|
Volume 270,
Number 39,
Issue of September 29, pp. 22924-22932, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Interleukin
4-inducible Phosphorylation of HMG-I(Y) Is Inhibited by Rapamycin (*)
(Received for publication, February 24, 1995; and in revised form, July 3, 1995)
Ding-Zhi
Wang
,
Philip
Ray
,
Mark
Boothby (§)
From the Department of Microbiology and Immunology, Vanderbilt
University School of Medicine, Nashville, Tennessee 37232-2363
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The non-histone chromosomal protein HMG-I(Y) participates in
repression of transcription directed by a promoter which confers
interleukin 4 (IL-4)-inducible activation in transfected B cell lines.
Metabolic labeling, phosphoamino acid analyses, and in vitro phosphorylation studies demonstrate that IL-4 induces serine
phosphorylation of HMG-I(Y) in B lymphocytes. Phosphopeptide mapping
shows that the predominant site of phosphorylation contains a casein
kinase II consensus motif. The immunosuppressive agent rapamycin has
been shown preferentially to inhibit IgE production by IL-4-treated
human B cells. It is shown here that rapamycin inhibits both activation
of the human germ line promoter by IL-4 and IL-4-inducible
phosphorylation of HMG-I(Y). These findings demonstrate a
rapamycin-sensitive pathway that transduces signals from the IL-4
receptor to nuclear factors that regulate inducible transcription. The
affinity of normal nuclear HMG-I(Y) for DNA is increased by
dephosphorylation in vitro, whereas in vitro kinase
reactions using casein kinase II decrease recombinant HMG-I(Y) binding
to DNA. These data further suggest a novel mechanism in which
phosphorylation triggered by IL-4 or other cytokines could regulate the
effects of HMG-I(Y) on gene transcription.
INTRODUCTION
Immunoglobulin heavy chain isotype switching is regulated by
cytokines. The transcriptional activity of promoters located upstream
from the heavy chain switch recombination targets is controlled by
cytokines as part of isotype switching(1, 2) .
Deletion of germ line promoter regions from mouse DNA by homologous
recombination inactivates isotype switching involving the mutant heavy
chain isotype, whereas insertion of a constitutive promoter allowed
normal lymphokine dependence to be
bypassed(3, 4, 5) . These data support the
involvement of germ line Ig promoters in regulation of immunoglobulin
isotype switching. In the case of immunoglobulin E (IgE), the
heavy chain immunoglobulin germ line promoter is activated by
interleukin 4 (IL-4) ( )treatment of human B cells or
treatment of mouse B cells by IL-4 plus the polyclonal activator
lipopolysaccharide(6, 7, 8) . The
immunosuppressive drug rapamycin inhibits IL-4-dependent IgE synthesis
by human B cells more, and at a lower concentration, than that of
certain other Ig isotypes(9, 10) . However, relatively
little is known about the signal transduction pathways that connect the
IL-4 receptor to nuclear events that mediate IL-4-dependent gene
transcription. We have previously shown that the induction of germ
line RNA reflects activation of transcription, and a DNA fragment from
the G promoter is sufficient to confer IL-4-inducible activation
on a heterologous reporter gene(11) . The non-histone
chromosomal protein HMG-I(Y) is an alternatively spliced
10-12-kDa high mobility group (HMG) protein that binds to the
minor groove of dA-T clusters but has some sequence preferences among
such dA-T regions(12, 13, 14) . HMG-I(Y)
participates in repression of basal activity and increases the
inducibility of the G and IL-4
promoters(15, 16) . It also contributes to regulation
of the promoters for interferon promoter by
virus(17, 18) , E-selectin by interleukin
1(19, 20) , and of the IL-2R (CD25) promoter by T
cell activation(21) . Because each of these promoters is
inducible, these data raise the question whether HMG-I(Y) is subject to
regulation in response to signals from cell surface receptors. HMG-I(Y) was originally identified as a protein whose
phosphorylation is associated with cellular transformation and
proliferation(22, 23) , whereas IL-4 is able to
inhibit the proliferation of leukemic B cells (24) . HMG-I(Y)
is phosphorylated by cdc2 kinase, and this threonine phosphorylation
leads to decreased DNA binding activity of HMG-I(Y) (25, 26) . These observations raised the possibility
that post-translational modification of HMG-I(Y) may be regulated by
IL-4. Thus, IL-4-inducible phosphorylation of HMG-I(Y) could contribute
to activation of the G promoter through phosphorylation-induced
derepression. To investigate whether IL-4 regulates the
phosphorylation status of HMG-I(Y), we have performed metabolic
labeling experiments with the IL-4-responsive human B lymphoblastoid
cell line JY(27) . These experiments demonstrate that IL-4
induces increased phosphorylation of HMG-I(Y), as well as increased
phosphorylation of other (unidentified) nuclear proteins. Phosphoamino
acid and phosphopeptide mapping analyses localize IL-4-inducible
phosphorylation of HMG-I(Y) to carboxyl-terminal serine residues
containing a casein kinase II consensus substrate motif. In vitro phosphatase treatment of nuclear extracts and casein kinase II
phosphorylation of HMG-I show that phosphorylation is associated with
decreased binding activity of HMG-I(Y). We also find that rapamycin
partially inhibits G promoter induction and causes a profound
block of the IL-4-inducible phosphorylation of HMG-I(Y). In contrast,
the tyrosine kinase inhibitor genistein has little effect on
IL-4-inducible HMG-I(Y) phosphorylation. These inhibitor results
suggest that IL-4-inducible phosphorylation of HMG-I(Y) occurs through
a pathway independent of STAT protein
activation(28, 29) . The results also suggest a model
of G promoter regulation in which IL-4-inducible phosphorylation
contributes to promoter activation through altered activity of
HMG-I(Y).
MATERIALS AND METHODS
Cell CultureJY cells (gift of Dr. L. Glimcher)
were cultured in Hepes-buffered RPMI 1640 supplemented with 50 units/ml
penicillin, 50 µg/ml streptomycin (Life Technologies, Inc.), 100
µM 2-mercaptoethanol, 3 mM glutamine, and 10%
heat-inactivated fetal calf serum. Rapamycin (generous gift of Dr. S.
Sehgal, Wyeth-Ayerst, Princeton, NJ) was prepared as a 100 µM stock in absolute ethanol stored at -20 °C. Fresh
working dilutions were prepared in -20 °C absolute ethanol
for immediate use at 1:1000 in cell cultures. Genistein (Life
Technologies, Inc.) was prepared as a stock in Me SO and
diluted to less than 1 part Me SO carrier/1000 in culture, a
concentration at which the Me SO had no effect. Purified
recombinant human (hu) IL-4 (R & D Systems, Minneapolis, MN and
generous gifts from Dr. M. Widmer, Immunex, Seattle, WA and Dr. J.
DeVries, DNAX, Palo Alto, CA) was used at 5 ng/ml unless otherwise
indicated.
Metabolic Labeling ExperimentsJY cells
(10 /ml) were cultured overnight in RPMI 1640 medium with
10% fetal bovine serum, rinsed twice with serum and phosphate-free
medium, then resuspended in phosphate-free medium containing 10%
dialyzed fetal bovine serum (Life Technologies, Inc.). Cells were
labeled for 3 or 4 h with 40 µCi/ml
[ P]orthophosphate (DuPont NEN), then stimulated
for the indicated times with huIL-4 at 5 ng/ml. Total time in label was
the same for all samples. For rapamycin treatment, cells were treated
with the indicated concentrations of rapamycin for 120 min prior to
stimulation with IL-4.
Nuclear Extracts and HMG-I(Y) AnalysesCells
either were cultured in medium only, or in medium supplemented with 5
ng/ml human IL-4, harvested, washed, and chilled to 4 °C for
subsequent steps. Nuclear proteins for two-dimensional gel analyses
were salt-extracted from nuclei as described
previously(11, 30, 31) , precipitated with
50% trichloroacetic acid, pelleted, washed twice with acetone, then
dissolved in acid-urea gel buffer (0.9 M acetic acid, 0.12 M 2-mercaptoethanol, and 15% sucrose, containing 4 M urea to avoid variable resolubilization of
HMG-I(Y))(23, 32) .Nuclear extracts for
phosphatase treatment and mobility shift experiments were prepared by
Nonidet P-40 lysis and high salt extraction of nuclei from JY cells.
Lysis and extraction were performed in the presence of protease
inhibitors but not phosphatase inhibitors, as described
previously(33, 34) . Because HMG-I(Y) is present both
in free form and in heteromeric complexes with other nuclear
proteins(15, 17, 18, 19, 20, 21) ,
in some experiments nuclear extracts were warmed for 3 min at 55 °C
to dissociate all complexes, leaving only monomeric HMG-I(Y).
Nondenaturing electrophoretic mobility shift assays were performed as
described previously(11, 31) . In the analyses shown,
a 140-base pair StyI fragment from the mouse G promoter
(-18 to +122) was used, as described
previously(15) . To verify that the mobility shift complex
consisted only of HMG-I(Y), binding inhibition experiments with
antiserum specific for HMG-I(Y) (15, 36) were
performed and showed blockade of the nucleoprotein complex. In
addition, two double-stranded DNA probes containing the dA-T tract at
the human G initiation sites were used to show that human HMG-I(Y)
also binds the human G promoter. An oligonucleotide with the
sequence CCACTGCCCGGCACAGAAATAACAACCACGGTTACT (residues 69-104
of(7) ) was used, as well as a 145-base pair fragment of DNA
spanning residues 52-196 (numbered as in(7) ) generated
by PCR with the germ line genomic clone pBS-hEI3.7 (generous gift of D.
Corti and D. Vercelli). Mobility shift data and two-dimensional gel
analyses of phosphorylation were quantified using a Fuji BAS 1000
PhosphorImager with a MacBAS software package.
In Vitro Phosphorylation of HMG-I(Y)Pure casein
kinase II (ProMega), and baculovirus-derived isoform of protein
kinase C (PKC , generous gift of J. Exton), were used in 50-µl
reactions. Reactions were performed in 25 mM Tris-Cl, pH 7.4,
10 mM MgCl , 200 mM NaCl, 0.1 mM ATP, 1 µg of HMG-I(Y), and 10-20 units of casein kinase
II incubated for 10-60 min at 37 °C or in 25 mM Tris-Cl, pH 7.5, 5 mM MgCl , 0.5 mM EGTA, 1 mM dithiothreitol, 50 µM ATP, 15
µg of HMG-I(Y), and PKC incubated for 5 min at 30
°C(37) . After incubation, analytical reaction samples were
added to SDS loading buffer, electrophoresed on 15% SDS-PAGE, and
transferred to nitrocellulose membranes for autoradiography and
subsequent phosphopeptide analysis.
Phosphoamino Acid and Phosphopeptide
AnalysesRadiolabeled phosphorylated HMG-I(Y) was transferred
from two-dimensional gels onto polyvinylidene diisopropyl fluoride
membranes (Millipore) for phosphoamino acid analyses or onto
nitrocellulose filters (Schleicher and Schuell) for phosphopeptide
mapping(38, 39, 40, 41) .
Filter-bound HMG-I(Y) was subjected to partial acid hydrolysis, and a
mixture of the solubilized hydrolysate with unlabeled phosphoamino acid
markers (Sigma) was applied to dye-free thin-layer cellulose plates (EM
Sciences) for two-dimensional electrophoresis. Phosphoamino acids were
resolved by electrophoresis at 900 V for 30 min in pH 1.9 buffer in the
first dimension and at 900 V for 45 min at pH 3.5 in the second
dimension. After autoradiography, the position of phosphoamino acid
markers was developed with ninhydrin spray to correlate with the
autoradiogram. Proteolytic digestion of filter-bound HMG-I(Y) was
performed with diphenylcarramyl chloride-treated trypsin (Sigma, Type
IX (T1005); (38) ), chymotrypsin (Sigma Type I-S (C7762); (38) ), or V8 protease (Boehringer Mannheim). The solubilized
peptides were applied to cellulose TLC plates for electrophoresis at
900 V for 30 min in the first dimension, followed by ascending
chromatography in pyridine:butanol:acetic acid:H O
(10:15:3:12), as described in (38) and (39) . Most
samples were subjected to electrophoresis in pH 8.9 buffer; for better
assignment of the site of phosphorylation, tryptic digests also were
electrophoresed in pH 1.9 and pH 3.5 buffer systems.
RNA AnalysesJY cells were plated in six-well
tissue culture clusters at 2 10 cells/ml in 3-ml
portions. Rapamycin was added to cultures 30 min before treatment with
IL-4; ethanolic carrier was added to untreated control cultures;
comparable results were obtained after overnight pretreatment with
rapamycin. Cells were harvested, rinsed twice with phosphate-buffered
saline, lysed in the presence of 3 M LiCl, 6 M urea
and processed according to(42) . Total cellular RNAs were
resolved under denaturing conditions on formaldehyde-agarose gels,
transferred to Nytran Plus filters (Schleicher and Schuell) and probed
with an 822-base pair fragment of genomic DNA from the human C
locus (generous gift of D. Vercelli) as described(8) .
Autoradiographic signals were quantified using a Fuji BAS 1000
PhosphorImager and the MacBAS software package.
RESULTS
IL-4-inducible Phosphorylation of
HMG-I(Y)HMG-I(Y) contributes to repression of the G
promoter and affects the activity of other inducible promoters as
well(15, 16, 17, 18, 19, 20, 21) .
To investigate whether the phosphorylation status of HMG-I(Y) is
regulated by IL-4, metabolic labeling experiments were performed using
JY, a human cell line in which the G promoter is highly responsive
to IL-4 treatment(7, 27) . The HMG of non-histone
chromosomal proteins is defined by their characteristic rapid mobility
during electrophoresis on acid-urea gels. Total nuclear proteins
labeled by P were therefore analyzed using a
two-dimensional acid urea/SDS-PAGE system(23, 32) . Fig. 1shows that HMG-I(Y) phosphorylation increased in
IL-4-treated cells as compared with controls.
Figure 1:
Onset of IL-4-inducible phosphorylation
of HMG-I(Y) precedes G RNA induction. A, the human B
lymphoblastoid cell line JY, in which IL-4 induction of germ line RNA
expression starts within 4 h after treatment(7) , was cultured
in carrier-free [ P]orthophosphate. Pure
recombinant human IL-4 was present in cultures for the indicated time;
all cultures were of equal length with equal cell numbers. Cells were
harvested, and two-dimensional acid-urea/SDS-polyacrylamide gels were
performed on 0.4 M salt-extracted nuclear proteins. Equal
masses of radiolabeled nuclear proteins, derived from equal cell
numbers, were resolved on 15% polyacrylamide acid-urea tube gels in the
first dimension, then resolved by electrophoresis on 15% SDS-PAGE, a
system previously shown to resolve HMG-I and Y from other HMG proteins
and histones(13, 23, 32) . The acid-urea
dimension ran from right to left on the horizontal axis, and the SDS-PAGE was from top to bottom. Control experiments with Western blotting showed that
the recovery of HMG-I(Y) was equivalent among samples in experiments.
The HMG-I(Y) spot is marked by an arrowhead on each
autoradiograph. B, a Northern blot analysis of total cellular
RNAs from JY cultured for the indicated period with recombinant human
IL-4 at 5 ng/ml. The autoradiograph shows filters probed with a human
C fragment(8) ; control hybridizations with GAPDH and
ethidium bromide staining showed equal loading of RNAs, including the
lanes showing no signal with the C
probe.
These metabolic
labeling studies first detected significantly increased phosphorylation
at 1 h, with a progressive increase between 1- and 3-h IL-4 treatment (Fig. 1A). Kinetic analyses of G induction by IL-4
show a 2 h lag before any detectable accumulation of G RNA, with
the first significant increase occurring at 2-4 h and a continued
progressive increase between 4 and 16 h ( (27) and Fig. 1B). We conclude that IL-4 induces increased
phosphorylation of HMG-I(Y) and that increased phosphorylation precedes
increased promoter activity.
Localization of the Phosphorylated Residues within
HMG-I(Y)Growth factor treatment or other stimulation of cells
can lead to gain or loss of phosphates from multiple sites within the
same nuclear protein or transcription factor, with different functional
outcomes for each site(40, 41, 43) . However,
cytokine-inducible changes in the phosphorylation status of HMG-I(Y)
have not been reported. Since HMG-I(Y) contains no tyrosine residues,
IL-4-inducible phosphorylation is predicted to be regulated by
serine/threonine kinases and phosphatases. To investigate whether IL-4
induces phosphorylation on the threonine residues adjacent to the DNA
binding domains, as for cdc2 kinase, we first performed phosphoamino
acid analyses on metabolically labeled HMG-I(Y). To imitate the
conditions of G promoter induction, unsynchronized JY cells were
treated with IL-4 for 3 h. These analyses demonstrated that HMG-I(Y) in
IL-4-treated B cells is exclusively phosphorylated on serine residues (Fig. 2). The same pattern was observed in phosphoamino acid
analyses of HMG-I(Y) metabolically labeled in control cells not treated
with IL-4 (data not shown). In addition, IL-4-inducible phosphorylation
of HMG-I(Y) is not limited to human cells or to tumor cells, as a
4-5-fold increase occurs after IL-4 treatment of the growth
factor-dependent mouse T cell line CTLL (data not shown).
Figure 2:
IL-4
inducible phosphorylation of HMG-I(Y) is on serine. Preparative
two-dimensional acid urea/SDS-PAGE gels were performed on
salt-extracted nuclei isolated from JY cells metabolically labeled with P during a 3-h IL-4 stimulation. The proteins were
electrophoretically transferred to PVP (Immobilon) filters, and the P-labeled HMG-I(Y) spot was excised from the blot after
autoradiography. Filter-bound HMG-I(Y) was then subjected to acid
hydrolysis and two-dimensional resolution of phosphoamino acids. The P-labeled spots were localized by autoradiography and
correlated with ninhydrin-stained internal control samples of
phosphoserine, phosphothreonine, and phosphotyrosine, whose positions
are indicated.
To
localize the site(s) of these phosphoserine residues in HMG-I(Y),
metabolically labeled protein was subjected to protease digestion with
trypsin or chymotrypsin, and two-dimensional phosphopeptide analyses
were performed. The site of phosphorylation was localized to a single
highly acidic peptide in IL-4-treated cells (Fig. 3). The same
tryptic peptide was observed in control cells. Digestion with V8
protease digestion also generated a single highly acidic peptide (data
not shown). In addition, the P-labeled chymotryptic and
tryptic peptide had almost identical mobility in two-dimensional
mapping and were highly acidic (Fig. 3). The data are most
consistent with serine phosphorylation sites in the C-terminal tryptic
and chymotryptic fragment, which differ only by two amino acids.
Figure 3:
Phosphopeptide mapping of radiolabeled
HMG-I(Y) peptides. A, the amino acid sequence of HMG-I(Y) is
indicated. Parentheses demarcate the 11-amino acid
alternatively spliced intron which differentiates HMG-I from HMG-Y.
Spaces separate amino acid residues at potential tryptic digestion
sites. The positions of threonine residues labeled in mouse 3T3
fibroblastoid cells are marked by + and * symbols; the asterisks indicate the site in HMG-I(Y) labeled in vitro by p34 cdc2 kinase(25, 26) . The triplicated DNA
binding motif is underlined. The consensus casein kinase II
site is at serines 102-103. B, radiolabeled HMG-I(Y) was
isolated from IL-4-treated JY cells as described in Fig. 2, then
subjected to hydrolysis with the indicated protease. A representative
autoradiograph is shown for a two-dimensional analysis of tryptic
phosphopeptides (C) and for a one-dimensional electrophoretic
analysis at pH 8.9, evaluating the similarity of net charge on the
labeled tryptic and chymotryptic peptide. Note that for both proteases,
incomplete digestion at closely spaced cleavage sites often led to a
``satellite spot'' representing partial
cleavage(38, 39, 40, 41) . D, a tabulation of the estimated net charges on
serine-containing tryptic and chymotryptic peptides. Charges are
estimated assuming either phosphorylation of a single residue (1S in the figure) or phosphorylation of two residues (2S).
The
site of basal and IL-4-inducible phosphorylation contains a consensus
sequence for phosphorylation by casein kinase II
[(S/t)-X-X-(E/d)]. To confirm the
assignment of IL-4-inducible labeling to the carboxyl terminus, and to
facilitate analyses of the functional consequences of this
phosphorylation, in vitro kinase reactions were performed
using a bacterially produced form of HMG-I(Y) with additional residues
at the N terminus and purified kinases. As seen in Fig. 4A, casein kinase II efficiently transferred
phosphates to HMG-I(Y). IL-4 can cause protein kinase C
activation(44, 45) , and the zeta ( ) isoform of
protein kinase C can be activated by lipid products of PI
3-kinase(37) . PKC might therefore provide a direct link
between PI 3-kinase activation and HMG-I(Y) phosphorylation in response
to IL-4. Therefore, PKC was tested in addition to casein kinase
II. PKC was far less efficient than casein kinase II in
transferring phosphates to HMG-I(Y). In quantitative experiments, the
transfer of phosphate from ATP to HMG-I(Y) is catalyzed by casein
kinase II at least 50% as efficiently as transfer to casein (data not
shown). Moreover, addition of 1 mol of phosphate/mol of HMG-I(Y) can be
achieved with adequate enzyme concentrations and incubation times (20
units for 1 h with 100 pmol of HMG-I(Y). We conclude that HMG-I(Y) is
an efficient substrate for casein kinase II but not PKC .
Figure 4:
Casein kinase II phosphorylates HMG-I(Y)
on the same tryptic peptide as IL-4-inducible phosphorylation. A, an autoradiograph of electrophoretically transferred
products from an in vitro kinase reaction performed with
protein kinase C (lane 1) or casein kinase II (lane
2). In reactions using considerably more PKC and longer
incubations, a small (<0.2 mol of PO /mol of HMG-I(Y))
amount of phosphorylation has been observed). B, an
autoradiograph of an electrophoretic separation of radiolabeled tryptic
peptides after phosphorylation of HMG-I(Y). The label was incorporated
either in vitro using casein kinase II and
[ - P]ATP or in cells metabolically labeled
with orthophosphate, from which HMG-I(Y) was then purified by
two-dimensional electrophoresis. The samples are as indicated; the
mixture consisted of equal counts of CK II or metabolically labeled
HMG-I(Y).
To
compare the substrate specificity of the IL-4-inducible kinase activity
to that of casein kinase II, the one-dimensional tryptic phosphopeptide
pattern of HMG-I(Y) phosphorylated in vitro by casein kinase
II was compared with that of nuclear HMG-I(Y) metabolically labeled in
IL-4-treated JY cells. As seen in Fig. 4B, casein
kinase II and the IL-4-inducible kinase generated the same profile. The
amino-terminal extension of bacterially produced HMG-I(Y) would alter
the mobility of the other peptide with a net negative charge in both
tryptic and chymotryptic digests. We conclude that in the JY cell line,
both basal and IL-4-inducible phosphorylation occurs on
carboxyl-terminal serines of the HMG-I(Y) molecule and is catalyzed by
a kinase with a casein kinase II-like specificity.
Rapamycin Inhibits IL-4-inducible HMG-I(Y)
PhosphorylationIL-4-dependent production of reaginic (IgE
class) antibodies in intact rats(9) , and IL-4-dependent IgE
production by human B cells(10) , are inhibited by rapamycin,
an antagonist of a signal transduction pathway associated with PI
3-kinases and related
molecules(46, 47, 48, 49) . Since
IL-4 activates receptor-associated PI
3-kinase(50, 51) , we investigated whether
IL-4-inducible phosphorylation of HMG-I(Y) is inhibited by rapamycin. Fig. 5A shows the results of metabolic labeling
experiments with JY cells after analysis of the nuclear proteins on
two-dimensional acid urea/SDS-PAGE. The only labeled protein whose
identity we have investigated by Western blotting is HMG-I(Y), and its
position is indicated by an arrow on each panel. As indicated
in Fig. 1A, the labeling of this HMG-I(Y) spot is
markedly increased in IL-4-treated cells (upper right-hand
panel) as compared with controls (upper left-hand panel).
However, little label was incorporated into the HMG-I(Y) spot if the
cells had been treated with rapamycin at concentrations in the range of
2-10 nM. This result indicates that the regulatory
proteins responsible for IL-4-inducible HMG-I(Y) phosphorylation can be
inhibited by rapamycin. The results also indicate that there may be
other IL-4-inducible increases in nuclear protein phosphorylation that
are inhibited by treatment of JY cells with rapamycin. Rapamycin acts
at concentrations in the nanomolar range. Fig. 5A also
shows that in dose response experiments, significant inhibition of
nuclear HMG-I(Y) phosphate incorporation by rapamycin occurred by 0.5
nM, with essentially maximal inhibition by 2 nM.
Thus, rapamycin inhibition of HMG-I(Y) phosphorylation occurs in a
range comparable with that reported for inhibition of growth
factor-inducible activity of signal transduction-related kinases (46, 47, 48, 49) .
Figure 5:
Rapamycin inhibits the stimulation of
HMG-I(Y) phosphorylation by HMG-I(Y). A, metabolic labelings
were performed as in Fig. 1, using a 3-h culture in IL-4 in each
case. Where indicated, cells were cultured in the stated concentration
of rapamycin for 30 min before the addition of IL-4. (The direction of
the acid-urea electrophoresis was from left to right in all but the unstimulated control). The position of HMG-I(Y) is
again marked by an arrow on the autoradiograph. B,
samples from the same experiment as in Fig. 1are shown, and
methods are as described in the legend to Fig. 1. Samples
treated with genistein were cultured overnight in the presence of 75
µM genistein to evaluate the effect at saturating
concentrations of this agent, as in (28) .
The initiation
of certain IL-4 receptor signal transduction pathways can depend
directly or indirectly on tyrosine kinases. Overnight treatment of a
human monocytic cell line with high concentrations of the tyrosine
kinase inhibitor genistein blocked the induction of a
tyrosine-phosphorylated nuclear protein by IL-4 (IL-4 NAF; (28) ). To investigate if the conditions of tyrosine kinase
inhibition which blocked IL-4 NAF induction would prevent
IL-4-inducible phosphorylation of HMG-I(Y), metabolic labeling
experiments were performed with JY cells, and the labeled nuclear
proteins were again resolved on two-dimensional acid-urea/SDS-PAGE. As
shown in Fig. 5B, genistein inhibition under the
conditions used to analyze IL-4 NAF did not prevent the dramatic
increase in HMG-I(Y) labeling induced by IL-4. Our interpretation is
that the IL-4 can induce signals that lead to increased serine
phosphorylation of HMG-I(Y) despite inhibition of cellular responses by
genistein.
Phosphorylation of HMG-I(Y) Decreases Its DNA Binding
ActivityTo assess whether IL-4-inducible phosphorylation at the
carboxyl-terminal serines of HMG-I(Y) influences its DNA binding
activity, we performed mobility shift assays with a radiolabeled
fragment of the mouse G promoter known to be an HMG-I(Y) binding
site associated both with repression of basal activity and with
promoter inducibility (Fig. 6)(15) . Because the vast
majority of both steady state and IL-4-inducible phosphorylation of
HMG-I(Y) occurs at the same site within the protein, treatment of
nuclear extracts with phosphatases will affect the degree of
phosphorylation only of this one site. Therefore, nuclear extracts were
incubated in phosphatase buffer only (Fig. 6A, lanes 1 and 4) or in buffer together with a phosphatase active
against phosphoserine/threonine (lanes 2 and 5), then
used in DNA binding assays. As seen in Fig. 6A, these
experiments demonstrated that dephosphorylation increased the DNA
binding activity of normal cellular HMG-I(Y). Inclusion of a
phosphatase inhibitor prior to the incubation blocked the increase in
DNA binding activity (lanes 3 and 6), contradicting
the possibility that increased activity is due to proteolytic digestion
or some modification other than dephosphorylation.
Figure 6:
Phosphorylation decreases the binding of
HMG-I(Y) to DNA. A, mobility shift experiments were performed
using nondenaturing PAG and a radiolabeled germ line promoter DNA
probe, of which a representative autoradiogram is shown. Nuclear
extracts were prepared under conditions that dissociate the multimeric
complex NF-BRE, so that all immunoreactive HMG-I(Y) is in the complex
of HMG-I(Y)-probe. The positions of this complex and of free
radiolabeled probe DNA are indicated. Nuclear extracts were either
subjected to a mock-incubation in phosphatase buffer prior to addition
to a binding reaction (lanes 1 and 4) or incubated in
phosphatase buffer with the indicated phosphatase (lanes 2, 3,
5, and 6; P.A.P. is potato acid phosphatase).
These incubations either contained no phosphatase inhibitors, or the
inhibitors sodium fluoride and sodium vanadate (+ phosphatase
inhibs). B, an autoradiograph from a mobility shift
experiment using a radiolabeled germ line promoter DNA probe is
shown. The assays included 15 ng (lanes 1 and 3) or
30 ng (lanes 2 and 4) purified recombinant HMG-I(Y).
In lanes 1 and 2, purified protein not reacted with
casein kinase II was used; in lanes 3 and 4, HMG-I(Y)
kinased by casein kinase II in the presence of unlabeled ATP was used.
A parallel reaction gave an estimated stoichiometry of phosphate
transfer as 1.03 mol of PO /mol of HMG-I(Y), and use of the
cold phosphorylated HMG-I(Y) in a second casein kinase II reaction
using [ P]ATP gave an estimated stoichiometry of
0.2 mol of PO /mol of HMG-I(Y). Thus, we estimate that the
cold phosphorylation reaction labeled 80-100% of a single serine
residue. Products from a labeling reaction were used directly for
standard HMG-I(Y) mobility shift assays. C, a scheme of the
germ line promoter, including the sequence in the region to which
HMG-I(Y) binds. The promoter is represented by an open
rectangle. A series of vertical hash marks denotes the
multiple cap sites previously identified in nuclease protection
experiments. The upstream-most cap site has been assigned +1. A
series of circles below the gene represents constitutive
binding activities and transcription factors whose binding site
contributes to G promoter function, whereas a stippled circle represents the inducible factor
NF-IL4(28, 29, 55, 59) . The +
and - symbols denote the role of each binding site. An expansion
shows the sequence around the HMG-I(Y) binding site previously mapped
at +3 to +9 of the mouse promoter(15) , with the dA-T
residues underlined and the site in bold typeface.
The sequence at the same position in the human G promoter (7) is shown below. Recombinant HMG-I(Y) binds to this human
sequence with a binding affinity of approximately 25% that of the mouse
sequence.
Because casein
kinase II mimics the phosphorylation of HMG-I(Y) induced in response to
IL-4 stimulation of JY cells, and stoichiometric addition of phosphate
can be achieved, the effect of in vitro phosphorylation also
could be assayed. As seen in Fig. 6B, preparations of
HMG-I(Y) phosphorylated in vitro with casein kinase II bound
to the G promoter probe 3-5-fold less efficiently than
purified recombinant material before phosphorylation. We conclude that
phosphorylation of the predominant phosphoamino acid site decreases
HMG-I(Y) binding activity and by extension that IL-4-inducible
phosphorylation of HMG-I(Y) decreases its binding activity.
Rapamycin Inhibits G Promoter Activation by
IL-4HMG-I(Y) contributes to repression of the G promoter
and to promoter inducibility(15) . Because rapamycin inhibits
the IL-4-inducible phosphorylation of HMG-I(Y), it should negate any
effect of this post-translational modification on normal G
promoter function. The induction of germ line RNAs by IL-4 is
regulated by increased transcription(11) . Therefore, to
quantify the effect of rapamycin on IL-4-inducible G promoter
activity, we performed Northern blot analyses on total cellular RNAs.
Cells treated with IL-4 after rapamycin pretreatment were compared with
cells treated only with IL-4 and with untreated cells. These
experiments show that although the G promoter retained some IL-4
inducibility, rapamycin inhibited 50% of the induction by IL-4 at doses
in the nM range (Fig. 7). Thus, although rapamycin
inhibition of promoter induction by IL-4 clearly is incomplete, we
conclude that the inhibition of G promoter activity by rapamycin
can be correlated with its ability to block IL-4-inducible
phosphorylation of a transcriptional repressor.
Figure 7:
Rapamycin inhibits the induction of G
mRNA by interleukin 4. Equal portions of the human B cell line JY were
cultured in no IL-4 (lane 1) or for 4 h in 5 ng/ml of pure
recombinant human IL-4 (lanes 2-6). After culture, total
cellular RNA was prepared, and equal 10-µg portions were analyzed
by Northern blots and hybridization with labeled constant region
exons. The cells had been pre-cultured in either 0.1% ethanolic carrier (lane 2); overnight in 7.5 µM genistein (lane
3), an inhibitor of tyrosine phosphorylation; or for 1 h in
cycloheximide at 50 µM (lane 4), 1 nM rapamycin (lane 5), 10 nM rapamycin (lane
6). Lane 7 is a control of 1 µg of total cellular RNA
from the human myeloma cell line U266, indicating the small difference
in mobility of mature (VDJ-C ) RNA from the germ line RNA.
Control hybridizations with a GAPDH probe, and ethidium bromide gel
staining, demonstrated comparable loading of samples. Measurement of
signals in this experiment with a PhosphorImager indicated levels of
G mRNA in the rapamycin-treated samples of 48% (1 nM) and
25% (10 nM) relative to the IL-4-treated
sample.
DISCUSSION
In addition to its control of IgE production, interleukin 4
regulates lymphocyte proliferation and plays a pivotal role in
determining the helper function of T cells(52, 53) .
Despite these important immunoregulatory properties, relatively little
is known about signal transduction mechanisms linking IL-4 receptor
engagement to the induction of IL-4-dependent genes. Recent studies
suggest that receptor-associated protein kinases, including Jak3
phosphorylate proteins such as NF-IL4, which may include Stat 6 (Stat
IL-4), a new member of a family of transcription factors termed STAT
(signal transduction and activation of transcription)
proteins(28, 29, 54, 55, 56, 57, 58) .
In the present study, we present evidence of a different pathway
stimulated by IL-4. The central findings of this study are (i) IL-4
treatment leads to increased phosphorylation of HMG-I(Y), a protein
involved in regulation of an IL-4-dependent promoter and of other
inducible promoters; (ii) this increased phosphorylation is refractory
to high doses of an inhibitor of tyrosine kinase pathways but sensitive
to the immunosuppressive rapamycin; and (iii) phosphorylation can
affect functional properties of HMG-I(Y), suggesting a novel mechanism
in which HMG-I(Y) function at inducible promoters such as the germ line
epsilon (G ) promoter may be modulated by IL-4-inducible
phosphorylation. IL-4 receptor engagement leads to increased serine
phosphorylation of HMG-I(Y), an exclusively nuclear protein involved in
the regulation of several inducible
promoters(15, 16, 17, 18, 19, 20, 21) .
Phosphorylation is potently inhibited by the immunosuppressive
rapamycin, yet is minimally affected by the tyrosine kinase inhibitor
genistein at a dose sufficient to inhibit NF-IL4 induction (28) ( )and germ line RNA accumulation in
response to IL-4. This result is not confined to the JY cell line or to
B cells, as we have used the mouse T cell line CTLL in similar
metabolic labeling experiments and find IL-4-inducible HMG-I(Y)
phosphorylation. In contrast, NF-IL-4 induction is inhibited by
genistein but resistant to rapamycin, suggesting that
IL-4-inducible HMG-I(Y) phosphorylation occurs independent of tyrosine
phosphorylation of the factor IL-4 NAF or Stat
6(28, 29, 55) . Thus, the properties of this
phosphorylation suggest a signal transduction pathway distinct from
that required for activation of STAT factors such as STF-IL4, NF-IL4,
or STAT IL4(28, 29, 55, 56) . Since
rapamycin inhibits IgE synthesis more, and at a lower concentration,
than that of certain other Ig isotypes(10) , and completely
blocks HMG-I(Y) phosphorylation under conditions which decrease RNA
levels only to half of control levels, promoter regulation by HMG-I(Y)
can only be one among several factors which determine germ line
transcription. IL-4-inducible, tyrosine-phosphorylated nuclear proteins
bind at -122 to -104 (NF-IL4 or IL-4 NAF; Refs. 28, 55, and
59) and near the HMG-I(Y)/NF-BRE site at +3 to +9
(STF-IL-4; (56) ). Mutations at the IL-4 NAF/NF-IL4 site show
that this sequence also both acts as a repressor element for basal
transcription and is involved in
inducibility(59, 60) . Taken together,
these observations provide evidence of a new signal transduction
pathway linking the IL-4 receptor to the nucleus and indicate that full
germ line promoter activation by IL-4 requires derepression
through cooperation of rapamycin-dependent serine/threonine kinases
with the more direct protein tyrosine kinase pathway. Independence
of IL-4-inducible phosphorylation of HMG-I(Y) from genistein inhibition
raises the question which pathway transduces a signal from the IL-4
receptor to HMG-I(Y). This observation is consistent with the ability
of an IL-4 receptor mutant devoid of intracytoplasmic tyrosine residues
to signal proliferation in a growth factor-dependent cell
line(61) . Rapamycin inhibition has been implicated in signal
transduction pathways that use PI 3-kinase or related
molecules(49, 62, 63, 64) , and IL-4
receptor engagement leads to recruitment of PI 3-kinase as well as
molecules such as the insulin receptor substrate 1 (IRS-1) and its
homologue 4PS(50, 51) . Thus, these early signal
transduction molecules may play a role in the genistein-independent
regulation of HMG-I(Y) phosphorylation status. The present data on
rapamycin inhibition implicate a specific pathway, downstream from
these membrane-associated signal transduction proteins and capable of
regulating the phosphorylation status of nuclear proteins. While MAP
kinase activation through Ras and Raf is one major signal transduction
pathway in which serine/threonine kinases stimulated by growth factors
regulate nuclear transcription factors (43, 65) , MAP
kinase activation by other cytokines is largely refractory to
rapamycin(46, 47, 48) , and IL-4 does not
activate Ras, Raf, or MAP
kinases(51, 66, 67) . Thus, it is unlikely
that these pathways account for the HMG-I(Y) phosphorylation reported
here. A serine/threonine kinase implicated in later steps in signal
transduction, pp70 S6 kinase, is the only growth factor-stimulated
signal transduction protein kinase known to be potently inhibited by
rapamycin(46, 47, 48, 49) . Both
IL-4 and the cytokine IL-2 lead to rapamycin-sensitive HMG-I(Y)
phosphorylation in the cytokine-responsive cell line CTLL. ( )Thus, it is likely that the pathway regulating HMG-I(Y)
phosphorylation involves a shared component of the cytokine receptor
family. The IL-2 receptor shares many signal transduction molecules
with the IL-4 receptor(57, 58, 68) and is
known to activate the serine/threonine kinase pp70/85 S6 kinase; this
activation is inhibited by rapamycin with similar dose-response
characteristics to those we observe for inhibition of IL-4-stimulated
HMG-I(Y)
phosphorylation(46, 47, 48, 49) .
Thus, the present data raise the possibility that pp70 S6 kinase is
activated by IL-4. Moreover, these data suggest that casein kinase
II-like activities may be regulated through pp70 S6 kinase in response
to IL-4. Fractionation of nucleus and cytoplasm indicates that the
phosphorylation of HMG-I(Y) occurs in the nucleus, and
there is evidence suggesting that pp70/85 S6 kinase activity may be
present in nuclei and regulate the phosphorylation status and activity
of transcription factors(32, 69) . However, the known
substrate specificity of pp70 S6 kinase does not include the casein
kinase II consensus site of HMG-I(Y) or any other sequence of HMG-I(Y).
These observations raise the question whether some other pathway
accounts for this IL-4-inducible phosphorylation. Casein kinase II is
regulated by growth factors, including insulin, which shares signal
transduction mechanisms with
IL-4(50, 70, 71, 72) , effects
regulatory phosphorylations of nuclear transcription
factors(41, 43) , and binds directly to the rapamycin
binding rotamase FKBP25(35) . However, FKBP25-rapamycin
complexes did not inhibit casein kinase II in vitro, and
casein kinase II is not reported to be inhibited by rapamycin in
vivo. Since there is no evidence of rapamycin-inhibiting casein
kinase II-like activities, the present data raise the possibility that
an indirect pathway relays signals from the IL-4 receptor to casein
kinase II-like activities. The data also suggest that IL-4-inducible
phosphorylation of HMG-I(Y) may regulate promoter activity. HMG-I(Y)
can either decrease (15, 16) or increase (17, 18, 19, 20, 21) promoter
activity. Antisense HMG-I(Y) RNA increased basal germ line
promoter activity and inducibility, with relatively little effect on
inducible activity. These data are most consistent with a role in basal
repression, which is somehow attenuated after B cell
stimulation(15) . One mechanism for this effect may be
interference with the universal transcription factor TATA-binding
protein (TBP). ( )TBP is recruited to pol II promoters by the
integrated action of promoter- and enhancer-binding transcription
factors. Factors necessary to achieve TBP loading at the G
promoter, or increased loading in response to IL-4, appear to include
BSAP(11) , NF-IL4(59, 60) , and
Sp1 and p50 NF- B(59) . The decrease in binding activity
after phosphorylation of HMG-I(Y) may therefore decrease its
interference with TBP binding to the minor groove of dA-T-rich
sequences such as the TATA box, a sequence preference shared by TBP and
HMG-I(Y). However, it is not certain that this mechanism alone would
be sufficient to account for the role of HMG-I(Y) in IL-4-stimulated
promoter activity. The fraction of total nuclear HMG-I(Y) which
actually undergoes phosphorylation in response to IL-4 cannot be
determined. HMG-I(Y) is a protein present in nuclei at high prevalence,
and we cannot quantify the effective specific activity of
[ P]phosphate donors within the JY cells during
labeling, and thus it is not clear what percentage of HMG-I(Y)
molecules are phosphorylated during these labeling experiments or
during IL-4 stimulation. Moreover, the expected decrease in binding
activity if a large fraction of nuclear HMG-I(Y) does undergo
IL-4-inducible phosphorylation could be counterbalanced by improved
recovery of phosphorylated HMG-I(Y) under the low salt extraction
conditions needed for mobility shift experiments. Assays comparing the
DNA binding activity of HMG-I(Y) extracted from control and
IL-4-treated JY cells have shown modest decreases in HMG-I(Y) binding
activity in IL-4-treated cells. This result is consistent with a model
in which IL-4 treatment decreases the ability of a repressor, HMG-I(Y),
to act on the G promoter and consequently contributes to increased
transcription of the promoter, but is variable and not uniformly
observed. An alternative mechanism is suggested by dephosphorylation
reactions with total nuclear extracts which demonstrate decreased
inclusion of HMG-I(Y) in an IL-4-inducible multimeric complex termed
NF-BRE(11, 15) . ( )Moreover, rapamycin
treatment of cells prior to IL-4 stimulation decreases the formation of
NF-BRE. Thus, phosphorylation may alter the association of
HMG-I(Y) with proteins that are involved in promoter regulation. In
this alternative model, G promoter activation could be enhanced if
phosphorylation altered the ability of NF-IL4 (which presumably
includes Stat 6), NF- B p50, or BSAP to load at G promoter
chromatin in vivo or to recruit
TBP(11, 59, 60) . Such alterations in
protein-protein interactions, while at present speculative, could also
suggest a role for HMG-I(Y) phosphorylation in the regulation of other
inducible promoters at which HMG-I(Y) has been shown to play a
role(16, 17, 18, 19, 20, 21) .
These considerations notwithstanding, the Northern blot experiments
which demonstrate that rapamycin decreases G RNA levels induced by
IL-4, taken together with the phosphorylation data, suggest that the
rapamycin-sensitive phosphorylation induced by IL-4 may serve a novel
regulatory role through decreased repression of the germ line
promoter.
FOOTNOTES
- *
- This work was supported by grants from
the Leukemia Society of America (to M. B.) and the Baxter Foundation
(to M. B.) and by National Institutes of Health Grant GM42550. The
costs of publication of this article were defrayed in part by the
payment of page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
Dept. of Microbiology and Immunology, Vanderbilt University School of
Medicine, Nashville, TN 37232-2363. Tel.: 615-343-1699; Fax:
615-343-7392.
- (
) - The abbreviations used are: IL-4,
interleukin 4; IgE, immunoglobulin E; HMG, high mobility group; PKC,
protein kinase C; PI, phosphatidylinositol; TBP, TATA box-binding
protein.
- (
) - D.-Z. Wang, A. L. Cherrington, B. M.
Famakin-Mosuro, and M. Boothby, submitted for publication.
- (
) - D.-Z. Wang, P. Ray, and M. Boothby, unpublished
observations.
- (
) - P. Ray, D.-Z. Wang, P. A. Weil,
and M. Boothby, unpublished observations.
- (
) - D.-Z.
Wang and M. Boothby, unpublished observations.
ACKNOWLEDGEMENTS
We thank D. Thanos and T. Maniatis for generous gifts
of rHMG-I and a pET-15b-huHMG-I(Y) bacterial expression construct; R.
Reeves for antiserum specific for HMG-I(Y); H. Jabara and D. Vercelli
for human C cDNA and for a germ line C genomic subclone
containing the human G promoter; J. Exton for purified PKC ;
L. Kerr, A. Richmond, and R. Stein for helpful discussions; and D.
Ballard for critically reading the manuscript and for helpful comments.
REFERENCES
- Esser, C., and Radbruch, A. (1990) Annu. Rev. Immunol. 8,717-735
[CrossRef][Medline]
[Order article via Infotrieve]
- Harriman, W., Volk, H., Defranoux, N., and Wabl, M. (1993) Annu. Rev. Immunol. 11,361-384
[CrossRef][Medline]
[Order article via Infotrieve]
- Jung, S., Rajewsky, K., and Radbruch, A. (1993) Science 259,984-987
[Abstract]
- Xu, L., Gorham, B., LI, S. C., Bottaro, A., and Alt, F. W., and Rothman, P. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,3705-3709
[Abstract/Free Full Text]
- Gu, H., Zou, Y., and Rajewsky, K. (1993) Cell 73,1155-1164
[CrossRef][Medline]
[Order article via Infotrieve]
- Rothman, P., Chen, Y. Y., Lutzker, S., Li, S. C., Stewart, V., Coffman, R., and Alt, F. W. (1990) Mol. Cell. Biol. 10,1672-1680
[Abstract/Free Full Text]
- Gauchat, J.-F., Lebman, D. A., Coffman, R. L., Gascan, H., and de Vries, J. E. (1990) J. Exp. Med. 172,463-473
[Abstract/Free Full Text]
- Jabara, H. H., Schneider, L. C., Shapira, S. K., Alfieri, C., Moody, C. T., Kieff, E., Geha, R. S., and Vercelli, D. (1990) J. Immunol. 145,3468-3473
[Abstract]
- Martel, R. R., Klicius, J., and Galet, S. (1977) Can. J. Physiol. Pharmacol. 55,48-51
[Medline]
[Order article via Infotrieve]
- Luo, H., Chen, H., Daloze, P., Chang, J., St-Louis, G., and Wu, J. (1991) Clin. Immunol. Immunopathol. 61,410-420
[Medline]
[Order article via Infotrieve]
- Rothman, P., Li, S. C., Gorham, B., Glimcher, L., Alt, F., and Boothby, M. (1991) Mol. Cell. Biol. 11,5551-5561
[Abstract/Free Full Text]
- Skalnik, D. G., and Neufeld, E. J. (1992) Biochem. Biophys. Res. Commun. 187,563-569
[CrossRef][Medline]
[Order article via Infotrieve]
- Solomon, M. J., Strauss, F., and Varshavsky, A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83,1276-1280
[Abstract/Free Full Text]
- Russnak, R. H., Candido, P. E. M., and Astell, C. R. (1988) J. Biol. Chem. 263,6392-6399
[Abstract/Free Full Text]
- Kim, J., Reeves, R., Rothman, P., and Boothby, M. (1995) Eur. J. Immunol. 25,798-808
[Medline]
[Order article via Infotrieve]
- Chuvpilo, S., Schomberg, C., Gerwig, R., Heinfling, A., Reeves, R., Grummt, F., and Serfling, E. (1993) Nucleic Acids Res. 21,5694-5704
[Abstract/Free Full Text]
- Thanos, D., and Maniatis, T. (1992) Cell 71,777-789
[CrossRef][Medline]
[Order article via Infotrieve]
- Du, W., Thanos, D., and Maniatis, T. (1993) Cell 74,887-898
[CrossRef][Medline]
[Order article via Infotrieve]
- Lewis, H., Kaszuba, W., DeLamarter, J. F., and Whelan, J. (1994) Mol. Cell. Biol. 14,5701-5709
[Abstract/Free Full Text]
- Whitley, M. Z., Thanos, D., Read, M. A., Maniatis, T., and Collins, T. (1994) Mol. Cell. Biol. 14,6464-6475
[Abstract/Free Full Text]
- John, S., Reeves, R. B., Lin, J.-X., Child, R., Leiden, J. M., Thompson, C. B., and Leonard, W. J. (1995) Mol. Cell. Biol. 15,1786-1796
[Abstract]
- Lund, T., Holtlund, J., Fredericksen, M., and Laland, S. G. (1983) FEBS Lett. 152,163-167
[CrossRef][Medline]
[Order article via Infotrieve]
- Giancotti, V., Pani, B., Andrea, P. D., Berlingieri, M. T., Di Fiore, P. P., Fusco, A., Vecchio, G., Philp, R., Crane-Robinson, C., Nicolas, R. H., Wright, C. A., and Goodwin, G. H. (1987) EMBO J. 6,1981-1987
[Medline]
[Order article via Infotrieve]
- Karray, S., DeFrance, T., Merle-Béral, H., Banchereau, J., Debré, P., and Galanaud, P. (1988) J. Exp. Med. 168,85-94
[Abstract/Free Full Text]
- Reeves, R., Langan, T. A., and Nissen, M. S. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,1671-1675
[Abstract/Free Full Text]
- Nissen, M. S., Langan, T. A., and Reeves, R. (1991) J. Biol. Chem. 266,19945-19952
[Abstract/Free Full Text]
- Gauchat, J. F., Gascan, H., De Waal Malefyt, R., and de Vries, J. E. (1992) J. Immunol. 148,2291-2299
[Abstract]
- Kotanides, H., and Reich, N. C. (1993) Science 262,1265-1267
[Abstract/Free Full Text]
- Hou, J., Schindler, U., Henzel, W. J., Ho, T. C., Brasseur, M., and McKnight, S. L. (1994) Science 265,1701-1706
[Abstract/Free Full Text]
- Dignam, J. D., Lebowitz, R., and Roeder, R. G. (1983) Nucleic Acids Res. 11,1475-1489
[Abstract/Free Full Text]
- Boothby, M., Gravallese, E., Liou H-C., and Glimcher, L. H. (1989) Science 242,1559-1562
- Kardalinou, E., Zhelev, N., Hazzalin, C. A., and Mahadevan, L. C. (1994) Mol. Cell. Biol. 14,1066-1074
[Abstract/Free Full Text]
- Marais, R., Wynne, J., and Treisman, R. (1993) Cell 73,381-393
[CrossRef][Medline]
[Order article via Infotrieve]
- Chen, R.-H., and Blenis, J. (1990) Mol. Cell. Biol. 10,3204-3215
[Abstract/Free Full Text]
- Jin, Y. J., and Burakoff, S. J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,7769-7773
[Abstract/Free Full Text]
- Disney, J. E., Johnson, K. R., Magnuson, N. S., Sylvester, S. R., and Reeves, R. (1989) J. Cell Biol. 109,1975-1982
[Abstract/Free Full Text]
- Nakanishi, H., Brewer, K. A., and Exton, J. H. (1993) J. Biol. Chem. 268,13-16
[Abstract/Free Full Text]
- Boyle, W. J., van der Geer, P., and Hunter, T. (1991) Methods Enzymol. 201,110-149
[Medline]
[Order article via Infotrieve]
- Siegel, J. N. Ausubel, F. M., Brent, R., Kingston, R. E., Moore, D. D., Smith, J. G., and Struhl, K. (eds) (1992) in Current Protocols in Molecular Biology, pp. 11.0.1-11.2.14, John Wiley and Sons, New York
- Binétruy, B., Smeal, T., and Karin, M. (1991) Nature 351,122-127
[CrossRef][Medline]
[Order article via Infotrieve]
- Lin, A., Frost, J., Deng, T., Smeal, T., Al-Alawi, N., Kikkawa, U., Hunter, T., Brenner, D., and Karin, M. (1992) Cell 70,777-789
[CrossRef][Medline]
[Order article via Infotrieve]
- Auffray C., and Rougeon F. (1980) Eur. J. Biochem. 107,303-314
[Medline]
[Order article via Infotrieve]
- Hunter, T., and Karin, M. (1992) Cell 70,375-387
[CrossRef][Medline]
[Order article via Infotrieve]
- Arruda, S., and Ho, J. L. (1992) J. Immunol. 149,1258-1264
[Abstract]
- Harnett, M. M., Holman, M. J., and Klaus, G. G. B. (1991) J. Immunol. 147,3831-3836
[Abstract]
- Calvo, V., Crews, C. M., Vik, T. A., and Bierer, B. E. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,7571-7575
[Abstract/Free Full Text]
- Chung, J., Kuo, C. J., Crabtree, G. R., and Blenis, J. (1992) Cell 69,1227-1236
[CrossRef][Medline]
[Order article via Infotrieve]
- Kuo, C. J., Chung, J., Fiorentino, D. F., Flanagan, W. M., Blenis, J., and Crabtree, G. R. (1992) Nature 358,70-73
[CrossRef][Medline]
[Order article via Infotrieve]
- Chung, J., Grammer, T. C., Lemon, K. P., Kazlauskas, A., and Blenis, J. (1994) Nature 370,71-75
[CrossRef][Medline]
[Order article via Infotrieve]
- Wang, L., Myers, M. G., Jr., Sun, X., Aaronson, S. A., White, M., and Pierce, J. H. (1993) Science 261,1591-1594
[Abstract/Free Full Text]
- Wang, L., Keegan, A. D., Paul, W. E., Heidaran, M. A., Gutkind, J. S., and Pierce, J. H. (1992) EMBO J. 11,4899-4908
[Medline]
[Order article via Infotrieve]
- Abehsira-Amar, O., Gibert, M., Joliy, M., Theze, J., and Jankovic, D. (1992) J. Immunol. 148,3820-3829
[Abstract]
- Kopf, M., Le Gros, G., Bachmann, M., Lamers, M. C., Bluethmann, H., and Kohler, G. (1993) Nature 362,245-248
[CrossRef][Medline]
[Order article via Infotrieve]
- Shuai, K., Schindler, C., Prezioso, V. R., Darnell, J. E., Jr. (1992) Science 258,1808-1812
[Abstract/Free Full Text]
- Köhler, I., and Rieber, E. P. (1993) Eur. J. Immunol. 23,3066-3071
[Medline]
[Order article via Infotrieve]
- Schindler, C., Kashleva, H., Pernis, A., Pine, R., and Rothman, P. (1994) EMBO J. 13,1350-1356
[Medline]
[Order article via Infotrieve]
- Witthuhn, B. A., Silvennoinen, O., Miura, O., Lai, K. S., Cwik, C., Liu, E. T., and Ihle, J. N. (1994) Nature 370,153-157
[CrossRef][Medline]
[Order article via Infotrieve]
- Johnston, J. A., Kawamura, M., Kirken, R. A., Chen, Y., Blake, T. B., Shibuya, K., Ortaldo, J. R., McVicar, D. W., and O'Shea, J. J. (1994) Nature 370,151-153
[CrossRef][Medline]
[Order article via Infotrieve]
- Delphin, S., and Stavnezer, J. (1995) J. Exp. Med. 181,181-192
[Abstract/Free Full Text]
- Albrecht, B., Peiritsch, S., and Woisetschlager, M. (1994) Int. Immunol. 6,1143-1151
[Abstract/Free Full Text]
- Seldin, D. C., and Leder, P. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,2140-2144
[Abstract/Free Full Text]
- Brown, E. J., Albers, M. W., Shin, T. B., Ichikawa, K., Keith, C. T., Lane, W. S., and Schreiber, S. L. (1994) Nature 369,756-759
[CrossRef][Medline]
[Order article via Infotrieve]
- Sabatini, D. M., Erdjument-Bromage, H., Lui, M., Tempst, P., and Snyder, S. H. (1994) Cell 78,35-43
[CrossRef][Medline]
[Order article via Infotrieve]
- Kunz, J., Henriquez, R., Schneider, U., Deuter-Reinhard, M., Movva, N. R., and Hall, M. N. (1993) Cell 73,585-596
[CrossRef][Medline]
[Order article via Infotrieve]
- Crews, C. M., and Erikson, R. L. (1993) Cell 74,215-217
[Medline]
[Order article via Infotrieve]
- Satoh, T., Nakafuku, M., Miyajima, A., and Kaziro, Y. (1991) Proc. Natl. Acad. Sci. U. S. A. 88,3314-3318
[Abstract/Free Full Text]
- Welham, M. J., Duronio, V., Sanghera, J. S., Pelech, S. L., and Schrader, J. W. (1992) J. Immunol. 149,1683-1693
[Abstract]
- Russell, S. M., Keegan, A. D., Harada, N., Nakamura, Y., Noguchi, M., Leland, P., Fridmann, M. C., Miyajima, A., Puri, R. K., Paul, W. E., and Leonard, W. J. (1993) Science 262,1880-1883
[Abstract/Free Full Text]
- de Groot, R. P., Ballou, L. M., and Sassone-Corsi, P. (1994) Cell 79,81-91
[CrossRef][Medline]
[Order article via Infotrieve]
- De Benedette, M., and Snow, E. C. (1991) J. Immunol. 147,2839-2845
[Abstract]
- Csermely, P., Schnaider, T., Cheatham, B., Olson, M. O. J., and Kahn, C. R. (1993) J. Biol. Chem. 268,9747-9752
[Abstract/Free Full Text]
- Klarlund, J. K., and Czech, M. P. (1988) J. Biol. Chem. 263,15872-15875
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y. J. Oh, J. H. Youn, Y. Ji, S. E. Lee, K. J. Lim, J. E. Choi, and J.-S. Shin
HMGB1 Is Phosphorylated by Classical Protein Kinase C and Is Secreted by a Calcium-Dependent Mechanism
J. Immunol.,
May 1, 2009;
182(9):
5800 - 5809.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Matsushita, T. Furumoto, S. Ishida, and Y. Takahashi
AGF1, an AT-Hook Protein, Is Necessary for the Negative Feedback of AtGA3ox1 Encoding GA 3-Oxidase
Plant Physiology,
March 1, 2007;
143(3):
1152 - 1162.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. R.M.O. Crombez, E. M.R. Vanoirbeek, W. J.M. Van de Ven, and M. M.R. Petit
Transactivation Functions of the Tumor-Specific HMGA2/LPP Fusion Protein Are Augmented by Wild-Type HMGA2
Mol. Cancer Res.,
February 1, 2005;
3(2):
63 - 70.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. E. Kelly-Welch, H. Y. Wang, L.-M. Wang, J. H. Pierce, G. Jay, F. Finkelman, and A. D. Keegan
Transgenic Expression of Insulin Receptor Substrate 2 in Murine B Cells Alters the Cell Density-Dependence of IgE Production In Vitro and Enhances IgE Production In Vivo
J. Immunol.,
March 1, 2004;
172(5):
2803 - 2810.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. L. Cayuela, M. Elias-Arnanz, M. Penalver-Mellado, S. Padmanabhan, and F. J. Murillo
The Stigmatella aurantiaca Homolog of Myxococcus xanthus High-Mobility-Group A-Type Transcription Factor CarD: Insights into the Functional Modules of CarD and Their Distribution in Bacteria
J. Bacteriol.,
June 15, 2003;
185(12):
3527 - 3537.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Padmanabhan, M. Elias-Arnanz, E. Carpio, P. Aparicio, and F. J. Murillo
Domain Architecture of a High Mobility Group A-type Bacterial Transcriptional Factor
J. Biol. Chem.,
November 2, 2001;
276(45):
41566 - 41575.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Rabah, S. Grant, C. Ma, and D. H. Conrad
Bryostatin-1 Specifically Inhibits In Vitro IgE Synthesis
J. Immunol.,
November 1, 2001;
167(9):
4910 - 4918.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. F. Shannon, L. S. Coles, J. Attema, and P. Diamond
The role of architectural transcription factors in cytokine gene transcription
J. Leukoc. Biol.,
January 1, 2001;
69(1):
21 - 32.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Gingras, S. Côté, and J. Simard
Multiple Signaling Pathways Mediate Interleukin-4-Induced 3{beta}-Hydroxysteroid Dehydrogenase/{Delta}5-{Delta}4 Isomerase Type 1 Gene Expression in Human Breast Cancer Cells
Mol. Endocrinol.,
February 1, 2000;
14(2):
229 - 240.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
R. Schwanbeck, G. Manfioletti, and J. R. Wisniewski
Architecture of High Mobility Group Protein I-C{middle dot}DNA Complex and Its Perturbation upon Phosphorylation by Cdc2 Kinase
J. Biol. Chem.,
January 21, 2000;
275(3):
1793 - 1801.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. N. Georas, J. E. Cumberland, T. F. Burke, R. Chen, U. Schindler, and V. Casolaro
Stat6 Inhibits Human Interleukin-4 Promoter Activity in T Cells
Blood,
December 15, 1998;
92(12):
4529 - 4538.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Chin, A. Pellacani, H. Wang, S. S. J. Lin, M. K. Jain, M. A. Perrella, and M.-E. Lee
Enhancement of Serum-response Factor-dependent Transcription and DNA Binding by the Architectural Transcription Factor HMG-I(Y)
J. Biol. Chem.,
April 17, 1998;
273(16):
9755 - 9760.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Pan, L. Xia, and R. P. McEver
Comparison of Promoters for the Murine and Human P-selectin Genes Suggests Species-specific and Conserved Mechanisms for Transcriptional Regulation in Endothelial Cells
J. Biol. Chem.,
April 17, 1998;
273(16):
10058 - 10067.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Currie
Functional Interaction between the DNA Binding Subunit Trimerization Domain of NF-Y and the High Mobility Group Protein HMG-I(Y)
J. Biol. Chem.,
December 5, 1997;
272(49):
30880 - 30888.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Wang, J. Zamorano, A. D. Keegan, and M. Boothby
HMG-I(Y) Phosphorylation Status as a Nuclear Target Regulated through Insulin Receptor Substrate-1 and the I4R Motif of the Interleukin-4 Receptor
J. Biol. Chem.,
October 3, 1997;
272(40):
25083 - 25090.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Piekielko, A. Drung, P. Rogalla, R. Schwanbeck, T. Heyduk, M. Gerharz, J. Bullerdiek, and J. R. Wisniewski
Distinct Organization of DNA Complexes of Various HMGI/Y Family Proteins and Their Modulation upon Mitotic Phosphorylation
J. Biol. Chem.,
January 12, 2001;
276(3):
1984 - 1992.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Diana, R. Sgarra, G. Manfioletti, A. Rustighi, D. Poletto, M. T. Sciortino, A. Mastino, and V. Giancotti
A Link between Apoptosis and Degree of Phosphorylation of High Mobility Group A1a Protein in Leukemic Cells
J. Biol. Chem.,
March 30, 2001;
276(14):
11354 - 11361.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Schwanbeck, M. Gymnopoulos, I. Petry, A. Piekielko, Z. Szewczuk, T. Heyduk, K. Zechel, and J. R. Wisniewski
Consecutive Steps of Phosphorylation Affect Conformation and DNA Binding of the Chironomus High Mobility Group A Protein
J. Biol. Chem.,
July 6, 2001;
276(28):
26012 - 26021.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|