|
|
|
|||||||
|
|||||||||
(Received for publication, March 27, 1995; and in revised form, July 14,
1995) From the
The roles of active site residues His
D-Xylose isomerase (EC 5.3.1.5) catalyzes the
reversible interconversions of D-xylose to D-xylulose
and D-glucose to D-fructose. The D-xylose
isomerase gene (xylA) has been cloned from a variety of
bacterial
sources(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) and
structures of the Streptomyces
rubiginosus(13, 14, 15) , Arthrobacter(16, 17, 18) , Actinoplanes missouriensis(19) , and Streptomyces
olivochromogenes(20, 21) enzymes have been
determined by x-ray crystallography. The catalytic domains fold as
eight-stranded Initially, a cis-enediol mechanism was proposed for D-xylose
isomerase(14, 22) , similar to the mechanism of
triose-phosphate isomerase. However, isotope exchange experiments (23) and crystallographic analyses (15, 16) with various substrates and inhibitors
suggests that the reaction proceeds via a metal-mediated hydride shift (Fig. 1a). The currently accepted pathway for the
reaction involves the preferential binding of
Figure 1:
Cartoons of the metal-mediated hydride
shift (a) (15, 16, 26) and
cyclic-hydride transfer mechanisms (b)(27) . Residues
relevant to this study (His
Site-directed mutagenesis has been used to probe the functions of
specific active site residues in D-xylose
isomerase(27, 28, 29, 30, 31, 32) ,
however, only a few structures of mutant enzymes have been
reported(19, 33, 34, 35) . Kinetic
data can be misleading if the substitutions affect the properties of
catalytically important residues other than those changed by
mutagenesis. For this reason, we have shifted our mutagenic studies
from the Escherichia coliD-xylose
isomerase(28, 29) , which has not been successfully
crystallized, to the S. rubiginosus enzyme which readily forms
crystals diffracting x-rays beyond 2.0
Å(15, 34, 36) . Here, we report the
cloning and expression of S. rubiginosus xylA in E.
coli, and investigate the roles of His
Figure 2:
Electron densities for D-xylose
isomerase complexes with ligands. For all of the panels, residues are
labeled at CA, metal ions (asterisks) are labeled M1 and M2,
and water molecules (asterisks) are labeled Wat. The dashed lines depict metal ligation and hydrogen bonds which
have distances
Figure 5:
Metal liganding at M2 (a) and M2` (b) in His
Figure 7:
Overlay of His
Figure 3:
Activity of D-xylose isomerase
and DEPC inactivation as a function of pH. Activity and enzyme
inactivation are as described under ``Materials and
Methods.''
Figure 4:
Anomeric preference of wild-type (
There is significant, unaccounted for
electron density 3.5 Å from M1 and 1.9 Å from M2 (Fig. 2b). Since metal cannot occupy both the modeled
position for M2 and the position at the excess density, it appears that
this is an alternate site for M2. An equivalent, low occupancy site for
M2 (M2`) has been described for the native S. rubiginosusD-xylose isomerase complexed with D-xylose (15) and is observed in our wild-type D-xylose
complex. The M2` position has been proposed to stabilize the transition
state of the acyclic-extended sugar in the metal-mediated hydride shift
mechanism through interactions with O1 and O2 of sugar(15) . In our wild-type structure, the relative difference peak heights
calculated from a F
Figure 6:
Overlay of the wild-type D-xylose
isomerase (thin lines) and Lys
The loss of the
Lys
The largest change observed when D-xylose is
added to His The structure of
His
Xylitol was added to His The S. rubiginosus xylA was cloned via PCR and
expressed in E. coli. The cloned PCR fragment contained
several nucleotide sequence differences, one of which gives rise to a
Phe
While we do not have an alternative
explanation for the results of Meng et al.(27) the
data from our study and others are not readily consistent with the
cyclic-hydride transfer mechanism. First, Lys With the
exception of the results of Meng et al.(27) , the
aforementioned data and observations are consistent with the proposed
metal-mediated hydride shift mechanism (Fig. 1a)(15, 16) . When D-xylose, D-glucose, xylitol, or sorbitol are added
to D-xylose isomerase, an acyclic-extended form of sugar is
observed which may represent substrate, product, or intermediate(s)
(15, 16, 18, 19, 21, 26, 35, 36). The orientation of substrate is such
that O1 is hydrogen bonded to Lys The results from this study and the
possible functions of His
Phe After binding of the Initial site-directed
mutagenesis experiments of the E. coliD-xylose
isomerase suggested that His His Additional evidence for the
importance of the hydrogen bond from His
There are several possible reasons for observing
cyclic sugar in these mutants: (i) the extended form of sugar
represents product, (ii) the mutated side chains directly or indirectly
block the ring opening step, or (iii) the binding energy of cyclic (or
pseudo-cyclic) sugar is improved to the binding energy of the extended
substrate. Computer simulations of D-xylose isomerase with D-xylose estimated that there is an increase of 8 kcal/mol
when D-xylose goes from pseudo-cyclic (O3 and O4 ligated to
M1) to acyclic (O2 and O4 ligated to M1) conformations(55) .
Entropic contributions were not included in their calculation and might
lower this estimate. One possibility is that the acyclic form of sugar
observed bound to the wild-type D-xylose complexes is actually D-xylulose(15) . Since Lys Lys His In contrast to the A. missouriensis His His The functions of active site residues in D-xylose
isomerase was investigated kinetically and structurally. Some of the
main conclusions and supporting observations are summarized here. 1)
His
Volume 270,
Number 39,
Issue of September 29, pp. 22895-22906, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
D
-Xylose Isomerase (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUSIONS
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
,
Phe
, Lys
, and His
in the Streptomyces rubiginosusD-xylose isomerase were
probed by site-directed mutagenesis. The kinetic properties and crystal
structures of the mutant enzymes were characterized. The pH dependence
of diethylpyrocarbonate modification of His suggests that
His does not catalyze ring-opening as a general acid.
His appears to be involved in anomeric selection and
stabilization of the acyclic transition state by hydrogen bonding.
Phe stabilizes the acyclic-extended transition state
directly by hydrophobic interactions and/or indirectly by interactions
with Trp
and Phe
. Lys and
His mutants have little or no activity and the structures
of these mutants with D-xylose reveal cyclic
-D-xylopyranose. Lys functions structurally
by maintaining the position of Pro
and Glu
and catalytically by interacting with acyclic-extended sugars.
His provides structure for the M2-metal binding site with
properties which are necessary for extension and isomerization of the
substrate. A second M2 metal binding site (M2`) is observed at a
relatively lower occupancy when substrate is added consistent with the
hypothesis that the metal moves as the hydride is shifted on the
extended substrate
/
barrel motifs and contain a well conserved
active site with two divalent metal ions(17) . All D-xylose isomerases require Mg
,
Co, or Mn ions for activity,
suggesting that they have similar enzymatic mechanisms.-D-xylopyranose (24, 25) followed by
ring opening(25) , extension of the substrate, and then the
hydride shift(15, 16, 26) . Recently, Meng et al.(27) have proposed that the hydride shift
occurs on the cyclic form of sugar (Fig. 1b).
