![]()
|
|
||||||||
(Received for publication, May 15, 1995) From the
A cDNA clone, predicted to encode a variant form of the type 1
fibroblast growth factor receptor (FGFR1) containing a dipeptide
Val-Thr (VT) deletion at amino acid positions 423 and 424 located
within the juxtamembrane region, was isolated from a Xenopus embryo (stage 8 blastula) library. Sequence analysis of genomic
DNA encoding a portion of the FGFR1 juxtamembrane region demonstrated
that this variant form arises from use of an alternative 5` splice
donor site. RNase protection analysis revealed that both VT- and
VT+ forms of the FGFR1 were expressed throughout embryonic
development, the VT+ being the major form. Amino acid position 424
is located within a consensus sequence for phosphorylation by a number
of Ser/Thr kinases. We demonstrate that a VT+ peptide was
specifically phosphorylated by protein kinase C (PKC) in
vitro, but not by protein kinase A (PKA). A VT- peptide, on
the other hand, was not a substrate for either enzyme. Phosphorylation
levels of in vitro synthesized FGFR-VT+ protein by PKC
were twice that of FGFR-VT- protein. In a functional assay, Xenopus oocytes expressing FGFR-VT- or FGFR-VT+
protein were equally able to mobilize intracellular Ca
Fibroblast growth factors (FGFs) ( FGFRs are encoded
by four genes whose transcripts are alternatively spliced to produce a
number of variant forms (reviewed in (3) ). Each of the four
FGFR types is capable of binding more than one member of the FGF
family, the ligand binding specificity being determined not only by the
receptor type but by the splicing form. For example, alternative
splicing of exons encoding the COOH-terminal half of the third Ig
domain of FGFR2 leads to production of FGFRs that no longer recognize
FGF-7(4) . In addition, Shi et al.(5) has
described an alternatively spliced FGFR isoform that encodes a
truncated, kinase-defective receptor which can heterodimerize with
full-length FGFRs and reduce tyrosine kinase activity. Clearly,
alternative splicing represents an important mechanism by which FGFR
activity can be regulated. FGFs induce differentiation of mesoderm
in Xenopus embryonic
tissue(6, 7, 8) , and FGFR signaling has been
shown to be required for this developmental event(9) . Mesoderm
induction during embryonic development is precisely regulated in time
and space to produce a distinct pattern of mesodermal tissues. In order
to investigate the molecular mechanisms involved in regulating this
complex developmental process, it is important initially to determine
which FGFR genes are involved and how FGFR signaling is regulated.
Evidence to date suggests that FGFR1 is likely to be important, since
both mRNA (10, 11) and protein (12) for FGFR1
are present in Xenopus blastulae, the stage during which
mesoderm induction takes place in the embryo. In addition, we have
demonstrated that FGFR1 was activated during FGF-induced mesoderm
differentiation in Xenopus(12) . Consequently, we
decided to focus on the FGFR1 gene and determine which FGFR1 isoforms
may be important for mesoderm induction. Two reports have described
FGFR1s cloned from Xenopus, however, neither isolated cDNA
from embryos. Musci et al.(10) cloned a three-Ig
domain FGFR1 from an oocyte library, whereas Friesel and Dawid (11) cloned both two- and three-Ig forms from a Xenopus cell line (XTC). Accordingly, we prepared and screened a cDNA
library from Xenopus blastulae for FGFR1 species. This paper
describes a Xenopus FGFR1 isoform which differs in its ability
to be regulated by protein kinase C (PKC).
Figure 1:
Amino acid comparison of Xenopus FGFR1s. The amino acid sequence of our clone, FGFR-VT-, was
aligned with the FGFR1 (XFGFR) cloned by Musci et al.(10) and that reported by Friesel and Dawid (11) (XFGFR-A2). Only amino acid changes are listed for XFGFR
and XFGFR-A2, and dashes indicate amino acid deletions. The
transmembrane domain is underlined and the position of the two PCR
primers used to amplify the genomic fragment in Fig. 2are
indicated by half-arrows. Restriction enzyme sites used for
plasmid construction are indicated by arrows on the
corresponding amino acid sequence.
Figure 2:
Genomic fragment spanning the VT region.
Partial sequence of the genomic fragment, amplified by PCR using
primers (shown in Fig. 1) that bracket the VT region, is shown
with the predicted amino acid sequence listed underneath. Predicted
exon and intron sequences are shown in upper- and lowercase, respectively, with the sequence encoding
Val
PKA
phosphorylation assays were performed using 115 ng of PKA (Upstate
Biotechnology, Inc.), 25 µM peptide, 10 µCi of
[
Mesoderm induction takes place during blastula stages of Xenopus development. In our efforts to understand the role of
the FGFR in this induction event, we set out to identify FGFR1 isoforms
that are expressed during blastula stages. We prepared a cDNA library
from mid-blastula (stage 8) Xenopus embryos and screened it
for FGFR1. A positive plaque containing a 3.8-kb insert was purified
and sequenced. The cDNA consisted of an open reading frame of 2.4 kb
bracketed by a 183-bp 5`-untranslated region and 1.3-kb 3`-untranslated
region. The amino acid of our clone was compared with previously cloned Xenopus FGFR1s: XFGFR (10) and XFGFR-A2 (11) (Fig. 1). Our clone and XFGFR encode FGFRs
containing three Ig domains in the extracellular region while XFGFR-A2
contains only two; this is a common variation of the FGFR1 that has
been extensively studied in other species (reviewed in (3) ).
Our clone was most similar to XFGFR-A2 in the remaining sequence, with
only four amino acid changes as opposed to eight for XFGFR. Examination
of these amino acid changes revealed one common difference between our
clone and the other two: the deletion of Val To investigate the
possibility that this deletion is generated by alternative splicing, we
sequenced a genomic fragment containing the VT region (Fig. 2).
By comparing the genomic DNA sequence to the cDNA sequence, the amino
acid sequence and 5` and 3` consensus splice sequences (5`:
(C/A)AG/GU(G/A)AG; 3`: ((C/U))
Figure 3:
RNase protection of total RNA isolated
from various stages of Xenopus embryonic development. A
A similar deletion of Thr-Val was reported for a FGFR1
cDNA cloned from a human hepatoma cell line(23) . These authors
suggested that this location may represent a possible site for
phosphorylation by a Ser/Thr kinase. Comparison with consensus
sequences for various Ser/Thr kinases (24) revealed that amino
acid position 424 was located within a consensus sequence for
phosphorylation by PKC and PKA; in FGFR-VT-, a Ser is in this
position, whereas in the VT+ isoform, a Thr is in this location.
We decided to examine whether this Ser or Thr could be phosphorylated
by PKC or PKA. Two peptides, corresponding to amino acids 417-428
of FGFR-VT- or amino acids 417-430 of the VT+ isoform,
were synthesized and used in in vitro kinase assays. As can be
seen in Fig. 4A, neither peptide was phosphorylated by
PKA. PKC, on the other hand, selectively phosphorylated the VT+
peptide. We also examined the ability of PKC to phosphorylate the
full-length proteins. For this purpose, we constructed an FGFR1 that
contains 3 Ig domains and Val
Figure 4:
Phosphorylation of the VT+ and
VT- isoforms by Ser/Thr kinases in vitro. A,
incorporation of [
One of the questions that
remained was whether differential phosphorylation of these two isoforms
by PKC affects receptor function. To examine this question, we measured
mobilization of intracellular Ca
Figure 5:
FGF-stimulated
FGFs are known to mediate a number of diverse and complex
cellular responses (reviewed in (1) ). The existence of nine
different FGFs, four FGFR genes with a number of alternative spliced
forms may in part explain the pleiotropic effects of the FGF family.
Thus, it will be important to investigate the biological activity of
the different FGFR gene products, in response to different FGF members,
in order to elucidate the signal transduction pathways leading to these
varied responses. We have isolated an FGFR1 cDNA from Xenopus blastulae that differs from previously cloned Xenopus FGFR1s by a Val-Thr deletion in the juxtamembrane region. Although
similar isoforms have been cloned from a human hepatoma cell line (23) and from rat brain(26) , their biological activity
was not characterized. We show here that Thr Our data shows
that, as in the human FGFR1 gene(27) , the nucleotides encoding
the Val-Thr are located at an exon-intron boundary, indicating that
this isoform is generated by the use of an alternative 5` splice site.
Both FGFR-VT- and -VT+ mRNA were expressed in Xenopus embryos at various stages of development and contrary to what one
would predict from comparison to 5` splice site consensus sequences,
FGFR-VT- was the minor form. However, it has been suggested that
identity of consensus sequences at the 5` splice site is not the sole
determinant in site selection but that there must be other sequence
elements or factors that contribute to the choice of 5` splice
site(22) . We have shown that Thr Members of the FGF
family induce mesoderm differentiation in explanted tissue from Xenopus embryos (6, 7, 8) and are
thought to play a role in mesodermal patterning in the developing
embryo. Convincing evidence for this comes from experiments with a
dominant negative mutant construct of the FGFR1 which inhibited
wild-type receptor activity(9) . These authors showed that
expression of mutant FGFR1 in Xenopus embryos resulted in
deficiencies in organized mesodermal tissue, suggesting a specific role
for FGF in differentiation of presumptive mesodermal tissue. However,
FGFRs are present on the surface of all cells in the embryo during
blastula stages(28) , making it was unclear how FGF induction
might be limited to presumptive mesoderm. In further studies, we
demonstrated that PKC was activated during mesoderm induction by FGF in
explants(29) . Our data suggested that PKC was involved in the
negative regulation of FGFR activity, since pretreatment of explants
with PMA inhibited FGF induction in this tissue. These data suggest
there may be an autocrine regulation of FGFR activity whose extent may
depend upon the proportion of VT+ and VT- forms expressed by
individual cells or tissues. Certainly, the tissue-specific expression
pattern of the two isoforms in the adult rat suggests that the
VT- isoform plays an important role in mediating FGF responses in
the brain(26) . Although we observed no change in the temporal
expression pattern of mRNA encoding the two isoforms in the whole
embryo, differential expression may occur over shorter time periods
than those examined or FGFR-VT- mRNA may be selectively expressed
in a subpopulation of cells within the embryo. We are currently
investigating which FGFR1 isoforms are expressed in different tissues
of the Xenopus blastula and determining the biological role of
these two isoforms in the developing embryo.
Volume 270,
Number 39,
Issue of September 29, pp. 22758-22763, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
in response to basic fibroblast growth factor (bFGF). However,
pretreatment with phorbol 12-myristate 13-acetate significantly reduced
this mobilization in oocytes expressing FGFR-VT+ while having
little effect on oocytes expressing FGFR-VT-. These findings
demonstrate that alternative splicing of Val
-Thr
generates isoforms which differ in their ability to be regulated
by phosphorylation and thus represents an important mechanism for
regulating FGFR activity.
)play a role in a
number of cellular responses, including mitogenesis, differentiation,
angiogenesis, and transformation (reviewed in (1) ). The family
of FGFs consists of nine distinct members(2) , related by amino
acid sequence and their ability to bind heparin, that mediate their
response by binding to high affinity cell surface FGF receptors
(FGFRs). Functional FGFRs are transmembrane proteins composed of an
extracellular ligand-binding domain containing two or three
immunoglobulin (Ig)-like domains and an intracellular domain consisting
of a juxtamembrane region, a split tyrosine kinase domain and a
COOH-terminal tail (reviewed in (3) ). FGF binding to the
extracellular domain of the FGFR results in receptor activation through
dimerization and autophosphorylation. The activated receptor can then
bind and phosphorylate a number of intracellular substrates, thus
altering their catalytic activity and initiating intracellular signal
transduction cascades (reviewed in (3) ).
Materials
Xenopus laevis were purchased
from Nasco and maintained as described in (13) . Eggs were
artificially inseminated, the jelly coats removed, and the embryos
cultured as described in Godsave et al.(14) .
Synthetic peptides corresponding to FGFR-VT+ (IPLRRQVTVSGDSS) and
FGFR-VT- (IPLRRQVSGDSS) were purchased from the Alberta Peptide
Institute (Edmonton, Alberta). Recombinant Xenopus bFGF was
expressed and purified according to Kimelman et al.(15) then stored at -20 °C. The anti-FGFR1 used
for immunoprecipitation in this study was a polyclonal antibody raised
against a synthetic COOH-terminal peptide (12) .cDNA Cloning and Sequencing of an FGFR1 Isoform from
Xenopus Embryos
A cDNA library was constructed from mRNA
isolated from stage 8 Xenopus blastulae using the ZAP II
kit (Stratagene) as directed. The library was screened using a 400-bp
fragment of the Xenopus FGFR1 cDNA previously cloned by PCR. (
)This 400-bp fragment was amplified from Xenopus stage 17 first strand cDNA using oligonucleotide primers within
the FGFR1 tyrosine kinase domain. The 400-bp amplification product was
then cloned in the EcoRV site of Bluescript KS+ and
sequenced on both strands, verifying its identity as a fragment of the Xenopus FGFR1. The 400-bp fragment was radiolabeled by random
primer labeling (Life Technologies, Inc.) to a specific activity of 5
10
cpm/µg. This probe was used to screen 1.5
10
recombinant plaques, as described in Wahl and
Berger(16) . Twelve positive plaques were isolated and the
largest of these contained a 3.8-kb insert which was further
characterized. The cDNA sequence for both strands of the 3.8-kb insert
was determined by the dideoxy chain termination method (17) using the Sequenase system (U. S. Biochemical Corp.).Sequencing of a Genomic Fragment Containing the VT Region
of the FGFR1
A 1.2-kb genomic fragment containing the VT region
was amplified from a Xenopus genomic library (Stratagene). The
amplification was performed with oligonucleotide primers
5`(GGGCTGCTTTTGTGTCCGCAAT) and 3`(GCCATGACTACTTGCC) bracketing the VT
region (see Fig. 1for location of primers), for 30 cycles
consisting of denaturation at 94 °C for 1 min, annealing at 50
°C for 1 min and extension at 72 °C for 2 min. PCR products
were separated on 1% agarose, the 1.2-kb band cut out and the DNA
extracted from the agarose gel with Qiaex (Qiagen) according to the
manufacturer's directions. Sequencing was performed as above,
using the PCR primers.
and Thr
shown in bold.
Alternative 5` splice donor sites used to generate the VT- or
VT+ isoforms are indicated by arrows.
RNase Protection Analysis
RNA was extracted and
purified from whole embryos using the LiCl/urea protocol described in
Goldin (18) . RNase protections were performed as in Paterno et al.(7) . The RNA antisense probe was prepared from
a BstEII-HgaI cDNA fragment of XFGFR-A2 (gift from
Dr. Robert Friesel, American Red Cross) cloned into the EcoRV
site of pBluescript KS+ (Stratagene). Transcription from the T7
promoter yielded a 261-base probe which protected a fragment of 162
bases for the VT+ isoform and two fragments of 107 and 49 bases
for the VT- isoform.PKC and PKA Phosphorylation Assays
Phosphorylation
by PKC of both the peptides (see ``Materials'' for sequence)
and full-length FGFR1 protein was measured using a PKC assay kit (Life
Technologies, Inc.), 15 ng of purified PKC enzyme (Upstate
Biotechnology, Inc.), and 10 µCi
[-
P]ATP (Amersham Corp.) per reaction. The
FGFR1 proteins used in this assay were synthesized in vitro from the FGFR-VT-pcDNAIneo or FGFR-VT+pcDNAIneo
plasmids (plasmid construction described below) using a coupled
transcription/translation system (Promega) as described in Ryan and
Gillespie(12) . The assays were performed according the
manufacturer's directions with the exception that the 5
substrate solution supplied with the kit was replaced with one lacking
the control peptide substrate. The substrate was then added separately
to each reaction: 25 µM peptide or in vitro synthesized FGFR1-VT- or -VT+ protein that had been
purified by immunoprecipitation from equal inputs of trichloroacetic
acid-precipitable counts/min. The control substrate was a gift from Dr.
J. Reynolds (Memorial University) and consisted of a synthetic peptide
(CNPLLRMFSFKAPT) corresponding to amino acids 336-348 of the
2L subunit of the
-aminobutyric acid receptor, which contains
a Ser that is phosphorylated by PKC(19) .
-
P]ATP in a buffer containing 20 mM Tris, pH 7.5, 1 mM EGTA, 5 mM MgCl
,
and 200 µM ATP. The control substrate was a 9-amino acid
synthetic peptide (GRTGRRNSI) purchased from Upstate Biotechnology,
Inc.Plasmid Construction
An FGFR-VT- receptor
construct lacking both 5`- and 3`-untranslated regions was generated by
subcloning a BseAI-RcaI cDNA fragment (Fig. 1), which encodes most of the open reading frame (amino
acids 3-789) of the FGFR-VT- cDNA, into the same sites of a
pcDNAIneo mammalian expression vector containing the FGFR-A2 cDNA. The
FGFR-A2pcDNAIneo plasmid contains the coding region of an FGFR1 isoform
lacking the first Ig domain (11) inserted into the BamHI site of pcDNAIneo (Invitrogen). The FGFR-VT+
receptor construct was generated by subcloning a BstEII-RcaI cDNA fragment (Fig. 1) of the
FGFR-A2pcDNAIneo, encoding the transmembrane and intracellular domains,
into the same sites of FGFR-VT-pcDNAIneo plasmid. The FGFRSP64T
constructs used for expression in Xenopus oocytes were
generated by subcloning a BamHI fragment, containing the
entire FGFR coding region, from the FGFR-VT-pcDNAIneo or
FGFR-VT+pcDNAIneo constructs in the BglII site of the
SP64T vector(20) .Oocyte Injections and Protein Analysis
cRNA was
transcribed using the SP6 Ribomax system (Promega) from the FGFRSP64T
constructs (described above) that had been linearized with XbaI. 4.6 nl containing 500 pg of cRNA was microinjected into
stage VI Xenopus oocytes prepared and cultured as described in
Amaya et al.(9) . Injected oocytes were metabolically
labeled by culturing for 24 h at 22 °C in medium containing 1
mCi/ml [S]methionine (1000 Ci/mmol; DuPont NEN).
After extensive washing, the oocytes were solubilized and the FGFR
immunoprecipitated as described in Ryan and Gillespie(12) . The
immunoprecipitates were analyzed by 8% SDS-polyacrylamide gel
electrophoresis followed by autoradiography.
Microinjected oocytes were maintained at 22 °C
for 24 h, washed extensively in CaCa
Release
Assays
-free medium, then
loaded for 3 h with
Ca
(10 Ci/g; DuPont
NEN) at a final concentration of 100 µCi/ml.
Ca
release was measured from groups of
10 oocytes as described in Amaya et al.(9) . Phorbol
12-myristate 13-acetate (PMA; Life Technologies, Inc.) and Xenopus bFGF were added at the indicated times to a final concentration of
250 nM and 100 ng/ml, respectively.
-Thr
(VT) in the juxtamembrane region of our FGFR1 cDNA. We have
therefore named our clone FGFR-VT-.
NCAG/G; reviewed in (21) and (22) ), we were able to examine a number of
possible origins for these two isoforms, including alternative exons
and alternative 5` and/or 3` splice sites. We concluded that the most
likely mechanism for the production of the two receptor forms is the
use of alternative 5` splice donor sites (Fig. 2). Splicing to
produce FGFR-VT- would make use of an excellent consensus 5`
splice donor site, whereas the splice site to produce FGFR-A2 or XFGFR
lacks three of the eight consensus nucleotides. Therefore, one would
predict that the major splicing product would be FGFR-VT- mRNA.
Interestingly, RNase protection of total RNA from embryos at various
developmental stages revealed that in fact VT+ mRNA was the major
form (Fig. 3). In addition, there appeared to be little change
in ratio of the VT+/VT- isoforms at the developmental stages
examined.
P-labeled 261-base probe corresponding to sequence of the
VT+ isoform and spanning the VT region was used in RNase
protection assays of total RNA isolated from embryos at various
development stages. Digestion of probe:VT+ hybrids resulted in a
162-bp protected fragment while digestion of probe:VT- hybrids
resulted in digestion of the six nucleotide single strand loop encoding
the VT, producing two protected fragments of 107 and 49 bp. Thus, the
two FGFR1 isoforms could be distinguished in the same sample. Lane
a, probe; lane b, digested probe; lane c, in vitro transcribed FGFR-VT+ cRNA; lane d, in vitro transcribed FGFR-VT- cRNA; lanes e-l, total RNA
isolated from the following developmental stages: stage 1, fertilized
egg; stage 2, 2-cell; stage 6, 32-cell; stage 8, mid-blastula; stage
10, gastrula; stage 16, neurula; stage 24, tailbud; and stage 41,
tadpole. The positions of the undigested probe and the VT+ and
VT- protected fragments are
indicated.
-Thr
, thus
differing from FGFR-VT- only by the presence of
Val
-Thr
. We refer to this construct as
FGFR-VT+. The substrates in this PKC assay were FGFR-VT- or
FGFR-VT+ protein isolated by immunoprecipitation from in vitro transcription/translation reactions. Both proteins were
phosphorylated by PKC (Fig. 4B); however, twice as much
[
P]PO
was incorporated into
FGFR-VT+. This demonstrates that the full-length proteins were
substrates for PKC and that presence of the VT increased the degree of
phosphorylation. The fact that FGFR-VT- protein, but not the
peptide, was phosphorylated by PKC suggests that there are additional
phosphorylation sites in the protein.
P]PO
into VT+
and VT- peptides by PKC or PKA in vitro. Assays were
performed as described under ``Experimental Procedures.'' PKC
assays were carried out in the presence or absence of an PKC-specific
inhibitor peptide. PKC-specific phosphorylation was calculated by
subtracting the counts/min incorporated in the presence of inhibitor
from that incorporated in the absence of inhibitor. PKA assays were
performed in the presence or absence of peptide and the difference used
to calculate PKA-specific incorporation. The average and standard
deviation of three separate experiments is shown. P
incorporation into the PKC control substrate peptide was 50,825
cpm/nmol and that for the PKA control substrate peptide was 672,506
cpm/nmol. B, incorporation of
P into
FGFR-VT+ and FGFR-VT- protein by PKC. The substrate in each
case was in vitro synthesized protein isolated by
immunoprecipitation. Assays were performed as in A. The average and
standard deviation of three separate experiments is
shown.
stimulated by FGF in
oocytes expressing either form of the FGFR1. Mobilization of
intracellular Ca
, as measured by
Ca
efflux from oocytes, is commonly
employed as a functional assay of FGFR
activity(9, 10, 25) . Xenopus oocytes were microinjected with H
O (control) or mRNA
encoding either FGFR-VT+ or FGFR-VT-. After a 24-h
incubation period to allow for expression of FGFR protein, oocytes were
loaded with Ca
in calcium-free medium.
Ca
release into the medium was measured
in response to addition of 100 ng/ml Xenopus bFGF (XbFGF) to
oocytes; parallel samples were pretreated for 20 min with 250 nM PMA, a phorbol ester that activates PKC, before addition of XbFGF.
H
O-injected oocytes showed no response to XbFGF (Fig. 5A). Oocytes expressing either FGFR isoform
exhibited a similar response to XbFGF treatment alone but not when
stimulated with XbFGF in the presence of PMA (Fig. 5, B and C). Pretreatment with PMA resulted in a slight
reduction in the magnitude of the Ca
release by oocytes expressing FGFR-VT- (Fig. 5B), whereas the
Ca
release by oocytes expressing FGFR-VT+ was significantly
reduced (Fig. 5C). To verify that, in these
experiments, the oocytes expressed equal amounts of FGFR-VT- or
VT+ protein, FGFRs were immunoprecipitated from oocytes labeled
with [
S]methionine and the precipitates analyzed
by SDS-polyacrylamide gel electrophoresis. The inset in Fig. 5C shows that there was no difference in the
synthesis of VT- and VT+ FGFR proteins.
Ca
release from oocytes expressing FGFR-VT- or FGFR-VT+
protein. Xenopus oocytes were microinjected with
H
O or cRNA encoding either FGFR-VT- or FGFR-VT+
and loaded with Ca
, as described under
``Experimental Procedures.'' Each sample contained 10 oocytes
and measurements were taken at 10-min intervals by removing 500 µl
of medium for scintillation counting and replacing it with 500 µl
of fresh medium. 250 nM PMA and 100 ng/ml Xenopus bFGF were added at the indicated times, for 30 and 10 min,
respectively. The experiment was performed on three separate occasions
and a representative experiment is shown. A,
H
O-injected oocytes. B, oocytes injected with
FGFR-VT- cRNA. C, oocytes injected with FGFR-VT+
cRNA. Inset in C, S-labeled FGFR protein
immunoprecipitated from oocytes injected with FGFR-VT- cRNA (lane 1) or FGFR-VT+ cRNA (lane 2).
, FGF;
, FGF + PMA.
can be
phosphorylated by PKC and in an in vivo functional assay, we
demonstrate that the biological activity of the FGFR1 containing this
Thr was significantly reduced by activation of PKC.
can be
phosphorylated by PKC. In the VT- peptide, a Ser is in position
424, but was not a substrate for PKC. Since PKC requires basic residues
in the -3 to +3 region of the phosphoacceptor
site(24) , one possible explanation for this discrepancy is the
presence of an acidic residue (Asp) in the +2 position.
Alternatively, deletion of Val-Thr may change the secondary structure
in this region, modifying recognition by PKC.
)
)
We thank Langtuo Deng for technical assistance.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
L. M. Cotton, M. K. O'Bryan, and B. T. Hinton Cellular Signaling by Fibroblast Growth Factors (FGFs) and Their Receptors (FGFRs) in Male Reproduction Endocr. Rev., April 1, 2008; 29(2): 193 - 216. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. C. Barnard, A. J. Williams, B. Rabier, O. Chassande, J. Samarut, S.-y. Cheng, J. H. D. Bassett, and G. R. Williams Thyroid Hormones Regulate Fibroblast Growth Factor Receptor Signaling during Chondrogenesis Endocrinology, December 1, 2005; 146(12): 5568 - 5580. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. L. Kirby, L. Yang, J. C. Labus, and B. T. Hinton Characterization of Fibroblast Growth Factor Receptors Expressed in Principal Cells in the Initial Segment of the Rat Epididymis Biol Reprod, June 1, 2003; 68(6): 2314 - 2321. [Abstract] [Full Text] [PDF] |
||||
![]() |
B. A. Tsui-Pierchala, R. C. Ahrens, R. J. Crowder, J. Milbrandt, and E. M. Johnson Jr. The Long and Short Isoforms of Ret Function as Independent Signaling Complexes J. Biol. Chem., September 6, 2002; 277(37): 34618 - 34625. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Paterno, P. J. Ryan, K. R. Kao, and L. L. Gillespie The VT+ and VT- Isoforms of the Fibroblast Growth Factor Receptor Type 1 Are Differentially Expressed in the Presumptive Mesoderm of Xenopus Embryos and Differ in Their Ability to Mediate Mesoderm Formation J. Biol. Chem., March 24, 2000; 275(13): 9581 - 9586. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. H. Ong, G. R. Guy, Y. R. Hadari, S. Laks, N. Gotoh, J. Schlessinger, and I. Lax FRS2 Proteins Recruit Intracellular Signaling Pathways by Binding to Diverse Targets on Fibroblast Growth Factor and Nerve Growth Factor Receptors Mol. Cell. Biol., February 1, 2000; 20(3): 979 - 989. [Abstract] [Full Text] |
||||
![]() |
S. Yang, A. Lockwood, P. Hollett, R. Ford, and K. Kao Overexpression of a Novel Xenopus Rel mRNA Gene Induces Tumors in Early Embryos J. Biol. Chem., May 29, 1998; 273(22): 13746 - 13752. [Abstract] [Full Text] [PDF] |
||||
![]() |
G. D. Paterno, Y. Li, H. A. Luchman, P. J. Ryan, and L. L. Gillespie cDNA Cloning of a Novel, Developmentally Regulated Immediate Early Gene Activated by Fibroblast Growth Factor and Encoding a Nuclear Protein J. Biol. Chem., October 10, 1997; 272(41): 25591 - 25595. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. R. Burgar, H. D. Burns, J. L. Elsden, M. D. Lalioti, and J. K. Heath Association of the Signaling Adaptor FRS2 with Fibroblast Growth Factor Receptor 1 (Fgfr1) Is Mediated by Alternative Splicing of the Juxtamembrane Domain J. Biol. Chem., February 1, 2002; 277(6): 4018 - 4023. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |