Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whitaker, R. D.
Right arrow Articles by Batt, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whitaker, R. D.
Right arrow Articles by Batt, C. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 39, Issue of September 29, pp. 22895-22906, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Probing the Roles of Active Site Residues in

D

-Xylose Isomerase (*)

(Received for publication, March 27, 1995; and in revised form, July 14, 1995)

Richard D. Whitaker (1)(§) Yunje Cho (1)(¶) Jaeho Cha (1)(**) H. L. Carrell (3)(§§) Jenny P. Glusker (3)(§§) P. Andrew Karplus (2) Carl A. Batt (1)(¶¶)

From the  (1)Department of Food Science and (2)Section of Biochemistry, Cell and Molecular Biology, Cornell University, Ithaca, New York 14853 and the (3)Institute for Cancer Research, Fox Chase Cancer Center, Philadelphia, Pennsylvania 19111

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
CONCLUSIONS
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The roles of active site residues His, Phe, Lys, and His in the Streptomyces rubiginosusD-xylose isomerase were probed by site-directed mutagenesis. The kinetic properties and crystal structures of the mutant enzymes were characterized. The pH dependence of diethylpyrocarbonate modification of His suggests that His does not catalyze ring-opening as a general acid. His appears to be involved in anomeric selection and stabilization of the acyclic transition state by hydrogen bonding. Phe stabilizes the acyclic-extended transition state directly by hydrophobic interactions and/or indirectly by interactions with Trp and Phe. Lys and His mutants have little or no activity and the structures of these mutants with D-xylose reveal cyclic alpha-D-xylopyranose. Lys functions structurally by maintaining the position of Pro and Glu and catalytically by interacting with acyclic-extended sugars. His provides structure for the M2-metal binding site with properties which are necessary for extension and isomerization of the substrate. A second M2 metal binding site (M2`) is observed at a relatively lower occupancy when substrate is added consistent with the hypothesis that the metal moves as the hydride is shifted on the extended substrate


INTRODUCTION

D-Xylose isomerase (EC 5.3.1.5) catalyzes the reversible interconversions of D-xylose to D-xylulose and D-glucose to D-fructose. The D-xylose isomerase gene (xylA) has been cloned from a variety of bacterial sources(1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12) and structures of the Streptomyces rubiginosus(13, 14, 15) , Arthrobacter(16, 17, 18) , Actinoplanes missouriensis(19) , and Streptomyces olivochromogenes(20, 21) enzymes have been determined by x-ray crystallography. The catalytic domains fold as eight-stranded alpha/beta barrel motifs and contain a well conserved active site with two divalent metal ions(17) . All D-xylose isomerases require Mg, Co, or Mn ions for activity, suggesting that they have similar enzymatic mechanisms.

Initially, a cis-enediol mechanism was proposed for D-xylose isomerase(14, 22) , similar to the mechanism of triose-phosphate isomerase. However, isotope exchange experiments (23) and crystallographic analyses (15, 16) with various substrates and inhibitors suggests that the reaction proceeds via a metal-mediated hydride shift (Fig. 1a). The currently accepted pathway for the reaction involves the preferential binding of alpha-D-xylopyranose (24, 25) followed by ring opening(25) , extension of the substrate, and then the hydride shift(15, 16, 26) . Recently, Meng et al.(27) have proposed that the hydride shift occurs on the cyclic form of sugar (Fig. 1b).


Figure 1: Cartoons of the metal-mediated hydride shift (a) (15, 16, 26) and cyclic-hydride transfer mechanisms (b)(27) . Residues relevant to this study (His, Phe, Lys, and His) are shown, as well as Asp, which is important in the cyclic-hydride transfer mechanism (b). Metal ions are labeled M1 and M2. In both mechanisms the alpha-pyranose (D-xylose is shown here) binds to the active site and after isomerization, the alpha-furanose form (D-xylulose is shown here) is released. In the metal-mediated hydride shift, ring opening is required prior to isomerization, while in the cyclic-hydride transfer ring opening and isomerization occur at the same step.



Site-directed mutagenesis has been used to probe the functions of specific active site residues in D-xylose isomerase(27, 28, 29, 30, 31, 32) , however, only a few structures of mutant enzymes have been reported(19, 33, 34, 35) . Kinetic data can be misleading if the substitutions affect the properties of catalytically important residues other than those changed by mutagenesis. For this reason, we have shifted our mutagenic studies from the Escherichia coliD-xylose isomerase(28, 29) , which has not been successfully crystallized, to the S. rubiginosus enzyme which readily forms crystals diffracting x-rays beyond 2.0 Å(15, 34, 36) . Here, we report the cloning and expression of S. rubiginosus xylA in E. coli, and investigate the roles of His and Phe in anomeric recognition, the putative role of His in ring opening, and the functions of His, Phe, Lys, and His in isomerization.


MATERIALS AND METHODS

Bacterial Strains and Plasmids

S. rubiginosus (ATCC 21175) was obtained from the American Type Culture Collection. E. coli BL21(DE3) (FompT r

Biochemical Reagents

All compounds were reagent grade and purchased from Sigma, except acetaldehyde and 5-thio-alpha-D-glucopyranose (THG), (^1)which were from Aldrich. The sugar 5-deoxy-D-xylulose was synthesized by aldol condensation of dihydroxyacetone and acetaldehyde, using rabbit muscle aldolase with the cofactor sodium arsenate as a catalyst, and was purified by ion-exchange chromatography, (^2)using a scheme similar to that described by Durrwachter et al.(37) for the synthesis of 5-deoxy-D-fructose.

DNA Isolation, Transformation, and Manipulations

S. rubiginosus was grown in yeast and maltose extract medium supplemented with 34% (w/v) sucrose and chromosomal DNA was isolated as Hopwood et al.(38) . Both plasmid and bacteriophage DNA were isolated from cultures of E. coli TG1 grown in LB medium as recommended by Sambrook et al.(39) . Site-directed mutagenesis was conducted as described previously(34, 40) . His was changed to Ser, Asn, and Asp; Phe to Ser; Lys to Met; and His to Ser and Glu. DNA sequencing was carried out with the 7-deaza-dGTP sequencing kit from U. S. Biochemical Corp.

Cloning and Expression of S. rubiginosus xylA in E. coli

The reported S. rubiginosus xylA sequence (12) was used to construct two oligonucleotide primers (primer 1: ATGAACTACCAGCCCACCCCCGAGGACAGG) (primer 2: TCAGCCCCGGGCGCCAGCAGGTGGTCCAT) which were used in a PCR to amplify xylA from purified S. rubiginosus chromosomal DNA. The PCR reaction mixture was in 100 µl, containing 2 units of Taq DNA polymerase, 250 µM each of dATP, dTTP, and dCTP, 125 µM each of dGTP and 7-deaza-dGTP, 0.5 µM each of primers 1 and 2, 500 ng of S. rubiginosus chromosomal DNA, 50 mM KCl, 1.5 mM MgCl(2), 0.05% Tween 20 (w/v), and 0.1 mg/ml bovine serum albumin in 10 mM Tris-HCl (pH 8.8). The PCR was conducted in a Hybaid thermocycler, using the following parameters: cycle 1, 90 °C for 10 min, 94 °C for 0.5 min, 65 °C for 2 min, 72 °C for 2 min; cycles 2-34, 94 °C for 0.5 min, 65 °C for 2 min, 72 °C for 2 min; cycle 35, 94 °C for 0.5 min, 65 °C for 2 min, 72 °C for 5 min. After the first PCR, 1 µl was removed and used in a second PCR. The reaction mixture was as above except primers 1 and 2 were replaced by primers containing restriction sites for EcoRI and BspHI (bold and underlined, respectively; GGAATTCATGAACTACCAGCCCACCCCCGAG) and HindIII (italic; CCCAAGCTTAGCCCCGGGCGCCCAGCAG). The PCR reaction was then as follows: cycle 1, 94 °C for 1 min, 50 °C for 1 min, 74 °C for 2 min; cycles 2-34, 94 °C for 0.5 min, 60 °C for 0.5 min, 74 °C for 2 min; cycle 35, 94 °C for 0.5 min, 60 °C for 0.5 min, 74 °C for 10 min. The PCR product was purified with a Sephacryl G-200 spin column (Pharmacia) and concentrated by isopropyl alcohol/sodium acetate precipitation. The PCR product was restricted with EcoRI and HindIII, ligated into EcoRI and HindIII digested M13 mp19 and transformed into E. coli TG1. Only one transformant was selected that had a 1.2-kilobase insert. The insert DNA was sequenced and confirmed to be xylA. The plasmid pRDW100 was constructed by removing the xylA insert from M13 mp19 with BspHI and HindIII and subcloning it into NcoI-HindIII digested pET11d. The production and purification of D-xylose isomerase was as described previously(34) .

Enzyme Assays

D-Xylose and D-xylulose solutions were prepared at least 12 h prior to use in kinetic assays in order to allow them to reach anomeric equilibrium. All mutants and wild-type D-xylose isomerase were preincubated with metal 12 h prior to measuring activity. The activity of His and Lys substitutions was assayed with D-xylose, as described previously(34) , using the method of Dische and Borenfreund (41) . The kinetics of His and Phe substitutions and of the wild-type D-xylose isomerase with D-xylose as a substrate were determined by the coupled sorbitol dehydrogenase assay(42) . The reaction was carried out at 30 °C in 100 mM KCl, 10 mM HEPES (pH 7.7), 10 mM MgCl(2), 0.55 mM NADH, 1.5 units of sorbitol dehydrogenase, 1-100 mMD-xylose and D-xylose isomerase (0.05-1 µM) in a total volume of 1 ml. The rate of NADH oxidation was followed on a Pharmacia UltraspecII spectrophotometer at 340 nm for 1.5 min. The kinetics of His mutants and wild-type D-xylose isomerase with D-xylulose as a substrate was performed at 30 °C in 100 mM KCl, 10 mM HEPES (pH 7.7), 10 mM MgCl(2), 0.5-40 mMD-xylulose, and 0.1-0.7 µMD-xylose isomerase in a total volume of 100 µl. When 5-10% of the D-xylulose was converted to D-xylose, the reaction was terminated by the addition of 100 µl of 0.1 M trichloroacetic acid (pH 2). D-Xylulose was separated from D-xylose by high performance liquid chromatography using a Bio-Rad Carbo-C column and the concentration of D-xylulose was determined by integration of the peak corresponding to its fraction. The kinetics of His mutants and wild-type on 5-deoxy-D-xylulose was determined at 30 °C in 100 mM KCl, 50 mM HEPES (pH 7.7), 10 mM MgCl(2), 10-200 mM 5-deoxy-D-xylulose, and 2-4 µMD-xylose isomerase in 200 µl. The reaction was stopped after 100 min with 25 µl of 2 M trichloroacetic acid (pH 2), 275 µl of D(2)O was added, and the amount of 5-deoxy-D-xylulose was determined by NMR (Brüker AM 300).

DEPC Inactivation of D-Xylose Isomerase

D-Xylose isomerase (18.6 µM) was inactivated with 0.157 mM DEPC in 10 mM MgCl(2) and 50 mM potassium phosphate buffer (pH 5.5-7.5) at 25 °C. Aliquots (10 µl) were removed from 0 to 10 min, and activity with D-xylose as a substrate was measured using the sorbitol dehydrogenase assay described above. The rate of DEPC inactivation at each pH was determined by plotting the log D-xylose isomerase activity against time of incubation with DEPC. The inflection point (pK(a)) was determined by taking the second derivative of the third order polynomial calculated by Cricket Graph version 1.3.2 (Malvern, PA).

Anomeric Specificity Assay

alpha-D-Xylose (96%) was dissolved in water and 100-µl aliquots were removed at various times. The activity of wild-type, His-Asn, or Phe-Ser enzymes on the mutarotating D-xylose (200 mM final D-xylose concentration) was determined in the sorbitol dehydrogenase assay, described above.

Crystallography

Crystallization of D-xylose isomerase was as described previously (34) . Crystals of D-xylose isomerase were stored in 1 mM MnCl(2), 2 mM Pipes (pH 7.2), and 2 M ammonium sulfate. The concentrations of D-xylose, THG, and xylitol used in crystal soaks containing 1 mM MnCl(2), 2 mM Pipes (pH 7.2), and 2 M ammonium sulfate are shown in Table 1, along with crystallographic and refinement data. X-ray diffraction data from crystals of His mutants with and without D-xylose were measured on a Nicolet X100A area detector, the data were integrated and scaled using the XDS software, and structures were refined using restrained least-squares refinement, as described in Cha et al.(34) . Diffraction data from all other crystals of mutants were measured on a San Diego Multiwire systems area detector and the structures were refined using the X-PLOR suite of programs, as described previously(34) .




RESULTS

Cloning and Expression of S. rubiginosus xylA

Two oligonucleotide primers, one of which was complementary to the 5` end and the other complementary to the 3` end of S. rubiginosus xylA(12) , were used in a PCR of S. rubiginosus chromosomal DNA. The annealing temperature for the PCR was varied from 37 to 70 °C, and MgCl(2) was added at 1.5-4 mM, but no products were amplified. Some DNA sequences with a high G + C content cannot be amplified unless 7-deaza-dGTP is included in the reaction mixture(43) . When 50% of the dGTP in the reaction mixture was substituted with 7-deaza-dGTP, a PCR product with the expected size (1.2 kilobases) was amplified. The DNA sequence of the cloned PCR product had differences at nucleotides 1735, 1857, and 2562 from the reported sequence of Wong et al.(12) . The differences at 1857 and 2562 were silent mutations (both TTT instead of TTC), but the difference at nucleotide 1735 corresponded to a PheLeu mutation (TTC to CTC) at residue 13 of the protein. The PCR product was cloned into pET11d, under the control of the T7 promoter and LacZ, and several transformants were obtained that expressed a 43-kDa protein only upon addition of isopropyl-1-thio-beta-D-galactopyranoside. This protein migrated the same in SDS-polyacrylamide gel electrophoresis as non-recombinant D-xylose isomerase, but this protein from the cell lysate was not soluble and had no enzymatic activity. To see if Leu may have caused the insolubility of recombinant D-xylose isomerase, it was mutated to Phe. Also, to potentially improve protein expression, the AGG codon for Arg, rarely observed in E. coli(44) , was replaced with the more common CGT codon. The Phe recombinant D-xylose isomerase (wild-type) was soluble and had kinetic properties identical to non-recombinant D-xylose isomerase(34) . This expression system was used to overexpress D-xylose isomerases containing active site mutations. As summarized in Table 1, six of these mutant enzymes have been kinetically characterized and crystallographically studied alone and in complex with D-xylose, and in one case, with xylitol.

Wild-type D-Xylose Isomerase Complexed with THG

The structure of the ArthrobacterD-xylose isomerase complexed with the cyclic inhibitor THG (K(i) = 33 mM) showed that His is approximately 3 Å from both the ring sulfur and atom O1, the anomeric oxygen(16) . The structure of the S. rubiginosusD-xylose isomerase with THG was determined to assess the His interactions in this enzyme with a cyclic alpha-pyranose sugar. THG can clearly be seen in the electron density map (Fig. 2a). The binding of THG in S. rubiginosus is comparable to that observed in the Arthrobacter enzyme, except His NE2 is 2.9 Å from the ring sulfur and 3.5 Å from the anomeric hydroxyl and two alternate positions for O6 are seen in the electron density (Fig. 2a). One position of O6 (ALT1) is nearly the same as that reported by Collyer et al.(45) and forms a hydrogen bond to Thr OG. In the other position (ALT2), O6 interacts with Wat. The different positions of O6 did not affect the hydrogen bonding or metal ligation of the other sugar hydroxyls. The B factors for M1 and M2 were 10 and 7 Å^2, respectively, indicating that the occupancy of both metals is high and their mobility is low.



Figure 2: Electron densities for D-xylose isomerase complexes with ligands. For all of the panels, residues are labeled at CA, metal ions (asterisks) are labeled M1 and M2, and water molecules (asterisks) are labeled Wat. The dashed lines depict metal ligation and hydrogen bonds which have distances leq3.2 Å and reasonable geometry. Cross-hatched lines represent electron density of the F - F ``omit'' map. The contour level is 3 in panels a and b, and 4 in panels c-f. a, wild-type/THG. THG was modeled in two conformations (ALT1 and ALT2) and each was refined at 0.5 occupancy. The main difference in ALT1 and ALT2 of THG is the position of O6. In ALT1, O6 is 2.8 Å from Thr OG, and in ALT2, O6 is 2.5 Å from Wat. The B factors for both models of THG, M1, and M2 are 17, 10, and 7 Å^2, respectively. Although not indicated in this figure, the positions of both metals shift 0.6 Å compared to the wild-type structure without THG. The protein side chains liganded to M1 shift 0.3 to 0.8 Å as a result of the new position of the metal and also because of the proximity of the sugar hydroxyls O3 and O4. Shifts in the positions of side chains liganded to M2 are also observed, most likely because the ligands to M1 are repositioned. The indole group of Trp rotated 9° about (2) and the phenyl ring of Phe (*, from a neighboring subunit) rotated 5° about (1) when THG was added. The amino side chain of Lys moves 0.5 Å in order to accommodate the new position of Wat which is hydrogen bonded to O2 of THG. His NE2 is 2.9 Å from the ring sulfur and 3.5 Å from the anomeric hydroxyl, and both O3 and O4 are liganded to M1 at 2.3 Å. b, His-Ser/xylose. D-Xylose was placed in the electron density, but not added during refinement because the electron density of the sugar is weak and in the absence of sugar, water molecules are located close to the positions of the sugar hydroxyls and would complicate an accurate determination of sugar occupancy (not shown). Sugar binding would be comparable to a wild type-xylulose complex(36) , except there is no hydrogen bond between Ser and O5. Instead, O5 of sugar could hydrogen bond to Wat and Wat, a water not observed in a wild-type/xylulose structure(36) . No water or metal were added to the electron density near M2, although we suspect that this electron density represents an alternate position for M2 (see Fig. 5). c, Lys-Met/xylose. alpha-D-Xylopyranose was modeled and refined in Lys-Met. The B factors for the sugar, M1, and M2 were 16, 12, and 13 Å^2, respectively. The binding of alpha-D-xylopyranose is comparable to wild-type/THG, except alpha-D-xylopyranose lacks C6 and O6. The sugar hydroxyls O3 and O4 are ligated to M1 at 2.4 and 2.3 Å, respectively. d, His-Glu/xylose. alpha-D-Xylopyranose was modeled and refined in His-Glu. The B factor for the sugar is 13 Å^2. Both metals are observed and metal ligation is similar in the absence of sugar(34) , except M1 is liganded by O3 and O4 of sugar at 2.4 and 2.2 Å, respectively. Glu does not ligand M2, but can interact with O3 of sugar at 3.0 Å. e, His-Ser/xylose. alpha-D-Xylopyranose was modeled and refined in His-Glu. The B factor for the sugar is 14 Å^2. Both metals are observed and metal ligation is similar to that observed in the absence of sugar(34) , except M1 is liganded by O3 and O4 of sugar at 2.3 and 2.2 Å, respectively. Two water molecules (Wat and Wat) are located near Ser and one water (Wat) replaces His NE2 as a ligand to M2. f, His-Ser/xylitol. The orientation of xylitol is such that O1 interacts with Lys NZ and O5 hydrogen bonds to His NE2. M1 is liganded by O2 and O4 at 2.2 and 2.3 Å, respectively. The B factor for xylitol is 6 Å^2. M2 is absent, alternate conformations (ALT1 and ALT2) for the side chain of Asp and two new water molecules (Wat and Wat) are shown. Additional differences are shown and described in Fig. 7.




Figure 5: Metal liganding at M2 (a) and M2` (b) in His-Ser/xylose. Labeling of metals, residues, and water molecules are as described in the legend to Fig. 2. Metal ligation is depicted as dashed lines and metal ligand distances are shown in Å. The ligation shown for M2` is highly speculative because the ligands may move when the metal shifts to the M2` position but due to the low occupancy at this site, alternative ligand positions would not be observed in the electron density. Wat is close to the M2` site (1.5 Å (b)), but it is shown liganded to M2` because it may move when M2 moves to M2`. The Asp and Asp carboxylate oxygens are 3.6 and 4.4 Å, respectively, from M2`, and are not M2` ligands unless they move correspondingly.




Figure 7: Overlay of His-Ser in the presence (bold lines) and absence (thin lines) of xylitol, showing the perturbed structure caused by xylitol binding. Labeling of water molecules, metal, and protein residues are as Fig. 2, except the five water molecules present in the absence of xylitol and located near the xylitol hydroxyls in His-Ser/xylitol are not labeled. No M2, two alternative positions (ALT1 and ALT2) for both the side chains of Glu and Asp, and two new water molecules (Wat and Wat which are shown in Fig. 2e) are observed in His-Ser/xylitol. The electron density of the alternative conformations for both Asp and Glu in the His-Ser/xylitol structure appeared to be equivalent (not shown), and each of the conformations were modeled at 0.5 occupancy. The average B factors for ALT1 and ALT2 of the Asp side chain are 13 and 8 Å^2, respectively, and for the two positions of the Glu side chain are 13 and 8 Å^2. The new positions for the Glu side chain cause the phenyl group of Phe to rotate 9° about (1) from its position observed in the xylitol-free His-Ser structure. Significant movement of M1 (0.5 Å) Asp OD2 (1.2 Å), and Asp OD1 (0.6 Å, not shown) is also observed, but M1 ligand distances (2.1 to 2.3 Å) do not differ significantly from the previously described structures in this study or others(15, 36) .



pK(a)of His

The ring-opening mechanism proposed by Collyer et al.(16) and Whitlow et al.(15) involves His acting as base to remove a proton from the anomeric oxygen of the substrate. However, in the wild-type/THG structure described above, His is closer (2.9 Å) to the ring sulfur than the anomeric hydroxyl (3.5 Å), suggesting that it might acid catalyze ring opening of the analogous sugar, D-xylose, via the protonation of the ring oxygen. Also, the His imidazole is held in place by a hydrogen bond to the carboxylate of Asp(36) which may help to raise the pK(a) of His. The protonation state of His was determined by chemical modification with DEPC, a reagent that reacts with histidines only in their deprotonated form(46) . Previous studies had shown that His is responsible for DEPC sensitivity(31, 47, 48, 49) , and this was reconfirmed in this study. The wild-type enzyme retained only 9.3% activity when incubated with DEPC (0.157 mM) at 25 °C for 10 min at pH 7.0, while His-Ser and His-Asn mutants (described below) retained 100% activity after incubation with DEPC. To determine the pK(a) of His, the rate of DEPC inactivation was measured in the pH range of 5.5-7.5 (Fig. 3). The inflection point (pK(a)) from two separate DEPC inactivation experiments was 6.40 ± 0.01. Parallel studies, using the same enzyme preparation, yielded a pH optimum for catalysis of D-xylose between pH 8 and 9 (Fig. 3).


Figure 3: Activity of D-xylose isomerase and DEPC inactivation as a function of pH. Activity and enzyme inactivation are as described under ``Materials and Methods.''



Kinetic Properties of HisMutants

To examine the role of His in anomeric recognition, ring opening, and isomerization, His was changed to Ser, Asn, and Asp. The His-Ser and His-Asn mutants had activity (Table 2), while His-Asp was insoluble and crude cell extracts containing this mutant enzyme had no activity. The k values for the His-Ser and His-Asn enzymes on D-xylose were 12- and 5-fold lower and the K(m) values were 2- and 7-fold higher than that observed for wild-type. It has been suggested that the lower k of His mutants is due to the loss of a hydrogen bond to O5 of the acyclic-extended substrate(30, 31) . The importance of this interaction was tested by examining the kinetics of D-xylose isomerase on the acyclic sugar 5-deoxy-D-xylulose. The His mutants had k values on the 5-deoxy-sugar similar to D-xylulose, while the wild-type had a 20-fold lower k on the deoxy-sugar than on D-xylulose (Table 2). The K(m) values on the 5-deoxy-sugar for the mutants (22.5 and 35.0 mM) were similar to the value for the native enzyme (22.0 mM).



Anomeric Specificity of D-Xylose Isomerase

D-Xylose isomerase preferentially binds the alpha-pyranose form of aldose(24, 25) . It has been reported that His is important for recognizing the alpha-pyranose (30) and that the Phe side chain prevents the beta-pyranose form from binding by steric exclusion of the O1 hydroxyl (15, 50) . To possibly allow beta-pyranose binding, the Phe side chain was replaced with the smaller hydrophilic Ser residue. The kinetics of this mutant show a 5-fold decrease in the k and a 7-fold increase in K(m) with D-xylose as a substrate (Table 1). The roles of His and Phe in anomeric recognition were directly explored by dissolving crystalline alpha-D-xylose in water and assaying relative activity, using experimental conditions similar to Lambier et al.(30) . Both wild-type and Phe-Ser had the highest activity immediately after D-xylose was dissolved and showed diminished activity as the beta-anomer was forming, until an activity equilibrium was reached (Fig. 4). His-Asn retained 100% activity over time (Fig. 4), indicating that this mutant has no preference for the alpha-pyranose over the beta-pyranose and is consistent with the results of Lambier et al.(30) .


Figure 4: Anomeric preference of wild-type (circle), Phe-Ser (Delta), and His-Asn () D-xylose isomerase. Crystalline alpha-D-xylopyranose (96%) was dissolved, aliquots were removed, and the relative rate on the mutarotating sugar was assayed at different time intervals by the coupled-sorbitol dehydrogenase assay, as described under ``Materials and Methods.''



Structures of His-Asn and His-Ser

In wild-type D-xylose isomerase, His NE2 hydrogen bonds to one water (Wat) and His ND1 interacts with Asp OD1(36) . The structures of His-Ser and His-Asn show only slight structural differences, and these differences are localized to the region around the substituted histidine. The electron densities of the His-Ser and His-Asn side chains appear well ordered and the average temperature factors for the Ser and Asn side chains are 17 and 13 Å^2, respectively. In the His-Ser structure, the side chain hydroxyl of Ser rotated approximately 150° from the position observed for His CG. In this position, Ser OG hydrogen bonds to the amide nitrogen and the OD carboxylate of Asp at 3.1 and 2.8 Å, respectively. One new water molecule (Wat) is observed 1.4 Å from the position normally occupied by His NE2 and it forms a hydrogen bond to Wat and Wat. The latter solvent molecule is 2 Å from its position in the native enzyme. In His-Asn, the Asn ND hydrogen bonds to Asp OD1 at 2.7 Å, replacing the His ND1-Asp OD1 interaction, and Asn OD hydrogen bonds to Wat at 2.9 Å. No other differences greater than 0.3 Å for either structure were observed.

Structure of His-Ser Complexed withD-Xylose

In many structures of wild-type D-xylose isomerase complexed with D-xylose or D-xylulose, His NE2 hydrogen bonds to O5, Lys NZ interacts with O1, and both O2 and O4 are liganded to M1 of the extended sugar(15, 36) . Although 1.5 MD-xylose was used to soak a His-Ser crystal, the electron density contributed by the sugar is weak; however, an acyclic-extended conformation of sugar can be seen in the F(o) - F(c) map (Fig. 2b). Placement of the sugar into the electron density reveals that hydrogen bonding to the protein and metal liganding are comparable to a wild-type/xylulose structure(36) , except there is no hydrogen bond between Ser and O5 (Fig. 2b). The B factors of both metals are significantly higher (36 Å^2 for both M1 and M2) than that observed in the wild type-xylulose complex (7 Å^2 for M1 and 6 Å^2 for M2,(36) ) suggesting that either the metals are more mobile or their occupancy is lower. The higher temperature factors of the metals might be caused by destabilization of the sugar in the active site (see ``Discussion'').

There is significant, unaccounted for electron density 3.5 Å from M1 and 1.9 Å from M2 (Fig. 2b). Since metal cannot occupy both the modeled position for M2 and the position at the excess density, it appears that this is an alternate site for M2. An equivalent, low occupancy site for M2 (M2`) has been described for the native S. rubiginosusD-xylose isomerase complexed with D-xylose (15) and is observed in our wild-type D-xylose complex. The M2` position has been proposed to stabilize the transition state of the acyclic-extended sugar in the metal-mediated hydride shift mechanism through interactions with O1 and O2 of sugar(15) .

In our wild-type structure, the relative difference peak heights calculated from a F(o) - F(c) map with M2 and M2` omitted is 0.12 e/A^3 for M2 and 0.0092 e/A^3 for M2`. This yields an estimated M2:M2` ratio of 13:1. Since the occupancy of M2` is 13-fold lower and side chain atoms and water molecules have fewer electrons than Mn, low occupancy positions for the ligands of M2` would not be seen above the noise in the electron density, as noted by others (15) . The potential liganding of the metal at M2` by Wat, His NE2, both carboxylate oxygens of Glu, and O1 and O2 of sugar is shown in Fig. 5.

Structure of Phe-Ser

In the wild-type enzyme, Phe is in the active site near the side chains of Trp and Phe (*, from a neighboring subunit). As a result of replacing the larger Phe with the smaller Ser, two alternative positions for Ser OG and two new waters (Wat and Wat) are observed in the Phe-Ser structure. In addition, the side chain of Trp moved 0.5 Å toward Ser and Phe rotated -13 and 9° about (1) and (2). No other changes greater than 0.3 Å were observed when compared to the wild-type enzyme.

Structure of Phe-Ser Complexed withD-Xylose

In the wild-type/THG structure, CZ of Phe is 3.8 Å from C1 of THG. In structures of S. rubiginosusD-xylose isomerase with an acyclic-extended pentose sugar bound in the active site(15, 36) , Phe is far from C1 (6.6 Å) and is closest to C3 (5.4 Å) of the sugar. When D-xylose is added to Phe-Ser, the electron density attributed to the sugar is disordered. Since several different conformations of cyclic, pseudo-cyclic (i.e. the sugar ring is cleaved and the sugar is somewhat cyclic) and acyclic-extended forms of D-xylose could fit into the electron density, sugar was omitted from the model. The position of M1 and M2 shift 0.2 and 0.4 Å, respectively, when D-xylose is added, but the B factors of M1 and M2 remain low (<10 Å^2). The other differences in the D-xylose complex are 0.4-Å shifts in the side chains of the metal ligands Glu, Glu, Asp, and Asp, equivalent to those observed in the wild-type/THG structure.

Structure of Lys-Met

In the metal-mediated hydride shift mechanism, Lys would assist in holding the substrate in the proper orientation and polarizing O1 by hydrogen bonding(15, 16, 30) . In the cyclic-hydride transfer, Lys has no direct catalytic role(27) . Lys was substituted with Met and this mutant enzyme had no detectable activity (Table 1). In wild-type D-xylose isomerase, Lys NZ hydrogen bonds to Asp OD1, Glu O, and Wat (Fig. 6, thin lines). Since Asp is a M2 ligand, it was possible that the Met substitution indirectly abolished activity by perturbing the structure around M2. The Lys-Met structure was determined and no large differences (>0.4 Å) in the conformations of residue 183 or 255 were observed, however, major structural changes occurred outside the active site at Glu and Pro (Fig. 6) and to a lesser extent in the active site at Phe and Trp.


Figure 6: Overlay of the wild-type D-xylose isomerase (thin lines) and Lys-Met (bold lines) showing the perturbed structure around the Met substitution. Labeling of water molecules, metal, and protein residues are as described in the legend to Fig. 2. Hydrogen bonds from Lys NZ to Asp OD 1, Glu O, and Wat in the wild-type enzyme are shown by dashed lines along with the corresponding distances for these interactions. In wild-type and Lys-Met, Glu, Pro, and Arg are the i, i+1, and i+2 residues in a non-standard turn. In wild-type, Pro is in a cis conformation while in Lys-Met, Pro is in a trans conformation. The / angles for Glu, Pro, and Arg are 76/107 and -81/-16 and -84/158, respectively, while in Lys-Met, the angles are 116/-65, -53/-33, and -135/160. The electron density around the Met side chain (not shown) is well ordered, and the average B factor for the Met side chain is 7 Å^2. There are 0.7-2.0 Å shifts in the positions of Glu and Pro. The new conformation of Glu in Lys-Met is stabilized by two new interactions, Glu OE1-Asp N and Pro O-Arg NH1 (not shown). The new position of the main chain oxygen of Pro results in the loss of two hydrogen bonds from Arg NH1 to two water molecules (not shown) in Lys-Met. The Phe side chain rotates approximately 18° toward Met CE when the polar amino group of Lys is replaced by the smaller non-polar Met, and Trp rotates approximately 10° about (2), as a result of Phe rotation and the new position of Pro. There are also slight shifts (0.3-0.4 Å) in the positions of M1, Glu, and Asp from that observed in the wild-type structure (see Fig. 2e).



The loss of the Lys-Glu hydrogen bond and the increased van der Waals radii associated with the Met side chain leads to the most dramatic structural change, with the Glu-cis-Pro peptide bond fliped from the cis to the trans conformation (Fig. 6). The Glu / angles change from 76/107° to 116/-65, both of which are angles normally not observed for non-glycine residues(51) . The energy of a Xaa-trans-Pro peptide bond is roughly 5-fold more favorable than a Xaa-cis-Pro peptide bond(51) .

Structure of Lys-Met Complexed withD-Xylose

When D-xylose is soaked into a Lys-Met crystal, electron density indicative of the cyclic alpha-D-xylopyranose is observed (Fig. 2c). The binding of alpha-D-xylopyranose is comparable to that of THG in wild-type, except alpha-D-xylopyranose lacks C6 and O6. There is no significant movement (>0.2 Å) of either metal in the Lys-Met/xylose structure compared to either the Lys-Met or the wild-type/THG structures. His NE2 is 2.7 Å from the ring-oxygen and is 3.4 Å from the anomeric oxygen. The positions of Glu, Pro, Phe, and Trp remain as in the unliganded Lys-Met structure.

Structures of His-Glu and His-Ser Complexed with D-Xylose

In wild-type D-xylose isomerase, His is the terminal residue on a short alpha-helix that includes residues 216-220. At neutral pH, the imidazole ND1 is protonated and hydrogen bonded to Pro O, and NE2 of the imidazole is ligated to M2. It was previously reported that substitutions to His result in almost a complete inactivation of D-xylose isomerase (Table 1) (34) and a decrease in thermostability. Structures of His-Ser, His-Asn, and His-Glu show that both M1 and M2 are still bound, but there are some perturbations (0.3 to 0.4 Å differences from the wild-type) in the protein around M2(34) . Crystal structures of His-Glu and His-Ser with D-xylose were determined to discover why these mutants have almost no activity. Both His mutants have clear ligand electron density into which alpha-D-xylopyranose (Fig. 2, d and e) was fitted and refined at full occupancy. The positions of M1 and M2 in the His-Glu and His-Ser do not differ greater than 0.3 Å from the sites they occupy in the wild-type/THG structure. The temperature factors for M1 are very similar in the wild-type/THG, His-Ser/xylose, and His-Glu/xylose structures (all 8 to 10 Å^2); the temperature factor for M2 is slightly higher in His-Ser/xylose (14 Å^2) than wild-type/THG (7 Å^2) and is significantly higher in His-Glu/xylose (26 Å^2), indicating that M2 is either more mobile or has a lower occupancy in the His mutants.

The largest change observed when D-xylose is added to His-Glu, is a 0.4-Å shift in the position of Asp OD. Glu does not replace the function of His NE2 in serving as a ligand to M2 (Fig. 2d), as previously observed in His-Glu without sugar(34) , but can interact with O3 at 3.0 Å. The position, coordination, and temperature factors for both metals is similar in His-Glu with or without D-xylose (34) .

The structure of HisSer/xylose shows only slight rotation of Trp and Phe, but these positions are observed in the wild-type/THG structure. There were no other significant changes (>0.3 Å) in the positions of the metals or their ligands compared to His-Ser without sugar(34) . The two new water molecules seen near the Ser side chain, Wat and Wat as well as the ligation of M2 by Wat in His-Ser/xylose (Fig. 2e), are also observed in His-Ser without D-xylose(34) .

Structures of His-Ser Complexed with Xylitol

Xylitol is an acyclic polyol inhibitor of D-xylose isomerase. The K(i) value of xylitol for the Streptomyces violaceoruberD-xylose isomerase is 0.45 mM(52) . The structure of wild-type S. rubiginosusD-xylose isomerase complexed with xylitol has been reported and xylitol is observed bound in an extended conformation and oriented such that O1 hydrogen bonds to Lys NZ and O5 with His NE2(14, 15) . Both metals are observed and M1 is liganded by the sugar hydroxyls O2 and O4.

Xylitol was added to His-Ser to mimic the acyclic sugar binding typically seen in native D-xylose isomerase-xylose complexes. The electron density of xylitol is well defined and xylitol binds in an extended conformation (Fig. 2f). However, significant structural changes are observed in and near the active site of His-Ser/xylitol (Fig. 2f and Fig. 7). These changes include the disappearance of M2, the addition of two new waters (Wat and Wat), alternative conformations for the side chains Asp and Glu, rotation of Phe, and changes in the position of both M1 and its carboxylate ligands. The electron density attributed to metal (Mn) at both M1 and M2 in all of the structures described in this work can easily be seen at 12 to 15. However, in His-Ser/xylitol only density around M1 is seen at 12 to 15, and no peaks greater than 5 are observed around the M2 site, strongly suggesting that M2 is not bound. In order to accommodate O1 of xylitol, Wat has moved 1.8 Å, and is only 1.0 Å from the site once occupied by M2. Glu OE2 shifted 1.2 Å and now hydrogen bonds to Wat at 2.9 Å and to a new water molecule (Wat) at 2.7 Å.


DISCUSSION

The S. rubiginosus xylA was cloned via PCR and expressed in E. coli. The cloned PCR fragment contained several nucleotide sequence differences, one of which gives rise to a PheLeu mutation. In S. rubiginosusD-xylose isomerase, Phe and the side chains of Val^18, Leu, Phe, and Phe are buried in a hydrophobic pocket, approximately 8.0 Å from the active site. Although we would not predict the Leu substitution to affect activity, it resulted in the formation of insoluble inclusion bodies. After Leu was changed back to Phe, soluble, active D-xylose isomerase was obtained, suggesting that the Phe-Leu mutation caused problems with protein folding.

Isomerization

A cyclic-hydride transfer isomerization mechanism has been proposed (Fig. 1b; (27) ) to unify the observations: (i) that rate-limiting step in the reaction is the C2-C1 hydride transfer and (ii) both the wild-type and mutant alpha-xylose isomerases from Clostridium thermosulfurogenes display a 2.5-fold difference in k for alpha-D-glucose as compared to beta-D-glucose(45) . Because ring opening of both alpha and beta-D-glucose produces chemically identical molecules, Meng et al.(27) argued that the different k values necessitate that the hydride shift must be concerted with ring opening.

While we do not have an alternative explanation for the results of Meng et al.(27) the data from our study and others are not readily consistent with the cyclic-hydride transfer mechanism. First, Lys-Met, His-Ser, and His-Glu complexed with D-xylose and wild-type/THG show that O2 is 4.5 Å from the closest of the carboxylate oxygens (OD 2) of Asp, and that this carboxylate oxygen is liganded to M1. It is highly unlikely that Asp could be a base catalyst given the orientation of the alpha-pyranose. Second, in the cyclic-hydride transfer mechanism, M2 and Lys would have no direct function in catalysis, even though our biochemical and crystallographic data indicate that both are important catalytically. The structure of His-Ser and His-Asn do not show any major structural perturbations at M1 or Asp, yet these mutants are almost totally inactive(34) . Structures of His-Ser, His-Glu, and Lys-Met with D-xylose have alpha-D-xylopyranose in the active site and display binding similar to wild-type/THG. Additional evidence for a role of M2 in catalysis is shown by substitutions at residues located near M2 ligands. Substitutions to Lys (Lys in S. rubiginosus) and Glu change the metal specificity and pH profile of the A. missouriensisD-xylose isomerase (30, 35) and structures of the Glu-Gln mutant with different metals show differences at the M2 site but not at M1(35) . Lys is essential for activity. Replacement of Lys with Met, Ser, Gln, or Arg renders the enzyme inactive(30) . The structures of Lys-Met reveals no dramatic changes to M1, M2, or their ligands and is further evidence against the cyclic-hydride transfer. However, the Lys-Met structures should be interpreted with caution since other structural changes occur in this enzyme.

With the exception of the results of Meng et al.(27) , the aforementioned data and observations are consistent with the proposed metal-mediated hydride shift mechanism (Fig. 1a)(15, 16) . When D-xylose, D-glucose, xylitol, or sorbitol are added to D-xylose isomerase, an acyclic-extended form of sugar is observed which may represent substrate, product, or intermediate(s) (15, 16, 18, 19, 21, 26, 35, 36). The orientation of substrate is such that O1 is hydrogen bonded to Lys NZ, O5 is hydrogen bonded to His NE2, and O2 and O4 of the extended sugar are liganded to M1 (Fig. 1a). In the metal-mediated hydride shift mechanism proposed by Collyer et al.(16) , Whitlow et al.(15) , and Lavie et al.(26) , a M2 bound hydroxide initiates isomerization by removal of the O2 hydrogen. M2 would shift approximately 1.9 Å to a site where it could be liganded by both carboxylate oxygens of Glu, the imidazole NE2 of His, Wat, and both O1 and O2 of substrate. The resulting negative charge on O2 would be stabilized by both M1 and M2 interactions. The C2 hydrogen would transfer directly to the partial positively-charged C1 and either a water molecule or Lys NZ might protonate O1. Lys NZ would help stabilize the sugar by interacting with O1 of the acyclic-extended substrate, intermediate(s), and product.

The results from this study and the possible functions of His, Phe, Lys, and His in the reaction are discussed below in terms of the metal-mediated hydride shift mechanism.

Hisand Phe

Prior to isomerization, sugar binding and ring-opening must occur. In solution, D-xylose and D-glucose exist predominately as hemiacetals, forming six-member pyranose rings with two anomeric forms (alpha and beta) that differ in their stereochemistry at C1. NMR and kinetic experiments have shown that D-xylose isomerase prefers the alpha-pyranose form of hemiacetal(24, 25) . His appears to be one determinant of the preference for the alpha-pyranose, by interacting with the anomeric hydroxyl(30) . The results with His-Asn suggests that this mutant enzyme has no preference for the alpha-pyranose over the beta-pyranose and is consistent with the proposal of Lambeir et al.(30) . It was proposed that Phe could be involved in anomeric selection by preventing beta-pyranose binding due to unfavorable interactions between the hydrophilic anomeric hydroxyl and the hydrophobic phenyl ring(15, 50) . Although changing the phenyl side chain to the smaller Ser decreased activity (Table 1), this mutation did not affect anomeric specificity, indicating that Phe is not a major determinant in anomeric recognition.

Phe does have a role in maintaining the structure of the active site, sugar binding, and stabilization of the transition state. The structure of Phe-Ser shows two new waters and changes in the positions of both the nearby hydrophobic side chains of Phe and Trp. Upon addition of D-xylose, disordered density is observed in the active site, into which different forms of sugar could be fit. As mentioned previously, the Phe-Ser mutation has a reduced k and an increased K(m) (Table 1). These results suggest that Phe is involved in stabilization of the acyclic extended transition state, through hydrophobic interactions directly with the sugar or indirectly by interacting with the nearby Trp and Phe side chains which in turn contact the sugar.

After binding of the alpha-pyranose, D-xylose isomerase catalyzes ring opening(25) . It was suggested that His NE2 could act as a catalytic base, abstracting a proton from the anomeric oxygen (O1) of the alpha-pyranose, and facilitating sugar ring cleavage(15, 16) . However, in the wild-type/THG structure, His NE2 is closer to the ring-sulfur of THG (2.9 Å) than the anomeric hydroxyl (3.5 Å), suggesting that the His imidazole could act as a acid catalyst and thus protonate the ring oxygen. The pH dependence of DEPC modification indicates that the pK(a) of His is 6.40 ± 0.01. From kinetic studies of the Mg-activated ArthrobacterD-xylose isomerase with fructose as a substrate, it was reported that the pK(a) for a group controlling K(m) was 6.2 ± 0.1 and it was suggested that this group was His (His in S. rubiginosus)(53) . The pK(a) of His determined by DEPC inactivation is consistent with the kinetic study of the Arthrobacter enzyme and indicates that at the pH optimum of the enzyme (near 8.0-9.0), His NE2 is deprotonated and probably could not be an acid catalyst in ring opening. Changing His to non-basic residues (Ser, Ala, Asn, and Gln) reduces activity, but the rate-limiting step in the overall reaction has been reported to be isomerization, not ring opening(30, 31) . The acyclic sugar 5-deoxy-D-xylulose can be used as a substrate, indicating that enzyme-catalyzed ring opening is not a step absolutely required prior to isomerization. Other than crystallographic observations noting the proximity of His to cyclic sugars (15, 16) , there is no biochemical evidence suggesting that His catalyzes ring opening.

Initial site-directed mutagenesis experiments of the E. coliD-xylose isomerase suggested that His (His in S. rubiginosus) might be catalytically important in a cis-enediol mechanism, as replacement with Arg or Tyr rendered the enzyme inactive(28) . However, when His was replaced with smaller residues (Ala, Ser, Asn, Asp, Glu, and Gln), these mutant enzymes retained activity(29, 30, 31) , proving that His is not crucial for catalysis and providing further evidence against the cis-enediol mechanism.

His does, however, interact with the transition state. In most crystal structures of D-xylose isomerase complexed with D-xylose, His interacts with O5 of an acyclic-extended form of sugar. Biochemical evidence for a His-sugar interaction is shown by comparing the kinetics of the wild-type enzyme and His mutants on D-xylose, D-xylulose, and 5-deoxy-D-xylulose (Table 2). Both mutants have lower k and higher K(m) values on D-xylose and D-xylulose when compared to the native enzyme. This is likely due to the loss of a hydrogen bond from O5 of the extended sugar to the substituted side chain. The interaction with the C5 hydrogen of 5-deoxy-D-xylulose and His NE2 of the native enzyme is clearly unfavorable, as reflected in both the diminished k and elevated K(m). A possible reason for the His mutants having a similar k on D-xylulose and 5-deoxy-D-xylulose is that their smaller side chains cannot hydrogen bond to O5 of D-xylulose, and the replaced side chains are not close enough to interact unfavorably with the C5 methyl group of 5-deoxy-D-xylulose.

Additional evidence for the importance of the hydrogen bond from His to O5 of the extended substrate can be inferred from the His-Ser/xylose structure. The Ser side chain is 6.9 Å away from O5 of the extended sugar and thus cannot form a hydrogen bond to substrate. The electron density contributed by the sugar in the active site is weak and the temperature factors of the metals are high, possibly because the hydrogen bond between substrate is lost and/or the His-Ser mutation makes the active site larger.

Lysand His

As mentioned previously, virtually all reports of wild-type D-xylose isomerase complexed with D-xylose have shown an acyclic conformation of sugar bound to the enzyme. The exception where alpha-D-xylopyranose was observed was attributed to the low occupancy of both metals(15) . The alpha-D-xylopyranose form is observed in Lys-Met, His-Ser, and His-Glu mutants none of which have appreciable activity (Table 1). The Lys-Met mutant is likely blocked at isomerization, since D-xylose exists in small amounts in solution as an acyclic form (0.3% in unbuffered solutions (54) ).

There are several possible reasons for observing cyclic sugar in these mutants: (i) the extended form of sugar represents product, (ii) the mutated side chains directly or indirectly block the ring opening step, or (iii) the binding energy of cyclic (or pseudo-cyclic) sugar is improved to the binding energy of the extended substrate. Computer simulations of D-xylose isomerase with D-xylose estimated that there is an increase of 8 kcal/mol when D-xylose goes from pseudo-cyclic (O3 and O4 ligated to M1) to acyclic (O2 and O4 ligated to M1) conformations(55) . Entropic contributions were not included in their calculation and might lower this estimate. One possibility is that the acyclic form of sugar observed bound to the wild-type D-xylose complexes is actually D-xylulose(15) . Since Lys-Met has no activity, and His-Ser and His-Glu have only 0.3 and 0.5% activity (Table 1), respectively, it might be expected that alpha-D-xylopyranose would be observed. However, one S. olivochromogenesD-xylose isomerase mutant, Glu-Lys (Glu in S. rubiginosus), has no activity but shows an acyclic-extended conformation of D-glucose bound in the active site(33) . A direct role for either Lys or His in ring opening is unlikely since both are far (>7 Å) from the anomeric and ring oxygens of substrate. We postulate that alpha-D-xylopyranose is observed in the His mutant structures because this form is energetically more stable in the mutants than the acyclic-extended conformation as M2 has dissociated from His-Ser/xylitol and the altered binding site cannot provide the proper metal geometry and/or enough ligands. In the case of Lys-Met, we believe alpha-D-xylopyranose is observed in the active site because the extended sugar is not stabilized by the absent Lys NZ-O1 sugar interaction and thus the alpha-D-xylopyranose conformation becomes more stable.

Lys could function catalytically in the metal-mediated hydride shift by assisting in the polarization of O1 of the transition state(15, 16, 30) . Substituting the Lys side chain with Met rendered D-xylose isomerase inactive. In studies of the A. missouriensisD-xylose isomerase, substitution with Ser, Gln, and Arg also inactivated the enzyme(30) . The absence of activity may, however, result from a structural defect that indirectly affects the function of another catalytically important residue. The structures of both Lys-Met and Lys-Met/xylose have large perturbations at and around Glu and Pro. Other changes are observed at Phe and Trp in the active site. Comparison of the wild-type enzyme complexed with D-xylose (i.e. acyclic-extended sugar) to the Lys-Met-xylose complex suggests that the extended sugar could be accommodated in the active site of Lys-Met. These results clearly indicate that Lys is structurally important but they also suggest that Lys has a role in extending the pseudo-cyclic sugar, stabilization of the acyclic-extended sugar, and isomerization, by interacting with O1 of the sugar.

His NE2 serves as a ligand to M2 when M2 is in either the high occupancy site (M2) or the low occupancy site (M2`)(15). Movement to the M2` may be concurrent with deprotonation of the C2 hydroxy(56) . Perturbing the structure at M2 or M2` could affect sugar extension by altering the properties of the metal(s) or the metal-bound Wat, both of which interact with O2 and/or O1 of the extended sugar(15, 16, 19, 26, 36) . The reason why the His mutants have little activity could be that the introduced side chains cannot stabilize the M2` site. Indirect evidence for M2` destabilization in His mutants is shown by the weaker binding at M2, measured kinetically (34) and observed crystallographically. Further evidence is provided by the ability of xylitol to eject the M2 when it is soaked into the mutant enzyme.

In contrast to the A. missouriensis His-Asn/xylose structure in which M2 is absent and acyclic-extended D-xylose is observed(19) , M2 and alpha-D-xylopyranose are observed in the structures of His-Ser (this study) and His-Glu (this study). The difference in M2 occupancy might be due to different metals used in the two studies; they employed Mg, while in this study Mn was used. Depending upon the substitution, there is a 48-200-fold decrease in metal affinity with Mg compared to Mn in S. rubiginosus His mutants(34) . The reason(s) that different sugar conformations are observed might be because different metals were used (as above) and/or that different substitutions might affect substrate binding or catalysis differently. It is unlikely these mutants operate using a different reaction mechanism. Attempts to recover second-site mutations that restore partial activity in either the E. coli or S. rubiginosus enzymes have yielded only reversions back to the original amino acid residue (i.e. His-Ser back to His; data not shown). Not all mutations at His result in the same activity. His-Gln has 3.4% activity, His-Ser, His-Asn, and His-Glu have 0.5-0.8% activity, and His-Lys has no activity(30, 34) .

His appears to be important for maintaining the structure around M2 when the substrate is extended. Both the structure of His-Ser/xylitol determined in this study and the structure of His-Asn/xylose from A. missouriensis(19) display similar sugar binding, show that M2 is absent, and reveal new positions for metal ligands and other residues which are located in and near the active site. These differences are presumably caused directly and indirectly by bringing O1 and O2 of the extended sugar near a M2 site with lower affinity for metal.


CONCLUSIONS

The functions of active site residues in D-xylose isomerase was investigated kinetically and structurally. Some of the main conclusions and supporting observations are summarized here. 1) His is not essential for catalysis, but appears to be responsible for anomeric recognition and to contribute to the stabilization of the transition state via hydrogen bonding to O5. His may act as a base-catalyst but not likely as an acid catalyst in ring-opening where enzyme activity is maximal. 2) Phe is not important for anomeric recognition or essential for enzyme activity, but it clearly contributes to the optimal binding of the transition state. 3) Lys is important structurally and probably catalytically. Lys-Met has structural perturbations at Glu, Pro, Trp, and Phe and no activity. Because residues located at the catalytic center only experience minor perturbations, we suggest that Lys has a direct role in sugar extension and/or isomerization through interactions with O1 of substrate. 4) Additional, unaccounted for electron density is observed near M2 in the structure of His-Ser/xylose and appears to represent an alternate position for M2 (M2`). Comparing the peak heights of M2 and M2` in the F(o) - F(c) map of the wild-type enzyme yields a ratio M2:M2` of 13:1. Metal at the M2` position could be a major contributor to catalysis coordinating both O1 and O2 of the acyclic-extended sugar. The low activity of His-Ser may be due to the inability of Ser to stabilize metal binding at the M2` position. 5) His is likely important because it coordinates metal at both the M2 and M2` positions, as we suggest it is necessary for catalysis. His-Ser and His-Glu mutants have little activity and their structures have M1, M2, and alpha-D-xylopyranose bound to the active site. Xylitol binds in an extended form to His-Ser, but the metal at the M2 position is lost from the enzyme rather than simply being shifted.


FOOTNOTES

*
This work was supported in part by the Cornell Center for Advanced Technology in Biotechnology (which is sponsored by the New York State Science and Technology Foundation, a consortium of industries), the National Science Foundation, and New York State Hatch funds. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Present address: New England Biolabs Inc., Beverly, MA 01915. National Institutes of Health Trainee.

Present address: Dept. of Cellular Biochemistry and Biophysics, Memorial Sloan-Kettering Cancer Center, New York, NY 10021.

**
Present address: Harvard Medical School, Dept. C. B. B. S. M, Boston, MA 02115.

§§
Supported by National Institutes of Health Grant CA-10925.

¶¶
To whom correspondence should be addressed: 413 Stocking Hall, Cornell University, Ithaca, NY 14853. Tel.: 607-255-2896; Fax: 607-255-8741; cab10{at}cornell.edu.

(^1)
The abbreviations used are: THG, 5-thio-alpha-D-glucose; PCR, polymerase chain reaction; DEPC, diethylpyrocarbonate; M1, metal 1; M2, metal 2; Wat, water; Pipes, 1,4-piperazinediethanesulfonic acid.

(^2)
S. Seeholzer, unpublished data.


ACKNOWLEDGEMENTS

We acknowledge and thank Steve Seeholzer (Fox Chase Cancer Center) for advice on the synthesis of 5-deoxy-D-xylulose, assaying D-xylose isomerase on 5-deoxy-D-xylulose, and general discussions. Anthony Yeung (Fox Chase Cancer Center) synthesized oligonucleotide primers used in this study.


REFERENCES

  1. Bor, Y. C., Moraes, C., Lee, S. P., Crosby, W. L., Sinskey, A. J., and Batt, C. A. (1992) Gene (Amst.) 114,127-132 [CrossRef][Medline] [Order article via Infotrieve]
  2. Feldmann, S. D., Sahm, H., and Sprenger, G. A. (1992) Mol. & Gen. Genet. 234,201-210
  3. Kikuchi, T., Itoh, Y., Kasumi, T., and Fukazawa, C. (1990) Agric. Biol. Chem. 54,2469-2472 [Medline] [Order article via Infotrieve]
  4. Lawlis, B. V., Dennis, M. S., Chen, E. Y., Smith, D. H., and Henner, D. J. (1984) Appl. Environ. Microbiol. 47,15-21 [Abstract/Free Full Text]
  5. Lee, Y. E., Ramesh, M. V., and Zeikus, J. G. (1993) J. Gen. Microbiol. 139,1227-1234
  6. Loviny-Anderton, T., Shaw, P. C., Shin, M. K., and Hartley, B. S. (1991) Biochem. J. 277,263-271
  7. Meaden, P. G., Aduse, O. J., Reizer, J., Reizer, A., Lanceman, Y. A., Martin, M. F., and Mitchell, W. J. (1994) Gene (Amst.) 141,97-101 [CrossRef][Medline] [Order article via Infotrieve]
  8. Rygus, T., Scheler, A., Allmansberger, R., and Hillen, W. (1991) Arch. Microbiol. 155,535-542 [CrossRef][Medline] [Order article via Infotrieve]
  9. Saari, G. C., Kumar, A. A., Kawasaki, G. H., Insley, M. Y., and O'Hara, P. J. (1987) J. Bacteriol. 169,612-618 [Abstract/Free Full Text]
  10. Scheler, A., Rygus, T., Allmansberger, R., and Hillen, W. (1991) Arch. Microbiol. 155,526-534 [CrossRef][Medline] [Order article via Infotrieve]
  11. Wilhelm, M., and Wollenberg, C. P. (1984) EMBO J. 3,2555-2560 [Medline] [Order article via Infotrieve]
  12. Wong, H. C., Ting, Y., Lin, H. C., Reichert, F., Myambo, K., Watt, K. W. K., Toy, P. L., and Drummond, R. J. (1991) J. Bacteriol. 173,6849-6858 [Abstract/Free Full Text]
  13. Carrell, H. L., Rubin, B. H., Hurley, T. J., and Glusker, J. P. (1984) J. Biol. Chem. 259,3230-3236 [Abstract/Free Full Text]
  14. Carrell, H. L., Glusker, J. P., Burger, V., Manfre, F., Tritsch, D., and Biellmann, J. F. (1989) Proc. Natl. Acad. Sci. U. S. A. 86,4440-4444 [Abstract/Free Full Text]
  15. Whitlow, M., Howard, A. J., Finzel, B. C., Poulos, T. L., Winborne, E., and Gilliland, G. L. (1991) Proteins Struct. Funct. Genet. 9,153-173 [CrossRef][Medline] [Order article via Infotrieve]
  16. Collyer, C. A., Henrick, K., and Blow, D. M. (1990) J. Mol. Biol. 212,211-236 [CrossRef][Medline] [Order article via Infotrieve]
  17. Henrick, K., Blow, D. M., Carrell, H. L., and Glusker, J. P. (1987) Protein Eng. 1,467-470 [Abstract/Free Full Text]
  18. Henrick, K., Collyer, C. A., and Blow, D. M. (1989) J. Mol. Biol. 208,129-158 [CrossRef][Medline] [Order article via Infotrieve]
  19. Jenkins, J., Janin, J., Rey, F., Chiadmi, M., Van Tilbeurgh, H., Lasters, I., De Malyer, M., Belle, D. van, Wodak, S. J., Lauwereys, M., Stanssens, P., Mrabet, N. T., Snauwaert, J., Matthyssens, G., and Lambeir, A. M. (1992) Biochemistry 31,5449-5458 [CrossRef][Medline] [Order article via Infotrieve]
  20. Farber, G. K., Machin, P., Almo, S. C., Petsko, G. A., and Hajdu, J. (1988) Proc. Natl. Acad. Sci. U. S. A. 85,112-115 [Abstract/Free Full Text]
  21. Farber, G. K., Glasfeld, A., Tiraby, G., Ringe, D., and Petsko, G. A. (1989) Biochemistry 28,7289-7297 [CrossRef][Medline] [Order article via Infotrieve]
  22. Rose, I. A., O'Connell, E. L., and Mortlock, R. P. (1969) Biochim. Biophys. Acta 178,376-379 [Medline] [Order article via Infotrieve]
  23. Allen, K. N., Lavie, A., Farber, G. K., Glasfeld, A., Petsko, G. A., and Ringe, D. (1994) Biochemistry 33,1481-1487 [CrossRef][Medline] [Order article via Infotrieve]
  24. Feather, M. S., Deshpande, V., and Lybyer, M. J. (1970) Biochem. Biophys. Res. Commun. 38,859-863 [CrossRef][Medline] [Order article via Infotrieve]
  25. Schray, K. J., and Rose, I. A. (1971) Biochemistry 10,1058-1062 [CrossRef][Medline] [Order article via Infotrieve]
  26. Lavie, A., Allen, K. N., Petsko, G. A., and Ringe, D. (1994) Biochemistry 33,5469-5480 [CrossRef][Medline] [Order article via Infotrieve]
  27. Meng, M., Bagdasarian, M., and Zeikus, J. G. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,8459-8463 [Abstract/Free Full Text]
  28. Batt, C. A., Jamieson, A. C., and Vandeyar, M. A. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,618-622 [Abstract/Free Full Text]
  29. Jamieson, A. C., and Batt, C. A. (1992) Protein Eng. 5,235-240 [Abstract/Free Full Text]
  30. Lambeir, A. M., Lauwereys, M., Stanssens, P., Mrabet, N. T., Snauwaert, J., van Tilbeurgh, H., Matthyssens, G., Lasters, I., De Mayler, M., Wodak, S. J., Jenkins, J., Chiadmi, M., and Janin, J. (1992) Biochemistry 31,5459-5466 [CrossRef][Medline] [Order article via Infotrieve]
  31. Lee, C., Bagdasarian, M., Meng, M., and Zeikus, J. G. (1990) J. Biol. Chem. 265,19082-19090 [Abstract/Free Full Text]
  32. Meng, M., Lee, C., Bagdasarian, M., and Zeikus, J. G. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,4015-4019 [Abstract/Free Full Text]
  33. Allen, K. N., Lavie, A., Glasfeld, A., Tanada, T. N., Gerrity, D. P., Carlson, S. C., Farber, G. K., Petsko, G. A., and Ringe, D. (1994) Biochemistry 33,1488-1494 [CrossRef][Medline] [Order article via Infotrieve]
  34. Cha, J., Cho, Y., Whitaker, R. D., Carrell, H. L., Glusker, J. P., Karplus, P. A., and Batt, C. A. (1994) J. Biol. Chem. 269,2687-2694 [Abstract/Free Full Text]
  35. van Tilbeurgh, H., Jenkins, J., Chiadmi, M., Janin, J., Wodak, S. J., Mrabet, N. T., and Lambeir, A. M. (1992) Biochemistry 31,5467-5471 [CrossRef][Medline] [Order article via Infotrieve]
  36. Carrell, H. L., Hoier, H., and Glusker, J. P. (1994) Acta Cryst. Sect. D 50,113-123 [CrossRef][Medline] [Order article via Infotrieve]
  37. Durrwachter, J. R., Drueckhammer, D. G., Nozaki, K., Sweers, H. M., and Wong, C. H. (1986) J. Am. Chem. Soc. 108,7812-7818 [CrossRef]
  38. Hopwood, D. A., Bibb, M. J., Chater, K. F., Kieser, T., Bruton, C. J., Kieser, H. M., Smith, C. P., Ward, J. M., and Schrempf, K. (1985) Genetic Manipulations of Streptomyces: A Laboratory Manual, John Innes Foundation, Norwich, Great Britain
  39. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  40. Vandeyar, M. A., Weiner, M. P., Hutton, C. J., and Batt, C. A. (1988) Gene (Amst.) 65,129-133 [CrossRef][Medline] [Order article via Infotrieve]
  41. Dische, Z., and Borenfreund, E. (1951) J. Biol. Chem. 192,583-587 [Free Full Text]
  42. Kersters, H. H., Callens, M., Van, O. O., Vangrysperre, W., and De, B. U. C. K. (1987) Enzyme Microb. Technol. 9,145-148 [CrossRef]
  43. Innis, M. A., Gelfad, D. H., Sninsky, J. J., and White, T. J. (eds) (1990) PCR Protocols: A Guide to Methods and Applications, Academic Press Inc., San Diego, CA
  44. Wada, K., Wada, Y., Doi, H., Ishibashi, F., Gojobori, T., and Ikemura, T. (1991) Nucleic Acids Res. 19,1981-1986
  45. Collyer, C. A., and Blow, D. M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87,1362-1366 [Abstract/Free Full Text]
  46. Miles, E. W. (1977) Methods Enzymol. 47,431-442 [Medline] [Order article via Infotrieve]
  47. Gaikwad, S. M., More, M. W., Vartak, H. G., and Deshpande, V. V. (1988) Biochem. Biophys. Res. Commun. 155,270-277 [CrossRef][Medline] [Order article via Infotrieve]
  48. Vangrysperre, W., Callens, M., Kersters-Hilderson, H., and De Bruyne, C. K. (1988) Biochem. J. 250,153-160 [Medline] [Order article via Infotrieve]
  49. Vangrysperre, W., van Damme, J., Vanderkerckhove, J., de Bruyne, C., Cornelis, R., and Kersters-Hilderson, H. (1990) Biochem. J. 265,699-705 [Medline] [Order article via Infotrieve]
  50. Collyer, C. A., Goldberg, J. D., Viehmann, H., Blow, D. M., Ramsden, N. G., Fleet, G. W. J., Montgomery, F. J., and Grice, P. (1992) Biochemistry 31,12211-12218 [CrossRef][Medline] [Order article via Infotrieve]
  51. Creighton, T. E. (1993) Proteins: Structures and Molecular Properties, W. H. Freeman and Company, New York
  52. Callens, M., Kersters, H. H., Van, O. O., and De, B. C. K. (1986) Enzyme Microb. Technol. 8,696-700 [CrossRef]
  53. Rangarajan, M., and Hartley, B. S. (1992) Biochem. J. 283,223-233
  54. Angyal, S. (1984) Adv. Carbohyd. Chem. Biochem. 42,15-68
  55. Smart, O. S., Akins, J., and Blow, D. M. (1992) Proteins Struct. Funct. Genet. 13,100-111 [CrossRef][Medline] [Order article via Infotrieve]
  56. Allen, K. N., Lavie, A., Petsko, G. A., and Ringe, D. (1995) Biochememistry 34,3742-3749

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Protein Eng Des SelHome page
J. Karimaki, T. Parkkinen, H. Santa, O. Pastinen, M. Leisola, J. Rouvinen, and O. Turunen
Engineering the substrate specificity of xylose isomerase
Protein Eng. Des. Sel., December 1, 2004; 17(12): 861 - 869.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
E. Urbanczyk-Wochniak, A. Leisse, U. Roessner-Tunali, A. Lytovchenko, J. Reismeier, L. Willmitzer, and A. R. Fernie
Expression of a Bacterial Xylose Isomerase in Potato Tubers Results in an Altered Hexose Composition and a Consequent Induction of Metabolism
Plant Cell Physiol., December 15, 2003; 44(12): 1359 - 1367.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
K. A. Erlandson, J.-H. Park, Wissam, El Khal, H.-H. Kao, P. Basaran, S. Brydges, and C. A. Batt
Dissolution of Xylose Metabolism in Lactococcus lactis
Appl. Envir. Microbiol., September 1, 2000; 66(9): 3974 - 3980.
[Abstract] [Full Text]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Whitaker, R. D.
Right arrow Articles by Batt, C. A.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Whitaker, R. D.
Right arrow Articles by Batt, C. A.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement