JBC Advanced Glycation Endproducts

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Garcia, C. K.
Right arrow Articles by Goldstein, J. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Garcia, C. K.
Right arrow Articles by Goldstein, J. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 4, Issue of January 27, 1995 pp. 1843-1849
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
cDNA Cloning of MCT2, a Second Monocarboxylate Transporter Expressed in Different Cells than MCT1 (*)

(Received for publication, August 30, 1994; and in revised form, October 20, 1994)

Christine Kim Garcia (§) Michael S. Brown Ravindra K. Pathak Joseph L. Goldstein

From the Departments of Molecular Genetics and Cell Biology, University of Texas Southwestern Medical Center, Dallas, Texas 75235-9046

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Low stringency screening of a cDNA library from hamster liver yielded a cDNA encoding MCT2, a monocarboxylate transporter that is 60% identical to hamster MCT1, the first monocarboxylate transporter to be isolated. The functional properties of the two MCTs were compared by expression in Sf9 insect cells using recombinant baculovirus vectors. Like MCT1, MCT2 transported pyruvate and lactate. The two transporters were sensitive to inhibition by phloretin and by alpha-cyano-4-hydroxycinnamate. MCT1, but not MCT2, was sensitive to organomercurial thiol reagents such as p-chloromercuribenzoic acid. Immunoblotting and immunofluorescence studies revealed a strikingly different tissue distribution of the two MCTs. MCT1 was present in erythrocytes and on the basolateral surfaces of intestinal epithelial cells. MCT2 was not detectable in these tissues, but it was abundant on the surface of hepatocytes. In the stomach, MCT1 was present on the basolateral surfaces of epithelial cells; in contrast, MCT2 was expressed on parietal cells of the oxyntic gland. In the kidney, MCT1 was present on the basolateral surfaces of epithelial cells in proximal tubules, whereas MCT2 was restricted to the collecting ducts. MCT1 was expressed on sperm heads in the testis and proximal epididymis. In the distal epididymis, it disappeared from sperm and appeared on the microvillar surface of the lining epithelium. In contrast, MCT2 was present on sperm tails throughout the epididymis and not on the epithelium. Both transporters were expressed in mitochondria-rich (oxidative) skeletal muscle fibers and cardiac myocytes. These findings suggest that MCT1 and MCT2 are adapted to play different roles in monocarboxylate transport in different cells of the body.


INTRODUCTION

Animal cells take up and excrete lactate, pyruvate, and other monocarboxylate anions by means of proton-coupled monocarboxylate transporters (MCTs) (^1)that exhibit a broad specificity. The transporters are inhibited by the relatively nonspecific inhibitor phloretin and by a more specific series of alpha-cyano-cinnamates (reviewed in (1) ). Monocarboxylate transport is extremely active in rodent erythrocytes, where it has been attributed to the activity of a single MCT. MCT activity in hepatocytes resembles that of the erythrocyte MCT, suggesting a similar MCT in this tissue. Cardiac muscle has been hypothesized to contain at least two MCTs based on differential sensitivity to stilbene inhibitors(1) .

A cDNA encoding a monocarboxylate transporter, designated MCT1, was recently isolated from a Chinese hamster ovary cell cDNA library (2) . The cDNA was isolated by an indirect route. The studies began with met-18b-2 cells, a line of mutant Chinese hamster ovary cells that exhibit an abnormally high uptake rate for mevalonate, a dihydroxy monocarboxylate that is an intermediate in cholesterol biosynthesis (3) . A cDNA that encodes Mev, a mevalonate transporter, was isolated by an expression cloning strategy from a met-18b-2 cell cDNA library(4) . The Mev protein contains 12 putative membrane-spanning regions, and it mediates rapid transport of mevalonate but not lactate, pyruvate, or other monocarboxylates(2) .

In searching for the origin of Mev, we discovered that the protein is encoded by a mutant allele of a normal hamster gene(2, 4) . The wild-type gene product is identical to Mev except that it contains a phenylalanine instead of a cysteine at amino acid 360 in the 10th membrane-spanning region(2) . The protein encoded by the wild-type cDNA had all of the properties previously ascribed to the erythrocyte MCT (2) . When expressed in human cells by transfection, it mediated bidirectional membrane transport of lactate, pyruvate, and other monocarboxylates, but not mevalonate. We concluded that the wild-type gene encoded the erythrocyte MCT, and we designated it as MCT1. A single base substitution in this gene had given rise to Mev, which allowed the met-18b-2 cells to grow under selection conditions that demanded high mevalonate uptake.

MCT1 is expressed abundantly in hamster erythrocyte membranes(2) . It is also expressed at relatively high levels in hamster cardiac and skeletal muscle, kidney, gastrointestinal tract, and epididymis. In skeletal muscle, MCT1 was found exclusively in mitochondria-rich (oxidative) fibers. In the testis and proximal epididymis, the protein was found on the heads of maturing sperm. However, in the distal epididymis the sperm no longer exhibited detectable MCT1, and the protein appeared on the microvillar surface of the lining epithelium (2) .

The lack of expression of MCT1 in the liver raised the possibility that a related MCT must be present in this tissue to account for the well documented transport of lactate and pyruvate in this tissue. Thus, in the current studies, we used a low stringency hybridization method to screen a hamster liver cDNA library for clones related to MCT1. We isolated a cDNA encoding MCT2, which is 60% identical to MCT1, transports lactate and pyruvate with comparable efficiency, and has a strikingly different tissue distribution than does MCT1 as well as a different sensitivity to organomercurial thiol reagents.


EXPERIMENTAL PROCEDURES

Materials

We obtained sodium pyruvate from Life Technologies, Inc., sodium [2-^14C]pyruvate (6-16 mCi/mmol) from DuPont NEN, and all other compounds from Sigma. Fall armyworm ovarian (Sf9) cells and recombinant baculovirus expressing adenylyl cyclase type II were kindly provided by Wei-Jen Tang and Alfred G. Gilman (Department of Pharmacology, University of Texas Southwestern Medical Center at Dallas).

Methods

Standard molecular biology techniques were used(5) . Total cellular RNA was isolated form Syrian hamster liver by the guanidinium thiocyanate/CsCl centrifugation procedure(6) . Poly(A) RNA was isolated by oligo(dT)-cellulose chromatography using an mRNA purification kit from Pharmacia Biotech Inc. Protein content of cell extracts was determined by the Lowry method(7) .

cDNA Cloning of pMCT2

Poly(A) RNA prepared from Syrian hamster liver was used to construct a size-selected, directional cDNA library with a ZAP-cDNA kit purchased from Stratagene(200400) with minor modifications of the recommended protocol. Poly(A) RNA (5 µg) was denatured with methylmercuric hydroxide at room temperature prior to first strand synthesis. XhoI-(dT)-primed cDNA was synthesized and ligated to EcoRI adapters according to the manufacturer's protocol. cDNAs greater than 1 kilobase in length were isolated from an 0.8% (w/v) agarose gel by electroelution and purified with an Elutip minicolumn (Schleicher & Schuell) prior to ligation into Uni-ZAP XR vector arms. After in vitro packaging (Stratagene Gigapack II packaging extract), the phages were plated out on host strain Escherichia coli XL1-Blue MRF` cells. 1 times 10^6 plaques were transferred to replicate filters and probed at 42 °C with 2 times 10^6 cpm/ml of the uniformly P-labeled random hexanucleotide-primed SalI-NotI fragment of pMCT1 (originally named pMev-wt) (4) and washed with 1.5 times SSC ((5) ) at 55 °C for 15 min. Two rounds of plaque isolation were performed; replicate filters were washed with 2 times SSC at room temperature for 1 h each time. The seven positive plaques isolated in this screen underwent in vivo excision of pBluescript phagemid from the Uni-ZAP vector (Stratagene ExAssist/SOLR system). Two strongly positive clones were determined to be pMCT1 by sequence analysis. Four weakly positive clones were partially sequenced and did not share sequence homology with pMCT1. One weakly positive clone with an insert of 2.1 kilobases was sequenced; a region of 250 nucleotides was found to be 72% identical to pMCT1. This clone was named pMCT2. Overlapping fragments of pMCT2 were inserted into pBluescript SK and sequenced by automated methods using an Applied Biosystems Model 373A DNA sequenator and vector-specific or internal primers.

Expression of MCT1 and MCT2 by Baculovirus Infection of Sf9 Cells

An aliquot (1 ng) of a plasmid expressing hamster MCT1 was amplified by PCR according to the manufacturer's instructions using Pfu polymerase (Stratagene) with the 5` -oligonucleotide GAGTGGGAATTCATGCCACCTGCAATTGGAGGA and the 3`-oligonucleotide GCCATCTCTAGATCAGACAGGACTCTCCTCTT. The PCR product was digested with EcoRI and XbaI, gel purified, and ligated to EcoRI-XbaI-digested pBacPak9 (Clontech). The baculoviral expression vector for MCT2 was prepared in a similar manner by PCR of the MCT2 coding region using the 5`-oligonucleotide AGTACAGAATTCATGCCATCGGAGACTGCTGTA and the 3`-oligonucleotide TAGACTTCTAGATTAAATATTGCTTTCTCTTT. Recombinant baculoviruses expressing MCT1 or MCT2 were generated by cotransfection of Sf9 cells in monolayers with the appropriate expression plasmid and linearized BacPAK6 viral DNA (Clontech) by the Lipofectin method(8) . Positive viral clones were isolated by plaque assay, identified by immunoblot analysis or by measurements of [^14C]pyruvate uptake, and amplified by three rounds of reinfection.

Assays of [^14C]Pyruvate Uptake in Sf9 Cells

Cultures (50 ml) of Sf9 cells at 1 times 10^6 cells/ml in IPL-41 insect medium containing 10% (v/v) heat-inactivated fetal calf serum, 1 times tryptose phosphate broth, 1 times yeastolate ultrafiltrate, 2.5 µg/ml fungizone, and 50 µg/ml gentamicin were infected with recombinant baculoviruses at a multiplicity of infection of 2 ((9) ). 20-22 h post-infection, aliquots (1 ml) of infected Sf9 cells were plated onto 22-mm wells and allowed to attach for 2 h. For assay of [^14C]pyruvate uptake, each monolayer was washed at room temperature with 1 ml of buffer A (150 mM NaCl, 10 mM sodium Hepes, 5 mM KCl, 1 mM MgCl(2), 1 mM CaCl(2), 0.2% (w/v) bovine serum albumin at pH 7.4) and preincubated at 0, 10, or 28 °C in 1 ml of buffer A. The medium was replaced with 0.4 ml of buffer A containing sodium [^14C]pyruvate. After incubation for the indicated time and temperature, each monolayer was washed three times at room temperature with 2 ml of buffer A (without bovine serum albumin) containing 0.6 mM phloretin. The amount of [^14C]pyruvate taken into the cell was determined as described(2) .

Antibodies

Polyclonal antibody IgG-K452 is directed against amino acids 425-484 of hamster MCT2 fused to bacterial glutathione S-transferase. The bacterial expression construct was prepared by ligating an EcoRI-XhoI-digested PCR product that encompassed the corresponding nucleotide sequence of pMCT2 to EcoRI-XhoI-digested pGEX-KG(10) . The fusion protein was expressed in E. coli BL21 (DE3) cells (Novagen, Madison, WI), purified by glutathione-agarose affinity chromatography, and covalently coupled to column supports with the ImmunoPure Ag/Ab Immobilization Kit 1 (Pierce) for isolation of affinity-purified antibodies. Affinity-purified IgG-F271, which is directed against amino acids 439-494 of MCT1 fused to bacterial glutathione S-transferase, was previously described(2) .

Immunofluorescence Microscopy

Hamsters were anesthetized with sodium pentobarbital (120 mg/kg body weight) and perfused at room temperature through the left ventricle with 80 ml of oxygenated Hank's balanced salt solution for 5 min to remove blood. Tissues were fixed and processed as previously described(2, 11) . Sections were incubated sequentially at room temperature as follows: first, buffer B (20 mM Tris-HCl, 200 mM NaCl, 0.4% (w/v) bovine serum albumin, and 0.01% (w/v) NaN(3) at pH 9) for 60 min; second, either 20 µg/ml affinity-purified IgG-F271 or 10 µg/ml affinity-purified IgG-K452 in buffer B overnight; and third, 25 mg/ml fluorescein isothiocyanate-labeled goat anti-rabbit IgG in buffer B for 2 h. Each incubation was followed by three successive 5-min washes in buffer B. Finally, sections were rinsed in distilled water for 1 min and mounted in DABCO (90% (v/v) glycerol, 50 mM Tris-HCl, 25% (w/v) 1,4-diazabicyclo[2.2.2]octane at pH 9.0). The samples were viewed and photographed with a Zeiss photomicroscope III with the appropriate filter package for fluorescein.


RESULTS

To search for a member of the MCT family that is expressed in liver, we used low stringency hybridization. A size-selected Syrian hamster liver cDNA library was constructed and screened with a P-labeled full-length MCT1 cDNA under low stringency hybridization conditions. One weakly positive clone encoded a protein that was similar, but not identical, to MCT1. We named this plasmid pMCT2. The 2.1-kilobase cDNA insert in pMCT2 contains one long open reading frame that encodes a protein of 484 amino acids plus 5`- and 3`-untranslated regions of 118 and 496 base pairs, respectively (Fig. 1). An inframe stop codon is located 39 nucleotides upstream from the putative initiator methionine.


Figure 1: Nucleotide and predicted amino acid sequences of hamster pMCT2. Nucleotide residues are numbered on the right; amino acid residues are numbered on the left. The putative polyadenylation signal is boxed. An inframe stop codon is found 39 nucleotides upstream of the putative initiator methionine.



The predicted amino acid sequence of MCT2 is 60% identical to that of MCT1. Fig. 2A compares these two sequences in a manner that maximizes alignment of identical residues. Hydropathy plots calculated with a window of 9 residues (12) are nearly superimposable for the two proteins. Both proteins have 12 long hydrophobic segments separated by relatively short hydrophilic regions (Fig. 2B). In both sequences, the longest stretches of hydrophilic residues are located between the 6th and 7th putative membrane-spanning regions and distal to the 12th membrane-spanning region. Within these two hydrophilic domains, the protein sequences are the most divergent. Only 8 of the 50 residues at the COOH termini of the two proteins are identical. In the 10th membrane-spanning region, MCT2 shares the Phe whose conversion to Cys converts MCT1 to a mevalonate transporter (indicated by asterisk in Fig. 2A).



Figure 2: Amino acid sequences (A) and hydropathy plots (B) of hamster MCT1 versus MCT2. A, two gaps introduced in the sequences of MCT1 and MCT2 to maximize their alignment are indicated by dots. Identical amino acid residues are boxed, and the amino acids are numbered on the right. 12 putative transmembrane regions are indicated by the overbars. The asterisk indicates the position of the phenylalanine in MCT1 that when mutated to a cysteine yields a protein that enhances mevalonate uptake(4) . B, the residue-specific hydropathy index was calculated over a window of 9 residues by the method of Kyte and Doolittle (12) using the Genetics Computer Group Wisconsin package (version 7.3). Positive values represent increased hydrophobicity. The 12 putative transmembrane regions are numbered.



To compare the transport activities of MCT1 and MCT2, we prepared recombinant baculoviruses expressing each of these proteins and used them to infect Sf9 insect cells. As a control, we studied Sf9 cells infected with a baculovirus that encodes adenylyl cyclase type II (a kind gift of Drs. W. J. Tang and A. G. Gilman). This protein was used as a control because of its topological resemblance to the MCTs, i.e. the presence of 12 membrane-spanning regions (13) . Cells expressing adenylyl cyclase took up [^14C]pyruvate at a low rate that was similar to that of uninfected Sf9 cells (data not shown). Cells expressing either MCT1 or MCT2 took up [^14C]pyruvate much faster than cells expressing adenylyl cyclase at all temperatures studied (Fig. 3). The rate of [^14C]pyruvate transport by both MCT1 and MCT2 increased at higher temperature, but the effect was greater for MCT2. At 0 °C, the rate of uptake by cells expressing MCT1 was 4-fold greater than the rate of uptake by cells expressing MCT2 (Fig. 3A). At 28 °C, the physiologic temperature for Sf9 cells, the rates of uptake by the two transporters were nearly equal (Fig. 3C). At 10 °C, the uptake rates were intermediate between those at 0 and 28 °C (Fig. 3B).


Figure 3: Uptake of [^14C]pyruvate by Sf9 cells expressing MCT1 or MCT2 at 0 (A), 10 (B), or 28 °C (C). Duplicate wells of cells infected with recombinant baculoviruses encoding MCT1 (circle), MCT2 (bullet), or adenylyl cyclase type II (up triangle) were set up for experiments as described under ``Experimental Procedures.'' 23 h after infection, each monolayer was washed once with 1 ml of buffer A at the indicated temperature, preincubated for 5 min with 1 ml of buffer A at the same temperature, and then incubated for the indicated time with 0.4 ml of buffer A containing 0.5 mM sodium [^14C]pyruvate (3.8 times 10^3 dpm/nmol) at the same temperature. Uptake of [^14C]pyruvate was determined as described under ``Experimental Procedures.'' ACII, adenylyl cyclase type II.



Fig. 4compares the effect of various inhibitors on the uptake of the [^14C]pyruvate at 28 °C by Sf9 cells expressing either MCT1 or MCT2. Phloretin affected both transporters equally with 50% inhibition occurring at approximately 0.4 mM (panel A). Both transporters were inhibited by alpha-cyano-4-hydroxycinnamate, but the inhibition curve was steeper for MCT2 than it was for MCT1 (panel B). 50% inhibition of MCT2 activity was attained at approximately 1.5 mM alpha-cyano-4-hydroxycinnamate, but MCT1 was not inhibited to this degree at the highest concentration tested (3 mM). Similar results were obtained in two additional experiments (not shown). In contrast, at 0 °C the cells expressing both transporters were equally sensitive to alpha-cyano-4-hydroxycinnamate with 50% inhibition at 0.3 mM for MCT1 and 0.6 mM for MCT2 (mean of four experiments, data not shown).


Figure 4: Uptake of [^14C]pyruvate at 28 °C by Sf9 cells expressing MCT1 or MCT2 (effects of inhibitors). Duplicate wells of cells infected with recombinant baculoviruses encoding MCT1 (circle) or MCT2 (bullet) were set up for experiments as described under ``Experimental Procedures.'' 23 h after infection, each monolayer was washed once at room temperature with 1 ml of buffer A, preincubated for 5 min at 28 °C in 1 ml of buffer A containing the indicated amount of inhibitor added in dimethyl sulfoxide at a final concentration of 0.55 or 1.1% (v/v), and then incubated for 1 min at 28 °C in 0.4 ml of buffer A containing the indicated inhibitor and 0.5 mM sodium [^14C]pyruvate (2.6 times 10^3 dpm/nmol). The ``100% of control values'' were 7.8 and 7.1 nmol minmg protein for [^14C]pyruvate uptake by MCT1 and MCT2, respectively. alpha-CN-4-OH cinnamate, alpha-cyano-4-hydroxycinnamate.



A striking difference was noted in the sensitivity of the two transporters to inactivation by p-chloromercuribenzenesulfonic acid (pCMBS) and p-chloromercuribenzoic acid (pCMB), two organomercurial agents that modify cysteine residues. Transport by MCT1 was blocked nearly completely at concentrations of pCMBS or pCMB above 0.3 mM. These concentrations had no effect on transport by MCT2 (Fig. 4, panels C and D). Similar results were obtained with pCMBS at 0 °C (data not shown).

Fig. 5compares saturation curves for the uptake of [^14C]pyruvate at 28 °C in Sf9 cells expressing either MCT1 or MCT2. The affinity of MCT2 for [^14C]pyruvate was somewhat higher than that of MCT1. In a series of four experiments, the average apparent K(m) value for [^14C]pyruvate uptake by MCT1 was 3.1 mM (range, 1.2-6.0), and the corresponding value for MCT2 was 0.8 mM (range, 0.4-1.9) as determined by double reciprocal plots. We cannot compare the V(max) for the two transporters since the amount of recombinant MCT1 or MCT2 protein produced by the infected cells cannot be precisely quantified.


Figure 5: Substrate saturation curves for uptake of [^14C]pyruvate in Sf9 cells expressing MCT1 or MCT2. Triplicate wells of cells infected with recombinant baculoviruses expressing MCT1 (circle), MCT2 (bullet), or adenylyl cyclase type II (up triangle) were set up for experiments as described under ``Experimental Procedures.'' 22 h after infection, each monolayer was washed once with 1 ml of buffer A, preincubated for 5 min with 1 ml of buffer A at 28 °C, and then incubated for 1 min at 28 °C with 0.4 ml of buffer A containing the indicated concentration of sodium [^14C]pyruvate (4.1 times 10^2 to 1.4 times 10^4 dpm/nmol). A blank value was determined by incubating triplicate wells of cells with varying concentrations of [^14C]pyruvate in the presence of 1 mM phloretin. The average blank values varied from 0.09 nmol minmg protein (0.3 mM) to 7.6 nmol minmg protein (10 mM). ACII, adenylyl cyclase type II.



To compare the tissue distributions of MCT1 and MCT2, we raised antibodies against the highly divergent hydrophilic COOH-terminal portions of each protein. The polyclonal antibodies were purified by affinity chromatography and were specific for MCT1 and MCT2, respectively, with no cross-reaction detectable on immunoblots. Both antibodies recognized proteins of approximately 43 kDa in immunoblots of membranes from various hamster tissues (Fig. 6). In some tissues, another band of approximately 90 kDa was also stained. This band probably represents the dimeric form of the transporter(2) . Some tissues such as the heart and epididymis expressed large amounts of both transporters. The lung, cecum, eye, and erythrocyte preferentially expressed MCT1, whereas the liver, kidney, stomach, and skin preferentially expressed MCT2. Although no immunoreactive MCT1 and MCT2 bands were observed in skeletal muscle on the immunoblots shown in Fig. 6, longer exposure of the gels showed trace expression of both MCTs.


Figure 6: Expression of MCT1 (upper) and MCT2 (lower) in various tissues of Syrian hamsters as determined by immunoblotting. Aliquots of tissues were homogenized (Polytron) in hypotonic buffer (20 mM Tris-HCl at pH 7.4, 5 mM MgCl(2), 1 mM sodium EDTA, 1 mM dithiothreitol, 0.5 mM phenylmethylsulfonyl fluoride, 10 µg/ml leupeptin, and 5 µg/ml pepstatin A) at a ratio of 2.5-5 ml of buffer/mg of tissue and centrifuged at 200 times g for 5 min at 4 °C. The resulting supernatant was then centrifuged at 2 times 10^5 g at 4 °C for 30 min, and the membrane pellet was resuspended in 0.5-1 ml of buffer containing 62.5 mM Tris-HCl at pH 6.8, 15% (w/v) SDS, 8 M urea, 10% (w/v) sucrose, 100 mM dithiothreitol, and 10 mM sodium EDTA. Protein concentrations were determined by the method of Lowry et al. (7) after samples were precipitated with 10% (w/v) trichloroacetic acid in 0.015% (w/v) sodium deoxycholate. Aliquots (30 µg) of membrane protein from the indicated tissue were separated on a 10% SDS-polyacrylamide gel (80 times 70 times 1 mm), transferred to nitrocellulose, and probed with 2 µg/ml of affinity-purified IgG-F271 (upper) or affinity-purified IgG-K452 (lower). The antibody was detected with an enhanced chemiluminescence system as described(4) . The blots were exposed to reflection film (DuPont NEN) at room temperature for 4 min. Open and closed arrows denote the monomeric and dimeric forms of MCT1 (upper) or MCT2 (lower), respectively. Asterisk denotes an immunoreactive doublet in lung that did not correspond to the molecular weight of MCT2.



Both affinity-purified antibodies were used to localize the transporters within tissues by indirect immunofluorescence (Fig. 7). MCT1 and MCT2 were both expressed in cardiac muscle (panels A and B) with some concentration at the intercalated disks (arrows). MCT1 was not detectable in liver by this technique, whereas MCT2 was abundant on the sinusoidal surfaces of hepatocytes (panels C and D). MCT1, but not MCT2, was found on the basolateral surfaces of epithelial cells in the cecum (panels E and F). Both transporters were present in the same myocytes in the gastrocnemius muscle as revealed by serial section (compare individual myocytes in panels G and H). Previous studies have shown that these myocytes are rich in mitochondria and represent oxidative fibers(2) .


Figure 7: Indirect immunofluorescence localization of MCT1 and MCT2 in various hamster tissues. Hamster heart (A, B), liver (C, D), cecum (E, F), gastrocnemius muscle (G, H), testis (I, J), distal epididymis (K, L), kidney cortex (M, N), and kidney medulla (O, P) were fixed and processed as described under ``Experimental Procedures.'' Sections were incubated with either 20 µg/ml of affinity-purified anti-MCT1 IgG-F271 (A, C, E, G, I, K, M, O) or 10 µg/ml of affinity-purified anti-MCT2 IgG-K452 (B, D, F, H, J, L, N, P) followed by fluorescein-conjugated goat anti-rabbit IgG. Arrowheads denote intercalated discs; e, epithelium; l, lumen; s, stroma; arrows, stereocilia; stars, spermatozoa; g, glomerulus. Magnifications: A-D, G-K, and M-P, 600x; E, F, and L, 1500x.



In the testis (Fig. 7, panel I) and proximal epididymis (data not shown), MCT1 was present on the heads of sperm. In striking contrast, MCT2 was present exclusively on sperm tails. This is illustrated by the positive stain of multiple sperm tails aggregated in the lumen of a seminiferous tubule in the testis (panel J). In the distal epididymis, MCT1 was no longer detectable on sperm, but instead it was found on the microvillar surface of the lining epithelium (panel K). MCT2 remained on sperm tails (panel L). In the renal cortex, MCT1 was found on the basolateral surfaces of epithelial cells in the proximal convoluted tubules (Fig. 7, panel M), whereas MCT2 was undetectable at this site (panel N). In the inner segment of the medulla, the distribution was reversed. MCT1 was not detectable (panel O), whereas MCT2 was abundant on the basolateral surfaces of epithelial cells in the collecting ducts (panel P).

In the stomach, MCT1 was present on the basolateral surfaces of epithelial cells (Fig. 8, panel A) but not in the oxyntic gland (panel B). MCT2, in contrast, was not detectable on epithelial cells, but rather it was expressed abundantly on the surface of parietal cells in the oxyntic gland (panels C and D).


Figure 8: Indirect immunofluorescence of MCT1 and MCT2 in the corpus of the stomach. Hamster stomach was fixed, processed, and stained with affinity-purified anti-MCT1 (A, B) or anti-MCT2 (C, D) as described in the legend to Fig. 7. A, surface mucosal cells of stomach epithelium, showing a basolateral staining of MCT1 (arrow). B, oxyntic gland, showing no staining of MCT1. C, surface mucosal cells of epithelium (top half) and oxyntic gland (bottom half), showing staining of MCT2 only in oxyntic gland and not in epithelium. D, oxyntic gland, showing staining of MCT2 only in parietal cells (arrowheads) and not in mucosal neck cells. Magnifications: A, B, and D, 1968x; C, 780x.




DISCUSSION

The current paper reports the cDNA cloning and preliminary analysis of the functional properties and tissue distribution of MCT2, a monocarboxylate transporter that was cloned by virtue of its sequence similarity to MCT1. The functional studies were performed in insect Sf9 cells, which have a low rate of pyruvate uptake. Expression of MCT1 or MCT2 increased [^14C]pyruvate uptake by more than 40-fold in these cells (Fig. 3).

The comparative studies conducted so far suggest that MCT1 and MCT2 act similarly in mediating the transmembrane movement of pyruvate and lactate. MCT2 had a 4-fold higher affinity for pyruvate as compared with MCT1 (apparent K(m) of 0.8 versus 3.1 mM) (Fig. 5). The affinities for L-lactate, however, were similar for the two transporters (apparent K(m) of 8.3 and 8.7 mM for MCT1 and MCT2, respectively, at 28 °C) (data not shown). We do not know whether the apparent difference in affinity for pyruvate is physiologically important. The kinetic studies reported here are preliminary and were designed to characterize the general properties of this new transporter. We also have not yet explored the relative transport activities of MCT1 and MCT2 with respect to a variety of monocarboxylates.

The most striking biochemical difference between MCT1 and MCT2 was the differential sensitivity to the organomercurial thiol reagents pCMB and pCMBS. Whereas MCT1 was sensitive to these agents, MCT2 was resistant. These data suggest that MCT1 has an externally accessible cysteine residue that is a target for organomercurials. This cysteine is either absent or inaccessible in MCT2. Previous studies have shown that the erythrocyte monocarboxylate transporter is inactivated by pCMB(1) . A similar inactivation has been reported for rat liver(14) . Our data indicate that hamster liver primarily expresses MCT2, which is resistant to pCMB. It is possible that the rat equivalent of MCT2 is sensitive to these organomercurial thiol reagents. Alternatively, rats and hamsters may express different isoforms of MCTs in the liver.

The differences in cellular distribution between MCT1 and MCT2 were dramatic. The only tissue in which MCT1 and MCT2 were expressed abundantly in the same cell type was striated muscle. In skeletal muscle, both transporters were expressed in the same mitochondria-rich (oxidative) fibers, and neither was detectable in the mitochondria-poor glycolytic fibers. Both transporters were also expressed in cardiac myocytes.

Although both transporters were expressed in the kidney, the cellular distribution was quite different. MCT1, as previously reported(2) , was highly expressed on the basolateral surface of epithelial cells in the proximal tubules of the renal cortex. On the other hand, MCT2 was expressed almost exclusively on the basolateral surface of epithelial cells in the collecting ducts of the medulla. Interestingly, previous studies have shown that lactate production is highest in the inner medullary collecting duct(15, 16) , the site of MCT2.

Another striking difference in cellular distribution was seen in the testis and epididymis. MCT1 was present on sperm heads in the testis and proximal epididymis and on the microvillar surface of the epithelium in the distal epididymis ( (2) and Fig. 7). In contrast, MCT2 was present on the tails of sperm throughout the testis and epididymis and was not seen in the epithelium. The reason why sperm express one isoform of MCT1 in their heads and another in their tails is unknown. It is possible that MCT2 is coupled to LDH-X, the isoform of lactate dehydrogenase that is expressed exclusively in sperm tails (17) . The reason for the loss of MCT1 from sperm heads as they mature is likewise obscure. We also do not know whether the MCT1 molecules that appear on the epithelial surface are shed from sperm heads or whether they represent newly synthesized protein.

The differential expression of MCT1 and MCT2 in the liver and gastrointestinal tract was also striking. MCT1 was abundant on the basolateral surfaces of epithelial cells throughout the gastrointestinal tract, including the stomach ( Fig. 6and 8A). In contrast, MCT2 was absent from epithelium but was abundant on parietal cells in the oxyntic glands (Fig. 8, C and D). MCT2 was much more abundant in liver than was MCT1 ( Fig. 6and Fig. 7).

The selective expression of MCT2 in the renal medulla and oxyntic glands of the stomach, both of which produce H, raises the possibility that MCT2 may be adapted to transport lactate more efficiently in environments where the extracellular or intracellular pH is acidic. Since MCT transporters are generally believed to transport lactate together with a proton, the direction of net transport is strongly dependent on the pH gradient across the cell membrane(2) . It will be of interest in the future to compare the effects of proton concentration gradients on monocarboxylate transport mediated by MCT1 and MCT2.


FOOTNOTES

*
This work was supported by National Institutes of Health Grant HL20948 and a research grant from the Perot Family Foundation. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) L31957[GenBank].

§
Supported by Medical Scientists Training Grant GM 08014 and National Institutes of Health National Research Service Award GM 07062.

(^1)
The abbreviations used are: MCT, monocarboxylate transporter; pCMB, p-chloromercuribenzoic acid; pCMBS, p-chloromercuribenzenesulfonic acid; PCR, polymerase chain reaction.


ACKNOWLEDGEMENTS

We thank Marc Duderstadt for invaluable technical assistance, Lisa Beatty for excellent help in culturing insect cells, Jeff Cormier and Michelle Laremore for sequencing DNA, and Dr. Richard G. W. Anderson for helpful advice and critical review of the manuscript.


REFERENCES

  1. Poole, R. C., and Halestrap, A. P. (1993) Am. J. Physiol. 264, C761-C782
  2. Garcia, C. K., Goldstein, J. L., Pathak, R. K., Anderson, R. G. W., and Brown, M. S. (1994) Cell 76, 865-873 [CrossRef][Medline] [Order article via Infotrieve]
  3. Faust, J., and Krieger, M. (1987) J. Biol. Chem. 262, 1996-2004 [Abstract/Free Full Text]
  4. Kim, C. M., Goldstein, J. L., and Brown, M. S. (1992) J. Biol. Chem. 267, 23113-23121 [Abstract/Free Full Text]
  5. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  6. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18, 5294-5299 [CrossRef][Medline] [Order article via Infotrieve]
  7. Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265-275 [Free Full Text]
  8. Groebe, D. R., Chung, A. E., and Ho, C. (1990) Nucleic Acids Res. 18, 4033 [Free Full Text]
  9. O'Reilly, D. R., Miller, L. K., and Luckow, V. A. (1992) Baculovirus Expression Vectors: A Laboratory Manual , W. H. Freeman and Co., New York
  10. Guan, K., and Dixon, J. E. (1991) Anal. Biochem. 192, 262-267 [CrossRef][Medline] [Order article via Infotrieve]
  11. Pathak, R. K., Yokode, M., Hammer, R. E., Hofmann, S. L., Brown, M. S., Goldstein, J. L., and Anderson, R. G. W. (1990) J. Cell Biol. 111, 347-359 [Abstract/Free Full Text]
  12. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132 [CrossRef][Medline] [Order article via Infotrieve]
  13. Tang, W.-J., and Gilman, A. G. (1991) Science 254, 1500-1503 [Abstract/Free Full Text]
  14. Edlund, G. L., and Halestrap, A. P. (1988) Biochem. J. 249, 117-126 [Medline] [Order article via Infotrieve]
  15. Bagnasco, S., Good, D., Balaban, R., and Burg, M. (1985) Am. J. Physiol. 248, F522-F526
  16. Uchida, S., and Endou, H. (1988) Am. J. Physiol. 255, F977-F983
  17. Hintz, M., and Goldberg, E. (1977) Dev. Biol. 57, 375-384 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
NeoReviewsHome page
T. D. Scholz and J. L. Segar
Cardiac Metabolism in the Fetus and Newborn
NeoReviews, March 1, 2008; 9(3): e109 - e118.
[Abstract] [Full Text] [PDF]


Home page
Physiol. GenomicsHome page
S. X. L. Zhang, T. R. Searcy, Y. Wu, D. Gozal, and Y. Wang
Alternative promoter usage and alternative splicing contribute to mRNA heterogeneity of mouse monocarboxylate transporter 2
Physiol Genomics, December 19, 2007; 32(1): 95 - 104.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Cell Physiol.Home page
H. M. Said, S. M. Nabokina, K. Balamurugan, Z. M. Mohammed, C. Urbina, and M. L. Kashyap
Mechanism of nicotinic acid transport in human liver cells: experiments with HepG2 cells and primary hepatocytes
Am J Physiol Cell Physiol, December 1, 2007; 293(6): C1773 - C1778.
[Abstract] [Full Text] [PDF]


Home page
Drug Metab. Dispos.Home page
Q. Wang and M. E. Morris
The Role of Monocarboxylate Transporter 2 and 4 in the Transport of {gamma}-Hydroxybutyric Acid in Mammalian Cells
Drug Metab. Dispos., August 1, 2007; 35(8): 1393 - 1399.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
Y. Yoshida, G. P. Holloway, V. Ljubicic, H. Hatta, L. L. Spriet, D. A. Hood, and A. Bonen
Negligible direct lactate oxidation in subsarcolemmal and intermyofibrillar mitochondria obtained from red and white rat skeletal muscle
J. Physiol., August 1, 2007; 582(3): 1317 - 1335.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
D. T. Thwaites and C. M. H. Anderson
H+-coupled nutrient, micronutrient and drug transporters in the mammalian small intestine
Exp Physiol, July 1, 2007; 92(4): 603 - 619.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. Fang, Q. J. Quinones, T. L. Holman, M. J. Morowitz, Q. Wang, H. Zhao, F. Sivo, J. M. Maris, and M. L. Wahl
The H+-Linked Monocarboxylate Transporter (MCT1/SLC16A1): A Potential Therapeutic Target for High-Risk Neuroblastoma
Mol. Pharmacol., December 1, 2006; 70(6): 2108 - 2115.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
D. Kirat, J. Masuoka, H. Hayashi, H. Iwano, H. Yokota, H. Taniyama, and S. Kato
Monocarboxylate transporter 1 (MCT1) plays a direct role in short-chain fatty acids absorption in caprine rumen
J. Physiol., October 15, 2006; 576(2): 635 - 647.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Renal Physiol.Home page
E. de Laplanche, K. Gouget, G. Cleris, F. Dragounoff, J. Demont, A. Morales, L. Bezin, C. Godinot, G. Perriere, D. Mouchiroud, et al.
Physiological oxygenation status is required for fully differentiated phenotype in kidney cortex proximal tubules
Am J Physiol Renal Physiol, October 1, 2006; 291(4): F750 - F760.
[Abstract] [Full Text] [PDF]


Home page
Exp PhysiolHome page
D. Kirat and S. Kato
Monocarboxylate transporter 1 (MCT1) mediates transport of short-chain fatty acids in bovine caecum
Exp Physiol, September 1, 2006; 91(5): 835 - 844.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
T. Hashimoto, R. Hussien, and G. A. Brooks
Colocalization of MCT1, CD147, and LDH in mitochondrial inner membrane of L6 muscle cells: evidence of a mitochondrial lactate oxidation complex
Am J Physiol Endocrinol Metab, June 1, 2006; 290(6): E1237 - E1244.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
T. Hashimoto, S. Masuda, S. Taguchi, and G. A Brooks
Immunohistochemical analysis of MCT1, MCT2 and MCT4 expression in rat plantaris muscle
J. Physiol., August 15, 2005; 567(1): 121 - 129.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. C. Wilson, D. Meredith, J. E. M. Fox, C. Manoharan, A. J. Davies, and A. P. Halestrap
Basigin (CD147) Is the Target for Organomercurial Inhibition of Monocarboxylate Transporter Isoforms 1 and 4: THE ANCILLARY PROTEIN FOR THE INSENSITIVE MCT2 IS EMBIGIN (gp70)
J. Biol. Chem., July 22, 2005; 280(29): 27213 - 27221.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. Miki, W. Qu, E. H. Goulding, W. D. Willis, D. O. Bunch, L. F. Strader, S. D. Perreault, E. M. Eddy, and D. A. O'Brien
Glyceraldehyde 3-phosphate dehydrogenase-S, a sperm-specific glycolytic enzyme, is required for sperm motility and male fertility
PNAS, November 23, 2004; 101(47): 16501 - 16506.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
L. Coles, J. Litt, H. Hatta, and A. Bonen
Exercise rapidly increases expression of the monocarboxylate transporters MCT1 and MCT4 in rat muscle
J. Physiol., November 15, 2004; 561(1): 253 - 261.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. Gopal, Y.-J. Fei, M. Sugawara, S. Miyauchi, L. Zhuang, P. Martin, S. B. Smith, P. D. Prasad, and V. Ganapathy
Expression of slc5a8 in Kidney and Its Role in Na+-coupled Transport of Lactate
J. Biol. Chem., October 22, 2004; 279(43): 44522 - 44532.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
C. E. Butz, G. B. McClelland, and G. A. Brooks
MCT1 confirmed in rat striated muscle mitochondria
J Appl Physiol, September 1, 2004; 97(3): 1059 - 1066.
[Abstract] [Full Text] [PDF]


Home page
J. Appl. Physiol.Home page
Y. Yoshida, H. Hatta, M. Kato, T. Enoki, H. Kato, and A. Bonen
Relationship between skeletal muscle MCT1 and accumulated exercise during voluntary wheel running
J Appl Physiol, August 1, 2004; 97(2): 527 - 534.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
L. B. Gladden
Lactate metabolism: a new paradigm for the third millennium
J. Physiol., July 1, 2004; 558(1): 5 - 30.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
Y. Wang, M. Tonouchi, D. Miskovic, H. Hatta, and A. Bonen
T3 increases lactate transport and the expression of MCT4, but not MCT1, in rat skeletal muscle
Am J Physiol Endocrinol Metab, September 1, 2003; 285(3): E622 - E628.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
F. Muller, K. Huber, H. Pfannkuche, J. R. Aschenbach, G. Breves, and G. Gabel
Transport of ketone bodies and lactate in the sheep ruminal epithelium by monocarboxylate transporter 1
Am J Physiol Gastrointest Liver Physiol, November 1, 2002; 283(5): G1139 - G1146.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Gastrointest. Liver Physiol.Home page
A. J. Schwab, L. Tao, T. Yoshimura, A. Simard, F. Barker, and K. S. Pang
Hepatic uptake and metabolism of benzoate: a multiple indicator dilution, perfused rat liver study
Am J Physiol Gastrointest Liver Physiol, June 1, 2001; 280(6): G1124 - G1136.
[Abstract] [Full Text] [PDF]


Home page
DiabetesHome page
C. Zhao, M. C. Wilson, F. Schuit, A. P. Halestrap, and G. A. Rutter
Expression and Distribution of Lactate/Monocarboxylate Transporter Isoforms in Pancreatic Islets and the Exocrine Pancreas
Diabetes, February 1, 2001; 50(2): 361 - 366.
[Abstract] [Full Text]


Home page
Am. J. Physiol. Endocrinol. Metab.Home page
A. Bonen, M. Tonouchi, D. Miskovic, C. Heddle, J. J. Heikkila, and A. P. Halestrap
Isoform-specific regulation of the lactate transporters MCT1 and MCT4 by contractile activity
Am J Physiol Endocrinol Metab, November 1, 2000; 279(5): E1131 - E1138.
[Abstract] [Full Text] [PDF]