![]()
|
|
||||||||
(Received for publication, August
30, 1994; and in revised form, October 20, 1994) From the
Low stringency screening of a cDNA library from hamster liver
yielded a cDNA encoding MCT2, a monocarboxylate transporter that is 60%
identical to hamster MCT1, the first monocarboxylate transporter to be
isolated. The functional properties of the two MCTs were compared by
expression in Sf9 insect cells using recombinant baculovirus vectors.
Like MCT1, MCT2 transported pyruvate and lactate. The two transporters
were sensitive to inhibition by phloretin and by
Animal cells take up and excrete lactate, pyruvate, and other
monocarboxylate anions by means of proton-coupled monocarboxylate
transporters (MCTs) ( A cDNA
encoding a monocarboxylate transporter, designated MCT1, was recently
isolated from a Chinese hamster ovary cell cDNA library (2) .
The cDNA was isolated by an indirect route. The studies began with
met-18b-2 cells, a line of mutant Chinese hamster ovary cells that
exhibit an abnormally high uptake rate for mevalonate, a dihydroxy
monocarboxylate that is an intermediate in cholesterol biosynthesis (3) . A cDNA that encodes Mev, a mevalonate transporter, was
isolated by an expression cloning strategy from a met-18b-2 cell cDNA
library(4) . The Mev protein contains 12 putative
membrane-spanning regions, and it mediates rapid transport of
mevalonate but not lactate, pyruvate, or other
monocarboxylates(2) . In searching for the origin of Mev, we
discovered that the protein is encoded by a mutant allele of a normal
hamster gene(2, 4) . The wild-type gene product is
identical to Mev except that it contains a phenylalanine instead of a
cysteine at amino acid 360 in the 10th membrane-spanning
region(2) . The protein encoded by the wild-type cDNA had all
of the properties previously ascribed to the erythrocyte MCT (2) . When expressed in human cells by transfection, it
mediated bidirectional membrane transport of lactate, pyruvate, and
other monocarboxylates, but not mevalonate. We concluded that the
wild-type gene encoded the erythrocyte MCT, and we designated it as
MCT1. A single base substitution in this gene had given rise to Mev,
which allowed the met-18b-2 cells to grow under selection conditions
that demanded high mevalonate uptake. MCT1 is expressed abundantly
in hamster erythrocyte membranes(2) . It is also expressed at
relatively high levels in hamster cardiac and skeletal muscle, kidney,
gastrointestinal tract, and epididymis. In skeletal muscle, MCT1 was
found exclusively in mitochondria-rich (oxidative) fibers. In the
testis and proximal epididymis, the protein was found on the heads of
maturing sperm. However, in the distal epididymis the sperm no longer
exhibited detectable MCT1, and the protein appeared on the microvillar
surface of the lining epithelium (2) . The lack of
expression of MCT1 in the liver raised the possibility that a related
MCT must be present in this tissue to account for the well documented
transport of lactate and pyruvate in this tissue. Thus, in the current
studies, we used a low stringency hybridization method to screen a
hamster liver cDNA library for clones related to MCT1. We isolated a
cDNA encoding MCT2, which is 60% identical to MCT1, transports lactate
and pyruvate with comparable efficiency, and has a strikingly different
tissue distribution than does MCT1 as well as a different sensitivity
to organomercurial thiol reagents.
To search for a member of the MCT family that is expressed in
liver, we used low stringency hybridization. A size-selected Syrian
hamster liver cDNA library was constructed and screened with a
Figure 1:
Nucleotide and predicted
amino acid sequences of hamster pMCT2. Nucleotide residues are numbered on the right; amino acid residues are numbered on the left. The putative polyadenylation
signal is boxed. An inframe stop codon is found 39 nucleotides
upstream of the putative initiator
methionine.
The predicted amino
acid sequence of MCT2 is 60% identical to that of MCT1. Fig. 2A compares these two sequences in a manner that
maximizes alignment of identical residues. Hydropathy plots calculated
with a window of 9 residues (12) are nearly superimposable for
the two proteins. Both proteins have 12 long hydrophobic segments
separated by relatively short hydrophilic regions (Fig. 2B). In both sequences, the longest stretches of
hydrophilic residues are located between the 6th and 7th putative
membrane-spanning regions and distal to the 12th membrane-spanning
region. Within these two hydrophilic domains, the protein sequences are
the most divergent. Only 8 of the 50 residues at the COOH termini of
the two proteins are identical. In the 10th membrane-spanning region,
MCT2 shares the Phe whose conversion to Cys converts MCT1 to a
mevalonate transporter (indicated by asterisk in Fig. 2A).
Figure 2:
Amino acid sequences (A) and
hydropathy plots (B) of hamster MCT1 versus MCT2. A, two gaps introduced in the sequences of MCT1 and MCT2 to
maximize their alignment are indicated by dots. Identical
amino acid residues are boxed, and the amino acids are numbered on the right. 12 putative transmembrane
regions are indicated by the overbars. The asterisk indicates the position of the phenylalanine in MCT1 that when
mutated to a cysteine yields a protein that enhances mevalonate
uptake(4) . B, the residue-specific hydropathy index
was calculated over a window of 9 residues by the method of Kyte and
Doolittle (12) using the Genetics Computer Group Wisconsin
package (version 7.3). Positive values represent increased
hydrophobicity. The 12 putative transmembrane regions are numbered.
To compare the transport activities of
MCT1 and MCT2, we prepared recombinant baculoviruses expressing each of
these proteins and used them to infect Sf9 insect cells. As a control,
we studied Sf9 cells infected with a baculovirus that encodes adenylyl
cyclase type II (a kind gift of Drs. W. J. Tang and A. G. Gilman). This
protein was used as a control because of its topological resemblance to
the MCTs, i.e. the presence of 12 membrane-spanning regions (13) . Cells expressing adenylyl cyclase took up
[
Figure 3:
Uptake of
[
Fig. 4compares the effect of
various inhibitors on the uptake of the
[
Figure 4:
Uptake of
[
A striking difference was noted in the
sensitivity of the two transporters to inactivation by p-chloromercuribenzenesulfonic acid (pCMBS) and p-chloromercuribenzoic acid (pCMB), two
organomercurial agents that modify cysteine residues. Transport by MCT1
was blocked nearly completely at concentrations of pCMBS or pCMB above 0.3 mM. These concentrations had no effect
on transport by MCT2 (Fig. 4, panels C and D).
Similar results were obtained with pCMBS at 0 °C (data not
shown). Fig. 5compares saturation curves for the uptake of
[
Figure 5:
Substrate saturation curves for uptake of
[
To compare the tissue distributions of MCT1
and MCT2, we raised antibodies against the highly divergent hydrophilic
COOH-terminal portions of each protein. The polyclonal antibodies were
purified by affinity chromatography and were specific for MCT1 and
MCT2, respectively, with no cross-reaction detectable on immunoblots.
Both antibodies recognized proteins of approximately 43 kDa in
immunoblots of membranes from various hamster tissues (Fig. 6).
In some tissues, another band of approximately 90 kDa was also stained.
This band probably represents the dimeric form of the
transporter(2) . Some tissues such as the heart and epididymis
expressed large amounts of both transporters. The lung, cecum, eye, and
erythrocyte preferentially expressed MCT1, whereas the liver, kidney,
stomach, and skin preferentially expressed MCT2. Although no
immunoreactive MCT1 and MCT2 bands were observed in skeletal muscle on
the immunoblots shown in Fig. 6, longer exposure of the gels
showed trace expression of both MCTs.
Figure 6:
Expression of MCT1 (upper) and
MCT2 (lower) in various tissues of Syrian hamsters as
determined by immunoblotting. Aliquots of tissues were homogenized
(Polytron) in hypotonic buffer (20 mM Tris-HCl at pH 7.4, 5
mM MgCl
Both affinity-purified
antibodies were used to localize the transporters within tissues by
indirect immunofluorescence (Fig. 7). MCT1 and MCT2 were both
expressed in cardiac muscle (panels A and B) with
some concentration at the intercalated disks (arrows). MCT1
was not detectable in liver by this technique, whereas MCT2 was
abundant on the sinusoidal surfaces of hepatocytes (panels C and D). MCT1, but not MCT2, was found on the basolateral
surfaces of epithelial cells in the cecum (panels E and F). Both transporters were present in the same myocytes in the
gastrocnemius muscle as revealed by serial section (compare individual
myocytes in panels G and H). Previous studies have
shown that these myocytes are rich in mitochondria and represent
oxidative fibers(2) .
Figure 7:
Indirect immunofluorescence localization
of MCT1 and MCT2 in various hamster tissues. Hamster heart (A, B), liver (C, D), cecum (E, F), gastrocnemius muscle (G, H), testis (I, J), distal epididymis (K, L),
kidney cortex (M, N), and kidney medulla (O, P) were fixed and processed as described under
``Experimental Procedures.'' Sections were incubated with
either 20 µg/ml of affinity-purified anti-MCT1 IgG-F271 (A, C, E, G, I, K, M, O) or 10 µg/ml of
affinity-purified anti-MCT2 IgG-K452 (B, D, F, H, J, L, N, P)
followed by fluorescein-conjugated goat anti-rabbit IgG. Arrowheads denote intercalated discs; e, epithelium; l,
lumen; s, stroma; arrows, stereocilia; stars, spermatozoa; g, glomerulus. Magnifications: A-D, G-K, and M-P, 600x; E, F, and L,
1500x.
In the testis (Fig. 7, panel I) and proximal epididymis (data not shown), MCT1 was
present on the heads of sperm. In striking contrast, MCT2 was present
exclusively on sperm tails. This is illustrated by the positive stain
of multiple sperm tails aggregated in the lumen of a seminiferous
tubule in the testis (panel J). In the distal epididymis, MCT1
was no longer detectable on sperm, but instead it was found on the
microvillar surface of the lining epithelium (panel K). MCT2
remained on sperm tails (panel L). In the renal cortex, MCT1
was found on the basolateral surfaces of epithelial cells in the
proximal convoluted tubules (Fig. 7, panel M), whereas
MCT2 was undetectable at this site (panel N). In the inner
segment of the medulla, the distribution was reversed. MCT1 was not
detectable (panel O), whereas MCT2 was abundant on the
basolateral surfaces of epithelial cells in the collecting ducts (panel P). In the stomach, MCT1 was present on the
basolateral surfaces of epithelial cells (Fig. 8, panel
A) but not in the oxyntic gland (panel B). MCT2, in
contrast, was not detectable on epithelial cells, but rather it was
expressed abundantly on the surface of parietal cells in the oxyntic
gland (panels C and D).
Figure 8:
Indirect immunofluorescence of MCT1 and
MCT2 in the corpus of the stomach. Hamster stomach was fixed,
processed, and stained with affinity-purified anti-MCT1 (A, B) or anti-MCT2 (C, D) as described in the
legend to Fig. 7. A, surface mucosal cells of stomach
epithelium, showing a basolateral staining of MCT1 (arrow). B, oxyntic gland, showing no staining of MCT1. C,
surface mucosal cells of epithelium (top half) and oxyntic
gland (bottom half), showing staining of MCT2 only in oxyntic
gland and not in epithelium. D, oxyntic gland, showing
staining of MCT2 only in parietal cells (arrowheads) and not
in mucosal neck cells. Magnifications: A, B, and
D, 1968x; C, 780x.
The current paper reports the cDNA cloning and preliminary
analysis of the functional properties and tissue distribution of MCT2,
a monocarboxylate transporter that was cloned by virtue of its sequence
similarity to MCT1. The functional studies were performed in insect Sf9
cells, which have a low rate of pyruvate uptake. Expression of MCT1 or
MCT2 increased [ The comparative studies
conducted so far suggest that MCT1 and MCT2 act similarly in mediating
the transmembrane movement of pyruvate and lactate. MCT2 had a 4-fold
higher affinity for pyruvate as compared with MCT1 (apparent K The most striking
biochemical difference between MCT1 and MCT2 was the differential
sensitivity to the organomercurial thiol reagents pCMB and pCMBS. Whereas MCT1 was sensitive to these agents, MCT2 was
resistant. These data suggest that MCT1 has an externally accessible
cysteine residue that is a target for organomercurials. This cysteine
is either absent or inaccessible in MCT2. Previous studies have shown
that the erythrocyte monocarboxylate transporter is inactivated by pCMB(1) . A similar inactivation has been reported for
rat liver(14) . Our data indicate that hamster liver primarily
expresses MCT2, which is resistant to pCMB. It is possible
that the rat equivalent of MCT2 is sensitive to these organomercurial
thiol reagents. Alternatively, rats and hamsters may express different
isoforms of MCTs in the liver. The differences in cellular
distribution between MCT1 and MCT2 were dramatic. The only tissue in
which MCT1 and MCT2 were expressed abundantly in the same cell type was
striated muscle. In skeletal muscle, both transporters were expressed
in the same mitochondria-rich (oxidative) fibers, and neither was
detectable in the mitochondria-poor glycolytic fibers. Both
transporters were also expressed in cardiac myocytes. Although both
transporters were expressed in the kidney, the cellular distribution
was quite different. MCT1, as previously reported(2) , was
highly expressed on the basolateral surface of epithelial cells in the
proximal tubules of the renal cortex. On the other hand, MCT2 was
expressed almost exclusively on the basolateral surface of epithelial
cells in the collecting ducts of the medulla. Interestingly, previous
studies have shown that lactate production is highest in the inner
medullary collecting duct(15, 16) , the site of MCT2. Another striking difference in cellular distribution was seen in the
testis and epididymis. MCT1 was present on sperm heads in the testis
and proximal epididymis and on the microvillar surface of the
epithelium in the distal epididymis ( (2) and Fig. 7).
In contrast, MCT2 was present on the tails of sperm throughout the
testis and epididymis and was not seen in the epithelium. The reason
why sperm express one isoform of MCT1 in their heads and another in
their tails is unknown. It is possible that MCT2 is coupled to LDH-X,
the isoform of lactate dehydrogenase that is expressed exclusively in
sperm tails (17) . The reason for the loss of MCT1 from sperm
heads as they mature is likewise obscure. We also do not know whether
the MCT1 molecules that appear on the epithelial surface are shed from
sperm heads or whether they represent newly synthesized protein. The
differential expression of MCT1 and MCT2 in the liver and
gastrointestinal tract was also striking. MCT1 was abundant on the
basolateral surfaces of epithelial cells throughout the
gastrointestinal tract, including the stomach ( Fig. 6and
8A). In contrast, MCT2 was absent from epithelium but was
abundant on parietal cells in the oxyntic glands (Fig. 8, C and D). MCT2 was much more abundant in liver than was
MCT1 ( Fig. 6and Fig. 7). The selective expression of
MCT2 in the renal medulla and oxyntic glands of the stomach, both of
which produce H The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank(TM)/EMBL Data Bank with accession number(s)
L31957[GenBank].
Volume 270,
Number 4,
Issue of January 27, 1995 pp. 1843-1849
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
-cyano-4-hydroxycinnamate. MCT1, but not MCT2, was sensitive to
organomercurial thiol reagents such as p-chloromercuribenzoic
acid. Immunoblotting and immunofluorescence studies revealed a
strikingly different tissue distribution of the two MCTs. MCT1 was
present in erythrocytes and on the basolateral surfaces of intestinal
epithelial cells. MCT2 was not detectable in these tissues, but it was
abundant on the surface of hepatocytes. In the stomach, MCT1 was
present on the basolateral surfaces of epithelial cells; in contrast,
MCT2 was expressed on parietal cells of the oxyntic gland. In the
kidney, MCT1 was present on the basolateral surfaces of epithelial
cells in proximal tubules, whereas MCT2 was restricted to the
collecting ducts. MCT1 was expressed on sperm heads in the testis and
proximal epididymis. In the distal epididymis, it disappeared from
sperm and appeared on the microvillar surface of the lining epithelium.
In contrast, MCT2 was present on sperm tails throughout the epididymis
and not on the epithelium. Both transporters were expressed in
mitochondria-rich (oxidative) skeletal muscle fibers and cardiac
myocytes. These findings suggest that MCT1 and MCT2 are adapted to play
different roles in monocarboxylate transport in different cells of the
body.
)that exhibit a broad specificity. The
transporters are inhibited by the relatively nonspecific inhibitor
phloretin and by a more specific series of
-cyano-cinnamates
(reviewed in (1) ). Monocarboxylate transport is extremely
active in rodent erythrocytes, where it has been attributed to the
activity of a single MCT. MCT activity in hepatocytes resembles that of
the erythrocyte MCT, suggesting a similar MCT in this tissue. Cardiac
muscle has been hypothesized to contain at least two MCTs based on
differential sensitivity to stilbene inhibitors(1) .
Materials
We obtained sodium pyruvate
from Life Technologies, Inc., sodium
[2-
C]pyruvate (6-16 mCi/mmol) from DuPont
NEN, and all other compounds from Sigma. Fall armyworm ovarian (Sf9)
cells and recombinant baculovirus expressing adenylyl cyclase type II
were kindly provided by Wei-Jen Tang and Alfred G. Gilman (Department
of Pharmacology, University of Texas Southwestern Medical Center at
Dallas).Methods
Standard molecular biology
techniques were used(5) . Total cellular RNA was isolated form
Syrian hamster liver by the guanidinium thiocyanate/CsCl centrifugation
procedure(6) . Poly(A) RNA was isolated by
oligo(dT)-cellulose chromatography using an mRNA purification kit from
Pharmacia Biotech Inc. Protein content of cell extracts was determined
by the Lowry method(7) .
cDNA Cloning of pMCT2
Poly(A) RNA prepared from Syrian hamster liver was used to construct a
size-selected, directional cDNA library with a ZAP-cDNA kit purchased
from Stratagene(200400) with minor modifications of the recommended
protocol. Poly(A)
RNA (5 µg) was denatured with
methylmercuric hydroxide at room temperature prior to first strand
synthesis. XhoI-(dT)-primed cDNA was synthesized and ligated
to EcoRI adapters according to the manufacturer's
protocol. cDNAs greater than 1 kilobase in length were isolated from an
0.8% (w/v) agarose gel by electroelution and purified with an Elutip
minicolumn (Schleicher & Schuell) prior to ligation into
Uni-ZAP
XR vector arms. After in vitro packaging
(Stratagene Gigapack II packaging extract), the phages were plated out
on host strain Escherichia coli XL1-Blue MRF` cells.
1
10
plaques were transferred to replicate filters
and probed at 42 °C with 2 10
cpm/ml of the
uniformly P-labeled random hexanucleotide-primed SalI-NotI fragment of pMCT1 (originally named
pMev-wt) (4) and washed with 1.5
SSC ((5) ) at
55 °C for 15 min. Two rounds of plaque isolation were performed;
replicate filters were washed with 2
SSC at room temperature
for 1 h each time. The seven positive plaques isolated in this screen
underwent in vivo excision of pBluescript phagemid from the
Uni-ZAP vector (Stratagene ExAssist/SOLR system). Two strongly positive
clones were determined to be pMCT1 by sequence analysis. Four weakly
positive clones were partially sequenced and did not share sequence
homology with pMCT1. One weakly positive clone with an insert of 2.1
kilobases was sequenced; a region of 250 nucleotides was found to be
72% identical to pMCT1. This clone was named pMCT2. Overlapping
fragments of pMCT2 were inserted into pBluescript SK and sequenced by
automated methods using an Applied Biosystems Model 373A DNA sequenator
and vector-specific or internal primers.
Expression of MCT1 and MCT2 by Baculovirus Infection
of Sf9 Cells
An aliquot (1 ng) of a plasmid expressing
hamster MCT1 was amplified by PCR according to the manufacturer's
instructions using Pfu polymerase (Stratagene) with the 5`
-oligonucleotide GAGTGGGAATTCATGCCACCTGCAATTGGAGGA and the
3`-oligonucleotide GCCATCTCTAGATCAGACAGGACTCTCCTCTT. The PCR product
was digested with EcoRI and XbaI, gel purified, and
ligated to EcoRI-XbaI-digested pBacPak9 (Clontech).
The baculoviral expression vector for MCT2 was prepared in a similar
manner by PCR of the MCT2 coding region using the 5`-oligonucleotide
AGTACAGAATTCATGCCATCGGAGACTGCTGTA and the 3`-oligonucleotide
TAGACTTCTAGATTAAATATTGCTTTCTCTTT. Recombinant baculoviruses expressing
MCT1 or MCT2 were generated by cotransfection of Sf9 cells in
monolayers with the appropriate expression plasmid and linearized
BacPAK6 viral DNA (Clontech) by the Lipofectin method(8) .
Positive viral clones were isolated by plaque assay, identified by
immunoblot analysis or by measurements of
[
C]pyruvate uptake, and amplified by three
rounds of reinfection.Assays of [
Cultures (50 ml) of Sf9 cells at 1
C]Pyruvate
Uptake in Sf9 Cells 10
cells/ml in IPL-41 insect medium containing 10%
(v/v) heat-inactivated fetal calf serum, 1 tryptose phosphate
broth, 1
yeastolate ultrafiltrate, 2.5 µg/ml fungizone, and
50 µg/ml gentamicin were infected with recombinant baculoviruses at
a multiplicity of infection of 2 ((9) ). 20-22 h
post-infection, aliquots (1 ml) of infected Sf9 cells were plated onto
22-mm wells and allowed to attach for 2 h. For assay of
[
C]pyruvate uptake, each monolayer was washed at
room temperature with 1 ml of buffer A (150 mM NaCl, 10 mM sodium Hepes, 5 mM KCl, 1 mM MgCl
, 1
mM CaCl
, 0.2% (w/v) bovine serum albumin at pH
7.4) and preincubated at 0, 10, or 28 °C in 1 ml of buffer A. The
medium was replaced with 0.4 ml of buffer A containing sodium
[
C]pyruvate. After incubation for the indicated
time and temperature, each monolayer was washed three times at room
temperature with 2 ml of buffer A (without bovine serum albumin)
containing 0.6 mM phloretin. The amount of
[
C]pyruvate taken into the cell was determined
as described(2) .Antibodies
Polyclonal antibody IgG-K452
is directed against amino acids 425-484 of hamster MCT2 fused to
bacterial glutathione S-transferase. The bacterial expression
construct was prepared by ligating an EcoRI-XhoI-digested PCR product that encompassed the
corresponding nucleotide sequence of pMCT2 to EcoRI-XhoI-digested pGEX-KG(10) . The fusion
protein was expressed in E. coli BL21 (DE3) cells (Novagen,
Madison, WI), purified by glutathione-agarose affinity chromatography,
and covalently coupled to column supports with the ImmunoPure Ag/Ab
Immobilization Kit 1 (Pierce) for isolation of affinity-purified
antibodies. Affinity-purified IgG-F271, which is directed against amino
acids 439-494 of MCT1 fused to bacterial glutathione S-transferase, was previously described(2) .Immunofluorescence Microscopy
Hamsters
were anesthetized with sodium pentobarbital (120 mg/kg body weight) and
perfused at room temperature through the left ventricle with 80 ml of
oxygenated Hank's balanced salt solution for 5 min to remove
blood. Tissues were fixed and processed as previously
described(2, 11) . Sections were incubated
sequentially at room temperature as follows: first, buffer B (20 mM Tris-HCl, 200 mM NaCl, 0.4% (w/v) bovine serum albumin,
and 0.01% (w/v) NaN
at pH 9) for 60 min; second, either 20
µg/ml affinity-purified IgG-F271 or 10 µg/ml affinity-purified
IgG-K452 in buffer B overnight; and third, 25 mg/ml fluorescein
isothiocyanate-labeled goat anti-rabbit IgG in buffer B for 2 h. Each
incubation was followed by three successive 5-min washes in buffer B.
Finally, sections were rinsed in distilled water for 1 min and mounted
in DABCO (90% (v/v) glycerol, 50 mM Tris-HCl, 25% (w/v)
1,4-diazabicyclo[2.2.2]octane at pH 9.0). The samples were
viewed and photographed with a Zeiss photomicroscope III with the
appropriate filter package for fluorescein.
P-labeled full-length MCT1 cDNA under low stringency
hybridization conditions. One weakly positive clone encoded a protein
that was similar, but not identical, to MCT1. We named this plasmid
pMCT2. The 2.1-kilobase cDNA insert in pMCT2 contains one long open
reading frame that encodes a protein of 484 amino acids plus 5`- and
3`-untranslated regions of 118 and 496 base pairs, respectively (Fig. 1). An inframe stop codon is located 39 nucleotides
upstream from the putative initiator methionine.
C]pyruvate at a low rate that was similar to
that of uninfected Sf9 cells (data not shown). Cells expressing either
MCT1 or MCT2 took up [
C]pyruvate much faster
than cells expressing adenylyl cyclase at all temperatures studied (Fig. 3). The rate of [
C]pyruvate
transport by both MCT1 and MCT2 increased at higher temperature, but
the effect was greater for MCT2. At 0 °C, the rate of uptake by
cells expressing MCT1 was 4-fold greater than the rate of uptake by
cells expressing MCT2 (Fig. 3A). At 28 °C, the
physiologic temperature for Sf9 cells, the rates of uptake by the two
transporters were nearly equal (Fig. 3C). At 10 °C,
the uptake rates were intermediate between those at 0 and 28 °C (Fig. 3B).
C]pyruvate by Sf9 cells expressing MCT1 or MCT2
at 0 (A), 10 (B), or 28 °C (C).
Duplicate wells of cells infected with recombinant baculoviruses
encoding MCT1 (), MCT2 (
), or adenylyl cyclase type II
(
) were set up for experiments as described under
``Experimental Procedures.'' 23 h after infection, each
monolayer was washed once with 1 ml of buffer A at the indicated
temperature, preincubated for 5 min with 1 ml of buffer A at the same
temperature, and then incubated for the indicated time with 0.4 ml of
buffer A containing 0.5 mM sodium
[
C]pyruvate (3.8 10
dpm/nmol) at the same temperature. Uptake of
[
C]pyruvate was determined as described under
``Experimental Procedures.'' ACII, adenylyl cyclase
type II.
C]pyruvate at 28 °C by Sf9 cells expressing
either MCT1 or MCT2. Phloretin affected both transporters equally with
50% inhibition occurring at approximately 0.4 mM (panel
A). Both transporters were inhibited by
-cyano-4-hydroxycinnamate, but the inhibition curve was steeper
for MCT2 than it was for MCT1 (panel B). 50% inhibition of
MCT2 activity was attained at approximately 1.5 mM
-cyano-4-hydroxycinnamate, but MCT1 was not inhibited to this
degree at the highest concentration tested (3 mM). Similar
results were obtained in two additional experiments (not shown). In
contrast, at 0 °C the cells expressing both transporters were
equally sensitive to
-cyano-4-hydroxycinnamate with 50% inhibition
at 0.3 mM for MCT1 and 0.6 mM for MCT2 (mean of four
experiments, data not shown).
C]pyruvate at 28 °C by Sf9 cells expressing
MCT1 or MCT2 (effects of inhibitors). Duplicate wells of cells infected
with recombinant baculoviruses encoding MCT1 () or MCT2 (
)
were set up for experiments as described under ``Experimental
Procedures.'' 23 h after infection, each monolayer was washed once
at room temperature with 1 ml of buffer A, preincubated for 5 min at 28
°C in 1 ml of buffer A containing the indicated amount of inhibitor
added in dimethyl sulfoxide at a final concentration of 0.55 or 1.1%
(v/v), and then incubated for 1 min at 28 °C in 0.4 ml of buffer A
containing the indicated inhibitor and 0.5 mM sodium
[
C]pyruvate (2.6 10
dpm/nmol). The ``100% of control values'' were 7.8 and
7.1 nmol minmg protein
for
[
C]pyruvate uptake by MCT1 and MCT2,
respectively.
-CN-4-OH cinnamate,
-cyano-4-hydroxycinnamate.
C]pyruvate at 28 °C in Sf9 cells expressing
either MCT1 or MCT2. The affinity of MCT2 for
[
C]pyruvate was somewhat higher than that of
MCT1. In a series of four experiments, the average apparent K
value for [
C]pyruvate
uptake by MCT1 was 3.1 mM (range, 1.2-6.0), and the
corresponding value for MCT2 was 0.8 mM (range, 0.4-1.9)
as determined by double reciprocal plots. We cannot compare the V
for the two transporters since the amount of
recombinant MCT1 or MCT2 protein produced by the infected cells cannot
be precisely quantified.
C]pyruvate in Sf9 cells expressing MCT1 or
MCT2. Triplicate wells of cells infected with recombinant baculoviruses
expressing MCT1 (), MCT2 (
), or adenylyl cyclase type II
(
) were set up for experiments as described under
``Experimental Procedures.'' 22 h after infection, each
monolayer was washed once with 1 ml of buffer A, preincubated for 5 min
with 1 ml of buffer A at 28 °C, and then incubated for 1 min at 28
°C with 0.4 ml of buffer A containing the indicated concentration
of sodium [
C]pyruvate (4.1 10
to 1.4 10
dpm/nmol). A blank value was
determined by incubating triplicate wells of cells with varying
concentrations of [
C]pyruvate in the presence of
1 mM phloretin. The average blank values varied from 0.09 nmol
minmg protein
(0.3 mM)
to 7.6 nmol min
mg protein
(10
mM). ACII, adenylyl cyclase type
II.
, 1 mM sodium EDTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 10
µg/ml leupeptin, and 5 µg/ml pepstatin A) at a ratio of
2.5-5 ml of buffer/mg of tissue and centrifuged at 200 g for 5 min at 4 °C. The resulting supernatant was then
centrifuged at 2
10
g at 4 °C for 30 min, and
the membrane pellet was resuspended in 0.5-1 ml of buffer
containing 62.5 mM Tris-HCl at pH 6.8, 15% (w/v) SDS, 8 M urea, 10% (w/v) sucrose, 100 mM dithiothreitol, and 10
mM sodium EDTA. Protein concentrations were determined by the
method of Lowry et al. (7) after samples were
precipitated with 10% (w/v) trichloroacetic acid in 0.015% (w/v) sodium
deoxycholate. Aliquots (30 µg) of membrane protein from the
indicated tissue were separated on a 10% SDS-polyacrylamide gel (80
70
1 mm), transferred to nitrocellulose, and probed
with 2 µg/ml of affinity-purified IgG-F271 (upper) or
affinity-purified IgG-K452 (lower). The antibody was detected
with an enhanced chemiluminescence system as described(4) . The
blots were exposed to reflection film (DuPont NEN) at room temperature
for 4 min. Open and closed arrows denote the
monomeric and dimeric forms of MCT1 (upper) or MCT2 (lower), respectively. Asterisk denotes an
immunoreactive doublet in lung that did not correspond to the molecular
weight of MCT2.
C]pyruvate uptake by more than
40-fold in these cells (Fig. 3).
of 0.8 versus 3.1 mM) (Fig. 5). The affinities for L-lactate, however, were
similar for the two transporters (apparent K
of
8.3 and 8.7 mM for MCT1 and MCT2, respectively, at 28 °C)
(data not shown). We do not know whether the apparent difference in
affinity for pyruvate is physiologically important. The kinetic studies
reported here are preliminary and were designed to characterize the
general properties of this new transporter. We also have not yet
explored the relative transport activities of MCT1 and MCT2 with
respect to a variety of monocarboxylates., raises the possibility that MCT2 may
be adapted to transport lactate more efficiently in environments where
the extracellular or intracellular pH is acidic. Since MCT transporters
are generally believed to transport lactate together with a proton, the
direction of net transport is strongly dependent on the pH gradient
across the cell membrane(2) . It will be of interest in the
future to compare the effects of proton concentration gradients on
monocarboxylate transport mediated by MCT1 and MCT2.
)
We thank Marc Duderstadt for invaluable technical
assistance, Lisa Beatty for excellent help in culturing insect cells,
Jeff Cormier and Michelle Laremore for sequencing DNA, and Dr. Richard
G. W. Anderson for helpful advice and critical review of the
manuscript.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
T. D. Scholz and J. L. Segar Cardiac Metabolism in the Fetus and Newborn NeoReviews, March 1, 2008; 9(3): e109 - e118. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. X. L. Zhang, T. R. Searcy, Y. Wu, D. Gozal, and Y. Wang Alternative promoter usage and alternative splicing contribute to mRNA heterogeneity of mouse monocarboxylate transporter 2 Physiol Genomics, December 19, 2007; 32(1): 95 - 104. [Abstract] [Full Text] [PDF] |
||||
![]() |
H. M. Said, S. M. Nabokina, K. Balamurugan, Z. M. Mohammed, C. Urbina, and M. L. Kashyap Mechanism of nicotinic acid transport in human liver cells: experiments with HepG2 cells and primary hepatocytes Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1773 - C1778. [Abstract] [Full Text] [PDF] |
||||
![]() |
Q. Wang and M. E. Morris The Role of Monocarboxylate Transporter 2 and 4 in the Transport of {gamma}-Hydroxybutyric Acid in Mammalian Cells Drug Metab. Dispos., August 1, 2007; 35(8): 1393 - 1399. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yoshida, G. P. Holloway, V. Ljubicic, H. Hatta, L. L. Spriet, D. A. Hood, and A. Bonen Negligible direct lactate oxidation in subsarcolemmal and intermyofibrillar mitochondria obtained from red and white rat skeletal muscle J. Physiol., August 1, 2007; 582(3): 1317 - 1335. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. T. Thwaites and C. M. H. Anderson H+-coupled nutrient, micronutrient and drug transporters in the mammalian small intestine Exp Physiol, July 1, 2007; 92(4): 603 - 619. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. Fang, Q. J. Quinones, T. L. Holman, M. J. Morowitz, Q. Wang, H. Zhao, F. Sivo, J. M. Maris, and M. L. Wahl The H+-Linked Monocarboxylate Transporter (MCT1/SLC16A1): A Potential Therapeutic Target for High-Risk Neuroblastoma Mol. Pharmacol., December 1, 2006; 70(6): 2108 - 2115. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kirat, J. Masuoka, H. Hayashi, H. Iwano, H. Yokota, H. Taniyama, and S. Kato Monocarboxylate transporter 1 (MCT1) plays a direct role in short-chain fatty acids absorption in caprine rumen J. Physiol., October 15, 2006; 576(2): 635 - 647. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. de Laplanche, K. Gouget, G. Cleris, F. Dragounoff, J. Demont, A. Morales, L. Bezin, C. Godinot, G. Perriere, D. Mouchiroud, et al. Physiological oxygenation status is required for fully differentiated phenotype in kidney cortex proximal tubules Am J Physiol Renal Physiol, October 1, 2006; 291(4): F750 - F760. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Kirat and S. Kato Monocarboxylate transporter 1 (MCT1) mediates transport of short-chain fatty acids in bovine caecum Exp Physiol, September 1, 2006; 91(5): 835 - 844. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hashimoto, R. Hussien, and G. A. Brooks Colocalization of MCT1, CD147, and LDH in mitochondrial inner membrane of L6 muscle cells: evidence of a mitochondrial lactate oxidation complex Am J Physiol Endocrinol Metab, June 1, 2006; 290(6): E1237 - E1244. [Abstract] [Full Text] [PDF] |
||||
![]() |
T. Hashimoto, S. Masuda, S. Taguchi, and G. A Brooks Immunohistochemical analysis of MCT1, MCT2 and MCT4 expression in rat plantaris muscle J. Physiol., August 15, 2005; 567(1): 121 - 129. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. C. Wilson, D. Meredith, J. E. M. Fox, C. Manoharan, A. J. Davies, and A. P. Halestrap Basigin (CD147) Is the Target for Organomercurial Inhibition of Monocarboxylate Transporter Isoforms 1 and 4: THE ANCILLARY PROTEIN FOR THE INSENSITIVE MCT2 IS EMBIGIN (gp70) J. Biol. Chem., July 22, 2005; 280(29): 27213 - 27221. [Abstract] [Full Text] [PDF] |
||||
![]() |
K. Miki, W. Qu, E. H. Goulding, W. D. Willis, D. O. Bunch, L. F. Strader, S. D. Perreault, E. M. Eddy, and D. A. O'Brien Glyceraldehyde 3-phosphate dehydrogenase-S, a sperm-specific glycolytic enzyme, is required for sperm motility and male fertility PNAS, November 23, 2004; 101(47): 16501 - 16506. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. Coles, J. Litt, H. Hatta, and A. Bonen Exercise rapidly increases expression of the monocarboxylate transporters MCT1 and MCT4 in rat muscle J. Physiol., November 15, 2004; 561(1): 253 - 261. [Abstract] [Full Text] [PDF] |
||||
![]() |
E. Gopal, Y.-J. Fei, M. Sugawara, S. Miyauchi, L. Zhuang, P. Martin, S. B. Smith, P. D. Prasad, and V. Ganapathy Expression of slc5a8 in Kidney and Its Role in Na+-coupled Transport of Lactate J. Biol. Chem., October 22, 2004; 279(43): 44522 - 44532. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. E. Butz, G. B. McClelland, and G. A. Brooks MCT1 confirmed in rat striated muscle mitochondria J Appl Physiol, September 1, 2004; 97(3): 1059 - 1066. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Yoshida, H. Hatta, M. Kato, T. Enoki, H. Kato, and A. Bonen Relationship between skeletal muscle MCT1 and accumulated exercise during voluntary wheel running J Appl Physiol, August 1, 2004; 97(2): 527 - 534. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. B. Gladden Lactate metabolism: a new paradigm for the third millennium J. Physiol., July 1, 2004; 558(1): 5 - 30. [Abstract] [Full Text] [PDF] |
||||
![]() |
Y. Wang, M. Tonouchi, D. Miskovic, H. Hatta, and A. Bonen T3 increases lactate transport and the expression of MCT4, but not MCT1, in rat skeletal muscle Am J Physiol Endocrinol Metab, September 1, 2003; 285(3): E622 - E628. [Abstract] [Full Text] [PDF] |
||||
![]() |
F. Muller, K. Huber, H. Pfannkuche, J. R. Aschenbach, G. Breves, and G. Gabel Transport of ketone bodies and lactate in the sheep ruminal epithelium by monocarboxylate transporter 1 Am J Physiol Gastrointest Liver Physiol, November 1, 2002; 283(5): G1139 - G1146. [Abstract] [Full Text] [PDF] |
||||
![]() |
A. J. Schwab, L. Tao, T. Yoshimura, A. Simard, F. Barker, and K. S. Pang Hepatic uptake and metabolism of benzoate: a multiple indicator dilution, perfused rat liver study Am J Physiol Gastrointest Liver Physiol, June 1, 2001; 280(6): G1124 - G1136. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. Zhao, M. C. Wilson, F. Schuit, A. P. Halestrap, and G. A. Rutter Expression and Distribution of Lactate/Monocarboxylate Transporter Isoforms in Pancreatic Islets and the Exocrine Pancreas Diabetes, February 1, 2001; 50(2): 361 - 366. [Abstract] [Full Text] |
||||
![]() |
A. Bonen, M. Tonouchi, D. Miskovic, C. Heddle, J. J. Heikkila, and A. P. Halestrap Isoform-specific regulation of the lactate transporters MCT1 and MCT4 by contractile activity Am J Physiol Endocrinol Metab, November 1, 2000; 279(5): E1131 - E1138. [Abstract] [Full Text] [PDF] |
||||