, Phe,
Lys, and His) are shown, as well as
Asp
, which is important in the cyclic-hydride transfer
mechanism (b). Metal ions are labeled M1 and M2. In both
mechanisms the -pyranose (D-xylose is shown here) binds
to the active site and after isomerization, the -furanose form (D-xylulose is shown here) is released. In the metal-mediated
hydride shift, ring opening is required prior to isomerization, while
in the cyclic-hydride transfer ring opening and isomerization occur at
the same step.
and Phe in anomeric recognition, the putative role of His in
ring opening, and the functions of His, Phe,
Lys, and His in isomerization.
Bacterial Strains and Plasmids
S.
rubiginosus (ATCC 21175) was obtained from the American Type
Culture Collection. E. coli BL21(DE3) (F
ompT r
Biochemical Reagents
All compounds were reagent
grade and purchased from Sigma, except acetaldehyde and
5-thio--D-glucopyranose (THG), (
)which were
from Aldrich. The sugar 5-deoxy-D-xylulose was synthesized by
aldol condensation of dihydroxyacetone and acetaldehyde, using rabbit
muscle aldolase with the cofactor sodium arsenate as a catalyst, and
was purified by ion-exchange chromatography, (
)using a
scheme similar to that described by Durrwachter et al.(37) for the synthesis of 5-deoxy-D-fructose.DNA Isolation, Transformation, and
Manipulations
S. rubiginosus was grown in yeast and
maltose extract medium supplemented with 34% (w/v) sucrose and
chromosomal DNA was isolated as Hopwood et al.(38) .
Both plasmid and bacteriophage DNA were isolated from cultures of E. coli TG1 grown in LB medium as recommended by Sambrook et al.(39) . Site-directed mutagenesis was conducted
as described previously(34, 40) . His was
changed to Ser, Asn, and Asp; Phe to Ser; Lys to Met; and His to Ser and Glu. DNA sequencing was
carried out with the 7-deaza-dGTP sequencing kit from U. S. Biochemical
Corp.Cloning and Expression of S. rubiginosus xylA in E.
coli
The reported S. rubiginosus xylA sequence (12) was used to construct two oligonucleotide primers (primer
1: ATGAACTACCAGCCCACCCCCGAGGACAGG) (primer 2:
TCAGCCCCGGGCGCCAGCAGGTGGTCCAT) which were used in a PCR to amplify xylA from purified S. rubiginosus chromosomal DNA.
The PCR reaction mixture was in 100 µl, containing 2 units of Taq DNA polymerase, 250 µM each of dATP, dTTP,
and dCTP, 125 µM each of dGTP and 7-deaza-dGTP, 0.5
µM each of primers 1 and 2, 500 ng of S. rubiginosus chromosomal DNA, 50 mM KCl, 1.5 mM
MgCl, 0.05% Tween 20 (w/v), and 0.1 mg/ml bovine serum
albumin in 10 mM Tris-HCl (pH 8.8). The PCR was conducted in a
Hybaid thermocycler, using the following parameters: cycle 1, 90 °C
for 10 min, 94 °C for 0.5 min, 65 °C for 2 min, 72 °C for 2
min; cycles 2-34, 94 °C for 0.5 min, 65 °C for 2 min, 72
°C for 2 min; cycle 35, 94 °C for 0.5 min, 65 °C for 2 min,
72 °C for 5 min. After the first PCR, 1 µl was removed and used
in a second PCR. The reaction mixture was as above except primers 1 and
2 were replaced by primers containing restriction sites for EcoRI and BspHI (bold and underlined, respectively;
GGAATTCATGAACTACCAGCCCACCCCCGAG) and HindIII (italic;
CCCAAGCTTAGCCCCGGGCGCCCAGCAG). The PCR reaction was then as
follows: cycle 1, 94 °C for 1 min, 50 °C for 1 min, 74 °C
for 2 min; cycles 2-34, 94 °C for 0.5 min, 60 °C for 0.5
min, 74 °C for 2 min; cycle 35, 94 °C for 0.5 min, 60 °C
for 0.5 min, 74 °C for 10 min. The PCR product was purified with a
Sephacryl G-200 spin column (Pharmacia) and concentrated by isopropyl
alcohol/sodium acetate precipitation. The PCR product was restricted
with EcoRI and HindIII, ligated into EcoRI
and HindIII digested M13 mp19 and transformed into E. coli TG1. Only one transformant was selected that had a 1.2-kilobase
insert. The insert DNA was sequenced and confirmed to be xylA.
The plasmid pRDW100 was constructed by removing the xylA insert from M13 mp19 with BspHI and HindIII and
subcloning it into NcoI-HindIII digested pET11d. The
production and purification of D-xylose isomerase was as
described previously(34) .Enzyme Assays
D-Xylose and D-xylulose solutions were prepared at least 12 h prior to use
in kinetic assays in order to allow them to reach anomeric equilibrium.
All mutants and wild-type D-xylose isomerase were preincubated
with metal 12 h prior to measuring activity. The activity of
His and Lys substitutions was assayed with D-xylose, as described previously(34) , using the
method of Dische and Borenfreund (41) . The kinetics of
His and Phe substitutions and of the
wild-type D-xylose isomerase with D-xylose as a
substrate were determined by the coupled sorbitol dehydrogenase
assay(42) . The reaction was carried out at 30 °C in 100
mM KCl, 10 mM HEPES (pH 7.7), 10 mM MgCl, 0.55 mM NADH, 1.5 units of sorbitol
dehydrogenase, 1-100 mMD-xylose and D-xylose isomerase (0.05-1 µM) in a total
volume of 1 ml. The rate of NADH oxidation was followed on a Pharmacia
UltraspecII spectrophotometer at 340 nm for 1.5 min. The kinetics of
His mutants and wild-type D-xylose isomerase with D-xylulose as a substrate was performed at 30 °C in 100
mM KCl, 10 mM HEPES (pH 7.7), 10 mM
MgCl, 0.5-40 mMD-xylulose, and
0.1-0.7 µMD-xylose isomerase in a total
volume of 100 µl. When 5-10% of the D-xylulose was
converted to D-xylose, the reaction was terminated by the
addition of 100 µl of 0.1 M trichloroacetic acid (pH 2). D-Xylulose was separated from D-xylose by high
performance liquid chromatography using a Bio-Rad Carbo-C column and
the concentration of D-xylulose was determined by integration
of the peak corresponding to its fraction. The kinetics of His mutants and wild-type on 5-deoxy-D-xylulose was
determined at 30 °C in 100 mM KCl, 50 mM HEPES
(pH 7.7), 10 mM MgCl, 10-200 mM
5-deoxy-D-xylulose, and 2-4 µMD-xylose isomerase in 200 µl. The reaction was
stopped after 100 min with 25 µl of 2 M trichloroacetic
acid (pH 2), 275 µl of DO was added, and the amount of
5-deoxy-D-xylulose was determined by NMR
(Brüker AM 300).DEPC Inactivation of D-Xylose
Isomerase
D-Xylose isomerase (18.6 µM) was
inactivated with 0.157 mM DEPC in 10 mM MgCl and 50 mM potassium phosphate buffer (pH 5.5-7.5)
at 25 °C. Aliquots (10 µl) were removed from 0 to 10 min, and
activity with D-xylose as a substrate was measured using the
sorbitol dehydrogenase assay described above. The rate of DEPC
inactivation at each pH was determined by plotting the log D-xylose isomerase activity against time of incubation with
DEPC. The inflection point (pK
) was determined by
taking the second derivative of the third order polynomial calculated
by Cricket Graph version 1.3.2 (Malvern, PA).Anomeric Specificity Assay
-D-Xylose
(96%) was dissolved in water and 100-µl aliquots were removed at
various times. The activity of wild-type, His-Asn, or
Phe-Ser enzymes on the mutarotating D-xylose (200
mM final D-xylose concentration) was determined in
the sorbitol dehydrogenase assay, described above.Crystallography
Crystallization of D-xylose isomerase was as described previously (34) .
Crystals of D-xylose isomerase were stored in 1 mM MnCl, 2 mM Pipes (pH 7.2), and 2 M
ammonium sulfate. The concentrations of D-xylose, THG, and
xylitol used in crystal soaks containing 1 mM MnCl, 2 mM Pipes (pH 7.2), and 2 M ammonium sulfate are shown in Table 1, along with
crystallographic and refinement data. X-ray diffraction data from
crystals of His mutants with and without D-xylose
were measured on a Nicolet X100A area detector, the data were
integrated and scaled using the XDS software, and structures were
refined using restrained least-squares refinement, as described in Cha et al.(34) . Diffraction data from all other crystals
of mutants were measured on a San Diego Multiwire systems area detector
and the structures were refined using the X-PLOR suite of programs, as
described previously(34) .
Cloning and Expression of S. rubiginosus
xylA
Two oligonucleotide primers, one of which was complementary
to the 5` end and the other complementary to the 3` end of S.
rubiginosus xylA(12) , were used in a PCR of S.
rubiginosus chromosomal DNA. The annealing temperature for the PCR
was varied from 37 to 70 °C, and MgCl was added at
1.5-4 mM, but no products were amplified. Some DNA
sequences with a high G + C content cannot be amplified unless
7-deaza-dGTP is included in the reaction mixture(43) . When 50%
of the dGTP in the reaction mixture was substituted with 7-deaza-dGTP,
a PCR product with the expected size (1.2 kilobases) was amplified. The
DNA sequence of the cloned PCR product had differences at nucleotides
1735, 1857, and 2562 from the reported sequence of Wong et al.(12) . The differences at 1857 and 2562 were silent
mutations (both TTT instead of TTC), but the difference at nucleotide
1735 corresponded to a Phe
Leu mutation (TTC to CTC) at residue 13
of the protein. The PCR product was cloned into pET11d, under the
control of the T7 promoter and LacZ, and several transformants were
obtained that expressed a 43-kDa protein only upon addition of
isopropyl-1-thio--D-galactopyranoside. This protein
migrated the same in SDS-polyacrylamide gel electrophoresis as
non-recombinant D-xylose isomerase, but this protein from the
cell lysate was not soluble and had no enzymatic activity. To see if
Leu
may have caused the insolubility of recombinant D-xylose isomerase, it was mutated to Phe. Also, to
potentially improve protein expression, the AGG codon for
Arg
, rarely observed in E. coli(44) , was
replaced with the more common CGT codon. The Phe recombinant D-xylose isomerase (wild-type) was soluble
and had kinetic properties identical to non-recombinant D-xylose isomerase(34) . This expression system was
used to overexpress D-xylose isomerases containing active site
mutations. As summarized in Table 1, six of these mutant enzymes
have been kinetically characterized and crystallographically studied
alone and in complex with D-xylose, and in one case, with
xylitol.Wild-type D-Xylose Isomerase Complexed with
THG
The structure of the ArthrobacterD-xylose
isomerase complexed with the cyclic inhibitor THG (K
= 33 mM) showed that His is
approximately 3 Å from both the ring sulfur and atom O1, the
anomeric oxygen(16) . The structure of the S. rubiginosusD-xylose isomerase with THG was determined to assess the
His interactions in this enzyme with a cyclic
-pyranose sugar. THG can clearly be seen in the electron density
map (Fig. 2a). The binding of THG in S. rubiginosus is comparable to that observed in the Arthrobacter enzyme, except His NE2 is 2.9 Å from the ring
sulfur and 3.5 Å from the anomeric hydroxyl and two alternate
positions for O6 are seen in the electron density (Fig. 2a). One position of O6 (ALT1) is nearly the same
as that reported by Collyer et al.(45) and forms a
hydrogen bond to Thr
OG. In the other position (ALT2), O6
interacts with Wat
. The different positions of O6 did not
affect the hydrogen bonding or metal ligation of the other sugar
hydroxyls. The B factors for M1 and M2 were 10 and 7
Å, respectively, indicating that the occupancy of
both metals is high and their mobility is low.
3.2 Å and reasonable geometry. Cross-hatched lines represent electron density of the F
- F
``omit'' map. The contour level is 3
in panels a and b, and 4 in panels c-f. a, wild-type/THG. THG was modeled in two conformations (ALT1
and ALT2) and each was refined at 0.5 occupancy. The main difference in
ALT1 and ALT2 of THG is the position of O6. In ALT1, O6 is 2.8 Å
from Thr OG, and in ALT2, O6 is 2.5 Å from
Wat. The B factors for both models of THG, M1, and M2 are
17, 10, and 7 Å, respectively. Although not indicated
in this figure, the positions of both metals shift 0.6 Å compared
to the wild-type structure without THG. The protein side chains
liganded to M1 shift 0.3 to 0.8 Å as a result of the new position
of the metal and also because of the proximity of the sugar hydroxyls
O3 and O4. Shifts in the positions of side chains liganded to M2 are
also observed, most likely because the ligands to M1 are repositioned.
The indole group of Trp rotated 9° about 
and the phenyl ring of Phe
(*, from a neighboring
subunit) rotated 5° about when THG was added.
The amino side chain of Lys moves 0.5 Å in order to
accommodate the new position of Wat
which is hydrogen
bonded to O2 of THG. His NE2 is 2.9 Å from the ring
sulfur and 3.5 Å from the anomeric hydroxyl, and both O3 and O4
are liganded to M1 at 2.3 Å. b,
His-Ser/xylose. D-Xylose was placed in the
electron density, but not added during refinement because the electron
density of the sugar is weak and in the absence of sugar, water
molecules are located close to the positions of the sugar hydroxyls and
would complicate an accurate determination of sugar occupancy (not
shown). Sugar binding would be comparable to a wild type-xylulose
complex(36) , except there is no hydrogen bond between
Ser and O5. Instead, O5 of sugar could hydrogen bond to
Wat
and Wat
, a water not observed in a
wild-type/xylulose structure(36) . No water or metal were added
to the electron density near M2, although we suspect that this electron
density represents an alternate position for M2 (see Fig. 5). c, Lys-Met/xylose. -D-Xylopyranose
was modeled and refined in Lys-Met. The B factors for the
sugar, M1, and M2 were 16, 12, and 13 Å,
respectively. The binding of -D-xylopyranose is
comparable to wild-type/THG, except -D-xylopyranose lacks
C6 and O6. The sugar hydroxyls O3 and O4 are ligated to M1 at 2.4 and
2.3 Å, respectively. d, His-Glu/xylose.
-D-Xylopyranose was modeled and refined in
His-Glu. The B factor for the sugar is 13
Å. Both metals are observed and metal ligation is
similar in the absence of sugar(34) , except M1 is liganded by
O3 and O4 of sugar at 2.4 and 2.2 Å, respectively. Glu does not ligand M2, but can interact with O3 of sugar at 3.0
Å. e, His-Ser/xylose.
-D-Xylopyranose was modeled and refined in
His-Glu. The B factor for the sugar is 14
Å. Both metals are observed and metal ligation is
similar to that observed in the absence of sugar(34) , except
M1 is liganded by O3 and O4 of sugar at 2.3 and 2.2 Å,
respectively. Two water molecules (Wat
and
Wat
) are located near Ser and one water
(Wat) replaces His NE2 as a ligand to M2. f, His-Ser/xylitol. The orientation of xylitol
is such that O1 interacts with Lys NZ and O5 hydrogen
bonds to His NE2. M1 is liganded by O2 and O4 at 2.2 and
2.3 Å, respectively. The B factor for xylitol is 6
Å. M2 is absent, alternate conformations (ALT1 and
ALT2) for the side chain of Asp
and two new water
molecules (Wat
and Wat
) are shown.
Additional differences are shown and described in Fig. 7.
-Ser/xylose. Labeling of metals,
residues, and water molecules are as described in the legend to Fig. 2. Metal ligation is depicted as dashed lines and
metal ligand distances are shown in Å. The ligation shown for M2`
is highly speculative because the ligands may move when the metal
shifts to the M2` position but due to the low occupancy at this site,
alternative ligand positions would not be observed in the electron
density. Wat
is close to the M2` site (1.5 Å (b)), but it is shown liganded to M2` because it may move when
M2 moves to M2`. The Asp and Asp
carboxylate oxygens are 3.6 and 4.4 Å, respectively, from
M2`, and are not M2` ligands unless they move
correspondingly.
-Ser in the
presence (bold lines) and absence (thin lines) of
xylitol, showing the perturbed structure caused by xylitol binding.
Labeling of water molecules, metal, and protein residues are as Fig. 2, except the five water molecules present in the absence
of xylitol and located near the xylitol hydroxyls in
His-Ser/xylitol are not labeled. No M2, two alternative
positions (ALT1 and ALT2) for both the side chains of Glu and Asp, and two new water molecules (Wat and Wat which are shown in Fig. 2e)
are observed in His-Ser/xylitol. The electron density of
the alternative conformations for both Asp and
Glu in the His-Ser/xylitol structure
appeared to be equivalent (not shown), and each of the conformations
were modeled at 0.5 occupancy. The average B factors for ALT1 and ALT2
of the Asp side chain are 13 and 8 Å,
respectively, and for the two positions of the Glu side
chain are 13 and 8 Å. The new positions for the
Glu side chain cause the phenyl group of Phe to rotate 9° about from its position
observed in the xylitol-free His-Ser structure.
Significant movement of M1 (0.5 Å) Asp OD2 (1.2
Å), and Asp
OD1 (0.6 Å, not shown) is also
observed, but M1 ligand distances (2.1 to 2.3 Å) do not differ
significantly from the previously described structures in this study or
others(15, 36) .
pK
The
ring-opening mechanism proposed by Collyer et al.(16) and Whitlow et al.(15) involves
Hisof His acting as base to remove a proton from the anomeric
oxygen of the substrate. However, in the wild-type/THG structure
described above, His is closer (2.9 Å) to the ring
sulfur than the anomeric hydroxyl (3.5 Å), suggesting that it
might acid catalyze ring opening of the analogous sugar, D-xylose, via the protonation of the ring oxygen. Also, the
His imidazole is held in place by a hydrogen bond to the
carboxylate of Asp
(36) which may help to raise
the pK of His. The protonation state
of His was determined by chemical modification with DEPC,
a reagent that reacts with histidines only in their deprotonated
form(46) . Previous studies had shown that His is
responsible for DEPC
sensitivity(31, 47, 48, 49) , and
this was reconfirmed in this study. The wild-type enzyme retained only
9.3% activity when incubated with DEPC (0.157 mM) at 25 °C
for 10 min at pH 7.0, while His-Ser and
His-Asn mutants (described below) retained 100% activity
after incubation with DEPC. To determine the pK of
His, the rate of DEPC inactivation was measured in the pH
range of 5.5-7.5 (Fig. 3). The inflection point
(pK) from two separate DEPC inactivation
experiments was 6.40 ± 0.01. Parallel studies, using the same
enzyme preparation, yielded a pH optimum for catalysis of D-xylose between pH 8 and 9 (Fig. 3).
Kinetic Properties of His
To examine the role of HisMutants in anomeric recognition, ring opening, and isomerization,
His was changed to Ser, Asn, and Asp. The
His-Ser and His-Asn mutants had activity (Table 2), while His-Asp was insoluble and crude
cell extracts containing this mutant enzyme had no activity. The k
values for the His-Ser and
His-Asn enzymes on D-xylose were 12- and 5-fold
lower and the K
values were 2- and 7-fold higher
than that observed for wild-type. It has been suggested that the lower k of His mutants is due to the loss
of a hydrogen bond to O5 of the acyclic-extended
substrate(30, 31) . The importance of this interaction
was tested by examining the kinetics of D-xylose isomerase on
the acyclic sugar 5-deoxy-D-xylulose. The His mutants had k values on the 5-deoxy-sugar
similar to D-xylulose, while the wild-type had a 20-fold lower k on the deoxy-sugar than on D-xylulose (Table 2). The K values on the 5-deoxy-sugar
for the mutants (22.5 and 35.0 mM) were similar to the value
for the native enzyme (22.0 mM).
Anomeric Specificity of D-Xylose
Isomerase
D-Xylose isomerase preferentially binds the
-pyranose form of aldose(24, 25) . It has been
reported that His is important for recognizing the
-pyranose (30) and that the Phe side chain
prevents the -pyranose form from binding by steric exclusion of
the O1 hydroxyl (15, 50) . To possibly allow
-pyranose binding, the Phe side chain was replaced
with the smaller hydrophilic Ser residue. The kinetics of this mutant
show a 5-fold decrease in the k and a 7-fold
increase in K with D-xylose as a
substrate (Table 1). The roles of His and Phe in anomeric recognition were directly explored by dissolving
crystalline -D-xylose in water and assaying relative
activity, using experimental conditions similar to Lambier et
al.(30) . Both wild-type and Phe-Ser had the
highest activity immediately after D-xylose was dissolved and
showed diminished activity as the -anomer was forming, until an
activity equilibrium was reached (Fig. 4). His-Asn
retained 100% activity over time (Fig. 4), indicating that this
mutant has no preference for the -pyranose over the -pyranose
and is consistent with the results of Lambier et
al.(30) .
),
Phe-Ser (
), and His-Asn (
) D-xylose isomerase. Crystalline -D-xylopyranose
(96%) was dissolved, aliquots were removed, and the relative rate on
the mutarotating sugar was assayed at different time intervals by the
coupled-sorbitol dehydrogenase assay, as described under
``Materials and Methods.''
Structures of His
In wild-type D-xylose isomerase, His-Asn and
His-Ser NE2 hydrogen bonds to one
water (Wat
) and His ND1 interacts with
Asp OD1(36) . The structures of
His-Ser and His-Asn show only slight
structural differences, and these differences are localized to the
region around the substituted histidine. The electron densities of the
His-Ser and His-Asn side chains appear well
ordered and the average temperature factors for the Ser and Asn side chains are 17 and 13
Å, respectively. In the His-Ser
structure, the side chain hydroxyl of Ser rotated
approximately 150° from the position observed for His CG. In this position, Ser OG hydrogen bonds to the
amide nitrogen and the OD carboxylate of Asp at 3.1 and
2.8 Å, respectively. One new water molecule (Wat)
is observed 1.4 Å from the position normally occupied by
His NE2 and it forms a hydrogen bond to Wat and Wat
. The latter solvent molecule is 2 Å
from its position in the native enzyme. In His-Asn, the
Asn ND hydrogen bonds to Asp OD1 at 2.7
Å, replacing the His ND1-Asp OD1
interaction, and Asn OD hydrogen bonds to Wat at 2.9 Å. No other differences greater than 0.3 Å for
either structure were observed.Structure of His
In many structures of wild-type D-xylose isomerase complexed with D-xylose or D-xylulose, His-Ser Complexed withD-Xylose NE2 hydrogen bonds to O5,
Lys NZ interacts with O1, and both O2 and O4 are liganded
to M1 of the extended sugar(15, 36) . Although 1.5 MD-xylose was used to soak a His-Ser
crystal, the electron density contributed by the sugar is weak;
however, an acyclic-extended conformation of sugar can be seen in the F
- F
map (Fig. 2b). Placement of the sugar into the electron
density reveals that hydrogen bonding to the protein and metal
liganding are comparable to a wild-type/xylulose
structure(36) , except there is no hydrogen bond between
Ser and O5 (Fig. 2b). The B factors of
both metals are significantly higher (36 Å for both
M1 and M2) than that observed in the wild type-xylulose complex (7
Å for M1 and 6 Å for
M2,(36) ) suggesting that either the metals are more mobile or
their occupancy is lower. The higher temperature factors of the metals
might be caused by destabilization of the sugar in the active site (see
``Discussion''). - F map with M2 and M2` omitted is 0.12 e/A
for
M2 and 0.0092 e/A for M2`. This yields an
estimated M2:M2` ratio of 13:1. Since the occupancy of M2` is 13-fold
lower and side chain atoms and water molecules have fewer electrons
than Mn, low occupancy positions for the ligands of
M2` would not be seen above the noise in the electron density, as noted
by others (15) . The potential liganding of the metal at M2` by
Wat, His NE2, both carboxylate oxygens of
Glu
, and O1 and O2 of sugar is shown in Fig. 5.Structure of Phe
In the
wild-type enzyme, Phe-Ser is in the active site near the side
chains of Trp and Phe (*, from a
neighboring subunit). As a result of replacing the larger Phe with the
smaller Ser, two alternative positions for Ser OG and two
new waters (Wat
and Wat
) are observed in
the Phe-Ser structure. In addition, the side chain of
Trp moved 0.5 Å toward Ser and
Phe rotated -13 and 9° about and . No other changes greater than 0.3 Å
were observed when compared to the wild-type enzyme.Structure of Phe
In the wild-type/THG structure, CZ of
Phe-Ser Complexed withD-Xylose is 3.8 Å from C1 of THG. In structures of S.
rubiginosusD-xylose isomerase with an acyclic-extended
pentose sugar bound in the active site(15, 36) ,
Phe is far from C1 (6.6 Å) and is closest to C3 (5.4
Å) of the sugar. When D-xylose is added to
Phe-Ser, the electron density attributed to the sugar is
disordered. Since several different conformations of cyclic,
pseudo-cyclic (i.e. the sugar ring is cleaved and the sugar is
somewhat cyclic) and acyclic-extended forms of D-xylose could
fit into the electron density, sugar was omitted from the model. The
position of M1 and M2 shift 0.2 and 0.4 Å, respectively, when D-xylose is added, but the B factors of M1 and M2 remain low
(<10 Å). The other differences in the D-xylose complex are 0.4-Å shifts in the side chains of
the metal ligands Glu
, Glu,
Asp, and Asp, equivalent to those observed
in the wild-type/THG structure.Structure of Lys
In the
metal-mediated hydride shift mechanism, Lys-Met would assist
in holding the substrate in the proper orientation and polarizing O1 by
hydrogen bonding(15, 16, 30) . In the
cyclic-hydride transfer, Lys has no direct catalytic
role(27) . Lys was substituted with Met and this
mutant enzyme had no detectable activity (Table 1). In wild-type D-xylose isomerase, Lys NZ hydrogen bonds to
Asp OD1, Glu O, and Wat (Fig. 6, thin lines). Since Asp is
a M2 ligand, it was possible that the Met substitution
indirectly abolished activity by perturbing the structure around M2.
The Lys-Met structure was determined and no large
differences (>0.4 Å) in the conformations of residue 183 or
255 were observed, however, major structural changes occurred outside
the active site at Glu and Pro (Fig. 6) and to a lesser extent in the active site at
Phe and Trp.
-Met (bold
lines) showing the perturbed structure around the Met
substitution. Labeling of water molecules, metal, and protein residues
are as described in the legend to Fig. 2. Hydrogen bonds from
Lys NZ to Asp OD 1, Glu O,
and Wat in the wild-type enzyme are shown by dashed
lines along with the corresponding distances for these
interactions. In wild-type and Lys-Met,
Glu, Pro, and Arg
are the i, i+1, and i+2 residues in a
non-standard turn. In wild-type, Pro is in a cis conformation while in Lys-Met, Pro is
in a trans conformation. The 
/
angles for
Glu, Pro, and Arg are 76/107
and -81/-16 and -84/158, respectively, while in
Lys-Met, the angles are 116/-65,
-53/-33, and -135/160. The electron density around
the Met side chain (not shown) is well ordered, and the
average B factor for the Met side chain is 7
Å. There are 0.7-2.0 Å shifts in the
positions of Glu and Pro. The new
conformation of Glu in Lys-Met is
stabilized by two new interactions, Glu OE1-Asp N and Pro O-Arg
NH1 (not shown). The
new position of the main chain oxygen of Pro results in
the loss of two hydrogen bonds from Arg NH1 to two water
molecules (not shown) in Lys-Met. The Phe side chain rotates approximately 18° toward Met CE when the polar amino group of Lys is replaced by
the smaller non-polar Met, and Trp rotates approximately
10° about , as a result of Phe rotation and the new position of Pro. There are
also slight shifts (0.3-0.4 Å) in the positions of M1,
Glu, and Asp from that observed in the
wild-type structure (see Fig. 2e).
-Glu hydrogen bond and the increased van
der Waals radii associated with the Met side chain leads to the most
dramatic structural change, with the
Glu-cis-Pro peptide bond fliped
from the cis to the trans conformation (Fig. 6). The Glu / angles change from
76/107° to 116/-65, both of which are angles normally not
observed for non-glycine residues(51) . The energy of a Xaa-trans-Pro peptide bond is roughly 5-fold more
favorable than a Xaa-cis-Pro peptide
bond(51) .Structure of Lys
When D-xylose is soaked into a
Lys-Met Complexed withD-Xylose-Met crystal, electron density indicative of the
cyclic -D-xylopyranose is observed (Fig. 2c). The binding of -D-xylopyranose
is comparable to that of THG in wild-type, except
-D-xylopyranose lacks C6 and O6. There is no significant
movement (>0.2 Å) of either metal in the
Lys-Met/xylose structure compared to either the
Lys-Met or the wild-type/THG structures. His NE2 is 2.7 Å from the ring-oxygen and is 3.4 Å from
the anomeric oxygen. The positions of Glu,
Pro, Phe, and Trp remain as
in the unliganded Lys-Met structure.Structures of His
In wild-type D-xylose isomerase,
His-Glu and
His-Ser Complexed with D-Xylose is the terminal residue on a short -helix that
includes residues 216-220. At neutral pH, the imidazole ND1 is
protonated and hydrogen bonded to Pro
O, and NE2 of the
imidazole is ligated to M2. It was previously reported that
substitutions to His result in almost a complete
inactivation of D-xylose isomerase (Table 1) (34) and a decrease in thermostability. Structures of
His-Ser, His-Asn, and His-Glu
show that both M1 and M2 are still bound, but there are some
perturbations (0.3 to 0.4 Å differences from the wild-type) in
the protein around M2(34) . Crystal structures of
His-Glu and His-Ser with D-xylose
were determined to discover why these mutants have almost no activity.
Both His mutants have clear ligand electron density into
which -D-xylopyranose (Fig. 2, d and e) was fitted and refined at full occupancy. The positions of
M1 and M2 in the His-Glu and His-Ser do not
differ greater than 0.3 Å from the sites they occupy in the
wild-type/THG structure. The temperature factors for M1 are very
similar in the wild-type/THG, His-Ser/xylose, and
His-Glu/xylose structures (all 8 to 10
Å); the temperature factor for M2 is slightly higher
in His-Ser/xylose (14 Å) than
wild-type/THG (7 Å) and is significantly higher in
His-Glu/xylose (26 Å), indicating that
M2 is either more mobile or has a lower occupancy in the His mutants.-Glu, is a 0.4-Å shift in the position
of Asp OD. Glu does not replace the
function of His NE2 in serving as a ligand to M2 (Fig. 2d), as previously observed in
His-Glu without sugar(34) , but can interact with
O3 at 3.0 Å. The position, coordination, and temperature factors
for both metals is similar in His-Glu with or without D-xylose (34) .Ser/xylose shows only slight rotation of Trp and Phe, but these positions are observed in the
wild-type/THG structure. There were no other significant changes
(>0.3 Å) in the positions of the metals or their ligands
compared to His-Ser without sugar(34) . The two
new water molecules seen near the Ser side chain,
Wat and Wat as well as the ligation of M2
by Wat in His-Ser/xylose (Fig. 2e), are also observed in His-Ser
without D-xylose(34) .Structures of His
Xylitol is an acyclic polyol inhibitor of D-xylose isomerase. The K-Ser Complexed with
Xylitol value of
xylitol for the Streptomyces violaceoruberD-xylose
isomerase is 0.45 mM(52) . The structure of wild-type S. rubiginosusD-xylose isomerase complexed with
xylitol has been reported and xylitol is observed bound in an extended
conformation and oriented such that O1 hydrogen bonds to Lys NZ and O5 with His NE2(14, 15) .
Both metals are observed and M1 is liganded by the sugar hydroxyls O2
and O4.-Ser to mimic the
acyclic sugar binding typically seen in native D-xylose
isomerase-xylose complexes. The electron density of xylitol is well
defined and xylitol binds in an extended conformation (Fig. 2f). However, significant structural changes are
observed in and near the active site of His-Ser/xylitol (Fig. 2f and Fig. 7). These changes include the
disappearance of M2, the addition of two new waters (Wat and Wat), alternative conformations for the side
chains Asp and Glu, rotation of
Phe, and changes in the position of both M1 and its
carboxylate ligands. The electron density attributed to metal
(Mn) at both M1 and M2 in all of the structures
described in this work can easily be seen at 12 to 15. However,
in His-Ser/xylitol only density around M1 is seen at 12
to 15, and no peaks greater than 5 are observed around the
M2 site, strongly suggesting that M2 is not bound. In order to
accommodate O1 of xylitol, Wat has moved 1.8 Å, and
is only 1.0 Å from the site once occupied by M2. Glu OE2 shifted 1.2 Å and now hydrogen bonds to Wat at 2.9 Å and to a new water molecule (Wat) at
2.7 Å.
Leu mutation. In S. rubiginosusD-xylose isomerase, Phe and the side chains
of Val
, Leu
, Phe
, and
Phe
are buried in a hydrophobic pocket, approximately 8.0
Å from the active site. Although we would not predict the
Leu substitution to affect activity, it resulted in the
formation of insoluble inclusion bodies. After Leu was
changed back to Phe, soluble, active D-xylose isomerase was
obtained, suggesting that the Phe-Leu mutation caused
problems with protein folding.Isomerization
A cyclic-hydride transfer isomerization
mechanism has been proposed (Fig. 1b; (27) ) to
unify the observations: (i) that rate-limiting step in the reaction is
the C2-C1 hydride transfer and (ii) both the wild-type and mutant
-xylose isomerases from Clostridium thermosulfurogenes display a 2.5-fold difference in k for
-D-glucose as compared to
-D-glucose(45) . Because ring opening of both
and -D-glucose produces chemically identical
molecules, Meng et al.(27) argued that the different k values necessitate that the hydride shift must
be concerted with ring opening.-Met,
His-Ser, and His-Glu complexed with D-xylose and wild-type/THG show that O2 is 4.5 Å from
the closest of the carboxylate oxygens (OD 2) of Asp, and
that this carboxylate oxygen is liganded to M1. It is highly unlikely
that Asp could be a base catalyst given the orientation
of the -pyranose. Second, in the cyclic-hydride transfer
mechanism, M2 and Lys would have no direct function in
catalysis, even though our biochemical and crystallographic data
indicate that both are important catalytically. The structure of
His-Ser and His-Asn do not show any major
structural perturbations at M1 or Asp, yet these mutants
are almost totally inactive(34) . Structures of
His-Ser, His-Glu, and Lys-Met
with D-xylose have -D-xylopyranose in the active
site and display binding similar to wild-type/THG. Additional evidence
for a role of M2 in catalysis is shown by substitutions at residues
located near M2 ligands. Substitutions to Lys
(Lys
in S. rubiginosus) and Glu change the metal specificity and pH profile of the A.
missouriensisD-xylose isomerase (30, 35) and structures of the Glu-Gln
mutant with different metals show differences at the M2 site but not at
M1(35) . Lys is essential for activity.
Replacement of Lys with Met, Ser, Gln, or Arg renders the
enzyme inactive(30) . The structures of Lys-Met
reveals no dramatic changes to M1, M2, or their ligands and is further
evidence against the cyclic-hydride transfer. However, the
Lys-Met structures should be interpreted with caution
since other structural changes occur in this enzyme. NZ, O5 is hydrogen
bonded to His NE2, and O2 and O4 of the extended sugar are
liganded to M1 (Fig. 1a). In the metal-mediated hydride
shift mechanism proposed by Collyer et al.(16) ,
Whitlow et al.(15) , and Lavie et
al.(26) , a M2 bound hydroxide initiates isomerization by
removal of the O2 hydrogen. M2 would shift approximately 1.9 Å to
a site where it could be liganded by both carboxylate oxygens of
Glu, the imidazole NE2 of His,
Wat, and both O1 and O2 of substrate. The resulting
negative charge on O2 would be stabilized by both M1 and M2
interactions. The C2 hydrogen would transfer directly to the partial
positively-charged C1 and either a water molecule or Lys NZ might protonate O1. Lys NZ would help stabilize
the sugar by interacting with O1 of the acyclic-extended substrate,
intermediate(s), and product., Phe,
Lys, and His in the reaction are discussed
below in terms of the metal-mediated hydride shift mechanism.His
Prior to isomerization, sugar binding and
ring-opening must occur. In solution, D-xylose and D-glucose exist predominately as hemiacetals, forming
six-member pyranose rings with two anomeric forms (and
Phe and )
that differ in their stereochemistry at C1. NMR and kinetic experiments
have shown that D-xylose isomerase prefers the -pyranose
form of hemiacetal(24, 25) . His appears
to be one determinant of the preference for the -pyranose, by
interacting with the anomeric hydroxyl(30) . The results with
His-Asn suggests that this mutant enzyme has no preference
for the -pyranose over the -pyranose and is consistent with
the proposal of Lambeir et al.(30) . It was proposed
that Phe could be involved in anomeric selection by
preventing -pyranose binding due to unfavorable interactions
between the hydrophilic anomeric hydroxyl and the hydrophobic phenyl
ring(15, 50) . Although changing the phenyl side chain
to the smaller Ser decreased activity (Table 1), this mutation
did not affect anomeric specificity, indicating that Phe is not a major determinant in anomeric recognition. does have a role in maintaining the structure of the active site,
sugar binding, and stabilization of the transition state. The structure
of Phe-Ser shows two new waters and changes in the
positions of both the nearby hydrophobic side chains of Phe and Trp. Upon addition of D-xylose,
disordered density is observed in the active site, into which different
forms of sugar could be fit. As mentioned previously, the
Phe-Ser mutation has a reduced k and an increased K (Table 1). These
results suggest that Phe is involved in stabilization of
the acyclic extended transition state, through hydrophobic interactions
directly with the sugar or indirectly by interacting with the nearby
Trp and Phe side chains which in turn
contact the sugar.-pyranose, D-xylose isomerase catalyzes ring opening(25) . It was
suggested that His NE2 could act as a catalytic base,
abstracting a proton from the anomeric oxygen (O1) of the
-pyranose, and facilitating sugar ring
cleavage(15, 16) . However, in the wild-type/THG
structure, His NE2 is closer to the ring-sulfur of THG
(2.9 Å) than the anomeric hydroxyl (3.5 Å), suggesting that
the His imidazole could act as a acid catalyst and thus
protonate the ring oxygen. The pH dependence of DEPC modification
indicates that the pK of His is 6.40
± 0.01. From kinetic studies of the
Mg-activated ArthrobacterD-xylose
isomerase with fructose as a substrate, it was reported that the
pK for a group controlling K was 6.2 ± 0.1 and it was suggested that this group was
His
(His in S.
rubiginosus)(53) . The pK of
His determined by DEPC inactivation is consistent with the
kinetic study of the Arthrobacter enzyme and indicates that at
the pH optimum of the enzyme (near 8.0-9.0), His NE2
is deprotonated and probably could not be an acid catalyst in ring
opening. Changing His to non-basic residues (Ser, Ala,
Asn, and Gln) reduces activity, but the rate-limiting step in the
overall reaction has been reported to be isomerization, not ring
opening(30, 31) . The acyclic sugar
5-deoxy-D-xylulose can be used as a substrate, indicating that
enzyme-catalyzed ring opening is not a step absolutely required prior
to isomerization. Other than crystallographic observations noting the
proximity of His to cyclic sugars (15, 16) , there is no biochemical evidence suggesting
that His catalyzes ring opening.
(His in S.
rubiginosus) might be catalytically important in a cis-enediol mechanism, as replacement with Arg or Tyr rendered
the enzyme inactive(28) . However, when His was
replaced with smaller residues (Ala, Ser, Asn, Asp, Glu, and Gln),
these mutant enzymes retained
activity(29, 30, 31) , proving that
His is not crucial for catalysis and providing further
evidence against the cis-enediol mechanism. does, however, interact with the transition state. In most
crystal structures of D-xylose isomerase complexed with D-xylose, His interacts with O5 of an
acyclic-extended form of sugar. Biochemical evidence for a
His-sugar interaction is shown by comparing the kinetics
of the wild-type enzyme and His mutants on D-xylose, D-xylulose, and 5-deoxy-D-xylulose (Table 2). Both mutants have lower k and
higher K values on D-xylose and D-xylulose when compared to the native enzyme. This is likely
due to the loss of a hydrogen bond from O5 of the extended sugar to the
substituted side chain. The interaction with the C5 hydrogen of
5-deoxy-D-xylulose and His NE2 of the native
enzyme is clearly unfavorable, as reflected in both the diminished k and elevated K. A
possible reason for the His mutants having a similar k on D-xylulose and
5-deoxy-D-xylulose is that their smaller side chains cannot
hydrogen bond to O5 of D-xylulose, and the replaced side
chains are not close enough to interact unfavorably with the C5 methyl
group of 5-deoxy-D-xylulose. to O5 of the
extended substrate can be inferred from the His-Ser/xylose
structure. The Ser side chain is 6.9 Å away from O5
of the extended sugar and thus cannot form a hydrogen bond to
substrate. The electron density contributed by the sugar in the active
site is weak and the temperature factors of the metals are high,
possibly because the hydrogen bond between substrate is lost and/or the
His-Ser mutation makes the active site larger.Lys
As mentioned previously, virtually all
reports of wild-type D-xylose isomerase complexed with D-xylose have shown an acyclic conformation of sugar bound to
the enzyme. The exception where and
His-D-xylopyranose was
observed was attributed to the low occupancy of both
metals(15) . The -D-xylopyranose form is observed
in Lys-Met, His-Ser, and
His-Glu mutants none of which have appreciable activity (Table 1). The Lys-Met mutant is likely blocked at
isomerization, since D-xylose exists in small amounts in
solution as an acyclic form (0.3% in unbuffered solutions (54) ).-Met has no
activity, and His-Ser and His-Glu have only
0.3 and 0.5% activity (Table 1), respectively, it might be
expected that -D-xylopyranose would be observed. However,
one S. olivochromogenesD-xylose isomerase mutant,
Glu
-Lys (Glu in S. rubiginosus),
has no activity but shows an acyclic-extended conformation of D-glucose bound in the active site(33) . A direct role
for either Lys or His in ring opening is
unlikely since both are far (>7 Å) from the anomeric and ring
oxygens of substrate. We postulate that -D-xylopyranose
is observed in the His mutant structures because this
form is energetically more stable in the mutants than the
acyclic-extended conformation as M2 has dissociated from
His-Ser/xylitol and the altered binding site cannot
provide the proper metal geometry and/or enough ligands. In the case of
Lys-Met, we believe -D-xylopyranose is
observed in the active site because the extended sugar is not
stabilized by the absent Lys NZ-O1 sugar interaction and
thus the -D-xylopyranose conformation becomes more
stable. could function catalytically in the
metal-mediated hydride shift by assisting in the polarization of O1 of
the transition state(15, 16, 30) .
Substituting the Lys side chain with Met rendered D-xylose
isomerase inactive. In studies of the A. missouriensisD-xylose isomerase, substitution with Ser, Gln, and Arg
also inactivated the enzyme(30) . The absence of activity may,
however, result from a structural defect that indirectly affects the
function of another catalytically important residue. The structures of
both Lys-Met and Lys-Met/xylose have large
perturbations at and around Glu and Pro.
Other changes are observed at Phe and Trp in the active site. Comparison of the wild-type enzyme complexed
with D-xylose (i.e. acyclic-extended sugar) to the
Lys-Met-xylose complex suggests that the extended sugar
could be accommodated in the active site of Lys-Met.
These results clearly indicate that Lys is structurally
important but they also suggest that Lys has a role in
extending the pseudo-cyclic sugar, stabilization of the
acyclic-extended sugar, and isomerization, by interacting with O1 of
the sugar. NE2 serves as a ligand to M2 when M2 is
in either the high occupancy site (M2) or the low occupancy site
(M2`)(15). Movement to the M2` may be concurrent with deprotonation of
the C2 hydroxy(56) . Perturbing the structure at M2 or M2`
could affect sugar extension by altering the properties of the metal(s)
or the metal-bound Wat, both of which interact with O2
and/or O1 of the extended
sugar(15, 16, 19, 26, 36) .
The reason why the His mutants have little activity could
be that the introduced side chains cannot stabilize the M2` site.
Indirect evidence for M2` destabilization in His mutants
is shown by the weaker binding at M2, measured kinetically (34) and observed crystallographically. Further evidence is
provided by the ability of xylitol to eject the M2 when it is soaked
into the mutant enzyme.-Asn/xylose structure in which M2 is absent and
acyclic-extended D-xylose is observed(19) , M2 and
-D-xylopyranose are observed in the structures of
His-Ser (this study) and His-Glu (this
study). The difference in M2 occupancy might be due to different metals
used in the two studies; they employed Mg, while in
this study Mn was used. Depending upon the
substitution, there is a 48-200-fold decrease in metal affinity
with Mg compared to Mn in S.
rubiginosus His mutants(34) . The reason(s)
that different sugar conformations are observed might be because
different metals were used (as above) and/or that different
substitutions might affect substrate binding or catalysis differently.
It is unlikely these mutants operate using a different reaction
mechanism. Attempts to recover second-site mutations that restore
partial activity in either the E. coli or S. rubiginosus enzymes have yielded only reversions back to the original amino
acid residue (i.e. His-Ser back to
His; data not shown). Not all mutations at His result in the same activity. His-Gln has 3.4%
activity, His-Ser, His-Asn, and
His-Glu have 0.5-0.8% activity, and
His-Lys has no activity(30, 34) . appears to be important for maintaining the
structure around M2 when the substrate is extended. Both the structure
of His-Ser/xylitol determined in this study and the
structure of His-Asn/xylose from A. missouriensis(19) display similar sugar binding, show that M2 is
absent, and reveal new positions for metal ligands and other residues
which are located in and near the active site. These differences are
presumably caused directly and indirectly by bringing O1 and O2 of the
extended sugar near a M2 site with lower affinity for metal.
is not essential for catalysis, but appears to be
responsible for anomeric recognition and to contribute to the
stabilization of the transition state via hydrogen bonding to O5.
His may act as a base-catalyst but not likely as an acid
catalyst in ring-opening where enzyme activity is maximal. 2)
Phe is not important for anomeric recognition or essential
for enzyme activity, but it clearly contributes to the optimal binding
of the transition state. 3) Lys is important structurally
and probably catalytically. Lys-Met has structural
perturbations at Glu, Pro,
Trp, and Phe and no activity. Because
residues located at the catalytic center only experience minor
perturbations, we suggest that Lys has a direct role in
sugar extension and/or isomerization through interactions with O1 of
substrate. 4) Additional, unaccounted for electron density is observed
near M2 in the structure of His-Ser/xylose and appears to
represent an alternate position for M2 (M2`). Comparing the peak
heights of M2 and M2` in the F - F map of the wild-type enzyme yields a ratio
M2:M2` of 13:1. Metal at the M2` position could be a major contributor
to catalysis coordinating both O1 and O2 of the acyclic-extended sugar.
The low activity of His-Ser may be due to the inability
of Ser to stabilize metal binding at the M2` position. 5)
His is likely important because it coordinates metal at
both the M2 and M2` positions, as we suggest it is necessary for
catalysis. His-Ser and His-Glu mutants have
little activity and their structures have M1, M2, and
-D-xylopyranose bound to the active site. Xylitol binds
in an extended form to His-Ser, but the metal at the M2
position is lost from the enzyme rather than simply being shifted.
)-D-glucose; PCR,
polymerase chain reaction; DEPC, diethylpyrocarbonate; M1, metal 1; M2,
metal 2; Wat, water; Pipes, 1,4-piperazinediethanesulfonic acid.)
We acknowledge and thank Steve Seeholzer (Fox Chase
Cancer Center) for advice on the synthesis of
5-deoxy-D-xylulose, assaying D-xylose isomerase on
5-deoxy-D-xylulose, and general discussions. Anthony Yeung
(Fox Chase Cancer Center) synthesized oligonucleotide primers used in
this study.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J. Karimaki, T. Parkkinen, H. Santa, O. Pastinen, M. Leisola, J. Rouvinen, and O. Turunen Engineering the substrate specificity of xylose isomerase Protein Eng. Des. Sel., December 1, 2004; 17(12): 861 - 869. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. Urbanczyk-Wochniak, A. Leisse, U. Roessner-Tunali, A. Lytovchenko, J. Reismeier, L. Willmitzer, and A. R. Fernie Expression of a Bacterial Xylose Isomerase in Potato Tubers Results in an Altered Hexose Composition and a Consequent Induction of Metabolism Plant Cell Physiol., December 15, 2003; 44(12): 1359 - 1367. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. A. Erlandson, J.-H. Park, Wissam, El Khal, H.-H. Kao, P. Basaran, S. Brydges, and C. A. Batt Dissolution of Xylose Metabolism in Lactococcus lactis Appl. Envir. Microbiol., September 1, 2000; 66(9): 3974 - 3980. [Abstract] [Full Text]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |