|
|
|
|||||||
|
|||||||||
(Received for publication, June 26,
1995; and in revised form, July 31, 1995) From the
Interferon-inducible membrane proteins of approximately 17 kDa
have been suggested to play a role in the antiproliferative activity of
interferons based on (1) their pattern of induction in
interferon-sensitive and -resistant cell lines and (2) the
ability of a membrane fraction enriched in 17-kDa proteins to inhibit
cell growth. To gain insight into the nature of the proteins that
mediate the antiproliferative activity of interferons, a monoclonal
antibody, 13A5, was generated that reacted specifically with a 17-kDa
interferon-inducible cell surface protein. The expression pattern of
this 17-kDa protein by human cell lines correlated with sensitivity to
the antiproliferative activity of interferons. To obtain information
regarding the structure of this protein, the 13A5 antibody was used to
screen COS cells transfected with a human cDNA expression library.
Sequence analysis of a full-length cDNA clone revealed identity with
the 9-27 cDNA, previously isolated on the basis of its interferon
inducibility by differential screening. In addition, the 17-kDa protein
encoded by the 9-27 gene was shown to be identical to the Leu-13
antigen. Leu-13 was previously identified as a 16-kDa
interferon-inducible protein in leukocytes and endothelial cells and is
a component of a multimeric complex involved in the transduction of
antiproliferative and homotypic adhesion signals. These results suggest
a novel level of cellular regulation by interferons involving a
membrane protein, encoded by the interferon-inducible 9-27 gene,
which associates with other proteins at the cell surface, forming a
complex relaying growth inhibitory and aggregation signals.
Interferons (IFN) ( In addition
to soluble cytokines and growth factors, cell-cell interactions
involving specific membrane proteins are likely to play an important
role in the control of cell growth and differentiation. Indeed, it has
been shown that the antiproliferative activity of IFN could be
transferred from cell to cell(3) . Moreover, it has been
suggested that IFN-induced cell surface proteins of approximately 17
kDa could be involved in their antiproliferative activity, since their
expression pattern in various cell lines correlates with the
sensitivity to the inhibition of cell growth induced by
IFNs(4, 5, 6) , and a membrane fraction
enriched for 17-kDa proteins inhibits cell growth(7) . The
purpose of the present study was to investigate the possible
contribution of IFN-inducible cell surface proteins to IFNs
antiproliferative activity. Our approach was based on the generation of
monoclonal antibodies (mAbs) directed against IFN-inducible cell
surface proteins. The mAbs could then be used to analyze the expression
and the function of their target and eventually to clone the
corresponding cDNA. Here we report the characterization of a mAb
directed against a 17-kDa membrane antigen inducible by IFNs. The
expression pattern of this 17-kDa protein by human cell lines
correlated with sensitivity to the antiproliferative activity of IFNs.
Expression cloning revealed that the 17-kDa protein is encoded by the
9-27 gene, which is a member of an IFN-inducible gene family
isolated by differential screening and whose function was
unknown(5, 6) . We also demonstrated that the product
of the 9-27 gene is a protein previously identified as Leu-13, a
leukocyte antigen that is part of a membrane complex of proteins
involved in the transduction of antiproliferative and homotypic
adhesion
signals(4, 5, 8, 9, 10, 11, 12) .
Hybridoma
supernatants were screened for their differential reactivity to
IFN- Additional murine mAbs used in this study include the
following: anti-Leu-13, an IgG
One mAb termed 13A5, an IgM
Figure 1:
Immunoprecipitation of Daudi
cells' proteins by 13A5. Untreated(-) or IFN-
The results of the 17-kDa protein expression
analysis are presented in Table 1. Fig. 2shows the
fluorescence histograms of four representative cell lines on a
logarithmic scale. We observed that IFN-
Figure 2:
IFN-
Some
of the cell lines tested expressed a basal level of the 17-kDa protein,
which was particularly prominent on K562 cells. Confirming the
fluorocytometric analysis, immunoprecipitation of
Figure 3:
Immunoprecipitation of K562 cell proteins
by 13A5. Untreated(-) or IFN-
Figure 4:
13A5 and anti-Leu-13 reacted with
9-27- but not 1-8u-transfected cells. A, COS cells
were transfected with the pse1.9-27 plasmid (heavylines) or with the control pse1 plasmid (thinlines) and reacted with 13A5 or anti-Leu-13 as indicated.
Cells were counterstained with a GAM-Ig-FITC antibody and analyzed by
flow cytometry. B, same experiment as in A except
that cells were transfected with the pse1.1-8 plasmid (heavylines). The control plasmid (thinlines) was pse1.
The cDNA sequence was
obtained by the dideoxy termination method. Comparison with the EMBL
data bank showed that the cDNA encoding the 17-kDa protein was nearly
identical to the 9-27 cDNA. The two sequences diverge at
positions 280 (A
The 9-27,
1-8u, and 1-8d coding sequences diverge at the amino and
carboxyl termini. Thus, it was theoretically possible that 13A5 and
anti-Leu-13 could recognize an epitope common to both 9-27 and
1-8 proteins. An reverse transcription polymerase chain reaction
approach using primers designed to amplify the 1-8u and
1-8d mRNAs resulted in the obtention of the 1-8u but not of
the 1-8d cDNA, which is less abundant and less homologous. As
shown in Fig. 4B, neither anti-Leu-13 nor 13A5 reacted
with COS cells transfected with the 1-8u cDNA. These results were
confirmed by immunoprecipitation experiments performed on in vitro synthesized 9-27 and 1-8u proteins. Both mAbs were
able to precipitate 9-27 but not 1-8u products (data not
shown). Therefore, the epitope recognized by 13A5 and anti-Leu-13 on
the 9-27 protein is not present in the 1-8u protein. Thus,
we conclude that the leukocyte antigen, Leu-13, is composed of only one
polypeptide encoded by the IFN-inducible 9-27 gene.
Figure 5:
Analysis of proteins coprecipitated by
mAbs 13A5 and 5A6. A, K562 cells were
Figure 6:
Effect of 13A5 and anti-Leu-13 mAbs on
homotypic adhesion and proliferation. A, induction of
homotypic adhesion by mAbs. K562, Jurkat, and U937 cells were cultured
for 24 h with or without 500 units/ml IFN-
Modulations of gene expression in cells exposed to IFNs play
an essential role in the ability of these cytokines to affect vital
biological processes. Several proteins whose synthesis is induced by
IFNs have been implicated in the antiviral activity shared by all IFNs
(for review, see (2) and (31) -33). The
inhibition of cell growth by IFNs is also likely to result from an
action on multiple pathways affecting different steps at which cell
growth can be regulated. Interestingly, two double-stranded
RNA-dependent antiviral pathways induced by IFNs have been recently
implicated in their antiproliferative activity as
well(34, 35, 36) . IFN treatment also
directly affects the function of two genes known to be involved in the
control of the cell-cycle, the protooncogene c-myc and the
tumor-suppressor retinoblastoma gene, resulting in arrest at the
G It has
been shown that the antiproliferative activity of IFN could be
transferred from cell to cell, not by diffusion of a soluble mediator
but through direct contact between cells(3) . To explore the
role of membrane proteins in the antiproliferative activity of IFNs, we
generated mAbs directed against IFN-inducible membrane antigens. We
obtained an antibody that reacted specifically with a 17-kDa protein.
This 17-kDa protein was induced by type I and II IFNs on a wide range
of cell lines sensitive to the antiproliferative effect of IFNs, but
not significantly on resistant cell lines. Screening of an expression
library yielded a full-length cDNA clone encoding the 17-kDa protein,
and sequence analysis revealed identity with the 9-27 cDNA. The 9-27 gene is induced by both type I and II IFNs, and the
mRNA level can increase as much as a 100-fold upon induction by IFNs.
Induction by IFNs is transcriptionally controlled by a single
IFN-stimulated response element present in the promoter of the gene (41) . The protein encoded by the 9-27 gene has a
calculated molecular mass of 13.9 kDa, in close agreement with the
observed 16-17 kDa(7, 10) . In addition, we
demonstrated that 9-27 was coding for the leukocyte antigen
Leu-13. In most cell types studied thus far, Leu-13 was shown to be
part of a membrane complex containing several distinct proteins. One of
these proteins is the 26-kDa TAPA-1 protein, the target of an
antiproliferative antibody(12) . TAPA-1 is strongly related at
the sequence level to two other surface proteins involved in the
regulation of cell growth, the ME491 melanoma-associated antigen, and
CD37, another leukocyte antigen(17) . Leu-13 and TAPA-1 are
involved in a mechanism controlling cellular adhesion since anti-Leu-13
and anti-TAPA-1 mAbs each triggers a general homotypic adhesion
phenomenon. Interestingly, homotypic adhesion induced by anti-Leu-13 or
anti-TAPA-1 is not dependent on adhesion pathways involving known
adhesion molecule including the leukocyte function-associated
antigen-1, the intercellular adhesion molecule-1, CD44, or
VLA-4(4, 5, 12) . Along with their
involvement in the regulation of cell aggregation, Leu-13 and TAPA-1
are likely to also play a role in the control of cell growth. Indeed,
anti-Leu-13 and anti-TAPA-1 mAbs can directly inhibit cell growth,
although this effect is observed in a more restricted subset of cell
lines(4, 12, 17) . Furthermore, anti-Leu-13
mAbs were shown to potentiate the antigrowth effect of IFN- Evidence that antibodies against
9-27/Leu-13 and TAPA-1 can induce a biological response suggests
that the multimeric cell surface complex containing 9-27/Leu-13,
TAPA-1, and other molecules is a receptor for an as yet unidentified
ligand. Indeed, activation of a signal transduction pathway by
extracellular signals often requires ligand-induced dimerization or
oligomerization of the corresponding receptor. Kinase(s) associated
with the receptor are brought together, resulting in their reciprocal
phosphorylation and the subsequent activation of further downstream
components of the signal transduction pathway(42) . Therefore,
antibodies against cell surface receptors that are activated by
dimerization can sometimes function as an agonist because they
artificially induce dimerization of the receptor, whereas Fab fragments
of such antibodies have no activity(42) . Taken together,
these results show that the 9-27 gene is coding for a cell
surface protein that associates with other membrane proteins, forming a
multimeric complex that relays growth inhibitory and cell adhesion
signals. Interferons seem to exert their inhibition on cell growth
by acting at many different levels, (1) directly affecting the
function of protein such as c-myc and Rb that are intimately
involved in cell-cycle control, (2) increasing the level of
enzymes such as the double-stranded RNA-dependent protein kinase and
the 2-5A synthetases that inhibit cell anabolism, and (3) inducing cell surface proteins such as 9-27/Leu-13
that relay other growth inhibitory signals. While the activation of a
single pathway might be sufficient to inhibit the growth of a given
cell, activation of multiple pathways by IFNs allows for both more
efficiency and flexibility in the control of cell growth. Indeed, in a
physiological setting, IFNs are acting on a population of cells at
distinct stages and in different programs of differentiation, cells
that are continuously exposed to various other stimuli and have to
maintain the ability to perform other essential functions, hence the
requirement for efficiency and flexibility, i.e. multiple
pathways.
The nucleotide sequence(s) reported in this paper has been submitted
to the GenBank(TM)/EMBL Data Bank with accession number(s)
X84958[GenBank].
Volume 270,
Number 40,
Issue of October 06, pp. 23860-23866, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)are multifunctional cytokines
that play a critical role in the defense against viral or parasitic
infections. These cytokines also exhibit antiproliferative and
differentiating activities, prompting an evaluation of their potential
as antitumor agents. While the results of animal testing have been
encouraging, clinical trials in humans have shown IFNs to be effective
for only a small subset of cancer types(1) . This dramatic host
difference in susceptibility to the antitumoral activity of IFNs
underscores the need to understand at the molecular level the mechanism
by which IFNs exert this activity. Exposure to IFNs leads to a
modulation in the levels of an estimated 50-100 cellular
proteins, which are thought to collectively mediate IFNs pleiotropic
effects(2) . Identifying the role and contribution of each
protein is a major challenge, but it will provide the basis for
designing better therapeutic strategies based on IFNs.
Cell Lines and Interferons
Daudi, Raji, and
Namalwa are human lymphoblastoid B cells (Burkitt lymphoma). DIF8 and
Daudi-R are two different IFN-resistant cell lines derived from Daudi
cells(13, 14) . Jurkat and H9 are human lymphoblastoid
T cells (derived from an acute lymphoblastic leukemia and from a
lymphoid leukemia, respectively). Reh and RS4;11 are human
lymphoblastoid null cells (acute lymphocytic leukemia). K562 are human
leukemic cells derived from a blast crisis of chronic myelogenous
leukemia. HL-60 are human promyelocytic cells (acute promyelocytic
leukemia). U937 are human monocyte-like cells (hystiocytic leukemia).
These cell lines were grown in suspension at 37 °C in a humidified
5% CO
atmosphere in RPMI 1640 supplemented with 10% FCS
(Life Technologies, Inc.), 10 mM HEPES, pH 7.4, 1 mM sodium pyruvate, 2 mML-glutamine, nonessential
amino-acids (Flow), 50 units/ml penicillin, and 50 µg/ml
streptomycin (Flow). UAC (human amniotic U cell), HeLa (human cervical
carcinoma), and FS-7F (human fibroblastoid cells) were grown at 37
°C in a humidified 5% CO atmosphere in Dulbecco's
modified Eagle's medium supplemented with 10% FCS, 2 mML-glutamine, 50 units/ml penicillin, and 50 µg/ml
streptomycin. Human recombinant IFN-
2 and human recombinant
IFN- (both from Boehringer Ingelheim) were used as a source of
IFNs.
Production of mAbs
BALB/c mice were immunized with
IFN--treated Daudi cells after a procedure of immunosuppression.
The immunosuppression and immunization schedule were adapted from a
procedure described by Matthew and Sandrock(15) . Four
tolerization steps were repeated at 2-week intervals and were followed
by three immunizations with IFN--treated cells. One tolerization
consisted in the injection of 10
untreated Daudi cells at
day 0 followed by three cyclophosphamide injections (100 µg/g) at
days 0, 1, and 2. One immunization consisted in the injection of
10 IFN--treated Daudi cells. The fusion of spleen
cells and Sp2/0 myeloma cells was performed at day 4 after the last
intravenous boosting as described previously(16) .-treated or untreated Daudi cells by flow cytometry.
Positively selected hybridomas were repeatedly cloned by limiting
dilution in the presence of 100 units/ml of recombinant murine
interleukin-6 to maintain Ig secretion. Antibody isotype was determined
using the mouse mAb isotyping kit from Life Technologies. IgM mAbs were
purified by ammonium sulfate precipitation of ascites fluid followed by
exclusion chromatography on A-0,5 resin (Bio-Rad 200-400 mesh),
and their concentration was quantified by enzyme-linked immunosorbent
assay. originally characterized by
Chen et al.(10) ; anti-TAPA-1 antibody
5A6(17) , an IgG (kind gift of Dr. S. Levy,
Stanford University School of Medicine, Stanford CA); anti-CD3 mAb
OKT3, an IgG (obtained from the American Type Culture
Collection); and two isotype-specific control antibodies that were
nonreactive against human cell lines, A4 (an IgG
that is an
anti-idiotypic antibody) and M104E (an IgM directed against B1355S
dextran, kindly provided by Dr. R. Ward (Roswell Park Cancer Institute,
Buffalo, NY)).Fluorocytometric Analysis
Expression of membrane
antigens was measured by indirect immunofluorescence analysis on a
FACSCAN flow cytometer (Becton Dickinson). Briefly, 10
cells were washed 3 times with PBS and incubated in PBS, 0.5%
bovine serum albumin, 0.01% NaN
with saturating amounts of
mAb for 1 h on ice; washed with PBS; and stained in 100 µl of 10
µg/ml goat anti-mouse-Ig-fluorescein isothiocyanate (Sigma) for 1 h
on ice. In each experiment, an isotype-matched negative control mAb was
substituted for the primary mAb to determine background levels of
fluorescence.Immunoprecipitations and Western Blot
Analysis
Cell surface proteins were radioiodinated in vials
coated with Iodogen (Pierce) (18) . Cells were lysed in 2%
Nonidet P-40 buffer (2% Nonidet P-40, 150 mM NaCl, 50 mM Tris, pH 7.5, 2 mM EDTA, 100 units/ml aprotinin) or 1%
CHAPS buffer (1% CHAPS, 150 mM NaCl, 10 mM Tris, pH
7.5, 0.02% NaN, 1 mM phenylmethylsulfonyl
fluoride, 100 units/ml aprotinin, 10 mM iodoacetamide).
Insoluble material was removed by centrifugation, and clear lysates
were passed through two consecutive P6DG (Bio-Rad) columns to eliminate
unreacted iodine. Immunoprecipitations in Nonidet P-40 or in CHAPS
buffer were performed as described
previously(12, 18) . Immunoprecipitated proteins were
separated by SDS-polyacrylamide gel electrophoresis under nonreducing
conditions and blotted electrophoretically to nitrocellulose
(Schleicher & Schuell). Membranes were blocked in 5% nonfat dry
milk, 0.1% Tween 20 in PBS and then incubated for 1 h with the
anti-TAPA-1 mAb 5A6 or a control antibody at 1 µg/ml in 0.1% Tween
20/PBS. Goat anti-mouse Ig-horseradish peroxidase (Amersham Corp.) was
used as secondary antibody, and horseradish peroxidase bound to
nitrocellulose was detected with the ECL chemiluminescence detection
system (Amersham Corp.) followed by exposure on Kodak X-Omat film.
Iodinated proteins were detected by exposure on PhosphorImager screen
(Molecular Dynamics).cDNA Library Construction
Total RNA from HeLa
cells treated for 24 h with 1000 units/ml IFN- was extracted by
the guanidium thiocyanate method followed by ultracentrifugation
through a CsCl cushion(19) . Poly(A) RNA was
isolated by oligo(dT) cellulose chromatography as described by Aviv and
Leder(20) . An oligo(dT) primed library was prepared from 500
ng of poly(A)
RNA using the primer-adapter procedure
described previously(21) . A library of approximately 3
10
independent clones was screened.COS Cells Transfection and Screening by
Panning
Plasmid DNA was prepared using the polyethylene glycol
purification method and was transfected into COS cells using
DEAE-dextran as described previously (22) . Briefly, 2
10 cells in a 10-cm dish were transfected with 12 µg of
DNA in 4 ml of Dulbecco's modified Eagle's medium
containing 800 µg of DEAE-dextran (Pharmacia Biotech Inc.), 200
µM chloroquine diphosphate, and 5% FCS. After 5 h at 37
°C, the transfection medium was removed, and the cells were treated
for 1 min at 4 °C with 10% MeSO in PBS. Cells were then
rinsed twice with PBS and overlaid with Dulbecco's modified
Eagle's medium, 1% FCS for 72 h. Transfected COS cells that
expressed the specific membrane protein were first enriched by
panning(23) , exactly as described previously(24) .
Episomal DNA was recovered from the selected cells by Hirt extraction (25) and used to transform MC1061 bacteria by electroporation.
Plasmid DNA recovered from the transformants was polyethylene
glycol-purified and used to transfect COS cells for the next round of
panning. Six panning cycles were performed. Thereafter, plasmid DNA was
prepared from bacterial pools, then from subpools, and finally from
individual clones.Synthesis of 1-8u cDNA
The 1-8u cDNA
was obtained by reverse transcription polymerase chain reaction using
mRNA isolated from IFN--treated HeLa cells and primers
1-8-5, CGGGATCCCGACCGCCGCTGGTC, and 1-8-3,
CGGAATTCATGCCTCCTGATCTATC, according to the manufacturer protocol
(Perkin Elmer). After restriction with BamHI and EcoRI, the cDNA was inserted into the BamHI-EcoRI-restricted pcD
A vector, a derivative
of pcDNAI/Amp (Invitrogen) in which the SV40 t intron sequence has been
replaced by the sequence of a human -globin intron. 10 constructs
were sequenced and found to contain the 1-8u cDNA sequence. The HindIII-EcoRI 1-8u-containing fragment was
subcloned into the HindIII-EcoRI-restricted pse1
plasmid.Adhesion Assays
100 µl of K562, Jurkat, or
U937 cells at 5 10
cells/ml were distributed in
flat bottom 96-microwell plates with or without 1000 units/ml
IFN-. Each well received an additional 100 µl of medium
containing 1 µg of one of the following mAbs: 13A5, a control IgM,
anti-Leu-13, or a control IgG1. Cells were incubated for 24 h at 37
°C, and adhesion was assessed microscopically.Lymphocyte Proliferation Assays
The effect of
anti-Leu-13 and 13A5 mAb on anti-CD3-driven proliferation of human
lymphocytes was determined essentially as described
previously(4, 10) . Briefly, human peripheral blood
mononuclear cells (PBMC) were isolated from normal donor buffy coat
leukocyte concentrates (American Red Cross, Buffalo, NY chapter) by
Ficoll-Hypaque centrifugation(4, 5) . PBMC were
resuspended at a final concentration of 2.5 10 cells/ml in flat bottom 96-well microtiter plates in RPMI 1640
containing 10% FCS, 100 units/ml penicillin, 100 µg/ml
streptomycin, and 2 mM glutamine. Lymphocyte proliferation was
induced by culturing PBMC in the presence of 0.5 µg/ml of anti-CD3
murine mAb. Anti-Leu-13, 13A5, and isotype-matched control antibodies
were included in anti-CD3-activated cultures at a final concentration
of 10 µg/ml. Each sample was set up in triplicate. At 72 h,
cultures were pulsed with 0.6 µM
[H]thymidine (6.7 Ci/mmol; DuPont NEN), and
[H]thymidine incorporation was measured in a
scintillation counter (Beckman Instruments).
Generation of a Monoclonal Antibody Reactive with a
17-kDa Membrane Protein Induced by IFN-
Daudi cells treated with IFN- on Daudi
Cells were used as a source
of IFN-induced antigens since they are very sensitive to the
antiproliferative activity of type I IFNs (13) . To increase
the frequency of mAbs recognizing IFN--induced antigens, mice were
first injected with untreated Daudi cells and submitted to a
cyclophosphamide regiment in an attempt to selectively kill lymphocytes
stimulated by constitutively expressed Daudi antigens. Tolerization was
followed by immunization with IFN--treated Daudi cells.
Spleenocytes were fused to Sp2/0 myeloma cells, and the resulting
hybridomas were screened by indirect immunofluorescence for secretion
of mAbs reacting differentially with IFN--treated and untreated
Daudi cells.
, reacted with a
protein that was highly inducible by IFN- on Daudi cells. The
antigen recognized by this mAb was characterized by immunoprecipitation
of I-labeled surface proteins from IFN-
-treated or
untreated Daudi cells. SDS-polyacrylamide gel electrophoresis analysis
of the immunoprecipitation products revealed that the molecular mass of
the protein recognized by 13A5 was approximately 17 kDa and that its
expression on Daudi cells was strongly induced upon IFN- treatment (Fig. 1, A and B). The antigen recognized by
13A5 had the same mobility as a predominant IFN-inducible protein that
can be detected in whole I-labeled IFN-
-treated
Daudi cell lysates (Fig. 1, A and C). An
IFN-inducible 17-kDa protein on the surface of Daudi cells has been
previously described and implicated in the antiproliferative activity
of IFN(5, 7) .
-treated
(+) Daudi cells were I-labeled and lysed in Nonidet
P-40 buffer. Immunoprecipitates or crude lysates were resolved on 20%
polyacrylamide gel. A, immunoprecipitation of cell lysates
with 13A5 or a control mAb. B, longer exposure of the gel
shown in A. C, crude lysates. Molecular mass markers
are indicated in kDa on the left.
Expression of the 17-kDa Protein in Response to
Interferons
Established human cell lines differ widely in their
sensitivity to the antiproliferative activity of IFNs. Expression of
the 17-kDa protein in response to type I and II IFNs was assayed by
indirect immunofluorescence on a panel of IFN-sensitive and -resistant
cell lines. Representatives of epithelial, fibroblastic,
promyelomonocytic and lymphoblastoid (B, T, and null) origin were
included (Table 1). DIF8 and Daudi R are mutant cell lines
derived from Daudi cells that were selected for resistance to the
antiproliferative effect of IFN-(13, 14) . U937,
Raji and Namalwa cell growth is also insensitive to the inhibitory
effects of IFN-.
treatment increased the
expression of the 13A5 antigen on most of the cell lines tested. As
much as a 20-fold increase was observed on Daudi, Jurkat, Reh, and
FS-7F cells. Interestingly, the level of induction was very weak on
several resistant cell lines (e.g. on DaudiR or U937) or
undetectable on DIF8. The pattern of expression appeared to correlate
closely with the ability of IFN- to inhibit cell growth. IFN-
also significantly affected the expression of the 17-kDa protein
although to a lesser extent than did IFN-
. Induction of the 17-kDa
protein by IFN- was observed in most cell lines tested, except in
those derived from B or T cells. This result is consistent with our
previous observation that genes that are predominantly induced by type
I IFN are not or very poorly inducible by IFN-
in cell lines of
lymphoblastoid origin(26) . We concluded that the 17-kDa
protein is inducible by both types of IFNs on sensitive cells.
or IFN- induction of the
17-kDa protein. Each cell line was reacted with 13A5 antibody (heavylines) or with a control IgM antibody (thinlines), followed by fluorescein-conjugated
anti-mouse antibody and immunofluorescence was assessed by flow
cytometry.
I-labeled surface proteins with 13A5 showed the high
basal level of the 17-kDa protein on K562 cells (Fig. 3).
Overexposure of the autoradiogram allowed the detection of a 28-kDa
component, similar to the one observed in the proteins
immunoprecipitated by 13A5 from IFN-
-treated Daudi cells (compare Fig. 1B and Fig. 3). Immunoprecipitated proteins
of 17 and 28 kDa were also detected under nonreducing conditions (Fig. 3B). These data suggest that the 17-kDa protein
is noncovalently associated in the cell membrane with a protein of 28
kDa.
-treated (+) K562 cells
were I-labeled and lysed in Nonidet P-40 buffer. 13A5
immunoprecipitates from K562 extracts were resolved on 20%
polyacrylamide gel under reducing conditions (A) or under
nonreducing conditions (B). Molecular mass markers are
indicated in kDa on the right of each gel.
Expression Cloning of the cDNA Coding for the 17-kDa
Protein
We constructed a directional cDNA expression library in
the pse1 vector (21) using mRNA extracted from HeLa cells that
had been incubated for 24 h in the presence of IFN-. Screening of
transfected cells reactive with the 13A5 mAb was undertaken using the
``panning'' method previously described for the cloning of
various eukaryotic membrane
proteins(17, 23, 24, 27) . Six
successive amplification and enrichment cycles were performed. Each
consisted of 4 steps: (1) transfection of the library into COS
cells, (2) selection of the positive cells by panning, (3) isolation of the plasmid DNA by Hirt extraction, (4) amplification of the recovered plasmid DNA in bacteria.
Three additional screening cycles were performed by transfecting
plasmid extracted from counted colony pools and by detecting the
positive pools by indirect immunofluorescence. This procedure lead to
the isolation of two identical clones containing a cDNA insert of 650
base pairs. COS cells transfected with the cDNA from one of these
clones was strongly reactive with the 13A5 mAb, as determined by flow
cytometric analysis (Fig. 4A).
T), 391 (C
T), 499 (G
A), 624
(C
T), and 643 (G
A) of the previously cloned 9-27
cDNA. Only the replacement at position 624 results in a modification in
the peptide sequence (Ser
Leu). These divergences
are probably due to allelic variations. The 9-27 cDNA was first
isolated on the basis of its IFN inducibility (28) and is part
of a family containing at least two other members, 1-8u and
1-8d, both IFN-inducible as well. The isolated cDNA was
full-length, containing the entire open reading frame of 9-27
preceded by a 5`-untranslated region corresponding to the second start
site of transcription reported for the 9-27 gene(29) .
The 9-27 Gene Encodes Leu-13
Leu-13 is a
16-kDa leukocyte surface antigen whose expression is stimulated on
endothelial cells and B lymphocytes after exposure to both types of
IFNs(4, 5, 10, 30) . Previous
immunoprecipitation studies have established that Leu-13 is
noncovalently associated with polypeptides of 28, 48, and 90
kDa(10, 12) . Taken together, these observations
prompted us to determine if the 9-27 gene, or the closely related
1-8u or 1-8d genes, encoded the Leu-13 antigen. In the
experiment shown in Fig. 4A, COS cells transfected with
the 9-27 cDNA were first reacted with 13A5 and anti-Leu-13 mAbs
and then were counterstained with a fluorescein-conjugated antibody and
analyzed by flow cytometry. Fig. 4A shows that both the
13A5 and anti-Leu-13 mAbs positively reacted with COS cells transfected
by the 9-27 encoding plasmid but not with the cells transfected
with the control plasmid. We conclude that 13A5 and anti-Leu-13 each
recognize an epitope in the 9-27 protein.Proteins Coprecipitated with the 17-kDa Protein
We
next investigated whether the 28-kDa protein coprecipitated with the
17-kDa protein by 13A5 could correspond to TAPA-1. TAPA-1 is a 26-kDa
protein that can associate with
Leu-13(8, 9, 11, 12) . I-labeled K562 cells were lysed in a 2% Nonidet P-40
buffer, as described previously in Fig. 3, or in buffer
containing 1% CHAPS, a mild nonionic detergent, to preserve most of the
noncovalent protein interactions. Fig. 5A shows that
the protein whose interaction with 17-kDa protein is preserved in the
Nonidet P-40 lysate did not correspond to TAPA-1. However, when the
cells were lysed in the milder CHAPS buffer, several proteins were
precipitated with either 5A6, the anti-TAPA-1 mAb, or 13A5, the
anti-9-27-encoded 17-kDa protein mAb. Using the 5A6 mAb, TAPA-1
was detected by Western blot among the proteins precipitated with the
13A5 mAb in CHAPS lysate (Fig. 5B), in agreement with
previously reported results obtained using anti-Leu-13
mAb(8, 9, 11, 12) . The 28-kDa
protein coprecipitated by 13A5, but not by 5A6, from Nonidet P-40
lysate appeared in both precipitation products when CHAPS lysate was
used. Thus 9-27/Leu-13 is associated with several proteins at the
cell surface, including TAPA-1, and the strength of these interactions
can be probed using different detergents.
I-labeled
and lysed in Nonidet P-40 buffer (lanes1 and 2) or in CHAPS buffer (lanes3 and 4). These cell extracts were immunoprecipitated by 5A6, the
anti-TAPA-1 antibody (lanes1 and 3), or by 13A5 (lanes2 and 4). Arrows, from higher to lower molecular mass, correspond to
p28, TAPA-1, 9-27. Molecular masses are given in kDa. B,
the same immunoprecipitates shown in A were separated by
SDS-polyacrylamide gel electrophoresis under nonreducing conditions,
transferred to a nitrocellulose sheet, and the presence of TAPA-1 was
revealed using the 5A6 antibody, a horseradish peroxidase-conjugated
anti-mouse antibody, and ECL chemiluminescence. Upperbands correspond to the antibodies used in the
immunoprecipitation.
Effect of 13A5 and anti-Leu-13 mAbs on Homotypic Adhesion
and Proliferation
Previous studies using anti-Leu-13 mAb have
established that this mAb can induce the homotypic adhesion of cells
expressing Leu-13 (4, 5, 10) and can inhibit
the anti-CD3-driven proliferation of
PBMC(4, 12, 17) . Fig. 6A shows the results of an homotypic adhesion assay on U937, Jurkat,
and K562 cells using 13A5, anti-Leu-13, and control mAbs.
Interestingly, the 13A5 mAb did not induce cell adhesion. In contrast,
the anti-Leu-13 mAb triggered adhesion of cells expressing
9-27/Leu-13, either constitutively (K562 or Jurkat), or in
response to IFN treatment (U937). Similarly, the 13A5 mAb had no
significant effect on the anti-CD3-driven proliferation of PBMC as
measured by incorporation of [H]thymidine, while
anti-Leu-13 mAb inhibited proliferation by more than 50% (Fig. 6B). These results suggest that 13A5 and
anti-Leu-13 mAbs reacted with distinct epitopes on the
9-27/Leu-13 molecule and that the latter mAb could mimic an
interaction with a physiological ligand, inducing a biological
response.
(+ifn or
-ifn) in the presence of the indicated mAbs at a final
concentration of 5 µg/ml. Control IgG1 and control IgM had no
effect on cell-to-cell adhesion. B, anti-Leu-13 inhibits
anti-CD3-driven proliferation of human PBMC. Human PBMC were cultured
in the absence or presence of 0.5 µg/ml of anti-CD3 mAb.
Anti-Leu-13, 13A5, or isotype-matched control antibodies were included
in cultures at a concentration of 10 µg/ml.
[H]thymidine incorporation was measured on day 3
of culture. Results represent the mean ±S.D. of replicate
cultures. Data are representative of three independent
experiments.
/G phase of the cell
cycle(37, 38, 39, 40) . on
leukemic B cells(4) . Insensitivity to the growth inhibitory
effect of anti-Leu-13 and anti-TAPA-1 mAbs in some cell lines can
probably be accounted for by the alterations in the control of cell
growth that occur when a cell line is established for in vitro growth. We also attempted to establish cell lines stably
expressing 9-27/Leu13 under the control of a constitutive
promoter. Although some clones did express heterogeneous levels of the
protein early in the selection procedure as revealed by staining,
expression rapidly declined to undetectable levels (data not shown).
This result suggested that stable expression of 9-27/Leu13 might
be hindering cell growth.
)
We thank Drs. M. Tovey and A. Hovanessian for
providing the Daudi resistant cell lines. We thank P. Berr for
excellent technical assistance and the members of the laboratories of
Drs. P. Ferrara and D. Caput for kind help in expression cloning
procedures. We also thank Drs. M. Van Mechelen and F. Andris for help
with immunological methods and Dr. M. Hosobuchi for critical reading of
the manuscript. We thank Boehringer Ingelheim for the generous supply
of recombinant IFN- and -.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  Y. Xu, G. Yang, and G. Hu Binding of IFITM1 enhances the inhibiting effect of caveolin-1 on ERK activation Acta Biochim Biophys Sin, June 1, 2009; 41(6): 488 - 494. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. M. Cameron, M. J. Cameron, J. F. Bermejo-Martin, L. Ran, L. Xu, P. V. Turner, R. Ran, A. Danesh, Y. Fang, P.-K. M. Chan, et al. Gene Expression Analysis of Host Innate Immune Responses during Lethal H5N1 Infection in Ferrets J. Virol., November 15, 2008; 82(22): 11308 - 11317. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Hatano, Y. Kudo, I. Ogawa, T. Tsunematsu, A. Kikuchi, Y. Abiko, and T. Takata IFN-Induced Transmembrane Protein 1 Promotes Invasion at Early Stage of Head and Neck Cancer Progression Clin. Cancer Res., October 1, 2008; 14(19): 6097 - 6105. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Nilsson, P. Eden, E. Olsson, R. Mansson, I. Astrand-Grundstrom, B. Strombeck, K. Theilgaard-Monch, K. Anderson, R. Hast, E. Hellstrom-Lindberg, et al. The molecular signature of MDS stem cells supports a stem-cell origin of 5q myelodysplastic syndromes Blood, October 15, 2007; 110(8): 3005 - 3014. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Han, K. J Austin, L. A Rempel, and T. R Hansen Low blood ISG15 mRNA and progesterone levels are predictive of non-pregnant dairy cows. J. Endocrinol., November 1, 2006; 191(2): 505 - 512. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Pellagatti, M. Cazzola, A. A. N. Giagounidis, L. Malcovati, M. G. D. Porta, S. Killick, L. J. Campbell, L. Wang, C. F. Langford, C. Fidler, et al. Gene expression profiles of CD34+ cells in myelodysplastic syndromes: involvement of interferon-stimulated genes and correlation to FAB subtype and karyotype Blood, July 1, 2006; 108(1): 337 - 345. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Klein, S. Bauersachs, S. E. Ulbrich, R. Einspanier, H. H.D. Meyer, S. E.M. Schmidt, H.-D. Reichenbach, M. Vermehren, F. Sinowatz, H. Blum, et al. Monozygotic Twin Model Reveals Novel Embryo-Induced Transcriptome Changes of Bovine Endometrium in the Preattachment Period Biol Reprod, February 1, 2006; 74(2): 253 - 264. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Munoz-Jordan, M. Laurent-Rolle, J. Ashour, L. Martinez-Sobrido, M. Ashok, W. I. Lipkin, and A. Garcia-Sastre Inhibition of Alpha/Beta Interferon Signaling by the NS4B Protein of Flaviviruses J. Virol., July 1, 2005; 79(13): 8004 - 8013. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 H. Lickert, B. Cox, C. Wehrle, M. M. Taketo, R. Kemler, and J. Rossant Dissecting Wnt/{beta}-catenin signaling during gastrulation using RNA interference in mouse embryos Development, June 1, 2005; 132(11): 2599 - 2609. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Becker, A. Sommer, J. R. Kratzschmar, H. Seidel, H.-D. Pohlenz, and I. Fichtner Distinct gene expression patterns in a tamoxifen-sensitive human mammary carcinoma xenograft and its tamoxifen-resistant subline MaCa 3366/TAM Mol. Cancer Ther., January 1, 2005; 4(1): 151 - 170. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. Hanna, P. Bechtel, Y. Zhai, F. Youssef, K. McLachlan, and O. Mandelboim Novel Insights on Human NK Cells' Immunological Modalities Revealed by Gene Expression Profiling J. Immunol., December 1, 2004; 173(11): 6547 - 6563. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C.E. Hoei-Hansen, J.E. Nielsen, K. Almstrup, M.A. Hansen, N.E. Skakkebaek, E. Rajpert-DeMeyts, and H. Leffers Identification of genes differentially expressed in testes containing carcinoma in situ Mol. Hum. Reprod., June 1, 2004; 10(6): 423 - 431. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Zucchi, A. Prinetti, M. Scotti, V. Valsecchi, R. Valaperta, E. Mento, R. Reinbold, P. Vezzoni, S. Sonnino, A. Albertini, et al. Association of rat8 with Fyn protein kinase via lipid rafts is required for rat mammary cell differentiation in vitro PNAS, February 17, 2004; 101(7): 1880 - 1885. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. L. Afonso, M. E. Piccone, K. M. Zaffuto, J. Neilan, G. F. Kutish, Z. Lu, C. A. Balinsky, T. R. Gibb, T. J. Bean, L. Zsak, et al. African Swine Fever Virus Multigene Family 360 and 530 Genes Affect Host Interferon Response J. Virol., February 15, 2004; 78(4): 1858 - 1864. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.A. SURANI, K. ANCELIN, P. HAJKOVA, U.C. LANGE, B. PAYER, P. WESTERN, and M. SAITOU Mechanism of Mouse Germ Cell Specification: A Genetic Program Regulating Epigenetic Reprogramming Cold Spring Harb Symp Quant Biol, January 1, 2004; 69(0): 1 - 10. [Abstract] [PDF]
|
|
|
|
|
|
D. Okamura, T. Kimura, T. Nakano, and Y. Matsui Cadherin-mediated cell interaction regulates germ cell determination in mice Development, December 29, 2003; 130(26): 6423 - 6430. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Munoz-Jordan, G. G. Sanchez-Burgos, M. Laurent-Rolle, and A. Garcia-Sastre Inhibition of interferon signaling by dengue virus PNAS, November 25, 2003; 100(24): 14333 - 14338. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. L. Brassard, M. J. Grace, and R. W. Bordens Interferon-{alpha} as an immunotherapeutic protein J. Leukoc. Biol., April 1, 2002; 71(4): 565 - 581. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. K. Pru, K. J. Austin, A. L. Haas, and T. R. Hansen Pregnancy and Interferon-{tau} Upregulate Gene Expression of Members of the 1-8 Family in the Bovine Uterus Biol Reprod, November 1, 2001; 65(5): 1471 - 1480. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. V. Terskikh, M. C. Easterday, L. Li, L. Hood, H. I. Kornblum, D. H. Geschwind, and I. L. Weissman From the Cover: From hematopoiesis to neuropoiesis: Evidence of overlapping genetic programs PNAS, July 3, 2001; 98(14): 7934 - 7939. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Liu, Y. Li, V. Prabhu, L. Young, K. G. Becker, P. J. Munson, and N.-p. Weng Augmentation in Expression of Activation-Induced Genes Differentiates Memory from Naive CD4+ T Cells and Is a Molecular Mechanism for Enhanced Cellular Response of Memory CD4+ T Cells J. Immunol., June 15, 2001; 166(12): 7335 - 7344. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Zucchi, L. Bini, R. Valaperta, A. Ginestra, D. Albani, L. Susani, J. C. Sanchez, S. Liberatori, B. Magi, R. Raggiaschi, et al. Proteomic dissection of dome formation in a mammary cell line: Role of tropomyosin-5b and maspin PNAS, April 25, 2001; (2001) 91101898. [Abstract] [Full Text]
|
|
|
|
 |
|
 H. Huang, S. Colella, M. Kurrer, Y. Yonekawa, P. Kleihues, and H. Ohgaki Gene Expression Profiling of Low-Grade Diffuse Astrocytomas by cDNA Arrays Cancer Res., December 1, 2000; 60(24): 6868 - 6874. [Abstract] [Full Text]
|
|
|
|
|
|
I. Zucchi, C. Montagna, L. Susani, P. Vezzoni, and R. Dulbecco The rat gene homologous to the human gene 9-27 is involved in the development of the mammary gland PNAS, February 3, 1998; 95(3): 1079 - 1084. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. W. Baird, K. M. Ryan, I. Hayes, L. Hampson, C. M Heyworth, A. Clark, M. Wootton, J. D. Ansell, U. Menzel, N. Hole, et al. Differentiating Embryonal Stem Cells Are a Rich Source of Haemopoietic Gene Products and Suggest Erythroid Preconditioning of Primitive Haemopoietic Stem Cells J. Biol. Chem., March 16, 2001; 276(12): 9189 - 9198. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Zucchi, L. Bini, R. Valaperta, A. Ginestra, D. Albani, L. Susani, J. C. Sanchez, S. Liberatori, B. Magi, R. Raggiaschi, et al. Proteomic dissection of dome formation in a mammary cell line: Role of tropomyosin-5b and maspin PNAS, May 8, 2001; 98(10): 5608 - 5613. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |