JBC INTERFERin siRNA transfection reagent

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Rosmarin, A. G.
Right arrow Articles by Simkevich, C. P.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Rosmarin, A. G.
Right arrow Articles by Simkevich, C. P.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 40, Issue of October 06, pp. 23627-23633, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
GABP and PU.1 Compete for Binding, yet Cooperate to Increase CD18 ( Leukocyte Integrin) Transcription (*)

(Received for publication, June 15, 1995; and in revised form, July 14, 1995)

Alan G. Rosmarin (§) David G. Caprio David G. Kirsch (¶) Hiroshi Handa (1) Carl P. Simkevich

From the Brown University School of Medicine, Division of Hematology, The Miriam Hospital, Providence, Rhode Island 02906 and theFaculty of Bioscience and Biotechnology, Tokyo Institute of Technology, 4259 Nagatsuda, Midoriku, Yokohoma 2267 Japan

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

CD18 (beta(2) leukocyte integrin) is a leukocyte-specific adhesion molecule that plays a crucial role in immune and inflammatory responses. A 79-nucleotide fragment of the CD18 promoter is sufficient to direct myeloid transcription. The CD18 promoter is bound by the B lymphocyte- and myeloid-restricted ets factor, PU.1, and disruption of the PU.1-binding sites significantly reduces promoter activity. However, PU.1 alone cannot fully account for the leukocyte-specific and myeloid-inducible transcription of CD18. We identified a ubiquitously expressed nuclear protein complex of extremely low electrophoretic mobility that also binds to this region of the CD18 promoter. This binding complex is a heterotetramer composed of GABPalpha, an ets factor, and GABPbeta, a subunit with homology to Drosophila Notch. GABPalpha competes with the lineage restricted factor, PU.1, for the same critical CD18 ets sites. The CD18 promoter is activated in myeloid cells by transfection with both GABPalpha and GABPbeta together, but not by either factor alone. Transfection of non-hematopoietic cells with the two GABP subunits together with PU.1 is sufficient to activate CD18 transcription in otherwise non-permissive cells. Thus, GABP and PU.1 compete for the same binding sites but cooperate to activate CD18 transcription.


INTRODUCTION

Cellular differentiation is linked to tightly regulated gene expression, and most developmentally regulated genes are controlled at the transcriptional level(1) . In some tissues, e.g. erythroid cells(2) , cellular differentiation and gene expression are governed by lineage restricted transcription factors. However, many lineage-specific or developmentally controlled genes are regulated by transcription factors that are expressed in a broader range of cell types. In such cases, specific combinations of these more widely expressed factors, or their lineage restricted modification, may contribute to tissue-specific gene expression.

CD18 (beta(2) leukocyte integrin) is a cell surface molecule that plays a crucial role in cell-cell and cell-matrix interactions. It is expressed exclusively by lymphocytes and myeloid cells (monocytes and granulocytes). During myeloid differentiation, CD18 expression increases due to increased transcription(3, 4) . We and others have cloned the gene encoding CD18 and isolated its promoter(4, 5, 6, 7) . The CD18 promoter directs expression of a linked reporter gene when transfected into myeloid cells(4, 6) . A 79-nucleotide (nt) (^1)region of the CD18 promoter that is crucial for its myeloid expression contains three potential binding sites for ets transcription factors. We have shown that this region of the promoter is bound by PU.1, an ets-related transcription factor that is expressed by B lymphocytes and myeloid cells. Mutagenesis of these PU.1-binding sites in the CD18 promoter decreases promoter activity and commensurately decreases PU.1 binding (8) .

CD18 and PU.1 are co-expressed in some cell types, e.g. myeloid cells and B lymphocytes. However, other transcription factors must contribute to the regulated transcription of CD18. T lymphocytes express CD18 in the absence of PU.1 expression(9, 10, 11) , and transfection of PU.1 is not sufficient to activate the CD18 promoter in non-hematopoietic cells. CD18 expression increases 4-fold during myeloid differentiation while PU.1 binding activity is not appreciably altered(8, 12) . Thus, PU.1 alone does not fully account for the leukocyte-specific and myeloid-inducible expression of CD18.

We have found, using the electrophoretic mobility shift assay (EMSA), that multiple nuclear proteins bind to the crucial regulatory region of the CD18 promoter. We characterized these factors in order to better define the regulated transcription of CD18. The sequence GGAA, which is the core binding site for several members of the ets transcription factor family, is present at three locations in the CD18 -79-nt promoter. We identified a protein complex of extremely low electrophoretic mobility that binds to these crucial regulatory elements. This complex contains both GABPalpha, an ets-related factor, and GABPbeta, a subunit with homology to Drosophila Notch(13, 14) . GABPbeta alone does not bind to DNA, but together these proteins form a heterotetrameric complex on the CD18 promoter. GABPalpha competes with PU.1 for binding to regulatory elements in the CD18 promoter. Transfection into myeloid cells of GABPalpha and GABPbeta together, but of neither factor alone, activates the CD18 promoter. Transfection of both GABP subunits along with PU.1 into non-hematopoietic cells is sufficient to activate a CD18 reporter construct. Thus, two different ets-related transcription factors, the lineage restricted factor PU.1 and the ubiquitously expressed factor GABPalpha, compete for binding to crucial regulatory sites in the CD18 promoter, yet they functionally cooperate to activate CD18 transcription.


MATERIALS AND METHODS

Transfection

U937 (American Type Culture Collection (ATCC) catalog no. CRL 1593), Raji (ATCC no. CCL 86), and Jurkat (ATCC no. CRL 8163) cells were passaged twice weekly in RPMI 1640 (Life Technologies, Inc.) supplemented with 10% fetal calf serum (ICN, Costa Mesa, CA) in an atmosphere of 5% CO(2). HeLa cells were passaged twice weekly in Dulbecco's modified Eagle's medium (Life Technologies, Inc.)/10% fetal calf serum. About 5 times 10^6 cells were transfected in a Bio-Rad Gene Pulser at 960 microfarads, 300 V with 20 µg of CD18/luc constructs and 1 µg of cytomegalovirus promoter/human growth hormone construct (CMV/hGH). Where indicated, 5 µg of the human homologues of GABPalpha and GABPbeta1-1 (E4TF1-60 and E4TF1-53, respectively (14) in the expression vector pCAGGS(15) ) were co-transfected with 20 µg of CD18/luc constructs and pGEM3zf was added to bring the total amount of transfected DNA to 30 µg. Fourteen h after transfection, luciferase activity was assayed, and growth hormone was measured from 100 µl of supernatant. Promoter activity is expressed as normalized relative light units, by dividing luciferase activity by growth hormone, to account for transfection efficiency(8) . Transfection results represent the mean and S.E. from three separate experiments.

Preparation of Nuclear Extracts and Proteins

Nuclear extracts were prepared as described(8) . In vitro translated proteins were prepared with 1 µg of the following supercoiled cDNAs in the TNT Coupled Reticulocyte Lysate System (Promega Corporation, Madison, WI): PU.1 (a gift of Richard Maki, La Jolla Cancer Research Institute, La Jolla, CA); Elf-1 and Ets-1 (gifts of Jeff Leiden, University of Chicago); Fli-1 (a gift of Michael Klemsz, University of Indiana). GABPalpha and GABPbeta1-1(16) , purified by nickel chelate chromatography, were gifts of Tom Brown (Pfizer, Inc., Groton, CT). GST-PU.1 (a gift of Tony Kouzarides, Wellcome/CRC Institute, Cambridge, United Kingdom) and GST-GABPalpha (as E4TF1-60, the human homologue of GABPalpha) fusion proteins were expressed in Escherichia coli, isolated with glutathione-Sepharose, and quantitated by staining with known protein standards in SDS-polyacrylamide gel electrophoresis.

EMSA

EMSA probes are schematized in Fig. 2A. The GGAA ets sites in the EMSA probes presented below are underlined (note that the GGAA sequence at -72/-75 is encoded on the bottom strand). Probes that correspond to -85/-37 of the CD18 promoter (AACCCACCACTTCCTCCAAGGAGGAGCTGAGAGGAACAGGAAGTGTCAG and its complement) were annealed and 5` end-labeled with [-P]ATP (ICN) by Polynucleotide Kinase (New England Biolabs, Beverly MA). Probes that correspond to -89/-58 (GTGCAACCCACCACTTCCTCCAAGGAGGAGCT and its complement) and -59/-32 (CTGAGAGGAACAGGAAGTGTCAGGACTTC and its complement), and corresponding mutant versions that contain GG CC mutations in the underlined ets sites, include SalI and BamHI compatible sites at either end and were labeled with [alpha-P]dCTP by the Klenow fragment of DNA Polymerase I. Radiolabeled probe (0.1 ng) was incubated for 10 min on ice with 1 µl of unprogrammed reticulocyte lysate, 1 µl of in vitro translated or purified protein, or 10 µg of nuclear extract in a 15-µl reaction containing 10 mM Tris, pH 7.5,50 mM NaCl, 1 mM EDTA, 1 mM beta mercaptoethanol, 1% Ficoll and poly(dIbulletdC) (Pharmacia Biotech Inc.; 2.0 µg for nuclear extracts, 0.5 µg for proteins). Where indicated, a 100-fold molar excess of homologous DNA or irrelevant probe that lacks an ets-binding site (corresponding to CD18 -903/-883; GCGAAGCTTGCAGTGAGCTGAGATCACGGATCCGCG, and its complement) were used as unlabeled competitors. Where indicated, up to 10-fold greater amounts of competing GST fusion proteins were added to binding reactions. Products were electrophoresed at 180 V in a 5% acrylamide/bis (19:1) gel in 0.5 times TBE (1 times TBE is 90 mM Tris-base, 90 mM boric acid, 2 mM EDTA) prior to autoradiography. Because binding by GABP proteins is sensitive to the ionic content of the electrophoretic gel(12) , EMSA with purified GABP was performed in 0.25 times TBE, where indicated. For supershift experiments, reactions were preincubated for 10 min on ice with either 1 µl of preimmune rabbit serum or 1 µl of polyclonal rabbit antiserum raised against either GABPalpha or GABPbeta (gifts of Tom Brown).


Figure 2: ets factors bind to CD18 promoter. A, the sequence of the CD18 promoter between -89 and -30 is displayed. The three potential ets-binding sites and the orientation of the sequence GGAA are indicated by arrows. Note that the GGAA sequence at -72/-75 is encoded on the bottom strand. Double-stranded probes used for EMSA are indicated by brackets. B, a double-stranded oligonucleotide probe corresponding to -85/-37 of the CD18 promoter was radiolabeled with [P]ATP. EMSA was performed with 10,000 counts/min probe in 0.5 times TBE. Proteins used in the binding assay include unprogrammed reticulocyte lysate (RL), in vitro translated PU.1, Ets-1, Fli-1, Elf-1, purified, bacterially expressed GABPalpha and GABPbeta, or nuclear extracts from U937 (myeloid), Raji (B lymphocyte), HeLa (cervical carcinoma), and Jurkat (T lymphocyte) cell lines. Right arrow indicates the location of binding by PU.1 (lanes 3, 9, and 10), and the curved arrow indicates a binding species unique to Jurkat cells.



DNase I Footprinting

A probe corresponding to -148/+28 relative to the dominant start site of CD18 transcription, radiolabeled on the non-coding strand, was prepared by a modification of the polymerase chain reaction, as described(8) . One µl of purified GABPalpha protein was equilibrated in 10 mM Tris, pH 7.4, 40 mM KCl, 1 mM EDTA, 1% Ficoll, 1 mM beta-mercaptoethanol for 10 min at room temperature, incubated with 5,000 counts/min of probe for 30 min at room temperature, and digested with 1 µg/ml DNase I (Sigma) at room temperature for precisely 1 min, phenol extracted, and ethanol-precipitated. Identical samples, which lacked added protein, were treated similarly, except they were digested with 0.5 µg/ml DNase I at room temperature for 20 s. Half of the resultant products were electrophoresed in a 6% polyacrylamide, 7 M urea gel alongside the same probe subjected to chemical sequencing and autoradiography performed.


RESULTS

CD18 Minimal Promoter Directs Lineage Restricted Expression

A 79-nt fragment of the CD18 promoter is active after transient transfection into U937 myeloid cells. The B lymphocyte and myeloid-restricted ets transcription factor PU.1 binds to this region of the promoter, and mutagenesis of each PU.1 site reduces promoter activity and commensurately decreases PU.1 binding(8) . Because PU.1 alone cannot fully account for its lineage restricted expression, we sought to identify other factors that may control CD18 transcription. In order to localize its leukocyte-specific activity, we transfected a variety of cell types with constructs that contain either 918 or 79 nt of the CD18 promoter; cells were co-transfected with CMV/hGH as an internal control for transfection efficiency. Fig. 1indicates that both the 918- and 79-nt CD18 promoter fragments are active in myeloid cells (U937), B lymphocytes (Raji), and T lymphocytes (Jurkat). In Raji cells, the 79-nt construct is significantly less active than the full-length promoter, indicating the presence of an element between -918 and -79 that enhances CD18 activity in B lymphoid cells. Neither CD18 promoter construct is active following transfection into non-hematopoietic HeLa cells (cervical carcinoma). These studies indicate that the 79-nt CD18 minimal promoter encodes the cell type-specific expression of the endogenous gene.


Figure 1: CD18 promoter is active in leukocytes, but not in non-hematopoietic cells. CD18(-918/luc) or CD18(-79/luc) were co-transfected with CMV/hGH into U937 (myeloid), Jurkat (T lymphocyte), Raji (B lymphocyte), and HeLa (non-hematopoietic) cell lines. Luciferase activity is normalized to the CMV/hGH internal control and expressed as normalized relative light units (NRLU). Results represent the mean ± S.E. from three separate experiments.



Lineage-specific and Ubiquitously Expressed Factors Bind to the CD18 Promoter

We performed EMSA with a radiolabeled, double-stranded probe corresponding to -85/-37 of the CD18 promoter, which contains three potential ets-binding sites (see Fig. 2A; GGAA at -72/-75, -53/-50, and -47/-44). Using nuclear extracts from U937, Raji, HeLa, and Jurkat cells, we found that several different protein species bind to this region of the CD18 promoter. Consistent with its known pattern of expression, PU.1 binding activity was present only in extracts of myeloid cells and B lymphocytes (Fig. 2B, lanes 9 and 10, right arrow)(8) . An as yet unidentified T cell-specific band (lane 12, curved arrow) is observed with the Jurkat nuclear extract. All other binding species are present in all of the nuclear extracts tested (lanes 9-12).

Multiple ets-related Transcription Factors Bind to the CD18 Promoter

ets transcription factors bind to related sequences, typically containing a core of GGAA. Therefore, we sought to determine if other ets factors besides PU.1 bind to the CD18 promoter. We performed EMSA with the -85/-37 probe and in vitro translated PU.1, Ets-1, Fli-1, and Elf-1. In addition to PU.1 (Fig. 2B, lane 3), Elf-1 (lane 6), and Spi-B (not shown) bound avidly to -85/-37. However, neither Elf-1 nor Spi-B formed a complex that co-migrates with binding species from nuclear extracts (lanes 9-12). Neither Ets-1 (lane 4), Fli-1 (lane 5), nor Ets-2 (not shown) bound to the CD18 -85/-37 probe, although each of these in vitro translated transcription factors bound to appropriate positive control probes (data not shown). None of these factors co-migrated with the unidentified binding species from Jurkat nuclear extracts.

GABP Complexes Bind to the CD18 Promoter

We performed EMSA with the CD18 -85/-37 probe and GABPalpha, a ubiquitously expressed member of the ets family. Recombinant GABPalpha, purified from bacteria, forms two binding complexes with the CD18 promoter (Fig. 2B, lane 7). GABPbeta, which exhibits homology to Drosophila Notch and is not related to the ets transcription factors, interacts with GABPalpha via its ankyrin repeats(13, 17) . When purified GABPbeta is added to GABPalpha, three distinct complexes are generated. Each complex co-migrates with a binding species present in the myeloid, lymphoid, and non-hematopoietic nuclear extracts (compare lane 8 to lanes 9-12), suggesting that the ubiquitous CD18 binding species (lanes 9-12) is GABP.

The multimeric pattern of binding by GABPalpha and GABPbeta to the CD18 promoter resembles GABP binding to the HSV IE promoter and other genes that contain multiple ets sites. Gel filtration, sedimentation, and cross-linking studies were used to characterize the nature of each of these binding species on the HSV IE promoter(13) . We used UV cross-linking and mutagenesis of the GABP subunits to confirm the multimeric nature of the binding complexes on the adenovirus E4 promoter(17) . The two complexes formed on the CD18 promoter by GABPalpha correspond to monomeric and homodimeric forms of the protein (Fig. 3, lane 2, M and D). GABPbeta alone does not bind to CD18 (lane 3). However, GABPalpha and GABPbeta together can generate three distinct binding species. These correspond to the monomeric GABPalpha (lane 4, M), heterodimeric GABPalpha/GABPbeta (D, which co-migrates with homodimeric GABPalpha(2)), and heterotetrameric GABPalpha(2)/GABPbeta(2) (T) species demonstrated in previous studies(13, 17) .


Figure 3: GABPalpha and GABPbeta are present in the co-migrating nuclear binding species. EMSA was performed with radiolabeled CD18 -85/-37 probe and GABPalpha alone (lane 2), GABPbeta alone (lane 3), GABPalpha and GABPbeta together (lane 4), and U937 nuclear extract (lanes 5-8). Binding reactions were preincubated with antibody against GABPalpha (lane 6), antibody against GABPbeta (lane 7), or preimmune serum (lane 8). The locations of monomeric, dimeric, and tetrameric binding species are indicated by M, D, and T, respectively, and the open arrow indicates the location of the supershifted proteins.



GABPalpha and GABPbeta Are Present in Myeloid Nuclear Extracts

We used antibodies to confirm the identity of the nuclear proteins that co-migrate with purified GABPalpha and GABPbeta. Preimmune serum does not appreciably alter binding by myeloid nuclear proteins to CD18 -85/-37 (Fig. 3, lane 8). However, an antibody against GABPalpha abrogates the monomeric and dimeric species and sharply reduces the intensity of the tetrameric species (lane 6, M, D, and T, respectively). Binding by this antibody results in a supershift of these proteins, as indicated by the open arrow. Note that a binding species of slightly slower electrophoretic mobility than the dimeric species is unaffected by the GABPalpha antibody. Antibody against GABPbeta abrogates the dimeric and tetrameric species and results in a supershift of the binding complexes (lane 7, open arrow). These results demonstrate that myeloid nuclei contain CD18-binding proteins that are immunologically related to GABP.

Localization of GABP-binding Sites

We prepared additional EMSA probes to further localize the GABP-binding sites within the crucial region of the CD18 promoter. Because binding by GABP proteins is dependent on the ionic strength of the electrophoretic gel(13) , the following experiments with purified proteins were performed in 0.25 times TBE. The region from -89/-58 contains one potential ets-binding site (GGAA at -72/-75, labeled A in Fig. 2A). GABPalpha alone can form monomeric, but not dimeric binding species on this DNA fragment (Fig. 4A, lane 5, M). GABPalpha and GABPbeta, together, can form the monomeric and dimeric (lane 6, M and D), but not the tetrameric binding species.


Figure 4: Localization of GABP-binding sites and sensitivity of binding to mutations. The following EMSA studies were performed in 0.25 times TBE. A, EMSA was performed with purified GABPalpha and GABPbeta and the following radiolabeled probes: -85/-37 (lanes 1-3), -89/-58 (lanes 4-6), and -59/-31 (lanes 7-9). The locations of monomeric, dimeric, and tetrameric binding species are indicated by M, D, and T, respectively. B, EMSA was performed with purified GABPalpha and GABPbeta and the following radiolabeled probes: wild type (wt) -89/-58 probe (lanes 1-3), -89/-58 probe containing GGAA CCAA mutation (mut) in the ets site (lanes 4-6), wild type -59/-31 probe (lanes 7-9), and -59/-31 probe with GGAA CCAA mutations in both of the ets sites (lanes 10-12).



The probe corresponding to -59/-31 of the CD18 promoter contains two potential ets sites (at -53/-50 and -47/-44, labeled B and C in Fig. 2A). GABPalpha alone forms predominantly a monomeric species (lane 8, M), with a small amount of homodimer (more apparent in Fig. 4B, lane 8). However, GABPalpha and GABPbeta together generate all three species that form on the larger -85/-37 probe (compare lane 9 to lane 3). Thus, each of the three potential ets sites supports GABPalpha binding and can contribute to formation of tetrameric GABP binding on the CD18 promoter.

GABP Binding Is Sequence-dependent

We prepared EMSA probes with mutations in each of the ets-binding sites to determine if GABP binding is dependent on the integrity of the conserved ets sites. Mutagenesis of the ets site in the -89/-58 probe (GGAA CCAA at -73/-72 in site A) abrogates all GABP binding (Fig. 4B, compare lanes 5 and 6 to lanes 2 and 3). Similarly, mutagenesis of the two ets sites in the -59/-31 probe (GGAA CCAA at -53/-52 in site B and -47/-46 in site C) abrogates GABP binding (compare lanes 11 and 12 to lanes 8 and 9). Thus, GABP binding depends on integrity of the ets sites.

DNase I Footprinting

We performed DNase I footprinting in order to further define the binding sites of GABP. A probe which corresponds to -148/+28 relative to the start site of CD18 transcription was prepared by polymerase chain reaction and labeled on the antisense strand. Purified GABPalpha protects three regions of the CD18 promoter from DNase I digestion (Fig. 5, vertical bars; compare lanes N (naked DNA) to lane alpha (GABPalpha)). The protected regions encompass the three ets-binding sites, labeled A-C in Fig. 2A, and they correspond to the footprints that we have previously demonstrated with U937 nuclear extract. The asterisk indicates a DNase I-hypersensitive site that is also seen with myeloid nuclear extracts(8) . The addition of GABPbeta to GABPalpha has little effect on the footprints (data not shown).


Figure 5: DNase I footprinting with GABPalpha. A probe corresponding to -148/+28 of the CD18 promoter was prepared by polymerase chain reaction and radiolabeled on the non-coding strand. DNase I footprinting was performed with 1 µl of purified, bacterially expressed GABPalpha (labeled alpha), or in the absence of added protein (N). Vertical bars indicate the location of the protected regions (labeled A-C which correspond to the ets sites in Fig. 2A). A prominent DNase I-hypersensitive site is indicated by the asterisk. Numbers at left correspond to promoter sequence relative to the dominant start site of transcription.



GABP and PU.1 Directly Compete for Binding to the CD18 Promoter

We sought to determine if GABPalpha and PU.1 compete for binding to the same ets sites in the CD18 promoter. These factors were expressed in E. coli as fusion proteins with GST and isolated with glutathione-Sepharose beads. No binding to the CD18 -85/-37 probe is seen with GST alone (not shown). EMSA with GST-GABPalpha generates two distinct bands, corresponding to monomeric and homodimeric binding species (Fig. 6A, lane 2, M and D, respectively). Their binding specificity is indicated by abrogation with 100-fold excess of unlabeled homologous probe (lane 3), but not by 100-fold excess of nonspecific competitor oligonucleotide (lane 4). Addition of increasing amounts of GST-PU.1 to a fixed amount of GABPalpha in the binding reaction recruits bound probe from GABPalpha to PU.1 (lanes 5-8). As PU.1 increases, there is preferential loss of binding to the monomeric form, relative to the dimeric form of GABPalpha, indicating the higher binding affinity of the dimeric GABPalpha species.


Figure 6: GABPalpha and PU.1 directly compete for binding to CD18 ets sites. A, EMSA was performed with radiolabeled CD18 -85/-37 probe and purified bacterially expressed GABPalpha (GST-E4TF1-60). GABPalpha binding (lane 2) is abrogated by 100-fold molar excess of unlabeled specific competitor probe (lane 3), but not by nonspecific probe (lane 4). Addition of increasing amounts of GST-PU.1 (lanes 5-8) causes loss of GABPalpha binding, in exchange for increased binding by PU.1. GABPalpha monomeric (M) and dimeric (D) binding species and PU.1 (PU.1) are indicated. A binding complex of high electrophoretic mobility (indicated by the asterisk) represents a proteolytic degradation product of GST-PU.1, as described previously(8) . B, GST-PU.1 binding (lane 2) is abrogated by a 100-fold excess of unlabeled specific competitor (lane 3), but not by nonspecific probe (lane 4). Addition of increasing amounts of GABPalpha (GST-E4TF1-60) recruits probe from PU.1 to GABPalpha complexes (lanes 5-9).



Similarly, EMSA with GST-PU.1 (Fig. 6B, lane 2, labeled PU.1) forms a distinct binding species with the CD18 -85/-37 probe that is abrogated by a 100-fold molar excess of homologous unlabeled probe but not by nonspecific probe (lanes 3 and 4, respectively). A species of high electrophoretic mobility (indicated by the asterisks in Fig. 6, A and B) is caused by binding to the probe by a proteolytic degradation product of PU.1(8) . Addition of increasing amounts of GABPalpha to a fixed amount of PU.1 in the binding reaction recruits probe to the GABPalpha complexes.

Co-transfection of Both GABPalpha and GABPbeta into Myeloid Cells Activates the CD18 Promoter

We sought to determine if GABPalpha and GABPbeta could activate the CD18 promoter in vivo. We co-transfected CD18(-918)/luc with mammalian expression vectors containing the human homologues of GABPalpha and GABPbeta1-1 (E4TF1-60 and E4TF1-53, respectively). Neither GABPalpha nor GABPbeta, alone, activated the CD18 promoter construct following transfection into U937 myeloid cells (Fig. 7A). However, co-transfection of both GABPalpha and GABPbeta with the CD18 promoter increased luciferase activity more than 10-fold. Interestingly, transfection into U937 cells of a PU.1 expression vector fails to substantially activate the CD18 promoter (not shown). Thus, the GABP complex activates myeloid expression from the CD18 promoter in vivo.


Figure 7: GABP alpha and GABPbeta together with PU.1 activate CD18 transcription. A, U937 cells were transfected with 20 µg of CD18(-918)/luc and no added effector, 5 µg of GABPalpha (pCAGGS-E4TF1-60) alone, 5 µg of GABPbeta (pCAGGS-E4TF1-53) alone, or 5 µg each of both GABPalpha and GABPbeta. Each sample was transfected with the internal control CMV/hGH and additional pGEM3zf to bring the amount of transfected DNA in each sample to 30 µg. Luciferase activity was measured 14 h later and was normalized to growth hormone expression. Data represent the mean ± S.E. from three separate experiments. B, HeLa cells were transfected with 20 µg CD18(-918)/luc and no added effector, 5 µg of GABPalpha (pCAGGS-E4TF1-60) alone, 5 µg of GABPbeta (pCAGGS-E4TF1-53) alone, 5 µg of PU.1 (in the mammalian expression vector pECE) alone, or combinations of 5 µg each, as indicated. Each sample was transfected with the internal control CMV/hGH and additional pGEM3zf to bring the amount of transfected DNA in each sample to 40 µg. Luciferase activity was measured 14 h later and was normalized to growth hormone expression. Data represent the mean ± S.E. from three separate experiments.



GABPalpha and GABPbeta Cooperate with PU.1 to Activate the CD18 Promoter in Non-hematopoietic Cells

The CD18 promoter encodes the lineage-specific activity of the endogenous CD18 gene, for it directs reporter expression in myeloid and lymphoid cells but not in non-hematopoietic cells (Fig. 1). We sought to determine if GABP co-activates the CD18 promoter following transfection into otherwise non-permissive HeLa cells. Transfection into HeLa cells of either GABPalpha or GABPbeta alone had no effect on CD18 promoter activity, and transfection of both GABP subunits had only a modest effect (Fig. 7B). Transfection into HeLa cells of PU.1, which is required for myeloid expression of CD18, fails to activate the CD18 promoter. However, co-transfection of both GABP subunits together with PU.1 increases CD18 promoter activity more than 10-fold. This indicates that although these two ets factors compete for the same CD18 promoter-binding sites, they functionally cooperate to increase CD18 expression in otherwise non-permissive cells.


DISCUSSION

In order to better define the molecular basis of myeloid differentiation, we are studying the factors that regulate transcription of the leukocyte beta(2) integrin, CD18. A 79-nt fragment of the CD18 promoter is required for transcription in myeloid cells(6, 8) , and we have previously shown that the ets-related transcription factor PU.1 binds to this region (8) . We now demonstrate that GABPalpha, a second ets factor, competes with PU.1 for binding to these sites in the CD18 promoter. GABPalpha forms multimeric complexes with its Notch-related partner GABPbeta, and together these factors activate CD18 transcription in myeloid cells. Furthermore, we show that GABP and PU.1 are sufficient to activate the CD18 promoter in non-hematopoietic cells. Thus, although these ets factors compete for promoter binding, they functionally cooperate to activate CD18 transcription.

The region of CD18 that is required for promoter activity contains three potential ets sites. Because ets transcription factors bind to similar core DNA sequences, we sought to determine if other ets factors, besides PU.1, bind to CD18. We detected a widely expressed nuclear factor of extremely low electrophoretic mobility that binds to this region of the CD18 promoter. Böttinger et al.(6) suggested that GABP might bind to the CD18 promoter. We now demonstrate that purified GABPalpha binds to all three CD18 ets regulatory elements. Purified GABPalpha alone forms monomers and homodimers on these sites and its binding is sensitive to mutation (GGAA CCAA) of the consensus ets sequence. GABPbeta alone does not bind to the CD18 promoter, but in the presence of GABPalpha it forms a complex that co-migrates with the low mobility nuclear binding complex. We used antibodies to confirm that this myeloid-binding complex contains proteins that are immunologically related to both GABPalpha and GABPbeta.

GABP was originally identified as a factor from rat nuclei that binds to critical regulatory elements in HSV IE genes(13, 16) . GABP is composed of two distinct polypeptides, which together are required for high affinity DNA binding and transcriptional activation. The human equivalents of GABPalpha and GABPbeta were independently cloned as regulators of adenovirus E4 gene transcription (E4TF1-60 and E4TF1-53/47, respectively) (14) and as nuclear respiratory factor 2 (NRF-2alpha and NRF-2beta/, respectively) (18) GABPalpha is a DNA-binding protein with homology to the ets family of transcription factors. GABPbeta is unrelated to the ets family, but it has homology to Drosophila Notch and Caenorhabditis elegans Glp-1 and Lin-1. Four ankyrin repeats in its amino terminus are required for its interaction with GABPalpha, and a coiled-coil motif in its carboxyl terminus permits GABPbeta homotypic dimerization(13, 17) . Whereas DNA binding is mediated by the GABPalpha subunit, transcriptional activation is controlled by GABPbeta(17, 18, 19) .

GABP generates a complex of extremely low electrophoretic mobility when it binds to CD18 promoter probes that contain at least two of its three ets-binding sites. Gel filtration, gradient sedimentation, and cross-linking studies were used to conclusively demonstrate the heterotetrameric nature of GABP complexes on a similar arrangement of three ets sites on HSV IE genes(13) . We used UV cross-linking and mutagenesis of the GABP subunits to confirm the multimeric nature of the binding complexes to the adenovirus E4 transcriptional promoter(17) . In the present study, we used mutagenesis of CD18 ets sites to demonstrate an identical pattern of binding by GABPalpha and GABPbeta. Other genes with multiple ets-binding sites, including folate-binding protein(20) , aldose reductase(21) , and cytochrome c oxidase subunits IV and 5b(22, 23) , are bound by GABP in a similar manner. As with each of these genes, the low mobility CD18 promoter binding complex represents GABPalpha(2)/GABPbeta(2) heterotetramers.

The two ets factors that bind to the CD18 promoter, PU.1 and GABPalpha, are expressed in very different lineage-specific patterns. PU.1 is expressed by B lymphocytes and myeloid cells(9, 10, 11) ; in accordance with its pattern of expression, we detect PU.1 binding activity only in these cellular compartments. PU.1 appears to control the transcription of several leukocyte-specific genes including CD11b (24) , M-CSF receptor(25) , FcR1(26, 27) , and macrophage scavenger receptor(28) , as well as CD18(8) . PU.1 is required for myeloid colony formation(29) , and its targeted disruption by homologous recombination abrogates lymphopoiesis and myelopoiesis(30) . Thus, PU.1 is essential for normal hematopoiesis and may control transcription of some myeloid genes.

In contrast to PU.1, GABPalpha and GABPbeta are widely expressed(16) . We detected binding to CD18 by the heterotetrameric GABP species in all cell types examined. Thus, GABP binding activity is present both in cells that express CD18 (myeloid cells and B and T lymphocytes) and in cells that do not express CD18 (HeLa). Although most genes whose activity is controlled by GABP are widely expressed, GABP also controls genes that are expressed in a lineage-restricted manner. For example, the gene encoding alpha4 integrin, which is expressed predominantly by leukocytes(31) , and the F promoter of 6-phosphofructo-2 kinase (32) are transcriptionally regulated by GABP.

How can the widely expressed GABP transcription complex control the lineage-restricted expression of genes such as CD18 and alpha4 integrin? There are multiple isoforms of the GABPbeta(14, 16, 22) , the subunit that controls transcriptional activation by GABP(17, 18) . These isoforms, which may be derived from alternative splicing of the mRNA transcript differ primarily in the region of the protein that is responsible for GABPbeta homodimerization. Alternate forms of GABPbeta1 may affect formation of GABP complexes and their interactions with other components of the transcriptional apparatus. Recently, GABPbeta2-1, a distinct but related gene that is encoded on a different chromosome, was described(33) . The two distinct GABPbeta genes differ in the region of the protein that is responsible for transcriptional activation. GABPbeta1 and GABPbeta2 can form heteromeric complexes with one another, thereby adding another level of complexity to the regulation to GABP function(33) . The cell type-specific and differentiation-associated expression of the GABPbeta genes and their various isoforms have not been well defined. Thus, subtle lineage-specific alterations in GABPbeta expression may control GABP complex formation and transcriptional activation and thereby contribute to the regulated expression of CD18. Cell type-specific transcriptional activation by the ubiquitously expressed GABP may also be influenced by lineage-restricted factors such as PU.1.

Other genes besides CD18 are also controlled by more than one ets factor. Immunoglobulin heavy chain enhancer function is regulated by binding of different ets factors including PU.1, Ets-1, and Erg-3(34, 35) . The alpha4 integrin promoter may be bound by a second ets factor besides GABPalpha(31) . Although we cannot exclude the possibility that GABP and PU.1 physically interact on the CD18 promoter in vivo, we identified no novel binding complexes that are formed by these factors in the electrophoretic mobility shift assay. Rather, titration of increasing amounts of PU.1 competes for GABPalpha binding to the CD18 promoter and vice versa. Furthermore, antibodies to GABP do not supershift the EMSA probes that are bound by PU.1 and vice versa(8) . Thus, PU.1 and GABPalpha appear to compete for the same CD18 promoter sites and their binding appears to be mutually exclusive.

Jurkat (T lymphoid) cells express CD18, yet they lack PU.1 expression. These cells possess a unique nuclear binding species which does not co-migrate with other ets factors that are expressed by T lymphocytes (Fig. 2). Additional mutagenesis studies and supershift assays (not shown) suggest that this binding species likely represents an as yet unidentified ets factor. We propose that this T cell factor acts in lieu of PU.1 and contributes to T lymphoid expression of CD18. These findings suggest that at least one other ets factor may functionally cooperate with GABP to effect CD18 transcription.

Transfection of both GABPalpha and GABPbeta into myeloid cells activates CD18 reporter activity more than 10-fold; we have found no such activation of CD18 myeloid transcription by PU.1. Furthermore, co-transfection of both GABP and PU.1 activates CD18 transcription in non-hematopoietic cells. This confirms our previous proposal that although PU.1 is necessary for myeloid expression of CD18, it alone is not sufficient to control CD18 transcription. Although these two ets factors compete for the same CD18 promoter-binding sites, they functionally cooperate to activate its transcription. GABP and PU.1 may have different roles in the process of transcriptional activation. For example, because PU.1 directly interacts with TATA-binding protein(36) , it may recruit the basal transcriptional apparatus to the TATA-less CD18 promoter, while GABP enhances other aspects of transcriptional activation. Further analysis of these factors should demonstrate the means by which these two ets factors cooperate to control CD18 transcription.


FOOTNOTES

*
This work was supported in part by American Cancer Society Grants DHP-11 and NIDDK R29 DK 44728 (both to A. G. R.) and by an American Heart Association Rhode Island Affiliate Fellowship (to C. P. S.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed. Tel.: 401-331-8500 (ext. 4648); Fax: 401-751-2398.

Present address: Johns Hopkins School of Medicine, Medical Scientist Training Program, Baltimore, MD 21209.

(^1)
The abbreviations used are: nt, nucleotide(s); EMSA, electrophoretic mobility shift assay; CMV/hGH, cytomegalovirus promoter/human growth hormone construct; GST, glutathione S-transferase; HSV IE, herpes simplex virus immediate early.


ACKNOWLEDGEMENTS

We gratefully thank Tom Brown for the gifts of GABPalpha and GABPbeta and antisera. PU.1-pECE was a gift of Richard Maki, GST-PU.1 was a gift of Tony Kouzarides, Elf-1 and Ets-1 cDNAs were gifts of Jeff Leiden, and Fli-1 cDNA was a gift of Michael Klemsz. A. G. R. thanks Ken Zaret for helpful discussions and Tom King for careful review of this manuscript.


REFERENCES

  1. Maniatis, T., Goodbourn, S., and Fischer, J. A. (1987) Science 236,1237-1245 [Abstract/Free Full Text]
  2. Weiss, M. J., Keller, G., and Orkin, S. H. (1994) Genes & Dev. 8,1184-1197
  3. Rosmarin, A. G., Weil, S. C., Rosner, G. L., Griffin, J., Arnaout, M. A., and Tenen, D. G. (1989) Blood 73,131-136 [Abstract/Free Full Text]
  4. Rosmarin, A. G., Levy, R., and Tenen, D. G. (1992) Blood 79,2598-2604 [Abstract/Free Full Text]
  5. Agura, E. D., Howard, M., and Collins, S. J. (1992) Blood 79,602-609 [Abstract/Free Full Text]
  6. Böttinger, E. P., Shelley, C. S., Farokhzad, O. C., and Arnaout, M. A. (1994) Mol. Cell. Biol. 4,2604-2615
  7. Weitzman, J. B., Wells, C. E., Wright, A. H., Clark, P. A., and Law, S. K. A. (1991) FEBS Lett. 294,97-103 [CrossRef][Medline] [Order article via Infotrieve]
  8. Rosmarin, A. G., Caprio, D., Levy, R., and Simkevich, C. (1995) Proc. Natl. Acad. Sci. U. S. A. 92,801-805 [Abstract/Free Full Text]
  9. Klemsz, M. J., McKercher, S. R., Celada, A., Van Beveren, C., and Maki, R. A. (1990) Cell 61,113-124 [CrossRef][Medline] [Order article via Infotrieve]
  10. Galson, D. L., Hensold, J. O., Bishop, T. R., Schalling, M., D'Andrea, A. D., Jones, C., Auron, P. E., and Housman, D. E. (1993) Mol. Cell. Biol. 13,2929-2941 [Abstract/Free Full Text]
  11. Hromas, R., Orazi, A., Neiman, R. S., Maki, R., Van Beveran, C., Moore, J., and Klemsz, M. (1993) Blood 82,2998-3004 [Abstract/Free Full Text]
  12. Chen, H., Zhang, P., Voso, M. T., Hohaus, S., Gonzalez, D. A., Glass, C. K., Zhang, D-E., and Tenen, D. G. (1995) Blood 85,2918-2928 [Abstract/Free Full Text]
  13. Thompson, C. C, Brown, T., and McKnight, S. L. (1991) Science 253,762-768 [Abstract/Free Full Text]
  14. Watanabe, H., Sawada, J.-I., Yano, K.-I., Yamaguchi, K., Goto, M., and Handa, H. (1993) Mol. Cell. Biol. 13,1385-1391 [Abstract/Free Full Text]
  15. Niwa, H., Yamamura, K., and Miyazaki, J. (1991) Gene (Amst.) 108,193-200 [CrossRef][Medline] [Order article via Infotrieve]
  16. LaMarco, K., Thompson, C. C., Byers, B. P., Walton, E. M., and McKnight, S. L. (1991) Science 253,789-792 [Abstract/Free Full Text]
  17. Sawada, J.-I., Goto, M., Sawa, C., Watanabe, H., and Handa, H. (1994) EMBO J. 13,1396-1402 [Medline] [Order article via Infotrieve]
  18. Gugneja, S., Virbasius, J. V., and Scarpulla, R. C. (1995) Mol. Cell. Biol. 15,102-111 [Abstract]
  19. Watanabe, H., Wada, T., and Handa, H. (1990) EMBO J. 9,841-847 [Medline] [Order article via Infotrieve]
  20. Sadasivan, E., Cedeno, M. M., and Rothenberg, S. P. (1994) J. Biol. Chem. 269,4725-4735 [Abstract/Free Full Text]
  21. Wang, K. Bohren, K. M., and Gabbay, K. H. (1993) J. Biol. Chem. 268,16052-16058 [Abstract/Free Full Text]
  22. Virbasius, J. V., Virbasius, C. A., and Scarpulla, R. C. (1993) Genes & Dev. 7,380-392
  23. Carter, R. S., and Avadhani, N. G. (1994) J. Biol. Chem. 269,4381-4387 [Abstract/Free Full Text]
  24. Pahl, H. L., Scheibe, R. J., Zhang, D.-E., Chen, H.-M., Galson, D. L., Maki, R. A., and Tenen, D. G. (1992) J. Biol. Chem. 268,5014-5020 [Abstract/Free Full Text]
  25. Zhang, D.-E., Hetherington, C. J., Chen, H.-M., and Tenen, D. G. (1994) Mol. Cell. Biol. 14,373-381 [Abstract/Free Full Text]
  26. Eichbaum, Q. G., Iyer, R., Raveh, D. P., Mathieu, C., and Ezekowitz, R. A. (1994) J. Exp. Med. 179,1985-1996 [Abstract/Free Full Text]
  27. Perez, C., Coeiffier, E., Moreau-Gachelin, F., Wietzerbin, J., and Benech, P. D. (1994) Mol. Cell. Biol. 14,5023-5031 [Abstract/Free Full Text]
  28. Moulton, K. S., Semple, K., Wu, H., and Glass, C. K. (1994) Mol. Cell. Biol. 14,4408-4418 [Abstract/Free Full Text]
  29. Voso, M. T., Burn, T. C., Wulf, G., Lim, B., Leone, G., and Tenen, D. G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,7932-7936 [Abstract/Free Full Text]
  30. Scott, E. W., Simon, M. C., Anastasi, J., and Singh, H. (1994) Science 265,1573-1577 [Abstract/Free Full Text]
  31. Rosen, G. D., Barks, J. L., Iademarco, M. F., Fisher, R. J., and Dean, D. C. (1994) J. Biol. Chem. 269,15652-15660 [Abstract/Free Full Text]
  32. Dupriez, V. J., Darville, M. I., Antoine, I. V., Gegonne, A., Ghysdael, J., and Rousseau, G. G. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,8224-8228 [Abstract/Free Full Text]
  33. de la Brousse, F. C., Birkenmeier, E. H., King, D. S., Rowe, L. B., and McKnight, S. L. (1994) Genes & Dev. 8,1853-1865
  34. Nelsen, B., Tian, G., Erman, B., Gregoire, J., Maki, R., Graves, B., and Sen, R. (1993) Science 261,82-86 [Abstract/Free Full Text]
  35. Rivera, R. R., Stuiver, M. H., Steenbergen, R., and Murre, C. (1993) Mol. Cell. Biol. 13,7163-7169 [Abstract/Free Full Text]
  36. Hagemeier, C., Bannister, A. J., Cook, A., and Kouzarides, T. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,1580-1584 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Immunol.Home page
T. Kong, M. Scully, C. S. Shelley, and S. P. Colgan
Identification of Pur{alpha} as a New Hypoxia Response Factor Responsible for Coordinated Induction of the beta2 Integrin Family
J. Immunol., August 1, 2007; 179(3): 1934 - 1941.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
K. J. Perkins, U. Basu, M. T. Budak, C. Ketterer, S. M. Baby, O. Lozynska, J. A. Lunde, B. J. Jasmin, N. A. Rubinstein, and T. S. Khurana
Ets-2 Repressor Factor Silences Extrasynaptic Utrophin by N-Box mediated Repression in Skeletal Muscle
Mol. Biol. Cell, August 1, 2007; 18(8): 2864 - 2872.
[Abstract] [Full Text] [PDF]


Home page
J. Leukoc. Biol.Home page
J. S. Hale, T. J. Dahlem, R. L. Margraf, I. Debnath, J. J. Weis, and J. H. Weis
Transcriptional control of Pactolus: evidence of a negative control region and comparison with its evolutionary paralogue, CD18 ({beta}2 integrin)
J. Leukoc. Biol., August 1, 2006; 80(2): 383 - 398.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. W. Darnowski, F. A. Goulette, Y.-j. Guan, D. Chatterjee, Z.-F. Yang, L. P. Cousens, and Y. E. Chin
Stat3 Cleavage by Caspases: IMPACT ON FULL-LENGTH Stat3 EXPRESSION, FRAGMENT FORMATION, AND TRANSCRIPTIONAL ACTIVITY
J. Biol. Chem., June 30, 2006; 281(26): 17707 - 17717.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
M. Yaneva, S. Kippenberger, N. Wang, Q. Su, M. McGarvey, A. Nazarian, L. Lacomis, H. Erdjument-Bromage, and P. Tempst
PU.1 and a TTTAAA Element in the Myeloid Defensin-1 Promoter Create an Operational TATA Box That Can Impose Cell Specificity onto TFIID Function.
J. Immunol., June 1, 2006; 176(11): 6906 - 6917.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. K. Resendes and A. G. Rosmarin
GA-Binding Protein and p300 Are Essential Components of a Retinoic Acid-Induced Enhanceosome in Myeloid Cells
Mol. Cell. Biol., April 15, 2006; 26(8): 3060 - 3070.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. Shimokawa and C. Ra
C/EBP{alpha} functionally and physically interacts with GABP to activate the human myeloid IgA Fc receptor (Fc{alpha}R, CD89) gene promoter
Blood, October 1, 2005; 106(7): 2534 - 2542.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
H. Imaki, K. Nakayama, S. Delehouzee, H. Handa, M. Kitagawa, T. Kamura, and K. I. Nakayama
Cell Cycle-dependent Regulation of the Skp2 Promoter by GA-binding Protein
Cancer Res., August 1, 2003; 63(15): 4607 - 4613.
[Abstract] [Full Text] [PDF]


Home page
BloodHome page
T. S. Bush, M. St. Coeur, K. K. Resendes, and A. G. Rosmarin
GA-binding protein (GABP) and Sp1 are required, along with retinoid receptors, to mediate retinoic acid responsiveness of CD18 (beta 2 leukocyte integrin): a novel mechanism of transcriptional regulation in myeloid cells
Blood, January 1, 2003; 101(1): 311 - 317.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Du, M. J. Stankiewicz, Y. Liu, Q. Xi, J. E. Schmitz, J. A. Lekstrom-Himes, and S. J. Ackerman
Novel Combinatorial Interactions of GATA-1, PU.1, and C/EBPepsilon Isoforms Regulate Transcription of the Gene Encoding Eosinophil Granule Major Basic Protein
J. Biol. Chem., November 1, 2002; 277(45): 43481 - 43494.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Sawa, T. Yoshikawa, F. Matsuda-Suzuki, S. Delehouzee, M. Goto, H. Watanabe, J.-i. Sawada, K. Kataoka, and H. Handa
YEAF1/RYBP and YAF-2 Are Functionally Distinct Members of a Cofactor Family for the YY1 and E4TF1/hGABP Transcription Factors
J. Biol. Chem., June 14, 2002; 277(25): 22484 - 22490.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Tanaka, A. Ueda, H. Kanamori, H. Ideguchi, J. Yang, S. Kitajima, and Y. Ishigatsubo
Cell-cycle-dependent Regulation of Human aurora A Transcription Is Mediated by Periodic Repression of E4TF1
J. Biol. Chem., March 15, 2002; 277(12): 10719 - 10726.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Jiang, A. Kumar, J. E. Parrillo, L. A. Dempsey, J. L. Platt, R. A. Prinz, and X. Xu
Cloning and Chara