotonic lysis with 0.87% NH(4)Cl. The above procedures were all performed at room temperature. The isolated cells were primarily cultured at 37 °C for 1-3 days before use. The cell viability estimated by the trypan blue dye exclusion method was more than 90%.

ADP-ribosylation

ADP-ribosylation of the recombinant RT6.1 was carried out in 15 µl of a mixture consisting of 50 mM sodium phosphate (pH 6.5), 2 mM ADP-ribose, 0.5% Chaps, 10 µM [alpha-P]NAD (0.2-0.5 TBq/mmol), and 100 µg/ml of the recombinant RT6.1. After incubation at 37 °C for 1 h, the reaction was terminated by the addition of 5 µl of 4-fold concentrated Laemmli buffer and boiling for 2 min. The sample (15 µl) was subjected to SDS-PAGE (13.5% of acrylamide gel). The gel was stained with Coomassie Brilliant Blue R-250, destained, dried, and exposed to FUJI RX film for 48-96 h with an intensifying screen. For ADP-ribosylation of intact RT6 protein present in cell surface, lymphocytes (2-8 times 10^6 cells/ml) were incubated with [alpha-P]NAD (0.5-10 TBq/mmol) at 37 °C in HBSS containing 2 mM ATP, 2 mM ADP-ribose, 1 mM FAD, 12.5 µM NADP, 1 mM MgCl(2), 0.1 mM MnCl(2), and 10 µM CaCl(2). The concentration of NAD was 0.16 µM unless otherwise specified. At indicated times, the cells were collected by centrifugation at 800 times g for 3 min and washed once with HBSS. The washed cells were lysed in 20 µl of 10 mM Tris-HCl (pH 7.5), 1% Nonidet P-40, 0.1% deoxycholate, 0.1% SDS, 150 mM NaCl, 1 mM EDTA, 10 mM ADP-ribose, 1 µM leupeptin, and 20 kallikrein inhibitory units/ml of aprotinin and then maintained at room temperature for 10 min. After centrifugation at 15,000 times g for 5 min, the clear supernatant was mixed with 6.67 µl of 4-fold concentrated Laemmli buffer and boiled for 2 min. The sample (15 µl) was subjected to SDS-PAGE and autoradiography as described above. The SDS-PAGE was performed under reducing conditions unless otherwise specified. For the experiment shown in Fig. 5, radioactivity incorporated into RT6.1 was analyzed by an imaging analyzer BAS 2000 (Fuji).


Figure 5: Time course of [P]ADP-ribosylation of RT6.1 in rat lymphocytes. Lymphocytes (2 times 10^6 cells/ml) were incubated with 0.27 (open circles) or 1.1 (closed circles) µM [alpha-P]NAD as described under ``Experimental Procedures.'' At the indicated times, the cells were lysed and subjected to SDS-PAGE. The extent of [P]ADP-ribosylated RT6.1 was measured by an imaging analyzer, and the data are normalized and expressed as percentages of the maximum value in the case of 1.1 µM NAD. Results are the average ± the range of duplicate determination.



Preparation of Anti-RT6.1 Antiserum

Rabbit was immunized with 1 mg of the recombinant RT6.1, which had been emulsified with an equal volume of Freund's complete adjuvant and boostered twice at intervals of 2 weeks with 0.5 mg of the recombinant RT6.1. The immunized rabbit was sacrificed, and collected blood was allowed to clot at room temperature for 2 h and at 4 °C for overnight. Anti-RT6.1 antiserum was recovered from the clotted blood by centrifugation at 1,500 times g for 10 min and stored at -80 °C until use.

Immunoprecipitation with Anti-RT6.1 Antiserum

Rat lymphocytes (approximately 2 times 10^6 cells) that had been radiolabeled with [alpha-P]NAD at 37 °C for 1 h were solubilized with 500 µl of the lysis buffer and maintained at room temperature for 10 min. After centrifugation, the clear supernatant was mixed with 20 µl of Sepharose CL-4B (Pharmacia-LKB) and incubated at room temperature for 10 min. After centrifugation, the prewashed supernatant was mixed with 20 µl of anti-RT6.1 antiserum or preimmune serum and incubated at room temperature for 30 min. The reaction mixture, after being further incubated with 20 µl of protein A-Sepharose CL-4B (Pharmacia-LKB) for 30 min, was centrifuged again, and the immunoprecipitant was dissolved in 20 µl of Laemmli buffer. The sample was boiled and subjected to SDS-PAGE, followed by autoradiography as described above. Sepharose CL-4B and protein A-Sepharose CL-4B was equilibrated with the lysis buffer before use.

Miscellaneous

Nucleic acid sequence of RT6.1 and truncated RT6.1 was determined by the dideoxynucleotide termination method. Phosphatidylinositol-specific phospholipase C (Bacillus thuringiensis) was purchased from TOAGOSEI. G(s) and ADP-ribosylation factor were partially purified from bovine brain membranes and cytosol, respectively, as described previously(18) . Bovine brain G(i) (alpha subtype) was purified as described previously(19) . Cholera toxin was purchased from Calbiochem. ADP-ribosylation of G(s) and G(i) was performed as described previously(20) . Protein transfer into a polyvinylidene difluoride filter was performed as described previously (21) . Other materials and chemicals were obtained from commercial sources. All experiments were repeated at least three times, and the results were fully reproducible. Hence typical data are illustrated in each figure.


RESULTS

NADGlycohydrolysis and Auto-ADP-ribosylation Catalyzed by Recombinant RT6.1

A recombinant RT6.1 protein fused with a maltose-binding protein (MBP-trRT6.1) was expressed in E. coli and purified to homogeneity for its characterization. Based on the matured form of RT6.1 in lymphocytes(16, 22) , the hydrophobic region of its amino terminus (amino acids 1-25) and the carboxyl-terminal region (amino acids 247-275) were truncated in the recombinant protein. When the purified MBP-trRT6.1 having the M(r) of 66,000 (Fig. 1, lane 1) was incubated with [alpha-P]NAD, the radiolabeled nucleotide was hydrolyzed into [P]ADP-ribose and nicotinamide (data not shown), as had been observed with RT6.2 exogenously expressed in rat adenocarcinoma cells(9) . A kinetic analysis with the recombinant RT6.1 revealed that K(m) and V(max) values were approximately 20 µM for NAD and 5 nmol of nicotinamide released per min/mg of protein, respectively, under the present conditions. When MBP-trRT6.1, which had been incubated with [alpha-P]NAD was separated by SDS-PAGE (Fig. 1, lane 2), there was an incorporation of the radioactivity into the 66-kDa protein probably due to its auto-ADP-ribosylation. However, stoichiometry of this modification was 0.05-0.1 mol of ADP-ribose/mol of MBP-trRT6.1 (see ``Discussion''). Both NAD glycohydrolase activity and auto-ADP-ribosylation of MBP-trRT6.1 were abolished by treatment of the purified protein with heating at 95 °C for 5 min. Thus, the recombinant RT6.1 appeared to exhibit not only NAD glycohydrolase but also ADP-ribosyltransferase activities. We next investigated a possible occurrence of the ADP-ribosylation of RT6.1 in intact lymphocytes expressing its mRNA.


Figure 1: Recombinant RT6.1 purified as a MBP-fusion protein and NAD-dependent auto-ADP-ribosylation of the purified protein. Lane 1, the recombinant RT6.1 purified as a MBP fusion protein (MBP-trRT6.1) was separated by SDS-PAGE and then stained with Coomassie Brilliant Blue R-250. Lane 2, the purified protein was incubated with [alpha-P]NAD and subjected to SDS-PAGE and autoradiography as described under ``Experimental Procedures.'' The position of the recombinant RT6.1 is indicated by an arrow.



NAD-dependent Modification of 31-kDa RT6.1 in Rat Lymphocytes

It has been reported that RT6 alloantigen is specifically expressed in the cell surface of T lymphocytes but not in thymocytes(11) . Thus, we prepared rat thymocytes and lymphocytes to analyze the expression of RT6 mRNA by means of reverse transcriptase-polymerase chain reaction. RT6.1 mRNA appeared to be expressed in lymphocytes isolated from lymph node and peripheral blood but not in thymocytes (data not shown). RT6.1-expressing lymphocytes isolated from rat lymph node were incubated with [alpha-P]NAD, and then radiolabeled proteins were separated by SDS-PAGE. As shown in Fig. 2A, there was an incorporation of the radioactivity of [alpha-P]NAD into a 31-kDa protein. When lymphocytes isolated from rat peripheral blood were incubated with [alpha-P]NAD and then analyzed by SDS-PAGE, there was also a radiolabeled 31-kDa protein (data not shown). However, such a radiolabeled protein was not observed in rat thymocytes, in which RT6.1 mRNA had not been expressed (data not shown). The radiolabeled 31-kDa protein in rat lymph node lymphocytes exhibited a different mobility on SDS-PAGE under non-reducing conditions (Fig. 2A). When rat lymphocytes, of which the 31-kDa protein had been radiolabeled with [alpha-P]NAD, were treated with phosphatidylinositol-specific phospholipase C and then subjected to a rapid centrifugation, the radiolabeled protein was mostly recovered from the supernatant fraction instead of the cell pellet (Fig. 2B). Moreover, the radiolabeled 31-kDa protein solubilized from the lymphocytes with a detergent could be immunoprecipitated with anti-RT6.1 antiserum (Fig. 2C). These results indicated that the 31-kDa protein modified by NAD was GPI-anchored RT6.1 expressed in rat lymphocytes.


Figure 2: Radiolabeling of 31-kDa protein by [alpha-P]NAD in rat lymphocytes and identification of the 31-kDa protein as RT6.1. Lymphocytes (1 times 10^6 cells) were incubated with [alpha-P]NAD for 1 h and subjected to the following treatments. A, cell lysates obtained from the radiolabeled cells were mixed with Laemmli buffer containing 2-mercaptoethanol or the buffer alone and subjected to SDS-PAGE under reducing (lane 1) or non-reducing (lane 2) conditions. Autoradiography was obtained as described under ``Experimental Procedures.'' B, radiolabeled cells were lysed in 40 µl of Laemmli buffer (lane 1) or resuspended in 30 µl of HBSS containing 1 mM ADP-ribose. The resuspended cells were further incubated with 2 µl of phosphatidylinositol-specific phospholipase C (18.2 units/ml) at 37 °C for 20 min, and the reaction mixture was separated from the cells by a rapid centrifugation. The cells in the pellet were lysed in 40 µl of Laemmli buffer (lane 2), and the supernatant containing the reaction mixture was mixed with 10 µl of 4-fold concentrated Laemmli buffer (lane 3). 20 µl of each of the samples was subjected to SDS-PAGE and autoradiography. C, the lysate of radiolabeled cells was subjected to immunoprecipitation with preimmune serum (lane 1) or anti-RT6.1 antiserum (lane 2) as described under ``Experimental Procedures.''



Auto-ADP-ribosylation of RT6.1 at Its Arginine Residue

To examine whether the radioactivity of [alpha-P]NAD incorporated into RT6.1 is caused by mono-ADP-ribosylation, the radiolabeled RT6.1 was treated with snake venom phosphodiesterase, and then radioactive materials released were analyzed by thin layer chromatography. As shown in Fig. 3, the major material was identified as 5`-[P]AMP, suggesting that the NAD-dependent modification of RT6.1 was due to mono-ADP-ribosylation. The modified amino acid of RT6.1 was further investigated by means of a chemical stability of the ADP-ribosyl bond connected to amino acids. [P]ADP-ribosylated RT6.1, after being separated by SDS-PAGE, was transferred into a polyvinylidene fluoride filter, and then the filter was treated with NH(2)OH or HgCl(2) (Fig. 4). There was a marked decrease in the radioactivity of RT6.1 upon treatment of the filter with NH(2)OH, as observed in the [P]ADP-ribosylated alpha-subunit of G(s), which had been induced by cholera toxin (Fig. 4B). Radiolabeled compound recovered after the NH(2)OH treatment was identified as [P]ADP-ribose (data not shown). However, such a decrease in the radiolabeled RT6.1 was not observed at all in HgCl(2) treatment under the conditions that [P]ADP-ribose incorporated into G(i)-alpha by pertussis toxin was eliminated (Fig. 4C). These results strongly suggested that the mono-ADP-ribosylation occurred at an arginine residue of RT6.1.


Figure 3: Release of 5`-[P]AMP by treatment of the radiolabeled RT6.1 with snake venom phosphodiesterase. Lymphocytes (2 times 10^6 cells) were incubated with [alpha-P]NAD for 1 h, washed, and solubilized with 130 µl of lysis buffer. After centrifugation, 56 µl of 90% trichloroacetic acid was added to the lysate, followed by standing on ice for 10 min. After centrifugation, the precipitate was washed with 4% trichloroacetic acid and dissolved in 15 µl of 0.2 M Tris-HCl (pH 9.0). This sample was further incubated with (PDE) or without (Cont) 0.5 units of snake venom phosphodiesterase (Boehringer Mannheim) in the presence of 6 mM MgCl(2) at 37 °C for 30 min. The reaction mixture (5 µl) was applied on a polyethyleneimine cellulose plate (Schleicher & Schuell) and developed with 0.5 M formic acid/0.1 M lithium chloride (A) or 0.5 M guanidine hydrochloride (B). Autoradiography was obtained as described under ``Experimental Procedures.''




Figure 4: Treatment of [P]ADP-ribosylated RT6.1 with hydroxylamine or mercury chloride. [P]ADP-ribosylated RT6.1 (RT6.1) in rat lymphocytes (3 times 10^6 cells), together with the alpha-subunits of G(s) (420 ng; alpha) and G(i) (215 ng; alpha), which had been [P]ADP-ribosylated by cholera and pertussis toxins, respectively, was subjected to SDS-PAGE, and then the separated proteins were transferred to a polyvinylidene difluoride filter as described under ``Experimental Procedures.'' The filters were incubated with 1 M NaCl (A), 1 M neutralized NH(2)OH (B), or 10 mM HgCl(2) (C) at 45 °C for 2 h and then subjected to autoradiography.



ADP-ribosylation of RT6.1 Reversibly Proceeding in Intact Lymphocytes

Fig. 5shows time courses of the ADP-ribosylation of RT6.1 in rat lymphocytes. Initial rate of ADP-ribosylation was dependent on the concentration of NAD added in the reaction mixture. After the [P]ADP-ribosylation reached a plateau level, the cells were washed and followed by the incubation with unlabeled ADP-ribose. By this treatment, radioactive materials that were nonspecifically bound to the cell surface could be removed without the reduction of the extent of [P]ADP-ribosylated RT6.1. Therefore, [P]ADP-ribosylated RT6.1 comprised approximately 90% of total radioactivity in the cells (data not shown). When the cells were further incubated in the absence of [P]NAD, there was a marked decrease in the radiolabeled RT6.1 (Fig. 6). There was no proteolytic fragment of the radiolabeled RT6.1 (data not shown), and the loss of the radioactivity was mostly recovered from the incubation medium as [P]ADP-ribose (Fig. 6). Moreover, the decrease in [P]ADP-ribosylated RT6.1 observed in the absence of [P]NAD was specifically inhibited by the addition of ADP-ribose to the incubation medium. These results suggested that there was an enzyme(s) responsible for the removal of ADP-ribose from the modified RT6.1 (i.e. ADP-ribosylarginine glycohydrolase) in the cell surface of the lymphocytes.


Figure 6: Release of [P]ADP-ribose from [P]ADP-ribosylated RT6.1 in rat lymphocytes. Lymphocytes (5 times 10^5 cells) were incubated with 0.27 µM [P]NAD for 1 h as described under ``Experimental Procedures.'' The cells, after being washed, were suspended in HBSS containing 2 mM ADP-ribose in order to remove radioactive material that nonspecifically bound to the cell surface. After incubation at 37 °C for 10 min, the cells were resuspended in 200 µl of HBSS and immediately lysed (lane 1) or further incubated at 37 °C for 20 min with (lane 3) or without (lane 2) 2 mM ADP-ribose. A, the reaction mixture was analyzed by thin layer chromatography as described in Fig. 4A. B, the cells were lysed and then subjected to SDS-PAGE and autoradiography.



We further investigated whether RT6.1 once modified and de-ADP-ribosylated was still capable of being [P]ADP-ribosylated. After the first ADP-ribosylation by incubation with NAD, the cells were washed and incubated with or without ADP-ribose. By this incubation without NAD, RT6.1 once modified was expected to be de-ADP-ribosylated, and ADP-ribose inhibited the de-ADP-ribosylation (see Fig. 6). Then the cells were washed and subjected to [P]ADP-ribosylation (Fig. 7). RT6.1 on the cells that had been incubated without ADP-ribose at the second incubation was still capable of being [P]ADP-ribosylated (Fig. 7). However, [P]ADP-ribosylation of RT6.1 on the cells that had been incubated with ADP-ribose at the second incubation was not observed (Fig. 7). The second incubation with ADP-ribose did not affect following [P]ADP-ribosylation (data not shown). Thus, the ADP-ribosylation of RT6.1 appeared to proceed reversibly in intact rat lymphocytes if NAD was supplied to the extracellular environment.


Figure 7: ADP-ribosylation of RT6.1 reversibly proceeding in rat lymphocytes. Lymphocytes (5 times 10^5 cells) were first incubated with 1.1 µM non-radiolabeled NAD for 20 min as described under ``Experimental Procedures.'' The cells, after being washed, were incubated at 37 °C for 20 min in 200 µl of HBSS in the presence (lane 2) or absence (lane 1) of 2 mM ADP-ribose. The cells, after being washed, were incubated with 0.27 µM [P]NAD at 37 °C for 20 min. The cells were lysed and then subjected to SDS-PAGE and autoradiography.




DISCUSSION

In the present study, we demonstrated that NAD-dependent ADP-ribosylation of RT6.1 occurred in intact lymphocytes. This ADP-ribosylation appeared to be catalyzed by RT6.1 itself, because a recombinant RT6.1 that was expressed in E. coli as a fusion protein with MBP also exhibited the same modification upon incubation with NAD. However, ADP-ribosyltransferase activity of this fusion protein was extremely low. Moreover, such an ADP-ribosylation was not apparently observed when the membrane fraction instead of intact lymphocytes was incubated with [P]NAD (data not shown). Zolkiewska and Moss (7) have recently reported that integrin alpha7 is ADP-ribosylated by a GPI-anchored ADP-ribosyltransferase in differentiated C2C12 cells. They have showed that the ADP-ribosylation of integrin occurs only in the intact cells and not in the membrane fraction. Takada et al. (9) have reported that RT6.2 exogenously expressed in adenocarcinoma cells exhibits only NAD glycohydrolase activity; the evidence for an ADP-ribosylation of RT6.2 was not described in their report. These results suggest that enzyme reactions catalyzed by these ADP-ribosyltransferases proceed only when their substrates take certain forms under physiological conditions.

In this report, we could observe reversible ADP-ribosylation of RT6.1 in intact rat lymphocytes. The reaction mixture of the ADP-ribosylation used in the present study contained several nucleotides, such as ADP-ribose, FAD, and ATP, beside the substrate of NAD. These compounds were very effective in inhibiting the degradation of NAD added and/or the reversal reaction of ADP-ribosylated RT6.1. Especially the existence of ATP in the reaction mixture was essentially required for a significant level of the ADP-ribosylation of RT6.1 in the cells. In the previous study(20) , Maehama et al. indicate that ATP could inhibit activity of a rat ADP-ribosylarginine glycohydrolase, of which substrates included ADP-ribosylated GTP-binding proteins modified by cholera and botulinum C(2) toxins. Although the enzyme responsible for the reversal reaction of modified RT6.1 has not been extensively investigated in the present study, it can be assumed that there is an enzyme(s) similar to the rat ADP-ribosylarginine glycohydrolase in the cell surface. We observed that the ADP-ribosylation of RT6.1 occurred in the presence of submicromolar concentrations (0.1-0.2 µM) of NAD, suggesting that this modification may be considerable under the physiological conditions.

Recently, Wang et al. (23) have reported that an enzyme of GPI-anchored NAD:arginine ADP-ribosyltransferase is present in cultured cytotoxic T cells. Incubation of the T cells with NAD caused ADP-ribosylation of the cell surface proteins and suppressed the cell ability to lyse target cells. This suppression appeared to be resultant from the failure of the cytotoxic T cells to form specific conjugates with the target cells. It is thus tempting to speculate that the ADP-ribosylation of RT6.1 similarly exerts its influence on a cell function(s) of rat lymphocytes. Further study on the possible cell function(s) linked to this unique modification is currently under investigation in our laboratory.


FOOTNOTES

*
This work was supported by research grants from the Scientific Research Fund of the Ministry of Education, Science, and Culture of Japan. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Dept. of Physiological Chemistry, Faculty of Pharmaceutical Sciences, University of Tokyo, Hongo, Tokyo 113, Japan. Tel.: 81-3-3812-2111, Ext. 4750; Fax: 81-3-3815-9604.

(^1)
The abbreviations used are: GPI, glycosylphosphatidylinositol; MBP, maltose-binding protein; Chaps, 3-[(3-cholamidopropyl)dimethylammonio]-1-propanesulfonate; PAGE, polyacrylamide gel electrophoresis; HBSS, Hanks' balanced salt solution; G(s), GTP-binding protein that mediates stimulation of adenylate cyclase; G(i), GTP-binding protein that mediates inhibition of adenylate cyclase.


REFERENCES

  1. Collier, R. J. (1990) in ADP-ribosylating Toxins and G Proteins (Moss, J., and Vaughan, M., eds) pp. 3-19, American Society for Microbiology, Washington, D. C.
  2. Fishman, P. H. (1990) in ADP-ribosylating Toxins and G Proteins (Moss, J., and Vaughan, M., eds) pp. 127-140, American Society for Microbiology, Washington, D. C.
  3. Ui, M. (1990) in ADP-ribosylating Toxins and G Proteins (Moss, J., and Vaughan, M., eds) pp. 45-77, American Society for Microbiology, Washington, D. C.
  4. Tanuma, S., Kawashima, K., and Endo, H. (1988) J. Biol. Chem. 263,5485-5489 [Abstract/Free Full Text]
  5. Peterson, J. E., Larew, J. S.-A., and Graves, D. J. (1990) J. Biol. Chem. 265,17062-17069 [Abstract/Free Full Text]
  6. Zolkiewska, A., Nightingale, M. S., and Moss, J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,11352-11356 [Abstract/Free Full Text]
  7. Zolkiewska, A., and Moss, J. (1993) J. Biol. Chem. 268,25273-25276 [Abstract/Free Full Text]
  8. Okazaki, I. J., Zolkiewska, A., Nightingale, M. S., and Moss, J. (1994) Biochemistry 33,12828-12836 [CrossRef][Medline] [Order article via Infotrieve]
  9. Takada, T., Iida, K., and Moss, J. (1994) J. Biol. Chem. 269,9420-9423 [Abstract/Free Full Text]
  10. Takada, T., Iida, K., and Moss, J. (1995) J. Biol. Chem. 270,541-544 [Abstract/Free Full Text]
  11. Thiele, H.-G., Koch, F., and Kashan, A. (1987) Transplant. Proc. 19,3157-3160
  12. Greiner, D. L., Handler, E. S., Nakano, K., Mordes, J. P., and Rossini, A. A. (1986) J. Immunol. 136,148-151 [Abstract]
  13. Crisá, L., Sarkar, P., Waite, D. J., Haag, F., Koch-Nolte, F., Rajan, T. V., Mordes, J. P., Handler, E. S., Thiele, H.-G., Rossini, A. A., and Greiner, D. L. (1993) Diabetes 42,688-695 [Abstract]
  14. Kosuda, L. L., Hosseinzadeh, H., Greiner, D. L., and Bigazzi, P. E. (1994) J. Toxicol. Environ. Health 42,303-321 [Medline] [Order article via Infotrieve]
  15. Koch, F., Kashan, A., and Thiele, H.-G. (1988) Immunology 65,259-265 [Medline] [Order article via Infotrieve]
  16. Koch, F., Haag, F., Kashan, A., and Thiele, H.-G. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,964-967 [Abstract/Free Full Text]
  17. Chomczynski, P., and Sacchi, N. (1987) Anal. Biochem. 162,156-159 [Medline] [Order article via Infotrieve]
  18. Tsai, S.-C., Noda, M., Adamik, R., Chang, P. P., Chen, H.-C., Moss, J., and Vaughan, M. (1988) J. Biol. Chem. 263,1768-1772 [Abstract/Free Full Text]
  19. Katada, T., Oinuma, M., and Ui, M. (1986) J. Biol. Chem. 261,8182-8191 [Abstract/Free Full Text]
  20. Maehama, T., Nishina, H., and Katada, T. (1994) J. Biochem. (Tokyo) 116,1134-1138 [Abstract/Free Full Text]
  21. Kobayashi, I., Shibasaki, H., Takahashi, K., Kikkawa, S., Ui, M., and Katada, T. (1989) FEBS Lett. 257,177-180 [CrossRef][Medline] [Order article via Infotrieve]
  22. Kashan, A., Buck, F., Haag, F., Koch, F., and Thiele, H.-G. (1989) Immunol. Lett. 23,133-138 [CrossRef][Medline] [Order article via Infotrieve]
  23. Wang, J., Nemoto, E., Kots, A. Y., Kaslow, H. R., and Dennert, G. (1994) J. Immunol. 153,4048-4058 [Abstract]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
Z.-X. Liu, O. Azhipa, S. Okamoto, S. Govindarajan, and G. Dennert
Extracellular Nicotinamide Adenine Dinucleotide Induces T Cell Apoptosis In Vivo and In Vitro
J. Immunol., November 1, 2001; 167(9): 4942 - 4947.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
R. Bortell, J. Moss, R. C. McKenna, M. R. Rigby, D. Niedzwiecki, L. A. Stevens, W. A. Patton, J. P. Mordes, D. L. Greiner, and A. A. Rossini
Nicotinamide Adenine Dinucleotide (NAD) and Its Metabolites Inhibit T Lymphocyte Proliferation: Role of Cell Surface NAD Glycohydrolase and Pyrophosphatase Activities
J. Immunol., August 15, 2001; 167(4): 2049 - 2059.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
F. Koch-Nolte, T. Duffy, M. Nissen, S. Kahl, N. Killeen, V. Ablamunits, F. Haag, and E. H. Leiter
A New Monoclonal Antibody Detects a Developmentally Regulated Mouse Ecto-ADP-Ribosyltransferase on T Cells: Subset Distribution, Inbred Strain Variation, and Modulation Upon T Cell Activation
J. Immunol., December 1, 1999; 163(11): 6014 - 6022.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. Weng, W. C. Thompson, H.-J. Kim, R. L. Levine, and J. Moss
Modification of the ADP-ribosyltransferase and NAD Glycohydrolase Activities of a Mammalian Transferase (ADP-ribosyltransferase 5) by Auto-ADP-ribosylation
J. Biol. Chem., November 5, 1999; 274(45): 31797 - 31803.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. J. Okazaki and J. Moss
Glycosylphosphatidylinositol-anchored and Secretory Isoforms of Mono-ADP-ribosyltransferases
J. Biol. Chem., September 11, 1998; 273(37): 23617 - 23620.
[Full Text] [PDF]


Home page
J. Immunol.Home page
E. Lesma, J. Moss, H. B. Brewer, R. Bortell, D. Greiner, J. Mordes, and A. A. Rossini
Characterization of High Density Lipoprotein-Bound and Soluble RT6 Released Following Administration of Anti-RT6.1 Monoclonal Antibody
J. Immunol., August 1, 1998; 161(3): 1212 - 1219.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Moss, L. A. Stevens, E. Cavanaugh, I. J. Okazaki, R. Bortell, T. Kanaitsuka, J. P. Mordes, D. L. Greiner, and A. A. Rossini
Characterization of Mouse Rt6.1 NAD:Arginine ADP-ribosyltransferase
J. Biol. Chem., February 14, 1997; 272(7): 4342 - 4346.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Hara, M. Tsuchiya, and M. Shimoyama
Glutamic Acid 207in Rodent T-cell RT6 Antigens Is Essential for Arginine-specific ADP-ribosylation
J. Biol. Chem., November 22, 1996; 271(47): 29552 - 29555.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. J. Okazaki, H.-J. Kim, and J. Moss
Cloning and Characterization of a Novel Membrane-associated Lymphocyte NAD:Arginine ADP-ribosyltransferase
J. Biol. Chem., September 6, 1996; 271(36): 22052 - 22057.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Hara-Yokoyama, I. Kukimoto, H. Nishina, K. Kontani, Y. Hirabayashi, F. Irie, H. Sugiya, S. Furuyama, and T. Katada
Inhibition of NAD+ Glycohydrolase and ADP-ribosyl Cyclase Activities of Leukocyte Cell Surface Antigen CD38 by Gangliosides
J. Biol. Chem., May 31, 1996; 271(22): 12951 - 12955.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Koch-Nolte, D. Petersen, S. Balasubramanian, F. Haag, D. Kahlke, T. Willer, R. Kastelein, F. Bazan, and , H.-Gün. Thiele
Mouse T Cell Membrane Proteins Rt6-1 and Rt6-2 Are Arginine/Protein Mono(ADPribosyl)transferases and Share Secondary Structure Motifs with ADP-ribosylating Bacterial Toxins
J. Biol. Chem., March 29, 1996; 271(13): 7686 - 7693.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Maehama, T.
Right arrow Articles by Katada, T.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Maehama, T.
Right arrow Articles by Katada, T.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.