JBC PeproTech; Our Business is Cytokines!

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gillespie, L. L.
Right arrow Articles by Paterno, G. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gillespie, L. L.
Right arrow Articles by Paterno, G. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 39, Issue of September 29, pp. 22758-22763, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Cloning of a Fibroblast Growth Factor Receptor 1 Splice Variant from Xenopus Embryos That Lacks a Protein Kinase C Site Important for the Regulation of Receptor Activity (*)

(Received for publication, May 15, 1995)

Laura L. Gillespie (§) Gang Chen (¶) Gary D. Paterno

From the Terry Fox Cancer Research Laboratories, Division of Basic Medical Sciences, Faculty of Medicine, Memorial University of Newfoundland, St. John's, Newfoundland, Canada A1B 3V6

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

A cDNA clone, predicted to encode a variant form of the type 1 fibroblast growth factor receptor (FGFR1) containing a dipeptide Val-Thr (VT) deletion at amino acid positions 423 and 424 located within the juxtamembrane region, was isolated from a Xenopus embryo (stage 8 blastula) library. Sequence analysis of genomic DNA encoding a portion of the FGFR1 juxtamembrane region demonstrated that this variant form arises from use of an alternative 5` splice donor site. RNase protection analysis revealed that both VT- and VT+ forms of the FGFR1 were expressed throughout embryonic development, the VT+ being the major form. Amino acid position 424 is located within a consensus sequence for phosphorylation by a number of Ser/Thr kinases. We demonstrate that a VT+ peptide was specifically phosphorylated by protein kinase C (PKC) in vitro, but not by protein kinase A (PKA). A VT- peptide, on the other hand, was not a substrate for either enzyme. Phosphorylation levels of in vitro synthesized FGFR-VT+ protein by PKC were twice that of FGFR-VT- protein. In a functional assay, Xenopus oocytes expressing FGFR-VT- or FGFR-VT+ protein were equally able to mobilize intracellular Ca in response to basic fibroblast growth factor (bFGF). However, pretreatment with phorbol 12-myristate 13-acetate significantly reduced this mobilization in oocytes expressing FGFR-VT+ while having little effect on oocytes expressing FGFR-VT-. These findings demonstrate that alternative splicing of Val-Thr generates isoforms which differ in their ability to be regulated by phosphorylation and thus represents an important mechanism for regulating FGFR activity.


INTRODUCTION

Fibroblast growth factors (FGFs) (^1)play a role in a number of cellular responses, including mitogenesis, differentiation, angiogenesis, and transformation (reviewed in (1) ). The family of FGFs consists of nine distinct members(2) , related by amino acid sequence and their ability to bind heparin, that mediate their response by binding to high affinity cell surface FGF receptors (FGFRs). Functional FGFRs are transmembrane proteins composed of an extracellular ligand-binding domain containing two or three immunoglobulin (Ig)-like domains and an intracellular domain consisting of a juxtamembrane region, a split tyrosine kinase domain and a COOH-terminal tail (reviewed in (3) ). FGF binding to the extracellular domain of the FGFR results in receptor activation through dimerization and autophosphorylation. The activated receptor can then bind and phosphorylate a number of intracellular substrates, thus altering their catalytic activity and initiating intracellular signal transduction cascades (reviewed in (3) ).

FGFRs are encoded by four genes whose transcripts are alternatively spliced to produce a number of variant forms (reviewed in (3) ). Each of the four FGFR types is capable of binding more than one member of the FGF family, the ligand binding specificity being determined not only by the receptor type but by the splicing form. For example, alternative splicing of exons encoding the COOH-terminal half of the third Ig domain of FGFR2 leads to production of FGFRs that no longer recognize FGF-7(4) . In addition, Shi et al.(5) has described an alternatively spliced FGFR isoform that encodes a truncated, kinase-defective receptor which can heterodimerize with full-length FGFRs and reduce tyrosine kinase activity. Clearly, alternative splicing represents an important mechanism by which FGFR activity can be regulated.

FGFs induce differentiation of mesoderm in Xenopus embryonic tissue(6, 7, 8) , and FGFR signaling has been shown to be required for this developmental event(9) . Mesoderm induction during embryonic development is precisely regulated in time and space to produce a distinct pattern of mesodermal tissues. In order to investigate the molecular mechanisms involved in regulating this complex developmental process, it is important initially to determine which FGFR genes are involved and how FGFR signaling is regulated. Evidence to date suggests that FGFR1 is likely to be important, since both mRNA (10, 11) and protein (12) for FGFR1 are present in Xenopus blastulae, the stage during which mesoderm induction takes place in the embryo. In addition, we have demonstrated that FGFR1 was activated during FGF-induced mesoderm differentiation in Xenopus(12) . Consequently, we decided to focus on the FGFR1 gene and determine which FGFR1 isoforms may be important for mesoderm induction.

Two reports have described FGFR1s cloned from Xenopus, however, neither isolated cDNA from embryos. Musci et al.(10) cloned a three-Ig domain FGFR1 from an oocyte library, whereas Friesel and Dawid (11) cloned both two- and three-Ig forms from a Xenopus cell line (XTC). Accordingly, we prepared and screened a cDNA library from Xenopus blastulae for FGFR1 species. This paper describes a Xenopus FGFR1 isoform which differs in its ability to be regulated by protein kinase C (PKC).


EXPERIMENTAL PROCEDURES

Materials

Xenopus laevis were purchased from Nasco and maintained as described in (13) . Eggs were artificially inseminated, the jelly coats removed, and the embryos cultured as described in Godsave et al.(14) . Synthetic peptides corresponding to FGFR-VT+ (IPLRRQVTVSGDSS) and FGFR-VT- (IPLRRQVSGDSS) were purchased from the Alberta Peptide Institute (Edmonton, Alberta). Recombinant Xenopus bFGF was expressed and purified according to Kimelman et al.(15) then stored at -20 °C. The anti-FGFR1 used for immunoprecipitation in this study was a polyclonal antibody raised against a synthetic COOH-terminal peptide (12) .

cDNA Cloning and Sequencing of an FGFR1 Isoform from Xenopus Embryos

A cDNA library was constructed from mRNA isolated from stage 8 Xenopus blastulae using the ZAP II kit (Stratagene) as directed. The library was screened using a 400-bp fragment of the Xenopus FGFR1 cDNA previously cloned by PCR. (^2)This 400-bp fragment was amplified from Xenopus stage 17 first strand cDNA using oligonucleotide primers within the FGFR1 tyrosine kinase domain. The 400-bp amplification product was then cloned in the EcoRV site of Bluescript KS+ and sequenced on both strands, verifying its identity as a fragment of the Xenopus FGFR1. The 400-bp fragment was radiolabeled by random primer labeling (Life Technologies, Inc.) to a specific activity of 5 times 10^8 cpm/µg. This probe was used to screen 1.5 times 10^6 recombinant plaques, as described in Wahl and Berger(16) . Twelve positive plaques were isolated and the largest of these contained a 3.8-kb insert which was further characterized. The cDNA sequence for both strands of the 3.8-kb insert was determined by the dideoxy chain termination method (17) using the Sequenase system (U. S. Biochemical Corp.).

Sequencing of a Genomic Fragment Containing the VT Region of the FGFR1

A 1.2-kb genomic fragment containing the VT region was amplified from a Xenopus genomic library (Stratagene). The amplification was performed with oligonucleotide primers 5`(GGGCTGCTTTTGTGTCCGCAAT) and 3`(GCCATGACTACTTGCC) bracketing the VT region (see Fig. 1for location of primers), for 30 cycles consisting of denaturation at 94 °C for 1 min, annealing at 50 °C for 1 min and extension at 72 °C for 2 min. PCR products were separated on 1% agarose, the 1.2-kb band cut out and the DNA extracted from the agarose gel with Qiaex (Qiagen) according to the manufacturer's directions. Sequencing was performed as above, using the PCR primers.


Figure 1: Amino acid comparison of Xenopus FGFR1s. The amino acid sequence of our clone, FGFR-VT-, was aligned with the FGFR1 (XFGFR) cloned by Musci et al.(10) and that reported by Friesel and Dawid (11) (XFGFR-A2). Only amino acid changes are listed for XFGFR and XFGFR-A2, and dashes indicate amino acid deletions. The transmembrane domain is underlined and the position of the two PCR primers used to amplify the genomic fragment in Fig. 2are indicated by half-arrows. Restriction enzyme sites used for plasmid construction are indicated by arrows on the corresponding amino acid sequence.




Figure 2: Genomic fragment spanning the VT region. Partial sequence of the genomic fragment, amplified by PCR using primers (shown in Fig. 1) that bracket the VT region, is shown with the predicted amino acid sequence listed underneath. Predicted exon and intron sequences are shown in upper- and lowercase, respectively, with the sequence encoding Val and Thr shown in bold. Alternative 5` splice donor sites used to generate the VT- or VT+ isoforms are indicated by arrows.



RNase Protection Analysis

RNA was extracted and purified from whole embryos using the LiCl/urea protocol described in Goldin (18) . RNase protections were performed as in Paterno et al.(7) . The RNA antisense probe was prepared from a BstEII-HgaI cDNA fragment of XFGFR-A2 (gift from Dr. Robert Friesel, American Red Cross) cloned into the EcoRV site of pBluescript KS+ (Stratagene). Transcription from the T7 promoter yielded a 261-base probe which protected a fragment of 162 bases for the VT+ isoform and two fragments of 107 and 49 bases for the VT- isoform.

PKC and PKA Phosphorylation Assays

Phosphorylation by PKC of both the peptides (see ``Materials'' for sequence) and full-length FGFR1 protein was measured using a PKC assay kit (Life Technologies, Inc.), 15 ng of purified PKC enzyme (Upstate Biotechnology, Inc.), and 10 µCi [-P]ATP (Amersham Corp.) per reaction. The FGFR1 proteins used in this assay were synthesized in vitro from the FGFR-VT-pcDNAIneo or FGFR-VT+pcDNAIneo plasmids (plasmid construction described below) using a coupled transcription/translation system (Promega) as described in Ryan and Gillespie(12) . The assays were performed according the manufacturer's directions with the exception that the 5 times substrate solution supplied with the kit was replaced with one lacking the control peptide substrate. The substrate was then added separately to each reaction: 25 µM peptide or in vitro synthesized FGFR1-VT- or -VT+ protein that had been purified by immunoprecipitation from equal inputs of trichloroacetic acid-precipitable counts/min. The control substrate was a gift from Dr. J. Reynolds (Memorial University) and consisted of a synthetic peptide (CNPLLRMFSFKAPT) corresponding to amino acids 336-348 of the 2L subunit of the -aminobutyric acid receptor, which contains a Ser that is phosphorylated by PKC(19) .

PKA phosphorylation assays were performed using 115 ng of PKA (Upstate Biotechnology, Inc.), 25 µM peptide, 10 µCi of [-P]ATP in a buffer containing 20 mM Tris, pH 7.5, 1 mM EGTA, 5 mM MgCl(2), and 200 µM ATP. The control substrate was a 9-amino acid synthetic peptide (GRTGRRNSI) purchased from Upstate Biotechnology, Inc.

Plasmid Construction

An FGFR-VT- receptor construct lacking both 5`- and 3`-untranslated regions was generated by subcloning a BseAI-RcaI cDNA fragment (Fig. 1), which encodes most of the open reading frame (amino acids 3-789) of the FGFR-VT- cDNA, into the same sites of a pcDNAIneo mammalian expression vector containing the FGFR-A2 cDNA. The FGFR-A2pcDNAIneo plasmid contains the coding region of an FGFR1 isoform lacking the first Ig domain (11) inserted into the BamHI site of pcDNAIneo (Invitrogen). The FGFR-VT+ receptor construct was generated by subcloning a BstEII-RcaI cDNA fragment (Fig. 1) of the FGFR-A2pcDNAIneo, encoding the transmembrane and intracellular domains, into the same sites of FGFR-VT-pcDNAIneo plasmid. The FGFRSP64T constructs used for expression in Xenopus oocytes were generated by subcloning a BamHI fragment, containing the entire FGFR coding region, from the FGFR-VT-pcDNAIneo or FGFR-VT+pcDNAIneo constructs in the BglII site of the SP64T vector(20) .

Oocyte Injections and Protein Analysis

cRNA was transcribed using the SP6 Ribomax system (Promega) from the FGFRSP64T constructs (described above) that had been linearized with XbaI. 4.6 nl containing 500 pg of cRNA was microinjected into stage VI Xenopus oocytes prepared and cultured as described in Amaya et al.(9) . Injected oocytes were metabolically labeled by culturing for 24 h at 22 °C in medium containing 1 mCi/ml [S]methionine (1000 Ci/mmol; DuPont NEN). After extensive washing, the oocytes were solubilized and the FGFR immunoprecipitated as described in Ryan and Gillespie(12) . The immunoprecipitates were analyzed by 8% SDS-polyacrylamide gel electrophoresis followed by autoradiography.

CaRelease Assays

Microinjected oocytes were maintained at 22 °C for 24 h, washed extensively in Ca-free medium, then loaded for 3 h with Ca (10 Ci/g; DuPont NEN) at a final concentration of 100 µCi/ml. Ca release was measured from groups of 10 oocytes as described in Amaya et al.(9) . Phorbol 12-myristate 13-acetate (PMA; Life Technologies, Inc.) and Xenopus bFGF were added at the indicated times to a final concentration of 250 nM and 100 ng/ml, respectively.


RESULTS

Mesoderm induction takes place during blastula stages of Xenopus development. In our efforts to understand the role of the FGFR in this induction event, we set out to identify FGFR1 isoforms that are expressed during blastula stages. We prepared a cDNA library from mid-blastula (stage 8) Xenopus embryos and screened it for FGFR1. A positive plaque containing a 3.8-kb insert was purified and sequenced. The cDNA consisted of an open reading frame of 2.4 kb bracketed by a 183-bp 5`-untranslated region and 1.3-kb 3`-untranslated region. The amino acid of our clone was compared with previously cloned Xenopus FGFR1s: XFGFR (10) and XFGFR-A2 (11) (Fig. 1). Our clone and XFGFR encode FGFRs containing three Ig domains in the extracellular region while XFGFR-A2 contains only two; this is a common variation of the FGFR1 that has been extensively studied in other species (reviewed in (3) ). Our clone was most similar to XFGFR-A2 in the remaining sequence, with only four amino acid changes as opposed to eight for XFGFR. Examination of these amino acid changes revealed one common difference between our clone and the other two: the deletion of Val-Thr (VT) in the juxtamembrane region of our FGFR1 cDNA. We have therefore named our clone FGFR-VT-.

To investigate the possibility that this deletion is generated by alternative splicing, we sequenced a genomic fragment containing the VT region (Fig. 2). By comparing the genomic DNA sequence to the cDNA sequence, the amino acid sequence and 5` and 3` consensus splice sequences (5`: (C/A)AG/GU(G/A)AG; 3`: ((C/U))(n)NCAG/G; reviewed in (21) and (22) ), we were able to examine a number of possible origins for these two isoforms, including alternative exons and alternative 5` and/or 3` splice sites. We concluded that the most likely mechanism for the production of the two receptor forms is the use of alternative 5` splice donor sites (Fig. 2). Splicing to produce FGFR-VT- would make use of an excellent consensus 5` splice donor site, whereas the splice site to produce FGFR-A2 or XFGFR lacks three of the eight consensus nucleotides. Therefore, one would predict that the major splicing product would be FGFR-VT- mRNA. Interestingly, RNase protection of total RNA from embryos at various developmental stages revealed that in fact VT+ mRNA was the major form (Fig. 3). In addition, there appeared to be little change in ratio of the VT+/VT- isoforms at the developmental stages examined.


Figure 3: RNase protection of total RNA isolated from various stages of Xenopus embryonic development. A P-labeled 261-base probe corresponding to sequence of the VT+ isoform and spanning the VT region was used in RNase protection assays of total RNA isolated from embryos at various development stages. Digestion of probe:VT+ hybrids resulted in a 162-bp protected fragment while digestion of probe:VT- hybrids resulted in digestion of the six nucleotide single strand loop encoding the VT, producing two protected fragments of 107 and 49 bp. Thus, the two FGFR1 isoforms could be distinguished in the same sample. Lane a, probe; lane b, digested probe; lane c, in vitro transcribed FGFR-VT+ cRNA; lane d, in vitro transcribed FGFR-VT- cRNA; lanes e-l, total RNA isolated from the following developmental stages: stage 1, fertilized egg; stage 2, 2-cell; stage 6, 32-cell; stage 8, mid-blastula; stage 10, gastrula; stage 16, neurula; stage 24, tailbud; and stage 41, tadpole. The positions of the undigested probe and the VT+ and VT- protected fragments are indicated.



A similar deletion of Thr-Val was reported for a FGFR1 cDNA cloned from a human hepatoma cell line(23) . These authors suggested that this location may represent a possible site for phosphorylation by a Ser/Thr kinase. Comparison with consensus sequences for various Ser/Thr kinases (24) revealed that amino acid position 424 was located within a consensus sequence for phosphorylation by PKC and PKA; in FGFR-VT-, a Ser is in this position, whereas in the VT+ isoform, a Thr is in this location. We decided to examine whether this Ser or Thr could be phosphorylated by PKC or PKA. Two peptides, corresponding to amino acids 417-428 of FGFR-VT- or amino acids 417-430 of the VT+ isoform, were synthesized and used in in vitro kinase assays. As can be seen in Fig. 4A, neither peptide was phosphorylated by PKA. PKC, on the other hand, selectively phosphorylated the VT+ peptide. We also examined the ability of PKC to phosphorylate the full-length proteins. For this purpose, we constructed an FGFR1 that contains 3 Ig domains and Val-Thr, thus differing from FGFR-VT- only by the presence of Val-Thr. We refer to this construct as FGFR-VT+. The substrates in this PKC assay were FGFR-VT- or FGFR-VT+ protein isolated by immunoprecipitation from in vitro transcription/translation reactions. Both proteins were phosphorylated by PKC (Fig. 4B); however, twice as much [P]PO(4) was incorporated into FGFR-VT+. This demonstrates that the full-length proteins were substrates for PKC and that presence of the VT increased the degree of phosphorylation. The fact that FGFR-VT- protein, but not the peptide, was phosphorylated by PKC suggests that there are additional phosphorylation sites in the protein.


Figure 4: Phosphorylation of the VT+ and VT- isoforms by Ser/Thr kinases in vitro. A, incorporation of [P]PO(4) into VT+ and VT- peptides by PKC or PKA in vitro. Assays were performed as described under ``Experimental Procedures.'' PKC assays were carried out in the presence or absence of an PKC-specific inhibitor peptide. PKC-specific phosphorylation was calculated by subtracting the counts/min incorporated in the presence of inhibitor from that incorporated in the absence of inhibitor. PKA assays were performed in the presence or absence of peptide and the difference used to calculate PKA-specific incorporation. The average and standard deviation of three separate experiments is shown. P incorporation into the PKC control substrate peptide was 50,825 cpm/nmol and that for the PKA control substrate peptide was 672,506 cpm/nmol. B, incorporation of P into FGFR-VT+ and FGFR-VT- protein by PKC. The substrate in each case was in vitro synthesized protein isolated by immunoprecipitation. Assays were performed as in A. The average and standard deviation of three separate experiments is shown.



One of the questions that remained was whether differential phosphorylation of these two isoforms by PKC affects receptor function. To examine this question, we measured mobilization of intracellular Ca stimulated by FGF in oocytes expressing either form of the FGFR1. Mobilization of intracellular Ca, as measured by Ca efflux from oocytes, is commonly employed as a functional assay of FGFR activity(9, 10, 25) . Xenopus oocytes were microinjected with H(2)O (control) or mRNA encoding either FGFR-VT+ or FGFR-VT-. After a 24-h incubation period to allow for expression of FGFR protein, oocytes were loaded with Ca in calcium-free medium. Ca release into the medium was measured in response to addition of 100 ng/ml Xenopus bFGF (XbFGF) to oocytes; parallel samples were pretreated for 20 min with 250 nM PMA, a phorbol ester that activates PKC, before addition of XbFGF. H(2)O-injected oocytes showed no response to XbFGF (Fig. 5A). Oocytes expressing either FGFR isoform exhibited a similar response to XbFGF treatment alone but not when stimulated with XbFGF in the presence of PMA (Fig. 5, B and C). Pretreatment with PMA resulted in a slight reduction in the magnitude of the Ca release by oocytes expressing FGFR-VT- (Fig. 5B), whereas the Ca release by oocytes expressing FGFR-VT+ was significantly reduced (Fig. 5C). To verify that, in these experiments, the oocytes expressed equal amounts of FGFR-VT- or VT+ protein, FGFRs were immunoprecipitated from oocytes labeled with [S]methionine and the precipitates analyzed by SDS-polyacrylamide gel electrophoresis. The inset in Fig. 5C shows that there was no difference in the synthesis of VT- and VT+ FGFR proteins.


Figure 5: FGF-stimulated Ca release from oocytes expressing FGFR-VT- or FGFR-VT+ protein. Xenopus oocytes were microinjected with H(2)O or cRNA encoding either FGFR-VT- or FGFR-VT+ and loaded with Ca, as described under ``Experimental Procedures.'' Each sample contained 10 oocytes and measurements were taken at 10-min intervals by removing 500 µl of medium for scintillation counting and replacing it with 500 µl of fresh medium. 250 nM PMA and 100 ng/ml Xenopus bFGF were added at the indicated times, for 30 and 10 min, respectively. The experiment was performed on three separate occasions and a representative experiment is shown. A, H(2)O-injected oocytes. B, oocytes injected with FGFR-VT- cRNA. C, oocytes injected with FGFR-VT+ cRNA. Inset in C, S-labeled FGFR protein immunoprecipitated from oocytes injected with FGFR-VT- cRNA (lane 1) or FGFR-VT+ cRNA (lane 2). , FGF; bullet, FGF + PMA.




DISCUSSION

FGFs are known to mediate a number of diverse and complex cellular responses (reviewed in (1) ). The existence of nine different FGFs, four FGFR genes with a number of alternative spliced forms may in part explain the pleiotropic effects of the FGF family. Thus, it will be important to investigate the biological activity of the different FGFR gene products, in response to different FGF members, in order to elucidate the signal transduction pathways leading to these varied responses. We have isolated an FGFR1 cDNA from Xenopus blastulae that differs from previously cloned Xenopus FGFR1s by a Val-Thr deletion in the juxtamembrane region. Although similar isoforms have been cloned from a human hepatoma cell line (23) and from rat brain(26) , their biological activity was not characterized. We show here that Thr can be phosphorylated by PKC and in an in vivo functional assay, we demonstrate that the biological activity of the FGFR1 containing this Thr was significantly reduced by activation of PKC.

Our data shows that, as in the human FGFR1 gene(27) , the nucleotides encoding the Val-Thr are located at an exon-intron boundary, indicating that this isoform is generated by the use of an alternative 5` splice site. Both FGFR-VT- and -VT+ mRNA were expressed in Xenopus embryos at various stages of development and contrary to what one would predict from comparison to 5` splice site consensus sequences, FGFR-VT- was the minor form. However, it has been suggested that identity of consensus sequences at the 5` splice site is not the sole determinant in site selection but that there must be other sequence elements or factors that contribute to the choice of 5` splice site(22) .

We have shown that Thr can be phosphorylated by PKC. In the VT- peptide, a Ser is in position 424, but was not a substrate for PKC. Since PKC requires basic residues in the -3 to +3 region of the phosphoacceptor site(24) , one possible explanation for this discrepancy is the presence of an acidic residue (Asp) in the +2 position. Alternatively, deletion of Val-Thr may change the secondary structure in this region, modifying recognition by PKC.

Members of the FGF family induce mesoderm differentiation in explanted tissue from Xenopus embryos (6, 7, 8) and are thought to play a role in mesodermal patterning in the developing embryo. Convincing evidence for this comes from experiments with a dominant negative mutant construct of the FGFR1 which inhibited wild-type receptor activity(9) . These authors showed that expression of mutant FGFR1 in Xenopus embryos resulted in deficiencies in organized mesodermal tissue, suggesting a specific role for FGF in differentiation of presumptive mesodermal tissue. However, FGFRs are present on the surface of all cells in the embryo during blastula stages(28) , making it was unclear how FGF induction might be limited to presumptive mesoderm. In further studies, we demonstrated that PKC was activated during mesoderm induction by FGF in explants(29) . Our data suggested that PKC was involved in the negative regulation of FGFR activity, since pretreatment of explants with PMA inhibited FGF induction in this tissue. These data suggest there may be an autocrine regulation of FGFR activity whose extent may depend upon the proportion of VT+ and VT- forms expressed by individual cells or tissues. Certainly, the tissue-specific expression pattern of the two isoforms in the adult rat suggests that the VT- isoform plays an important role in mediating FGF responses in the brain(26) . Although we observed no change in the temporal expression pattern of mRNA encoding the two isoforms in the whole embryo, differential expression may occur over shorter time periods than those examined or FGFR-VT- mRNA may be selectively expressed in a subpopulation of cells within the embryo. We are currently investigating which FGFR1 isoforms are expressed in different tissues of the Xenopus blastula and determining the biological role of these two isoforms in the developing embryo.


FOOTNOTES

*
This work was supported by a grant (to L. L. G. and G. D. P.) from the Medical Research Council of Canada. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed.

Present address: Dept. of Biochemistry, 3655 Drummond St., McGill University, Montreal, Quebec H3G 1Y6. Tel.: 709-737-6293; Fax: 709-737-7010.

(^1)
The abbreviations used are: FGFs, fibroblast growth factors; bFGF, basic FGF; XbFGF, Xenopus bFGF; FGFRs, FGF receptors; PKC, protein kinase C; PKA, protein kinase A; bp, base pair(s); kb, kilobase(s); PCR, polymerase chain reaction; PMA, phorbol 12-myristate 13-acetate.

(^2)
L. L. Gillespie, unpublished data.


ACKNOWLEDGEMENTS

We thank Langtuo Deng for technical assistance.


REFERENCES

  1. Baird, A., and Klagsburn, M. (1991) The Fibroblast Growth Factor Family , The New York Academy of Sciences, New York
  2. Miyamoto, M., Naruo, K.-I., Seko, C., Matsumoto, S., Kondo, T., and Kurokawa, T. (1993) Mol. Cell. Biol. 13,4251-4259 [Abstract/Free Full Text]
  3. Jaye, M., Schlessinger, J., and Dionne, C. A. (1992) Biochim. Biophys. Acta 1135,185-199 [Medline] [Order article via Infotrieve]
  4. Miki, T., Bottaro, D. P., Fleming, T. P., Smith, C. L., Burgess, W. H., Chan, A. M.-L., and Aaronson, S. A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,246-250 [Abstract/Free Full Text]
  5. Shi, E., Kan, M., Xu, J., Wang, F., Hou, J., and McKeehan, W. L. (1993) Mol. Cell. Biol. 13,3907-3918 [Abstract/Free Full Text]
  6. Slack, J. M. W., Darlington, B. G., Heath, J. K., and Godsave, S. F. (1987) Nature 326,197-200 [CrossRef][Medline] [Order article via Infotrieve]
  7. Paterno, G. D., Gillespie, L. L., Dixon, M. S., Slack, J. M. W., and Heath, J. K. (1989) Development (Camb.) 106,79-83 [Abstract]
  8. Isaacs, H. V., Tannahill, D., and Slack, J. M. W. (1992) Development (Camb.) 114,711-720 [Abstract]
  9. Amaya, E., Musci, T. J., and Kirschner, M. W. (1991) Cell 66,257-270 [CrossRef][Medline] [Order article via Infotrieve]
  10. Musci, T. J., Amaya, E., and Kirschner, M. W. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,8365-8369 [Abstract/Free Full Text]
  11. Friesel, R., and Dawid, I. (1991) Mol. Cell. Biol. 11,2481-2488 [Abstract/Free Full Text]
  12. Ryan, P. J., and Gillespie, L. L. (1994) Dev. Biol. 166,101-111 [CrossRef][Medline] [Order article via Infotrieve]
  13. Wu, M., and Gerhart, J. (1991) Methods Cell Biol. 36,3-17 [Medline] [Order article via Infotrieve]
  14. Godsave, S. F., Isaacs, H., and Slack, J. M. W. (1988) Development (Camb.) 102,555-566 [Abstract]
  15. Kimelman, D., Abraham, J. A., Haaparanta, T., Palisi, T. M., and Kirschner, M. W. (1988) Science 242,1053-1056 [Abstract/Free Full Text]
  16. Wahl, G. M., and Berger, S. L. (1987) Methods Enzymol. 152,415-423 [Medline] [Order article via Infotrieve]
  17. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74,5463-5467 [Abstract/Free Full Text]
  18. Goldin, A. L. (1991) Methods Cell Biol. 36,487-509 [Medline] [Order article via Infotrieve]
  19. Whiting, P., Mckernan, R. M., and Iversen, L. L. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,9966-9970 [Abstract/Free Full Text]
  20. Kreig, P. A., and Melton, D. A. (1984) Nucleic Acids Res. 12,7057-7070 [Abstract/Free Full Text]
  21. Green, M. (1991) Annu. Rev. Cell Biol. 7,559-599 [CrossRef]
  22. Horowitz, D. S., and Krainer, A. R. (1994) Trends Genet. 10,100-106 [CrossRef][Medline] [Order article via Infotrieve]
  23. Hou, J., Kan, M., McKeehan, K., McBride, G., Adams, P., and McKeehan, W. L. (1991) Science 251,665-668 [Abstract/Free Full Text]
  24. Kennelly, P. J., and Krebs, E. G. (1991) J. Biol. Chem. 266,15555-15558 [Free Full Text]
  25. Ueno, H., Gunn, M., Dell, K., Tseng, A., Jr., and Williams, L. (1992) J. Biol. Chem. 267,1470-1476 [Abstract/Free Full Text]
  26. Yazaki, N., Fujita, H., Ohta, M., Kawasaki, T., and Itoh, N. (1993) Biochim. Biophys. Acta 1172,37-42 [Medline] [Order article via Infotrieve]
  27. Johnson, D. E., Lu, J., Chen, H., Werner, S., and Williams, L. T. (1991) Mol. Cell. Biol. 11,4627-4634 [Abstract/Free Full Text]
  28. Gillespie, L. L., Paterno, G. D., and Slack, J. M. W. (1989) Development (Camb.) 106,203-208 [Abstract]
  29. Gillespie, L. L., Paterno, G. D., Mahadevan, L. C., and Slack, J. M. W. (1992) Mech. Dev. 38,99-108 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Endocr. Rev.Home page
L. M. Cotton, M. K. O'Bryan, and B. T. Hinton
Cellular Signaling by Fibroblast Growth Factors (FGFs) and Their Receptors (FGFRs) in Male Reproduction
Endocr. Rev., April 1, 2008; 29(2): 193 - 216.
[Abstract] [Full Text] [PDF]


Home page
EndocrinologyHome page
J. C. Barnard, A. J. Williams, B. Rabier, O. Chassande, J. Samarut, S.-y. Cheng, J. H. D. Bassett, and G. R. Williams
Thyroid Hormones Regulate Fibroblast Growth Factor Receptor Signaling during Chondrogenesis
Endocrinology, December 1, 2005; 146(12): 5568 - 5580.
[Abstract] [Full Text] [PDF]


Home page
Biol. Reprod.Home page
J. L. Kirby, L. Yang, J. C. Labus, and B. T. Hinton
Characterization of Fibroblast Growth Factor Receptors Expressed in Principal Cells in the Initial Segment of the Rat Epididymis
Biol Reprod, June 1, 2003; 68(6): 2314 - 2321.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
B. A. Tsui-Pierchala, R. C. Ahrens, R. J. Crowder, J. Milbrandt, and E. M. Johnson Jr.
The Long and Short Isoforms of Ret Function as Independent Signaling Complexes
J. Biol. Chem., September 6, 2002; 277(37): 34618 - 34625.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. D. Paterno, P. J. Ryan, K. R. Kao, and L. L. Gillespie
The VT+ and VT- Isoforms of the Fibroblast Growth Factor Receptor Type 1 Are Differentially Expressed in the Presumptive Mesoderm of Xenopus Embryos and Differ in Their Ability to Mediate Mesoderm Formation
J. Biol. Chem., March 24, 2000; 275(13): 9581 - 9586.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
S. H. Ong, G. R. Guy, Y. R. Hadari, S. Laks, N. Gotoh, J. Schlessinger, and I. Lax
FRS2 Proteins Recruit Intracellular Signaling Pathways by Binding to Diverse Targets on Fibroblast Growth Factor and Nerve Growth Factor Receptors
Mol. Cell. Biol., February 1, 2000; 20(3): 979 - 989.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
S. Yang, A. Lockwood, P. Hollett, R. Ford, and K. Kao
Overexpression of a Novel Xenopus Rel mRNA Gene Induces Tumors in Early Embryos
J. Biol. Chem., May 29, 1998; 273(22): 13746 - 13752.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
G. D. Paterno, Y. Li, H. A. Luchman, P. J. Ryan, and L. L. Gillespie
cDNA Cloning of a Novel, Developmentally Regulated Immediate Early Gene Activated by Fibroblast Growth Factor and Encoding a Nuclear Protein
J. Biol. Chem., October 10, 1997; 272(41): 25591 - 25595.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. R. Burgar, H. D. Burns, J. L. Elsden, M. D. Lalioti, and J. K. Heath
Association of the Signaling Adaptor FRS2 with Fibroblast Growth Factor Receptor 1 (Fgfr1) Is Mediated by Alternative Splicing of the Juxtamembrane Domain
J. Biol. Chem., February 1, 2002; 277(6): 4018 - 4023.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gillespie, L. L.
Right arrow Articles by Paterno, G. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gillespie, L. L.
Right arrow Articles by Paterno, G. D.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.