|
|
|
|||||||
|
|||||||||
(Received for publication, April 7,
1995; and in revised form, July 12, 1995) From the
The mechanisms underlying transcriptional activation are not
very well understood, and knowledge is based on experiments with a
small number of mostly viral activators. We have investigated the
mechanism underlying transactivation by the activation domain present
in the N-terminal part of retinoic acid receptor (RAR)
Transcription of RNA polymerase II promoters requires an
assembly of the preinitiation complex consisting of basal transcription
factors. This process begins with the binding of TFIID to the TATA box,
followed by ordered binding of the other transcription factors (TFIIA,
-B, -E, -F, -H) and RNA polymerase forming the initiation
complex(1, 2) . Transcription factors bound to
promoter or enhancer sequences modulate the activity of polymerase II
promoters. Transcription factors contain a DNA-binding domain (DBD) ( The mechanism
by which these activators exert their effect is currently a point of
discussion. The removal of repressors interacting with a component of
TFIID by activators was proposed(9) . Furthermore, it has been
suggested that activators can facilitate steps in the formation of the
preinitiation complex by interacting with a component of this complex
(10 and references therein). Thereby, the assembly of the preinitiation
complex could be enhanced, and/or the number of active transcription
complexes could be increased(11, 12) . Also, the
formation of an open complex following the formation of the initiation
complex may be a target for an activator. Based on these models,
activators may modulate transcription in several ways, whereby
generally an interaction with one or more components of the basal
transcription machinery seems to be necessary. Several activators have
been shown to interact with TATA-binding
protein(13, 14, 15) , TFIIB (16, 17, 18) , or TATA-binding
protein-associated factors(19, 20) . In some cases,
point mutants with reduced activity show also reduced in vitro binding(14, 21, 22) . Occasionally,
however, a bridging factor/cofactor is needed for activation, possibly
indirectly connecting the activator with a component of the
preinitiation complex (9) . The observation that the AFs of the
estrogen receptor (ER) function in a cell-specific way, and the
observed promoter specificity of the AFs of ER (23) has led to
the hypothesis that cofactors are required for the activity of the
activators. The requirement for cofactors both in vitro and in vivo has recently been confirmed(24, 25) .
A different requirement for transcriptional activation may be
phosphorylation. The activity of several transcription factors, e.g. CREB and c-jun have been shown to be
up-regulated by phosphorylation (for review, see (26) ). Also,
steroid hormone receptors are phosphorylated in
vivo(27) . RARs belong to the steroid/thyroid hormone
receptor superfamily which share a common domain structure, denoted
A-F(28, 29) . The C region contains the DNA-binding
domain which is most conserved among the different members of this
family and consists of two zinc fingers. The hormone-binding domain is
located in the E region and contains, besides the binding domain, a
dimerization domain and a hormone-dependent transactivation function
(AF-2). The N-terminal part of the receptor (AB) also contains an
autonomous region involved in transactivation (AF-1) which functions
independently of ligand, when coupled to a heterologous DNA-binding
domain(28, 29) . We and others have previously
reported the presence of two autonomous transcriptional activation
functions in RAR Since no activation function present in the
AB region of a member of this superfamily has been analyzed in detail
so far, we decided to characterize AF-1 of RAR
Figure 1:
Transcriptional activation of the
CRBPII promoter by various mutant RAR
To test whether
phosphorylation is involved in the activity of AF-1, we changed the
tyrosine, threonine, and all serine residues present in this region to
alanine and tested the ability of these mutants to activate
transcription, when coupled to GAL-DBD. Fig. 2shows the
quantification of CAT assays of COS cells transfected with these
mutants. It is clear from these results that all mutants are still
active; only the mutation of serines 22, 24, and 25 to alanine showed a
35% reduction in activity. These transfection data indicated that the
putative phosphorylation sites are not absolutely required for AF-1
activity, but that they can, however, influence the activity. A
decrease in the in vivo phosphorylation levels might be
expected upon mutation of the putative phosphorylation sites.
Therefore, in vivo phosphorylation experiments using the
indicated mutants in the HA-RAR
Figure 2:
The activity of AF-1 is modulated by
putative phosphorylation sites. COS cells were transfected with various
RAR
Figure 4:
Transcriptional activation by the various
mutant activators/receptors. On the left, a diagram of the
various point mutants is depicted. Transfections using these mutants
were performed with either GAL-RAR(1-76) fusion constructs with 5
Figure 3:
Negatively charged amino acids are
important for AF-1 activity. Representative CAT assay of a transfection
in COS cells of the indicated point mutants (schematically depicted in Fig. 4) in GAL-RAR
Next we
asked whether negative charge per se is needed or whether the
presence of these specific negatively charged amino acids is required.
Mutation of Asp-3, -6 to glutamic acid, which has been shown previously
to be a poor substitute for aspartic acid in case of VP16(5) ,
resulted in a decrease almost as strong as the corresponding Ala
mutant. We then attempted to create a stronger activator by introducing
extra negative charge. Changing LDF (16, 17, 18) to aspartic acid residues (DDD)
did not result in a receptor with higher activity, but instead a small
decrease was observed. Above we have shown that replacement of
S22A,S24A,S25A resulted in a decrease in activity (Fig. 2). Upon
changing the serine residues of this putative phosphorylation site to
aspartic acid, a stronger activator was created (Fig. 3),
showing the importance of negative charge for activation and suggesting
that phosphorylation can, by introducing extra negative charge,
modulate the activity of this activator.
Transfection of these mutants in P19 EC cells gave
similar results, confirming that the negatively charged residues are
most important for activation (data not shown). To confirm that the
previous results are not caused by differential stability or
accumulation of the various proteins, we performed Western blots using
both the GAL-RAR Next we examined whether the critical amino acids of AF-1,
when present in the fusion constructs, are also the most important
residues for AF-1 activity in the full-length receptor. We therefore
compared the activity of each mutant AF-1 by transfecting them as
GAL-fusion constructs as well as within the normal receptor context on
the CRBPII promoter and on the hRAR
Figure 6:
Homology comparison of RAR
Figure 5:
Overexpression of AF-1 can repress the
activity of acidic activators. A, transfection of 200 ng of
GAL-DBD fused activator AF-1 (1-76), VP16 (414-491), or
RelA (43) together with the indicated amounts (µg) of
cytomegalovirus-driven HA-RAR
Comparison of
several domains which have been shown to belong to the class of acidic
activators (VP16(5) , RelA,(42, 43) ,
Rta2(44) ) revealed a striking similarity as depicted in Fig. 6. The positions of hydrophobic ( In this paper, we show that the autonomous activation
function (AF-1) present at the N terminus of RAR The
relatively high activity of VP16 and TA
Figure 7:
Projection of AF-1 and VP16 in a helical
wheel model. The regions of RAR
Recently,
the activation function present in the C-terminal part of the
hormone-binding domain (AF-2) of members of the steroid/thyroid hormone
receptor superfamily has been
characterized(60, 61, 62, 63, 64) ,
shown to depend also on the presence of hydrophobic and negatively
charged residues, and was proposed to form an
Volume 270,
Number 40,
Issue of October 06, pp. 23552-23559, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
2 Is an Acidic Activator
Resembling VP16 (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
2 (AF-1).
We show that RAR2 phosphorylation is not crucial for its activity
although it may modulate AF-1 activity. Sequential mutation of the
negatively charged residues (Asp) resulted in a stepwise decrease in
activity, while mutation of all aspartic acid residues resulted in
complete loss of activity. Comparison of the critical region for
activation with other activators revealed moderate homology with the
viral activator VP16. The hydrophobic amino acids surrounding the
negatively charged residues reported to be critical for activation by
VP16 are all conserved in AF-1. The hydrophobic residues are required
for AF-1, since mutation of these residues resulted in a decrease in
activity. Furthermore, the activity of this activator, VP16 and
TA
of RelA, is squelched by overexpression of an
AF-1-containing expression construct, indicating that AF-1 is an acidic
activator. Squelching experiments further indicate that AF-1 and AF-2
function by different mechanisms. Comparison of activation functions
present in the AB region of other members of the steroid/thyroid
hormone receptor family: RAR
2, RAR2, and GR suggested that
also these receptors contain an acidic activation domain. The mechanism
underlying activation by AF-1 is discussed.
)and an activation function (AF), each of which are
interchangeable units, and generally are functioning independently when
coupled to a heterologous AF or DBD(3) . Activation
functions/activators are regions of 30-100 amino acids in length
and can be classified by their sequence similarity or the presence of
predominant amino acids: acidic, glutamine-, or
proline-rich(4) . Presently, little is known about the exact
role of the predominant amino acids (Asp/Glu, Gln, or Pro) in
activators, and it is unclear whether secondary structure is required
for activation. Mutational analysis of acidic activators has shown that
negative charge per se is not sufficient for activation as
mutation of negative to neutral or even positive amino acids does not
or only marginally interferes with activation capacity(5) . An
amphipathic -helix, with negatively charged residues on one
surface and hydrophobic residues on the other, could be a requirement
for activation(6) . However, some mutations destroying the
putative -helix also remain active(5) . Based on
mutational analysis, the GAL4 activator was proposed to form an
antiparallel -sheet structure (7) . Using circular
dichroism, the presence of this structure (under slightly acid
conditions) was confirmed(8) . Structural analysis using NMR
has not provided any evidence for the presence of stable secondary
structure elements in any activator analyzed so far. which activate transcription both by different,
cell-type and promoter-dependent mechanisms(30, 31) .
The activation function present in the N-terminal part of the protein
(AF-1, formerly called TAF-1), is located in the first 32 amino acids
of the receptor, and functions both in the presence and absence of RA.
This region is negatively charged and contains putative phosphorylation
sites, but no obvious homology with known activators was
observed(30) .2 in more detail.
Here we show that AF-1 is an acidic activator, three aspartic acids
present in this region are required for its activity, and the
hydrophobic residues contribute to activity. Sequence comparison
revealed that this activation function has homology with the acidic
transactivation domain of VP16.
Plasmids
By site-directed mutagenesis (Altered
Sites Kit, Promega), we introduced a SmaI site in front of the
ATG of RAR2 in the same reading frame as the SmaI site of
pGEX 2T and pSG424 (GST and GAL-DBD, respectively, sequence:
GCAGACATTCAGTGCCCGGGGATCATGTTTGAC). All mutants were made by
polymerase chain reaction or using site-directed mutagenesis and cloned
to GAL-RAR-CF, containing the first 76 amino acids of RAR2
fused to the DBD of GAL4(1-147) (30) and pSG5-RAR
using the SmaI and XhoI sites. RAR 
A was
constructed by polymerase chain reaction using a primer (sequence:
tcccccGGGATCAATTGAAACACAGAGCA) containing a SmaI site
in front of the first amino acid of the B-region in the same reading
frame as the SmaI site of HA-tag RAR (an expression
vector containing the hemagglutinin-tag and a SmaI site in
front of the ATG of RAR) and primer Drev (GTGCATTCTTGCTTCGAAGT);
this Sma-Xho-digested polymerase chain reaction
product was cloned in the corresponding sites of HA-tag RAR.
Digestion of this plasmid with SmaI and XhoI, Klenow
treatment, and ligation resulted in RAR AB. RAR
1-27 was made by cloning the HinfI
(blunt)-XhoI fragment in SmaI-XhoI-digested
pSG5 RAR, starting at amino acid 27, the first ATG. HA-tag RAR
E was made by cloning the XhoI-Xba fragment from RAR
E (30) in the corresponding HA-tag RAR sites. Cloning
the KpnI-BamHI fragment from RAR E in the
corresponding sites of the AB construct resulted in
HA-tag-RAR AB,E. To generate GST-RAR 1-76, the SmaI-XhoI fragment of pSG5-RAR2 was ligated
after Klenow treatment in the SmaI site of pGEX-2T and
transformed to Escherichia coli Jm101. All constructs were
sequenced to check mutations and reading frames: expression was
confirmed by Western blot using a polyclonal antibody against the F
region of RAR or an anti-GAL antibody.Transfection and CAT Assay
Transfections were
carried out by calcium phosphate co-precipitation as reported
before(30) . 8 µg of reporter 5 
GAL-CAT (5 GAL
binding sites in front of an E1b TATA box-CAT(32) ),
mCRBPII-CAT or hRAR2-CAT (-63/+156; 33), 1 µg of
expression vector (GAL-RAR fusion constructs pSG424 or pSG5-RAR
and pSG5-RXR) together with 1.5 µg of SV2-LacZ as reference
plasmid. For preparation of whole cell extract, 10 µg of expression
construct was transfected. After removal of the precipitate, 1.0
µM RA was added when indicated, and, after a subsequent 24
h, cells were harvested. CAT assay was performed as described; for
quantification a PhosphorImager (Molecular Dynamics) was employed, and
percentage conversion was normalized for transfection efficiency using
the -galactosidase assay(30) . Transfection was performed
using at least two different batches of expression vector DNA, and data
are presented as the mean (relative activity or CAT activity) of at
least five independent or three duplicate experiments with the S.E.
between the different experiments generally less than 15%.Western Blotting
Whole cell extract from
transiently transfected COS cells was prepared by three subsequent
freeze/thaw cycles (-80 °C/4 °C) in 50-100 µl
of lysis buffer (20 mM Tris, pH 7.5, 20% (v/v) glycerol, and
400 mM KCl) together with 0.2 mM phenylmethylsulfonyl
fluoride and protease inhibitors (aprotinin, leupeptin, pepstatin, and
chymostatin, final concentration 1.0 µg/ml of each). Equivalent
amounts of extract were loaded and separated on 8-12.5% (w/v)
SDS-polyacrylamide gel electrophoresis and transferred to
nitrocellulose using a semi-dry blot apparatus. Membranes were blocked
in 4% (w/v) nonfat dry milk in PBST (150 mM NaCl, 16
mM Na
HPO
, 4 mM
NaHPO, and 1% (v/v) Tween 20) for 1 h. Blots
were incubated using either a monoclonal against GAL-DBD (1:750) or a
polyclonal against the F region of RAR
(RP(F)112(34) ) (1:750) in PBST containing 2% (w/v) nonfat
dry milk for 2 h. After 7 washes in PBST, blots were incubated with
peroxidase-conjugated second antibodies in PBST containing 2% (w/v)
nonfat dry milk. After 7 washes with PBST, blots were developed using
the ECL kit (Amersham).In Vivo Labeling and Immunoprecipitation
Cells
were transfected as described, and 24 h post-transfection medium was
changed for phosphate-free DF medium containing 7.5% (v/v) dialyzed
serum, and cells were labeled with 1 mCi of
[P]orthophosphate/ml (ICN), for 4 h. 1.0
µM RA was added together with
[
P]orthophosphate (4 h). Cells were washed with
cold PBS0 (150 mM NaCl, 16 mM Na
HPO, and 4 mM NaHPO), scraped in PBS0, and lysed in 40
µl of lysis buffer (see Western blotting). After centrifugation,
the cell lysate was precleared in 750 µl of IP buffer (50 mM Tris, pH 7.5, 100 mM NaCl, 5 mM EDTA, 1% (v/v)
Triton X-100) containing 0.2 mM phenylmethylsulfonyl fluoride
and protease inhibitors using 1 µl of normal mouse serum and 50
µl of 50% (v/v) slurry protein A-Sepharose in IP buffer. 50 mM NaF, 40 mM -glycerophosphate, and 0.2 mM NaVO were added to both lysis and IP buffer. The
lysates were then incubated for 2 h with 50 µl of 12CA5 hybridoma
supernatant; thereafter, 50 µl of 50% (v/v) slurry protein
A-Sepharose in IP buffer was added and incubated for another hour.
Beads were washed 3 times with 1 ml of IP buffer, once with 100 mM Tris-HCl, pH 7.5, 0.5 M LiCl (1 ml), and once with 10
mM Tris-HCl, pH 7.5 (1 ml). Immunocomplexes were eluted by
incubation at 100 °C for 5 min in sample buffer and run on a
10-12.5% (w/v) SDS-PAGE gel.
The First 32 Amino Acids of RAR
We have previously shown that, when
coupled to the DNA-binding domain (DBD) of GAL4, the first 32 amino
acids are required and sufficient for transactivation(30) .
RAR2 Are Required and
Sufficient for AF-1 Activity lacking the AB region showed decreased transactivation
capacity, which is dependent on the promoter
used(30, 35) . Results obtained with GAL-fusion
constructs are sometimes different from results with the same
activation function in its normal protein context. To determine whether
the first 32 amino acids are also sufficient for AF-1 activity in the
receptor context,we made several RAR deletion constructs, as shown
in Fig. 1A. All mutants were translated properly and
accumulated to similar levels as judged by Western blot of extracts of
COS cells transfected with these mutants; only the expression of
1-27 is slightly lower, because it lacks a consensus Kozak
sequence (Fig. 1B). These mutant receptors were
transfected in COS-1 cells together with the CRBPII promoter coupled to
the CAT gene. This promoter has been shown to be activated only by AF-1
and not by AF-2 of RAR2(35) . Fig. 1B shows a quantification of these transfections; no activity was
observed in the absence of RA, and activity was dependent on
cotransfection of RARs. Constructs lacking the A or AB region no longer
activated the CRBPII promoter as has been reported before(35) .
The mutant receptors 1-27 and 11-22, which were
no longer active when fused to GAL-DBD, were also unable to activate
transcription of the CRBPII promoter. The receptor containing only the
first 32 residues (33-76), however, was still able to
activate this promoter albeit to a lesser extent than the full-length
receptor. From these data we conclude that the first 32 amino acids of
RAR2 are required and probably sufficient for the activity of
AF-1, both when present in the normal receptor context and when fused
to a heterologous DBD.
receptors. A,
schematic representation of the different RAR2 deletion
constructs. B, activation of transcription from CRBPII-CAT by
the indicated receptors in the presence or absence of 1.0 µM retinoic acid (RA) in COS cells, depicted as the mean CAT
activity (±S.E.) of four independent experiments. All receptors
are expressed at similar levels in COS cells as judged by Western blot
using an antibody against the F region of RAR2 (lower
panel).
Phosphorylation Is Not Required for Transactivation by
AF-1
The observation that RARs are phosphorylated in vivo(34, 36, 37) and recent observations by
us ()and others (38) that the activity of RARs can
be up-regulated by protein kinase A, indicated that phosphorylation may
be important for the activity of AF-1. E constructs (containing a
hemagglutinin tag in front of the AB region in the RAR expression
construct lacking the hormone-binding domain) were performed. No
obvious differences in phosphorylation levels for the various mutants
were observed (data not shown). Since we were not able to map the
phosphorylation sites within this region, it is possible that the
absence of phosphorylation is not the cause of this decrease but rather
the introduction of Ala instead of Ser residues. An alternative
explanation could be that the kinase responsible for this
phosphorylation event is induced upon RA treatment, and a 4-h RA
treatment in the in vivo phosphorylation experiment is too
short to see the differences in phosphorylation levels between wild
type and mutants. From these data we conclude that phosphorylation is
not crucial for AF-1 activity, although it may modulate the activity of
this activator.
2 (1-76) point mutants (schematically depicted in Fig. 4) coupled to GAL-DBD, together with the reporter 5
GAL-CAT (32) in the presence of 1.0 µM RA. CAT
activity was determined and is presented as the mean CAT activity
(±S.E.) of five independent
experiments
GAL-CAT as reporter in COS cells or with RAR expression
constructs containing the indicated mutation, with CRBPII-CAT as
reporter in COS cells or with hRAR-CAT (-63/+156) in
RAC65 cells, in the presence of 1.0 µM RA. On the right, results are presented as the mean of four to six
independent or three duplicate experiments with a S.E. between various
experiments smaller than 20%. Activity was calculated relative to wild
type (WT) activator/receptor; - represents the residual
activity in the absence of co-transfected activator or receptor; nd, not determined.
Negatively Charged Amino Acids Are Responsible for AF-1
Activity
We have observed that RAR AF-1 when fused to
GAL-DBD is capable of activating transcription synergistically upon
multimerization of GAL binding sites, (
)as has been reported
similarly for VP-16(39) . Therefore, it can be hypothesized
that these activators function by similar mechanisms. Experiments with
VP16 have indicated that negatively charged amino acids are involved in
and are required for the activity of VP-16. Moreover, the hydrophobic
residues surrounding the Asp/Glu residues are required for its
activity(5) . Analysis of the minimal autonomous activation
region of AF-1 (amino acids 1-32) indicated that this region is
overall negatively charged, implying that negatively charged residues
could be involved in the activity of AF-1. To test this hypothesis, we
first mutated all negatively charged amino acids individually to
noncharged residues (Ala) and transfected these GAL-DBD coupled mutants
together with a GAL-responsive reporter in COS cells. We observed a
considerable decrease in CAT activity of the mutant activator when
compared to wild type, as shown in Fig. 3. Also, the conversion
of Asp-17 to threonine resulted in a similar decrease in activity,
showing that not only an aspartic acid to alanine substitution is
destructive (data not shown). Subsequently, multiple aspartic acid
residues were changed simultaneously to alanines causing a further
decrease in activity, and, upon alteration of all aspartic acid
residues, nearly all activity was lost (Fig. 3).
(1-76) together with 5
GAL-CAT as reporter in the presence of 1.0 µM
RA.
Hydrophobic Residues Contribute to AF-1
Activity
We then tested whether hydrophobic amino acids, like in
VP16, are also required for activation. Mutation of F2P and M5P
resulted in a significant decrease (38 and 35%, respectively), while
alteration of the hydrophobic Val to Ala caused a larger (62%)
reduction in activity (Fig. 4). The decrease in activity by
mutation of hydrophobic residues is not as strong as reported for the
F442P mutant of VP16(40) . These data indicate that, although
the mutation of aspartic acid residues caused a stronger decrease in
activity, the hydrophobic residues substantially contribute to the
activity of AF-1. AF-1 fusion constructs and mutant receptors,
containing the same mutations in the RAR expression construct. All
proteins migrated according to their expected molecular weight, and the
variations in expression levels were not more than 2-fold (data not
shown). promoter. By comparing the
transactivation capacity of all mutants (Fig. 4) with the wild
type RAR on these promoters, we observed that the amino acids
found to be critical in the GAL AF-1 fusion protein were also important
for AF-1 activity when present in RAR. As expected, the activity
of the CRBPII promoter was most dramatically decreased by mutations
that change the negatively charged amino acids to neutral residues.
Mutations that did not give a phenotype as GAL-fusion construct also
caused no significant or only a weak decrease in activity as compared
to the wild type receptor. The only exception was the S22D,S24D,S25D
mutant which was impaired in activity on the CRBPII promoter while it
was a stronger activator as GAL-fusion protein. This is possibly caused
by disruption of the structure of the receptor which could be permitted
in the GAL-fusion protein but not in the complete receptor. The
aspartic acid residues of AF-1 were also important for activation of
the RAR promoter. These results are unexpected as Nagpal et
al.(35) have shown that the A region of RAR does not
contribute to RAR promoter activation whereas we observed that
every mutant in which parts of AF-1 are deleted or mutated caused a
decrease in RAR-dependent RAR promoter activation, comparable
with the mutant RAR lacking the complete AB region ( Fig. 1and Fig. 4; data not shown). We, however, used
RAC65 cells in these experiments, whereas Nagpal et al.(35) used COS cells, probably explaining the differences
in the role of AF-1 in RAR2 promoter activation. This was
confirmed by transfection of these mutant receptors in COS cells with
both the RAR promoter and with RARE-tk-CAT as a reporter
showing that all mutants activate these promoters to a similar extent
(data not shown). Furthermore, we cannot exclude that regions within
the B region contribute to the activity of AF-1 although no indications
for the presence of an autonomous AF within this region were
found(30) . From these data we conclude that for activation by
AF-1 the negatively charged amino acids are required, both as an
autonomous AF and also when present in the full-length receptor.AF-1 Is an Acidic Activator
The importance of
aspartic acid and the requirement of hydrophobic amino acids
surrounding these negatively charged residues lead to the hypothesis
that AF-1 is an acidic activator. We therefore compared AF-1 with known
acidic activation domains and observed a moderate homology with
conservation of hydrophobic and negative residues (see Fig. 6).
We therefore investigated whether these activators are functioning
similarly by performing squelching experiments, whereby, as a
consequence of overexpression of one activator, common limiting
targets, also required for the other activator, are titrated
away(41) . Increasing amounts of AF-1 containing and AF-2
lacking cytomegalovirus or SV40 driven RAR construct (HA-RAR
E) were transfected together with the GAL-DBD-coupled activators
AF-1, VP16, and RelA TA, RAR AF-2, and GR AF-2 with
the GAL-responsive promoter(32) . As expected, the activity of
the hormone-dependent activators (in the presence of their ligands) of
RAR and GR was not repressed by RAR E, whereas the
activity of the first three activators was repressed when a 25-fold
excess of squelcher was present (Fig. 5A). GAL AF-1 was
most dramatically repressed by overexpression of this receptor. At
lower concentrations of squelcher, the repression of VP16 and TA was significantly less than that of GAL AF-1. This can be
explained by the fact that these activators both consist of two
autonomous activation functions (40, 42, 43) , and, therefore, probably a
higher level of squelcher is required for maximal repression. The
specificity of this squelching by AF-1 was confirmed by performing
similar experiments, with a RAR construct lacking AF-1 and AF-2
(HA-RAR AB,E) which did not cause a decrease in activity of
these activators in the presence of this construct at 2.5- or 10-fold
excess; only at the highest concentration (25-fold), a 30% reduction
was observed possibly caused by (artificial) activation domains still
present in this construct (data not shown). These data indicate that
AF-1 and AF-2 function by different mechanisms. To confirm this, we
performed squelching experiments with GAL AF-1, GAL AF-2, and GAL GR
AF-2, in the presence or absence of a 20-fold excess of RAR
constructs containing both or only one of the two activation functions.
The activity of all activators was repressed by cotransfection of
full-length RAR, while the activity of AF-2 of both RAR and
GR was only repressed by an E region (AF-2)-containing RAR
expression construct, whereas the activity of GAL AF-1 was only
significantly repressed by squelchers that contain the AB region. These
data therefore indicate that AF-1, VP16, and RelA activate
transcription through the same or overlapping targets and consequently
belong to the same class of activators, whereas AF-2 of both RAR
and GR belong to a different class of activators.
with other
activators showing both amino acid and structural homology with VP16
and other (acidic) activators. Sequence alignment of various activators
showing that homology is observed with AF-1 of RAR when RAR
AF-1 is aligned around the hydrophobic residues of VP16 (5) and
other activators. The hydrophobic residues () A, F, I, L, M, V,
and Y are boxed, the negatively charged residues(-) D
and E are shown in bold.
E or empty CMV4 (total of 5.0
µg) and a GAL-responsive reporter (5 µg) in COS cells, in the
presence of 1 µM RA and 0.1 µM dexamethasone
in case of GAL-DBD GR AF-2. Results are presented as relative activity
compared to the activity in the absence of HA-RAR E. B, 50 ng of the indicated GAL-DBD fused activators were
transfected together with 1.0 µg of the indicated SV40-driven
RAR expression constructs with a GAL-responsive reporter (5
µg) in COS cells in the presence of 1 µM RA and 0.1
µM dexamethasone in the case of GAL-DBD GR
AF-2.
) and negatively
charged(-) residues is mostly conserved, with hydrophobic
residues at positions 2, 5, 7, or 8 while generally at least two of the
residues between these hydrophobic amino acids are negatively charged.
This pattern was also found in RAR
2 and RAR2, suggesting that
these receptors also contain an autonomous activator at the N terminus
that belongs to the class of acidic activators. Also in the activation
domains of C/EBP, c-Fos, E1A, and GR, a sequence of hydrophobic
residues around the aspartic acid and/or glutamic acid residues was
found.
2, located between
amino acids 1 and 32, is an acidic activator. This is supported by a
number of observations. First, the activity of this activator is
dependent on the presence of three aspartic acid residues, and
hydrophobic residues are also required for activity. The behavior of
other mutant activators is in agreement with the working mechanism of
acidic activators as mutation of all nonhydrophobic/negatively charged
amino acids were permissive. Furthermore, squelching experiments
indicate that overexpression of an AF-1-containing construct interferes
with the activity of VP16 and the recently characterized acidic
activator TA of RelA. These activators all share the
ability to activate transcription synergistically upon multimerization
of binding sites(39, 42, 43) . Finally, we observed sequence similarity between this activator
and several other acidic activators, in which the position of critical
hydrophobic and negatively charged residues is conserved. of RelA compared
with AF-1 of RAR (at least 10 times less active) can be explained
by the presence of two or more regions involved in activation (40, 42, 43) and also by the presence of more
negatively charged amino acids in VP16 or RelA(43) . In the
case of RAR, there are also two regions which contribute to the
activity of AF-1 including the region around Asp-3 and Asp-6 and the
region around Asp-17. The first region is homologous with acidic
activators, whereas in the latter region the presence of only negative
and hydrophobic residues was observed. Although we do not know how the
latter region is contributing to activity, point mutants (D17A;
L16,F18D) as well as deletion constructs (11-22;
11-76(30) ) indicate that it does contribute to the
activity of this activator.Phosphorylation Modulates AF-1 Activity
Phosphorylation
experiments in COS cells transfected with various RAR deletion
constructs showed that multiple regions of RAR, including the AB
region, were phosphorylated (data not shown). Mutational analyses
suggest that phosphorylation might modulate the activity of this
autonomous activation function. The functional significance of the
putative phosphorylation sites in AF-1 was established by introducing
alanine residues for serine 22, 24, and 25 after which a decrease in
activity became apparent. On the contrary, upon changing these residues
to aspartic acid, an increase in activity was observed. Similar
findings have been reported for ER(45) ,
c-jun(46) , and p53 (47) . A possible
explanation is that phosphorylation introduces extra negative charge,
which can be mimicked by introducing negatively charged amino acids.
Recently, phosphorylation sites of the estrogen receptor (45, 48) have been mapped and found to be present also
within the transactivation domain of ER, and these sites have been
shown to contribute to the activity of the receptor. Although all
experiments performed so far are in agreement with the model that
phosphorylation modulates the activity of the activator, the specific
sites have not been mapped since the levels of phosphorylation and/or
expression of the transfected receptor were too low to perform tryptic
phosphomaps.Primary and Secondary Structure of AF-1
Deletion
analysis has revealed previously that the first 32 amino acids of
RAR2 are required and sufficient for AF-1 activity(30) .
Here we show that the negatively charged and hydrophobic residues are
important for the activity of this activator. Comparable findings have
been reported for GAL4(49, 50) , GCN4(51) ,
and VP16(5, 52) . It has been postulated that this
class of activators forms an amphipathic -helix with hydrophobic
residues on one side with negatively charged residues on the other side
of the helix(6) . Using the Chou and Fasman (53) prediction, an -helix could be formed over the first
9 residues, containing amino acids shown to be required for activation.
This lead to the question whether structure is required for
activation(54) . We therefore expressed the first 76 amino
acids of RAR in E. coli, purified the protein, and
performed CD and NMR analyses. Using one- and two-dimensional H nuclear magnetic resonance, no secondary structure could
be demonstrated, although the CD measurements indicated the presence of
low levels of secondary structure elements. ()Similar
results have been obtained using the activation domains of VP16 (55) and TA of RelA(43) . The absence of
secondary structure elements in activation domains is in agreement with
the idea of the presence of so-called acid blobs in acidic
activators(56) . During the preparation of this manuscript, the
presence (in hydrophobic solvent) and significance of an -helical
structure in the activation domain of GR was confirmed by CD and NMR
analyses(57) . This suggests that although in vitro (in aqueous solution) activators are largely
unstructured(43, 55, 57) ,in
vivo these proteins may adopt a helical structure. This latent
secondary structure could be stabilized by secondary modifications (e.g. phosphorylation) or by the presence of other highly
structured regions in the receptor (DNA- and hormone-binding domain).
Furthermore, it is also possible that structure is formed upon
interaction of the receptor with DNA or with component(s) of the basal
transcription machinery, as suggested by Sigler (56) and
Frankel and Kim(58) .Modeling AF-1 as
On the basis of the
assumption that the class of acidic activators indeed form an
-Helix-helix, we projected the first 8 amino acids of RAR2, the
minimal activation domain of VP16, and several other activators to a
helical wheel (58) (Fig. 7) whereby in almost all cases
the negative amino acids face one side of the helix and the hydrophobic
residues the other side of the helix. From mutational analyses of both
VP16 (5, 52) and Rta2 (EBV)(44) , the Phe at
position 5 in this helix is the most important and the residues close
to this amino acid are generally hydrophobic while the residues at the
other side of the helix (positions 3, 4, and 6) are negatively charged.
The importance of negative/hydrophobic residues at these positions was
confirmed by mutational analysis(52) . These authors observed
that 4 copies of the DDLDL or 2 copies of the DDFDLDL sequence is
sufficient for activation and projection of these minimal activation
units in a helical wheel confirms the presence of a hydrophobic and a
negatively charged side of the -helix in functional activators
(data not shown). Further detailed mutational analyses of individual
hydrophobic amino acids and combinations of these residues as well as
structural analyses are required to confirm this model.
and VP16 shown to be involved in
transactivation and predicted to form an -helix are projected
within a helical wheel model(59) . Numbers represent
the amino acid numbers of RAR AF-1. The smaller letters represent the activation domain of VP16 aligned as shown in Fig. 6; - and indicate that these positions, based
on the alignments of Fig. 6, are generally negatively charged or
hydrophobic, respectively.
-helix as
well(62) . The position of these residues is, however,
different in AF-1 (Dx
D
) as compared to AF-2
(
xE
). Furthermore, the presence of glutamic
acid cannot be altered to aspartic acid (AF-2: 61, 63) and vice versa
(AF-1: D3E,D6E) without a decrease in activity. Finally, squelching
experiments showed that the activity of AF-2 cannot be repressed by
overexpression of AF-1 and vice versa (Fig. 5B).
Together, these findings strongly suggest that these activators
function by different mechanisms, and each fulfill a different role in
the retinoid response. This is confirmed by the observation that AF-1
and AF-2 contribute differently to the activation of various
RA-dependent promoters(35) . The characterization of the two
activation functions present in these receptors will be helpful in
achieving a better understanding of the mechanism of action of these
receptors in vivo.
))))
We are grateful to Drs. P. Chambon and M.-P. Gaub for
providing CRBPII-CAT and antisera against GALDBD and RAR. We thank
Dr. P. A. Baeuerle for providing us with the GAL4-RelA-N and Dr.
M. Parker for GAL GR AF-2. Furthermore, we thank Drs. R. Boelens and B.
van der Burg for critical reading of the manuscript. We acknowledge
Drs. R. Knegtel and K. Hård for CD and NMR analysis and Dr. R.
Kaptein and Dr. S. W. de Laat for their continuous interest and
support. We thank Patricia Swanink, F. J. M. Vervoordeldonk, and J.
Heinen for excellent technical assistance.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  S. E. Wardell, S. C. Kwok, L. Sherman, R. S. Hodges, and D. P. Edwards Regulation of the Amino-Terminal Transcription Activation Domain of Progesterone Receptor by a Cofactor-Induced Protein Folding Mechanism Mol. Cell. Biol., October 15, 2005; 25(20): 8792 - 8808. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Kumar and E. B. Thompson Transactivation Functions of the N-Terminal Domains of Nuclear Hormone Receptors: Protein Folding and Coactivator Interactions Mol. Endocrinol., January 1, 2003; 17(1): 1 - 10. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Tung, T. Shen, M. G. Abel, R. L. Powell, G. S. Takimoto, C. A. Sartorius, and K. B. Horwitz Mapping the Unique Activation Function 3 in the Progesterone B-receptor Upstream Segment. TWO LXXLL MOTIFS AND A TRYPTOPHAN RESIDUE ARE REQUIRED FOR ACTIVITY J. Biol. Chem., October 19, 2001; 276(43): 39843 - 39851. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J Plassat, L Penna, P Chambon, and C Rochette-Egly The conserved amphipatic alpha-helical core motif of RARgamma and RARalpha activating domains is indispensable for RA-induced differentiation of F9 cells J. Cell Sci., January 8, 2000; 113(16): 2887 - 2895. [Abstract] [PDF]
|
|
|
|
|
|
R. Hi, S. Osada, N. Yumoto, and T. Osumi Characterization of the Amino-terminal Activation Domain of Peroxisome Proliferator-activated Receptor alpha . IMPORTANCE OF alpha -HELICAL STRUCTURE IN THE TRANSACTIVATING FUNCTION J. Biol. Chem., December 3, 1999; 274(49): 35152 - 35158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. A. Kester, C. Blanchetot, J. den Hertog, P. T. van der Saag, and B. van der Burg Transforming Growth Factor-beta -stimulated Clone-22 Is a Member of a Family of Leucine Zipper Proteins That Can Homo- and Heterodimerize and Has Transcriptional Repressor Activity J. Biol. Chem., September 24, 1999; 274(39): 27439 - 27447. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Karperien, H. Farih-Sips, J. A.A. Hendriks, B. Lanske, S. E. Papapoulos, A.-B. Abou-Samra, C. W.G.M. Löwik, and L. H.K. Defize Identification of a Retinoic Acid-Inducible Element in the Murine PTH/PTHrP (Parathyroid Hormone/Parathyroid Hormone-Related Peptide) Receptor Gene Mol. Endocrinol., July 1, 1999; 13(7): 1183 - 1196. [Abstract] [Full Text]
|
|
|
|
|
|
V. J. Green, E. Kokkotou, and J. A. A. Ladias Critical Structural Elements and Multitarget Protein Interactions of the Transcriptional Activator AF-1 of Hepatocyte Nuclear Factor 4 J. Biol. Chem., November 6, 1998; 273(45): 29950 - 29957. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Hadzopoulou-Cladaras, E. Kistanova, C. Evagelopoulou, S. Zeng, C. Cladaras, and J. A.A. Ladias Functional Domains of the Nuclear Receptor Hepatocyte Nuclear Factor 4 J. Biol. Chem., January 3, 1997; 272(1): 539 - 550. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |