Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Essink, B. B. O.
Right arrow Articles by Berkhout, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Essink, B. B. O.
Right arrow Articles by Berkhout, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 40, Issue of October 06, pp. 23867-23874, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Structural Requirements for the Binding of tRNA to Reverse Transcriptase of the Human Immunodeficiency Virus Type 1 (*)

(Received for publication, June 9, 1995; and in revised form, August 2, 1995)

Belinda B. Oude Essink Atze T. Das Ben Berkhout (§)

From the Department of Virology, Academic Medical Center, University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, the Netherlands

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Reverse transcription of the human immunodeficiency virus type 1 (HIV-1) RNA genome is primed by the cellular tRNA(3) molecule. Packaging of this tRNA primer during virion assembly is thought to be mediated by specific interactions with the reverse transcriptase (RT) protein. Portions of the tRNA molecule that are required for interaction with the RT protein remain poorly defined. We have used an RNA gel mobility shift assay to measure the in vitro binding of purified RT to mutant forms of tRNA(3). The anticodon loop could be mutated without eliminating RT recognition. However, mutations in the TC stem were found to partially interfere with RT binding, and D arm mutants were completely inactive in RT binding. Interestingly, binding of the RT protein to tRNA(3) facilitates the subsequent annealing of template strand to the 3`-terminus of the tRNA molecule. Consistent with this finding, we demonstrate that mutant HIV-1 virions lacking the RT protein do contain a viral RNA genome without an associated tRNA(3) primer. We also found that a preformed primer tRNA-template complex is efficiently recognized by RT protein in vitro. Extension of the template molecule over the TC loop did result in complete inhibition of RT binding, suggesting the presence of additional recognition elements in the TC loop. These results, combined with a comparative sequence analysis of tRNA species present in HIV-1 virions and RNA motifs selected in vitro for high affinity RT binding, suggest that RT recognizes the central domain of the tRNA tertiary structure, which is formed by interaction of the D and TC loops.


INTRODUCTION

Retroviruses contain large amounts of tRNA, which is a non-random subset of the cellular tRNA pool (reviewed in (1) ). One tRNA species can anneal to the viral RNA genome and acts as a primer for cDNA synthesis by the viral reverse transcriptase enzyme (RT), (^1)and this priming species is generally dominant among the tRNAs included in the particles. Different viruses use a different tRNA primer; avian retroviruses (e.g. avian myeloblastosis virus) use tRNA, most murine retroviruses and the human T-cell leukemia viruses (HTLV-I and HTLV-II) use tRNA, and the human (HIV) and simian immunodeficiency viruses use tRNA(3)(1, 2, 3, 4, 5) . There is accumulating evidence that packaging of the correct tRNA primer is determined by the RT protein. First, the RT proteins of the avian myeloblastosis virus and HIV-1 retroviruses have been shown to bind to their respective tRNA primers in vitro(6, 7) . Second, the primer tRNA is apparently absent from virus particles that lack the RT protein(8, 9, 10) . Alternatively, it is conceivable that the primer is specifically co-packaged with the RNA genome through annealing of the 3`-terminal 18 nucleotides of the tRNA primer to a perfect complementary sequence on the viral genome, the so-called primer binding site (PBS). This complex may be further stabilized through additional base-pairing interactions between the two RNA molecules (11, 12, 13, 14, 15, 53) . For the Rous sarcoma virus and HIV-1, however, it was reported that the tRNA primer is included in particles that lack viral RNA sequences encoding the PBS(3, 4, 10, 16, 17) . These combined results suggest that the affinity for RT determines, at least in part, which tRNA species will be packaged.

A complex between the HIV-1 RT protein and the tRNA(3) primer has been identified in vitro using a variety of experimental approaches(7, 18, 19, 20, 21, 22, 23, 24, 25) . However, the question of binding specificity of HIV-1 RT toward its cognate primer remains unresolved. For instance, several studies reported binding of other tRNA species with equal affinity(13, 20, 23) . Based on UV cross-linking experiments, Barat et al. (7) have reported that HIV-1 RT interacts with its cognate primer tRNA(3) by virtue of specific contacts with the anticodon stem-loop(7) . It remains to be established whether solely the anticodon domain of tRNA(3) is in contact with the enzyme. For instance, nuclease footprinting analysis suggested mild protection of all three loops by RT(25) .

It was demonstrated that an in vitro synthesized tRNA(3) transcript can functionally substitute for its natural counterpart in RT binding studies and reverse transcription assays(13, 18, 24, 25) . It was also shown that synthetic tRNA(3) adopts the correct L-shaped structure, suggesting that all base pairs and tertiary interactions (e.g. between D and TC loops) are formed in the absence of base modifications(25) . Apparently, synthetic tRNA transcripts contain all sequence and structure requirements for recognition by the RT enzyme, although modified nucleotides may be important for fine tuning tRNA identity(13, 18, 26) . Therefore, to a first approximation, rules that apply to the selective recognition of tRNA(3) by the HIV-1 RT protein may be obtained in in vitro experiments with synthetic tRNA species. This allows a mutational analysis of the sequence and structure requirements in tRNA(3) for RT binding.

Here, we probed the binding site for RT on synthetic tRNA(3) in bandshift binding experiments with mutated tRNA molecules and demonstrate that the anticodon loop is not important for RT binding. In contrast, we found that mutations in the D-stem loop abolished RT binding. Furthermore, we demonstrate that annealing of an antisense oligonucleotide mimicking the PBS sequence to tRNA(3) was possible at 37 °C with the RT-tRNA complex but not with free tRNA, suggesting that RT opens the acceptor stem to allow intermolecular base pairing. A preformed tRNA(3)-PBS complex, in which both acceptor and TC stems will be disrupted, was efficiently recognized by RT protein. Extension of this oligonucleotide by five nucleotides, thereby forming a duplex with the TC loop nucleotides, was found to completely block RT binding. These data, combined with results of a recent SELEX experiment (27) and a comparative sequence analysis of the tRNA species present in HIV-1 virions(4) , suggest that the tertiary tRNA structure and the sequence of the D arm of tRNA(3) is critically important for recognition by the RT protein.


MATERIALS AND METHODS

Plasmids were constructed to facilitate transcription of the tRNA(3) gene with T7 RNA polymerase. Clones for wild-type (wt) tRNA(3) and several mutants were constructed from a series of three overlapping DNA oligonucleotides that contained the tRNA sequence flanked by an upstream T7 RNA polymerase promoter and a downstream BanI restriction site to allow run-off transcription. Oligonucleotide 1-wt contained the wild-type tRNA(3) sequence 5`-CTCACTATAGGCCCGGATAGCTCAGTCGGTAGAGCATCAGACTTTTAATCTGAGGGTCCAGGGTTCAAGTCCCTG-3` (overlap regions underlined). Similar oligonucleotides with specific mutations in different tRNA domains were synthesized (see Fig. 1). The central, sense oligomers 1 were individually annealed to 3`-antisense oligonucleotide 2, which encoded BanI and EcoRI restriction sites for transcription and cloning purposes, respectively: 5`ATGGAATTCCCTGGCGCCCGAACAGGGACTTGAA-3` (sites in bold, overlap underlined). The DNA duplex synthesized in a PCR reaction with oligomers 1 and 2 was extended by the 5`-sense oligonucleotide 3, containing a T7 promoter and a BamHI site: 5`CATGGATCCTAATACGACTCACTATAGGC-3` (site in bold, overlap underlined). An initial PCR reaction was performed with 5 ng of central oligonucleotide 1 and a molar excess of 5` and 3` oligonucelotides 2 and 3 (100 ng each, 35 cycles of 1 min, 95 °C; 1 min, 55 °C; and 1 min, 72 °C). A sample was subsequently used in a second PCR reaction with a 100 ng of primers 2 and 3 (100 ng each, PCR protocol as indicated above). The final PCR product was digested with BamHI and EcoRI and inserted into plasmid pUC9. All plasmids were checked directly by sequencing.


Figure 1: Secondary structure models of natural and synthetic tRNA(3). The shadedregions were mutated in synthetic tRNA(3) as indicated (, deletion) and studied in this work. Base modifications within the D, anticodon, and TC arms in natural tRNA(3) are indicated according to standard nomenclature(36) ; A^1, 1-methyladenosine; A9, N-((9-beta-D-ribofuranosyl-2-methylthiopurine-2-yl)-carbamoyl)threonine; C^5, 5-methylcytidine; D, dihydrouridine; G^2, N(2)-methylguanosine; G^7, 7-methylguanosine; T^3, 2`-O-methyl-5-methyluridine; U^9, 5-methoxycarbonylmethyl-2-thiouridine; , pseudouridine. The 5`- and 3`-extended tRNA forms contained 24 and 5 additional nucleotides, respectively (5`, ggauccuaauacgacucacuauag; 3`, caggg).



The BanI restriction site was used to allow run-off transcription of a 74-nucleotide-long tRNA(3) transcript. We initially failed to obtain BanI cleavage, which was shown to result from methylation of an overlapping dcm recognition sequence(28) . To circumvent this problem, we transformed all pUC-tRNA(3) plasmids into the dcm host GM48. Unlabeled T7 transcripts were synthesized according to standard methods(29, 30) . tRNA(3) was internally labeled with [alpha-P]UTP during in vitro synthesis in a 2-h reaction with 1 µg of linearized DNA in 12 µl of T7 buffer (20 mM Tris-HCl, pH 7.5, 2 mM spermidine, 10 mM dithiothreitol, 12 mM MgCl(2)) containing 0.5 mM G/A/CTP, 0.16 mM UTP and 2 µl of [alpha-P]UTP (800 Ci/mmol), 50 units of T7 RNA polymerase and 10 units of RNase inhibitor. Upon DNase treatment and phenol extraction, the RNA was ethanol precipitated, dissolved in renaturation buffer (10 mM Tris-HCl, pH 7.5, 100 mM NaCl), and refolded by incubation at 85 °C for 2 min, followed by slow cooling to room temperature. The recombinant HIV-1 RT enzyme was obtained from Dr. D. Stammers (Wellcome Research Labs, Beckenham, Kent). This purified protein is in the 66,000 homodimer form and supplied at a 0.13 µg/µl concentration (38,000 enzyme units/mg protein) in 0.8 M ammonium sulfate, 20 mM Tris, 100 mM NaCl, 0.1 mM EDTA, 0.5 mM dithiothreitol. Moloney murine leukemia virus RT was obtained from Life Technologies, Inc., and avian myeloblastosis virus RT was from Boehringer Mannheim.

The affinity of RT for tRNA was measured by gel-bandshift assay(31) . In some experiments, tRNA was pre-incubated with oligonucleotides as indicated in the figure legends. Oligonucleotide PBS is 5`-TGGCGCCCGAACAGGGAC-3`, oligonucleotide 3 and PBS, which is identical to oligonucleotide 2, were described in the PCR protocol (see above). A standard RT binding reaction mixture (20 µl) contained 10 ng of uniformly labeled tRNA probe in buffer (20 mM Tris-HCl, pH 7.5, 50 mM NaCl, 0.1 mM EDTA, and 5% glycerol) with 0.26 µg of RT protein. The final concentration of HIV-1 RT was 100 nM, that of the tRNA molecule was 20 nM, and that of oligonucleotide was geq500 nM. After incubation for 15 min at 20 °C, the samples were separated on a 5% non-denaturing polyacrylamide gel in 0.25 times TBE containing 5% glycerol. Electrophoresis at 30 V was for approximately 18 h at room temperature. Gels were dried and exposed to x-ray film at -80 °C using intensifying screens. For quantitation, gels were exposed overnight in a Molecular Dynamics phosphorimager.

The full-length molecular HIV-1 clone pLAI was used to construct an RT-deficient viral genome (RT). Details of the DNA construction are presented elsewhere(32) . All techniques (cell culture, DNA transfection, virus purification, isolation of HIV-1 genomic RNA, and subsequent tRNA or oligonucleotide primer extension assays) were previously described(33) .


RESULTS

Binding of HIV-1 RT to tRNA(3)Requires an Intact D Arm but No Specific Anticodon Loop Sequences

We have used gel-bandshift assays to establish that in vitro made human tRNA(3) (Fig. 1) can bind to the HIV-1 RT protein in the absence of either the primer binding site on viral RNA or additional protein factors. Complex formation was readily detected as a shift in the mobility of the riboprobe in the gel (Fig. 2A, compare lanes1 and 2). A variety of parameters affecting the binding of the RT protein to tRNA(3) was studied, and binding conditions were optimized (results not shown). For instance, binding was found to be temperature independent (0-37 °C) and completed in a 10-min incubation. Complex formation was strongly inhibited by greater than 100 mM NaCl or 100 mM MgCl(2). Binding was observed in the presence of vast excess of 5 S rRNA added as a nonspecific competitor (1 µg or approximately 25 pmol). Furthermore, no RT-tRNA(3) complexes were obtained with RT enzymes of the Moloney murine leukemia and avian myeloblastosis viruses (data not shown).


Figure 2: RT binding activity of wt and mutant tRNA(3) as measured by the gel shift assay. A, the labeled tRNA(3) probes indicated on top of the panel were incubated in the presence and absence of HIV-1 RT protein (+ and -) and subjected to electrophoresis on a native polyacrylamide gel followed by autoradiography. The migration positions of free and RT-associated tRNA(3) are indicated at the rightside of the panel. B, comparison of the relative RT binding capacity of wt and mutant tRNA(3) molecules. Gel shift assays as shown in panelA were quantitated using a phosphorimager. The amount of probe RNA bound to RT was calculated, and binding activity obtained with wt tRNA(3) was set at 100%. Activities are means from at least four (5`ext) and up to eight (wt, D) separate experiments. Variations in values between experiments differed by <20%. The three point mutations (C3 U, G10 C, C13 U) are in the context of the AC mutant.



The specificity of the interaction between the HIV-1 RT protein and tRNA(3) implies that the tRNA molecule contains features that distinguish it from other transcripts. In differentiating among cellular tRNAs, the unique nucleotide sequence of the anticodon loop may form such an identity element. Consistent with this idea, cross-linking experiments revealed contacts between RT and the anticodon loop of tRNA(3)(7) . To assess the sequence-specific contribution of this tRNA domain to RT recognition, we constructed a 6-base substitution mutant (Fig. 1, AC mutant). Gel shift assays with wt and mutant tRNA(3) are shown in Fig. 2A and quantitated in Fig. 2B. The AC mutant consistently showed normal levels of RT binding when compared to wt tRNA(3) (Fig. 2A, lanes14 and 2, respectively). To further define the sequence and structure requirements for the binding of RT to tRNA(3), two additional mutants were made: one substituting 4 bases in the TC stem (Fig. 1, TC mutant), and the other carrying a 6-nucleotide deletion in the D arm (D mutant). Mutations in the D arm affected RT binding most severely (Fig. 2A, lane4), and a partial reduction in RT binding efficiency was measured for the TC mutant (lane6).

We also analyzed the RT binding capacity of 3-point mutants that were fortuitously obtained in the context of the AC mutant (C3 U, G10 C, C13 U). Compared to the AC mutant, we consistently measured reduced RT recognition (20-30%) for the two D arm mutants (G10 C and C13 U), whereas 70% binding was measured for the acceptor stem mutant (C3 U). The results of these binding assays are summarized in Fig. 2B. The combined data suggest that the sequence and structure of the D arm in tRNA(3) is critically important for RT binding.

To investigate whether RT could bind to extended forms of tRNA(3) with additional nucleotides added to either its 5`- or 3`-end, we synthesized two different transcripts. First, we used an aberrant plasmid construct with two tandem T7 promoter elements. Transcription of this plasmid will produce a mixture of two RNAs, wt tRNA(3) and a 5`-elongated form with 24 additional nucleotides (Fig. 2A, lane11). RT binding assays indicated that this 5`-extended tRNA(3) did efficiently form a complex with the RT protein (lane12). Second, we generated 3`-extended transcripts by using the downstream EcoRI restriction site for run-off transcription. This results in the synthesis of a 79-nucleotide-long transcript, which is 5 nucleotides longer than wt tRNA(3) (Fig. 2A, lane15). It should be noted that this 3`-elongated transcript is only 3 nucleotides longer than natural tRNA(3) because our synthetic wt tRNA is lacking the 3`-terminal CA dinucleotide (Fig. 1). In contrast to the results obtained for 5`-extended tRNA, we consistently measured reduced RT binding for the 3`-extended molecule (lane16). Furthermore, we measured no binding activity for a transcript with 171 additional 3`-nucleotides (data not shown).

We observed some surprising effects of the tRNA(3) size variants on the electrophoretic mobility of the binary RT complexes. As expected, the free 5`-extended tRNA(3) molecule migrated slower in the polyacrylamide gel compared to wt tRNA(3) (Fig. 2A, lane11). The complex of RT protein with this extended RNA mutant, however, ran ahead of the wt tRNA(3)-RT complex (lane12). This result was confirmed in binding experiments with a gel-eluted, purified form of the 5`-extended tRNA (data not shown). It seems plausible that it is primarily the conformation of the RNA-protein complex and not so much the molecular weight of its constituents that determines the migration in a native gel. Since it has been reported that the RT polypeptide is a flexible protein and that substantial conformational changes occur upon primer binding(34) , our findings may suggest that this primer-induced conformational change in RT is affected by 5`-extension of the tRNA(3) primer. No such migration effect was observed for the RT complexed with the 3`-extended form of tRNA(3) (lane16).

Reverse Transcriptase Can Recognize a Preformed tRNA-PBS Complex

We next tested whether a preformed tRNA(3)-PBS complex could still be specifically recognized by the RT protein. We therefore synthesized an oligonucleotide that mimics the PBS sequence of the HIV-1 template RNA. This PBS oligonucleotide can form a 16-base pair duplex with the 3`-end of synthetic tRNA(3) (Fig. 1, nucleotide positions 59-74), thereby disrupting both the acceptor and TC stem regions. To follow both nucleic acid moieties, we performed binding assays with P label on either the tRNA(3) primer or the PBS template (Fig. 3, A and B, respectively). Formation of the tRNA-PBS complex was found to be dependent on a denaturation step (lanes3), which is expected because the tRNA cloverleaf structure needs to be partially unfolded for the PBS oligonucleotide to gain access to its target sequence in the acceptor and TC stems. Most importantly, we detected a ``supershifted'' RT-tRNA-PBS complex upon subsequent incubation with HIV-1 RT (lanes4). This ternary complex can be visualized with either a labeled tRNA or PBS species. These results indicate that RT can specifically recognize the preformed tRNA-PBS complex. Alternatively, RT may have bound the tRNA and DNA probes as individual molecules, perhaps by using different protein domains. We can rule out this possibility because formation of the ternary complex is dependent on the presence of a pre-assembled tRNA-PBS complex and not seen with both RNA/DNA components present as individual molecules due to a 0 °C pre-incubation (lanes5). Furthermore, ternary complex formation was specific for the PBS oligonucleotide and not seen with unrelated probes that do not bind tRNA(3) (e.g. oligonucleotide 3 in Fig. 4A, lane6).


Figure 3: RT can recognize a preformed tRNA(3)-PBS complex. A, gel shift assay with P-labeled tRNA(3) in the absence or presence of RT and the primer binding site oligonucleotide PBS (indicated on top of the panel). tRNA(3) was pre-incubated with excess PBS oligonucleotide (3 µg) either for 15 min at 0 °C or for 2 min at 85 °C, followed by slow cooling to 20 °C. The subsequent incubation with RT was for 15 min at 20 °C. The migration position of the individual RNA/DNA components and the binary and tertiary complexes are indicated. The slower migrating RNA species present in the tRNA sample (lane1) is a tRNA conformer that disappeared under denaturing gel electrophoresis conditions (data not shown). B, gel shift assay with P-labeled PBS oligonucleotide in the absence or presence of RT and the tRNA(3) primer (indicated on top of the panel). tRNA(3) was pre-incubated with PBS either for 15 min at 0 °C or for 2 min at 85 °C, followed by slow cooling to 20 °C. The subsequent incubation with RT was for 15 min at 20 °C. A longer exposure of lanes3 and 4 is shown to allow identification of the P PBS oligonucleotide in the ternary complex with RT and tRNA(3).




Figure 4: Inhibition of the RT-tRNA(3) binding by masking of the TC loop. A, gel shift assay with P-labeled tRNA(3) in the absence or presence of RT, the PBS, or the control oligonucleotide 3 (indicated on top of the panel). tRNA(3) was pre-incubated with 3 µg of the oligonucleotides indicated either for 15 min at 0 °C or for 2 min at 85 °C, followed by slow cooling to 20 °C. The subsequent incubation with RT was for 15 min at 20 °C. The migration position of the individual RNA/DNA components and the binary complexes are indicated. The slower migrating RNA species present in the tRNA sample is a conformer that disappeared under denaturing gel electrophoresis conditions (data not shown). B, gel shift assay with the P-labeled PBS oligonucleotide in the absence or presence of RT and the tRNA(3) primer (indicated on top of the panel). tRNA(3) was pre-incubated with PBS either for 15 min at 0 °C or for 2 min at 85 °C, followed by slow cooling to 20 °C. The subsequent incubation with RT was for 15 min at 20 °C.



As described earlier, we observed some unexpected gel migration effects with RT-nucleic acid complexes. Although no linear relationship exists between the size of a nucleic acid-protein complex and its electrophoretic mobility on native gels, we do think that the shift seen upon inclusion of the relatively small PBS oligonucleotide in the RT-tRNA complex is rather dramatic. A plausible explanation is that the RT polypeptide adopts a different conformation in the binary versus the ternary complex. Consistent with this idea, it has been reported that RT binds a primer differently depending on the presence or absence of template(35) .

We next tested whether the TC loop needs to be accessible for interaction with the RT protein with an extended version of the PBS oligonucleotide; PBS, which forms a duplex with the 3`-terminal 21 nucleotides of synthetic tRNA(3), thereby blocking the complete TC loop (Fig. 1, nucleotide positions 54-74). In contrast to the results obtained with the PBS oligonucleotide, we found that RT could not recognize the preformed tRNA-PBS complex (Fig. 4A, lane4; Fig. 4B, lane5). These results suggest that the TC loop nucleotides are important for recognition by the RT protein. It is important to note that the PBS probe does not exert a general toxic effect on RT activity because inhibition by PBS is restricted to the situation in which the oligonucleotide is annealed to tRNA(3) in a 85 °C pre-incubation (Fig. 4A, lane4). The control 0 °C pre-incubation showed efficient RT-tRNA(3) complex formation in the presence of a free PBS probe (Fig. 4A, lane3). Furthermore, unrelated oligomers were unable to interfere with the RT-tRNA interaction, even upon 85 °C pre-incubation with tRNA (Fig. 4A, lane6, and data not shown).

RT Protein Facilitates the tRNA-PBS Annealing

It has been proposed that binding of the RT protein to tRNA(3) results in opening of the acceptor stem, thus facilitating the subsequent annealing to the PBS site(22) . We tested this idea by incubation of either the preformed RT-tRNA(3) complex or the free tRNA(3) with the PBS-mimicking oligonucleotide at increasing temperatures (Fig. 5, panelsA and B, respectively, with quantified data in panelsC and D, respectively). The majority of the binary RT-tRNA(3) complex was supershifted to the ternary RT-tRNA(3)-PBS complex at a relatively low temperature of 30 °C, and complete conversion was observed at 35 °C (Fig. 5, A and C). We note that the ternary complex disappeared at higher incubation temperatures (50 °C, material present in the slot), which is most likely due to the formation of insoluble protein aggregates. Most importantly, a 50 °C incubation was required for significant PBS binding to the free tRNA molecule (Fig. 5, B and D). This functional test suggests that RT directly influences the PBS binding capacity of tRNA(3).


Figure 5: RT protein facilitates binding of the template PBS oligonucleotide to the tRNA(3) primer. A, a preformed binary complex (P-tRNA(3)-RT) was incubated with PBS oligonucleotide at increasing temperatures (0-50 °C, indicated on top of the panel) and subsequently analyzed on a native polyacrylamide gel. The position of free tRNA, free PBS oligonucleotide, and the binary and ternary complexes are indicated. B, The free tRNA(3) was incubated with P PBS oligonucleotide at the temperatures indicated on top of the panel and analyzed in a native polyacrylamide gel. C and D, The graphs shown represent a quantitative analysis of panelsA and B, respectively. The different bands resolved on the native gel were quantitated with a phosphorimager.



One could argue that the in vitro binding assay does not accurately reflect the in vivo situation, where it is the Gag-Pol precursor protein instead of a processed RT form that is involved in packaging of cellular tRNA(10) . Therefore, we analyzed the status of the tRNA-viral RNA complex in mutant virions lacking the RT protein. A large deletion was introduced into the RT gene of the molecular HIV-1 clone pLAI. As expected, this RT mutant is replication incompetent, but normal levels of virions can be produced in transient transfection assays in HeLa cells(32) . We isolated total RNA from purified virions and scored for the presence of tRNA and vRNA with primer extension assays (Fig. 6, lanes1-3 and 4-6, respectively). A normal level of viral RNA was detected in RT compared with wild-type virus particles (lanes6 and 4, respectively). In contrast, we measured a dramatic reduction in the amount of tRNA primer associated with the RNA genome of RT compared to wild-type particles (lanes3 and 1, respectively). A tRNA occupancy of only 2% was estimated from overexposed gels (not shown). These combined results clearly demonstrate that the RT domain, which is not required for virion assembly and packaging of the viral RNA genome, is essential for the establishment of a functional tRNA primer-template complex in vivo.


Figure 6: RT-deficient HIV-1 virions contain an RNA genome lacking an associated tRNA(3) primer. Viruses were produced upon transfection of HeLa cells with either the wild-type HIV-1 plasmid (WT, lanes1 and 4) or an RT deletion mutant (RT; lanes3 and 6). A sample of mock-transfected cells was used as a negative control (lanes2 and 5). Viral RNA genomes were extracted, and the associated tRNA primer was visualized in a tRNA-extension assay upon addition of RT enzyme and [P]dNTPs (lanes1-3). The viral RNA was analyzed in a standard primer extension assay with a DNA oligonucleotide primer complementary to positions +123/+151 of HIV-1 RNA (lanes4-6). The position of the respective products is indicated; the tRNA-cDNA molecule is 257 nucleotides, and the cDNA product is 151 nucleotides in length.



A Comparative Analysis of RNA Molecules Specifically Recognized by RT Protein

It has been proposed that the RT protein is responsible for the in vivo selection of tRNAs from the pool of host cell tRNA species. This idea is supported by the apparent absence of primer tRNA in RT-defective HIV-1 particles(10) . Wild-type HIV-1 virions contain 4 major-abundance tRNA species: tRNA(3) primer, the tRNA(1) and tRNA(2) isoacceptors, and tRNA(4) . To identify features that the tRNAs may have in common, we present the sequence and cloverleaf secondary structure of the 4 tRNAs in Fig. 7A and a consensus tRNA sequence in Fig. 7B. Despite the fact that the D-stem loop is relatively well conserved among class III tRNAs (Fig. 7B), some sequence variation is allowed. Strikingly, the D-stem loop of the 4 tRNAs present in HIV-1 virions have similar loop sequences and share an identical stem region. In contrast, the anticodon stem-loop sequences are less conserved among the 4 tRNAs. This comparative analysis is consistent with our experimental data showing that the D-stem loop, but not the anticodon loop, is critical for RT binding.


Figure 7: Sequence similarities between tRNA(3) and other HIV-1 virion tRNAs. A, the cloverleaf structure of the four tRNA species isolated from HIV-1 virus particles are shown(4) . Sequence differences when compared to tRNA(3) are shaded. tRNA(1) and tRNA(2) differ only by 1 base pair in the anticodon stem. tRNA contains 1 additional nucleotide in the D loop, which is indicated by +D. B, consensus sequence of class III tRNA molecules. The sequence of absolutely conserved nucleotides is shown(37) . Pyrimidine, purine, and random positions are indicated. C, comparison of the consensus pseudoknot structure identified in an in vitro SELEX experiment (27) and the D arm of tRNA(3). N is any nucleotide. For both structures, we circled the four A residues that flank the stem region. Tertiary interactions are indicated by thinlines. In the pseudoknot structure, four ``loop'' nucleotides base pair to sequences 3` to the hairpin. In the D loop, four nucleotides are involved in tertiary interactions, with the base pairing partner indicated in bold, e.g.U8.



Another class of RT-binding RNA molecules was recently identified in a search for high affinity inhibitors of the HIV-1 RT protein. Tuerk et al. (27) used the SELEX procedure (systematic evolution of ligands by exponential enrichment) to isolate RT binding molecules from a randomized RNA population. This selection procedure did enrich for sequences with a pseudoknot structure, without an apparent homology to tRNA(3) or other naturally occurring sequences available in the GenBank data base(27) . Reexamination of this consensus motif, however, allowed us to recognize a striking similarity to the D arm of tRNA(3) (Fig. 7C). First, both structures consist of a 4-base pair stem and a loop of 8 nucleotides. Second, multiple loop nucleotides in both structures are involved in tertiary base pairing interactions with other segments of the same molecule. The SELEX RNA motifs are characterized by a pseudoknot interaction between loop nucleotides and sequences 3` of the hairpin. Likewise, the D-loop nucleotides are known to interact with other nucleotides in the formation of the typical L-shaped tertiary tRNA structure (e.g. A14-U8 and G18-55).

Although a significant variability in the primary sequence of the collection of selected pseudoknots was found, a well conserved stem and a strong bias for A nucleotides at multiple single-stranded positions was reported(27) . Little sequence similarity is apparent for the stem regions of the SELEX-pseudoknot and the D arm of tRNA(3) (only 1 out of 4 base pairs is identical), but 4 A nucleotides are flanking both stems (circled in Fig. 7C). It should be noted that only two of these A nucleotides are absolutely conserved among different tRNA species (Fig. 7B), suggesting that this characteristic may be one of the features used by RT to discriminate between cellular tRNAs. The combined results of the SELEX approach and our mutational analysis suggest that RT may recognize certain features in the D-stem loop in the L-shaped tertiary structure of tRNA(3).


DISCUSSION

Whereas detailed biochemical studies of the HIV-1 RT-tRNA(3) binary complex have been presented(7, 18, 19, 20, 21, 22, 23, 24, 25) , a limited number of mutagenesis experiments have been performed. Two recent studies (38, 39) analyzed the RT protein domain(s) involved in tRNA binding, and two studies reported binding experiments with mutated forms of synthetic tRNA(3)(18, 24) . The binding experiments presented by Barat et al. (18) and the data presented in this manuscript indicate that the anticodon loop of tRNA(3) is not directly involved in the interaction with RT. A similar conclusion was reached by Huang et al. (40) based on the efficient incorporation into virus particles of a mutant tRNA(3) species with an altered anticodon sequence. Our in vitro binding data do suggest that the TC and especially the D arm nucleotides play a critical role in selection of the tRNA(3) primer for reverse transcription of the HIV-1 viral genome. We like to note that both stem loops are on the outside of a native tRNA molecule (41) and therefore readily accessible for interaction with RT amino acids. The finding that the D arm is important for RT binding is also supported both by a comparative sequence analysis of both the subset of tRNA species that are abundantly present in HIV-1 particles (4) (Fig. 7A) and the RNA molecules selected for RT binding in vitro(27) (Fig. 7C). The latter SELEX procedure did enrich for RNA pseudoknot motifs that resemble the structure and sequence of the D arm of tRNA(3). This RNA motif was also shown to selectively inhibit the HIV-1 RT function. These combined results strongly suggest an involvement of the D arm in specific RT binding. Furthermore, Tuerk et al. (27) used two randomized starting templates, either with or without the tRNA(3) anticodon arm. No difference in the affinity of these two RNA populations for HIV-1 RT was found, and the subsequent selection process was indifferent to the presence of the anticodon sequences. This result confirms that the anticodon loop is not involved in the tRNA-RT interaction in a sequence-specific manner.

We showed efficient binding of RT protein to the binary tRNA(3)-PBS complex, suggesting that RT binding requires neither the intact acceptor stem nor the intact TC stem. It seems likely that the interaction of tRNA(3) with the PBS sequence will still allow for the formation of both the anticodon and D-stem loop structures(42) , but it is unknown whether the tertiary D-TC loop interaction is maintained in the PBS-tRNA complex. The finding that extension of the PBS oligonucleotide over the TC loop did completely block RT recognition may suggest that the TC loop contains critical recognition nucleotides that interact with RT. Alternatively, the importance of the TC loop may reflect recognition of the typical L-shaped structure of tRNA molecules, which is dependent on the D-TC loop interaction(41, 43) . As pointed out in the results section (Fig. 7C), the RT SELEX experiment suggests that the tertiary RNA folding is critical for RT binding. Because all tRNAs are structurally quite similar, tRNA(3)-specific nucleotides are also expected to contribute to the observed specificity of binding.

We cannot currently explain the differences between our results and the binding data of Weiss et al.(24) , who reported efficient RT binding with the 3`-terminal 24 nucleotides of tRNA(3). It is possible that at least some of the experimental discrepancies can be attributed to the use of different RT and tRNA reagents. In general, binding studies have been performed with synthetic or natural tRNA(3) molecules and with many different forms of mature RT protein (66,000 homodimer or 66,000/51,000 heterodimer, 66,000 or 51,000 monomer). In this respect, it should also be noted that, whereas all in vitro binding studies use these mature RT species, in vivo primer selection is believed to occur during the initial stages of virus assembly when only the precursor Gag-Pol fusion protein Pr160K is available. Experiments with RT-deleted HIV-1 virus particles clearly demonstrated the involvement of the RT domain in selective tRNA packaging (10) and annealing of the tRNA primer to the viral RNA genome (this study). We note that although it has been suggested that tRNA(3) binding may involve both subunits of the RT dimer(44, 45) , it is currently unknown whether the Gag-Pol precursor exists as a dimer.

Upon packaging of the tRNA primer, the cloverleaf RNA structure should be partially melted to expose its 3`-end for binding to the complementary PBS sequence on the viral RNA genome. Using footprint analysis, Sarih-Cottin et al. (22) originally reported that HIV-1 RT binding resulted in unwinding of the acceptor stem. In contrast, Wöhrl et al. (25) saw little evidence for such an effect and suggested that excessive nuclease digestion could have hampered the former study. Our binding experiments indicate that RT protein stimulates the annealing of a PBS oligonucleotide to the binary RT-tRNA(3) complex (Fig. 5). Consistent with this idea, we demonstrated that mutant RT HIV-1 virions contain a viral RNA genome lacking the complementary tRNA(3) primer.

A critical role for the HIV-1 RT protein in packaging of the tRNA(3) primer is now well established based on in vitro binding experiments(7, 18, 19, 20, 21, 22, 23, 24, 25) and the phenotype of RT viruses(10, 32) . This may suggest that the complementary PBS sequence on the viral RNA is less important for encapsidation of the proper primer tRNA molecule. Interestingly, HIV-1 mutants with altered PBS identities were recently constructed and tested for replication competence(33, 46) . Such PBS mutants are forced to use primers other than tRNA(3) and exhibit severe replication defects. Furthermore, reversion to the wild-type tRNA(3) was observed in both studies upon prolonged culture(33, 46) . These results convincingly demonstrate that tRNA primer selection is determined primarily by the HIV-1 RT protein. This does not, however, rule out a role for other RNA/protein factors in packaging or annealing of the tRNA primer. First, distinct tRNA regions, especially the single-stranded loop regions, may initially anchor the primer on the template in the vicinity of the PBS by analogy to the ``kissing'' step in ColE1 plasmid replication(47) , and several non-PBS base-pairing interactions between HIV RNA and tRNA(3) have been proposed (11, 12, 13, 14, 15, 53) . Second, the nucleocapsid protein NC has been suggested to bind and unwind tRNA(26, 48) , although this interaction lacks specificity for the tRNA(3) molecule(49) . Because both RT and NC domains are part of the Gag-Pol precursor polyprotein, these subunits may cooperate in the initial interactions with the tRNA primer.

Finally, our experimental data do suggest that tRNA packaging and tRNA-mediated initiation of reverse transcription are not necessarily performed by the same RT molecule since RT can efficiently recognize a pre-assembled tRNA-PBS complex. According to this scenario, a Gag-Pol precursor may be involved in tRNA packaging and annealing of the primer to the viral RNA template, whereas a second, mature RT protein may play an active role in initiation of reverse transcription on the pre-assembled tRNA-PBS complex. Consistent with this hypothesis, these two reactions are widely separated both in time and place. Whereas tRNA encapsidation occurs on the surface of virus-producing cells, reverse transcription is only initiated upon entry of the viral particle into cytoplasm of newly infected cells, although a low level of cDNA was found in HIV-1 virus particles using sensitive PCR techniques(50, 51) . In support of this ``multi-RT'' mechanism, retroviral particles have been reported to contain a molar excess of RT protein(1, 52) .


FOOTNOTES

*
This work was supported in part by the Netherlands Organization for Scientific Research (NWO). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Tel.: 31-20-566-4854; Fax: 31-20-691-6531.

(^1)
The abbreviations used are: RT, reverse transcriptase; HIV-1, human immunodeficiency virus type 1; PBS, primer binding site; PCR, polymerase chain reaction; wt, wild type.


ACKNOWLEDGEMENTS

We thank Dr. D. Stammers for the generous gift of purified RT protein that was obtained through the MRC AIDS Reagent Project. We thank Rein de Haan for technical assistance, Jeroen van Wamel for oligonucleotide synthesis, Rob Benne for the gift of Escherichia coli strain GM48, and Wim van Est for artwork and photography.


REFERENCES

  1. Varmus, H., and Swanstrom, R. (1985) in Molecular Biology of RNA Tumor Viruses (Weiss, R., Teich, N., Varmus, H., and Coffin, J., eds) 2nd Ed., Cold Spring Laboratory, Cold Spring Harbor, NY
  2. Rhim, H., Park, J., and Morrow, C. D. (1991) J. Virol. 65,4555-4564 [Abstract/Free Full Text]
  3. Nagashunmugam, T., Velpaldi, A., Goldsmith, C. S., Zaki, S. R., Kalyanaraman, V. S., and Srinivasan, A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,4114-4118 [Abstract/Free Full Text]
  4. Jiang, M., Mak, J., Ladha, A., Cohen, E., Klein, M., Rovinski, B., and Kleiman, L. (1993) J. Virol. 67,3246-3253 [Abstract/Free Full Text]
  5. Das, A. T., Koken, S. E. C., Oude Essink, B. B., van Wamel, J. L. B., and Berkhout, B. (1994) FEBS Lett. 341,49-53 [CrossRef][Medline] [Order article via Infotrieve]
  6. Panet, A., and Berliner, H. (1978) J. Virol. 26,214-220 [Abstract/Free Full Text]
  7. Barat, C., Lullien, V., Schatz, O., Keith, G., Nugeyre, M. T., Gruninger-Leitch, F., Barre-Sinoussi, F., LeGrice, S. F. J., and Darlix, J. L. (1989) EMBO J. 8,3279-3285 [Medline] [Order article via Infotrieve]
  8. Sawyer, R. C., and Hanafusa, H. (1979) J. Virol. 29,863-871 [Abstract/Free Full Text]
  9. Peters, G. G., and Hu, J. (1980) J. Virol. 36,692-700 [Abstract/Free Full Text]
  10. Mak, J., Jiang, M., Wainberg, M. A., Hammarskjold, M.-L., Rekosh, D., and Kleiman, L. (1994) J. Virol. 68,2065-2072 [Abstract/Free Full Text]
  11. Cobrinik, D., Aiyar, A., Ge, Z., Katzmann, M., Huang, H., and Leis, J. (1991) J. Virol. 65,3864-3872 [Abstract/Free Full Text]
  12. Aiyar, A., Cobrinik, D., Ge, Z., Kung, H.-J., and Leis, J. (1992) J. Virol. 66,2464-2472 [Abstract/Free Full Text]
  13. Kohlstaedt, L. A., and Steitz, T. A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,9652-9656 [Abstract/Free Full Text]
  14. Berkhout, B., and Schoneveld, I. (1993) Nucleic Acids Res. 21,1171-1178 [Abstract/Free Full Text]
  15. Isel, C., Marquet, R., Keith, G., Ehresmann, C., and Ehresmann, B. (1993) J. Biol. Chem. 268,25269-25272 [Abstract/Free Full Text]
  16. Gerwin, B., and Levin, J. G. (1977) J. Virol. 24,478-488 [Abstract/Free Full Text]
  17. Levin, J. G., and Seidman, J. G. (1979) J. Virol. 29,328-335 [Abstract/Free Full Text]
  18. Barat, C., LeGrice, S. F. J., and Darlix, J.-L. (1991) Nucleic Acids Res. 19,751-757 [Abstract/Free Full Text]
  19. Bordier, B., Tarrago-Litvak, L., Sallafranque-Andreola, M., Robert, D., Tharaud, D., Fournier, M., Barr, P. J., Litvak, S., and Sarih-Cottin, L. (1990) Nucleic Acids Res. 18,429-435 [Abstract/Free Full Text]
  20. Delahunty, M. D., Wilson, S. H., and Karpel, R. L. (1994) J. Mol. Biol. 236,469-479 [CrossRef][Medline] [Order article via Infotrieve]
  21. Sallafranque-Andreola, M. L., Robert, D., Barr, P. J., Fournier, M., Litvak, S., Sarih-Cottin, L., and Tarrago-Litvak, L. (1989) Eur. J. Biochem. 184,367-374 [Medline] [Order article via Infotrieve]
  22. Sarih-Cottin, L., Bordier, B., Musier-Forsyth, K., Andreola, M., Barr, P. J., and Litvak, S. (1992) J. Mol. Biol. 226,1-6 [CrossRef][Medline] [Order article via Infotrieve]
  23. Sobol, R. W., Suhadolnik, R. J., Kumar, A., Lee, B. J., Hatfield, D. L., and Wilson, S. H. (1991) Biochemistry 30,10623-10631 [CrossRef][Medline] [Order article via Infotrieve]
  24. Weiss, S., Konig, B., Muller, H. J., Seidel, H., and Goody, R. S. (1992) Gene (Amst.) 111,183-197 [CrossRef][Medline] [Order article via Infotrieve]
  25. Wöhrl, B. M., Ehresmann, B., Keith, G., and LeGrice, S. F. J. (1993) J. Biol. Chem. 268,13617-13624 [Abstract/Free Full Text]
  26. Prats, A. C., Sarih, L., Gabus, C., Litvak, S., Keith, G., and Darlix, J. L. (1988) EMBO J. 7,1777-1783 [Medline] [Order article via Infotrieve]
  27. Tuerk, C., MacDougal, S., and Gold, L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,6988-6992 [Abstract/Free Full Text]
  28. Oude Essink, B. B., and Berkhout, B. (1994) Nucleic Acids Res. 22,108 [Free Full Text]
  29. Gurerick, V. V., Pokrovskaya, I. D., Obukhova, T. A., and Zozulya, S. A. (1991) Anal. Biochem. 195,207-213 [CrossRef][Medline] [Order article via Infotrieve]
  30. Berkhout, B., Oude Essink, B. B., and Schoneveld, I. (1993) FASEB J. 7,181-187 [Abstract]
  31. Fried, M., and Crothers, D. M. (1981) Nucleic Acids Res. 9,6505-6525 [Abstract/Free Full Text]
  32. Das A. T., and Berkhout, B. (1995) Nucleic Acids Res. 23,1319-1326 [Abstract/Free Full Text]
  33. Das A. T., Klaver, B., and Berkhout, B. (1995) J. Virol. 69,3090-3097 [Abstract]
  34. Arnold, E., Jacobo-Molina, A., Nanni, R. G., Williams, R. L., Lu, X., Ding, J., Clark, A. D., Zhang, A., Ferris, A. L., Clark, P., Hizi, A., and Hughes, S. H. (1992) Nature 357,85-89 [CrossRef][Medline] [Order article via Infotrieve]
  35. Andreola, M.-L., Tarrago-Litvak, L., Levina, A. S., Kolocheva, T. I., El Dirani-Diab, R., Jamkovoj, V. I., Khalimskaya, N. L., Barr, P. J., Litvak, S., and Nevinsky, G. A. (1993) Biochemistry 32,3629-3637 [CrossRef][Medline] [Order article via Infotrieve]
  36. Sprinzl, M., Hartman, T., Weber, J., Blank, J., and Zeidler, R. (1989) Nucleic Acids Res. 17,1-172 [Abstract/Free Full Text]
  37. Schimmel, P. R., S ö ll, D., and Abelson, J. N. (eds) Transfer-RNA: Structure, Properties, and Recognition (1979) Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  38. Kumar, A., Kim, H.-R., Sobol, R. W., Becerra, S. P., Lee, B.-J., Hatfield, D. L., Suhadolnik, R. J., and Wilson, S. H. (1993) Biochemistry 32,7466-7474 [CrossRef][Medline] [Order article via Infotrieve]
  39. Jacques, P. S., Wöhrl, B. M., Howard, K. J., and Le Grice, S. F. J. (1994) J. Biol. Chem. 269,1388-1393 [Abstract/Free Full Text]
  40. Huang, Y., Mak, J., Co, Q., Li, Z., Wainberg, M. A., and Kleiman, L. (1994) J. Virol. 68,7676-7683 [Abstract/Free Full Text]
  41. Kim, S. H., Suddath, F. L., Quigley, G. J., McPherson, A., Sussman, J. L., Wang, A. H. J., Seeman, N. C., and Rich, A. (1974) Science 185,435-440 [Abstract/Free Full Text]
  42. Eiden J. J., Quade, K., and Nichols, J. L. (1976) Nature 259,245-247 [CrossRef][Medline] [Order article via Infotrieve]
  43. Ladner, J. E., Jack, A., Robertus, J. D., Brown, R. S., Rhodes, D., Clark, B. F. C., and Klug, A. (1975) Proc. Natl. Acad. Sci. U. S. A. 72,4414-4418 [Abstract/Free Full Text]
  44. Richter-Cook, N. J., Howard, K. J., Cirino, N. M., Wöhrl, B. M., and Le Grice, S. F. J. (1992) J. Biol. Chem. 267,15952-15957 [Abstract/Free Full Text]
  45. Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A., and Steitz, T. A. (1992) Science 256,1783-1790 [Abstract/Free Full Text]
  46. Li, X., Mak, J., Arts, E. J., Gu, Z., Kleiman, L., Wainberg, M. A., and Parniak, M. A. (1994) J. Virol. 68,6198-6206 [Abstract/Free Full Text]
  47. Tomizawa, J., and Som, T. (1984) Cell 38,871-878 [CrossRef][Medline] [Order article via Infotrieve]
  48. Khan, R., and Giedroc, D. P. (1992) J. Biol. Chem. 267,6689-6695 [Abstract/Free Full Text]
  49. Mély, Y., de Rocquigny, H., Sorinas-Jimeno, M., Keith, G., Roques, B. P., Marquet, R., and Gérard, D. (1995) J. Biol. Chem. 270,1650-1656 [Abstract/Free Full Text]
  50. Trono, D. (1992) J. Virol. 66,4893-4900 [Abstract/Free Full Text]
  51. Lori, F., di Marzo Veronese, F., De Vico, A. L., Lusso, P., Reitz, M. S., and Gallo, R. C. (1992) J. Virol. 66,5067-5074 [Abstract/Free Full Text]
  52. Layne, S. P., Merges, M. J., Dembo, M., Spouge, J. L., Conley, S. R., Moore, J. P., Raina, J. L., Renz, H., Gelderblom, H. R., and Nara, P. L. (1992) Virology 189,695-714 [CrossRef][Medline] [Order article via Infotrieve]
  53. Isel, C., Ehresmann, C., Keith, G., Ehresmann, B., and Marquet, R. (1995) J. Mol. Biol. 247,236-250 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
Y. Bilbille, F. A. P. Vendeix, R. Guenther, A. Malkiewicz, X. Ariza, J. Vilarrasa, and P. F. Agris
The structure of the human tRNALys3 anticodon bound to the HIV genome is stabilized by modified nucleosides and adjacent mismatch base pairs
Nucleic Acids Res., June 1, 2009; 37(10): 3342 - 3353.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Ooms, D. Cupac, T. E. M. Abbink, H. Huthoff, and B. Berkhout
The availability of the primer activation signal (PAS) affects the efficiency of HIV-1 reverse transcription initiation
Nucleic Acids Res., March 12, 2007; 35(5): 1649 - 1659.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
T. E. M. Abbink, N. Beerens, and B. Berkhout
Forced Selection of a Human Immunodeficiency Virus Type 1 Variant That Uses a Non-Self tRNA Primer for Reverse Transcription: Involvement of Viral RNA Sequences and the Reverse Transcriptase Enzyme
J. Virol., October 1, 2004; 78(19): 10706 - 10714.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
H. Huthoff, K. Bugala, J. Barciszewski, and B. Berkhout
On the importance of the primer activation signal for initiation of tRNAlys3-primed reverse transcription of the HIV-1 RNA genome
Nucleic Acids Res., September 1, 2003; 31(17): 5186 - 5194.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. W. Hooker, W. B. Lott, and D. Harrich
Inhibitors of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Target Distinct Phases of Early Reverse Transcription
J. Virol., April 1, 2001; 75(7): 3095 - 3104.
[Abstract] [Full Text]


Home page
Nucleic Acids ResHome page
Q. Yu and C. D. Morrow
Essential regions of the tRNA primer required for HIV-1 infectivity
Nucleic Acids Res., December 1, 2000; 28(23): 4783 - 4789.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Beerens and B. Berkhout
In Vitro Studies on tRNA Annealing and Reverse Transcription with Mutant HIV-1 RNA Templates
J. Biol. Chem., May 12, 2000; 275(20): 15474 - 15481.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
C. Ulich, A. Dunne, E. Parry, C. W. Hooker, R. B. Gaynor, and D. Harrich
Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription
J. Virol., March 1, 1999; 73(3): 2499 - 2508.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
E. J. Arts, J. T. Miller, B. Ehresmann, and S. F. J. Le Grice
Mutating a Region of HIV-1 Reverse Transcriptase Implicated in tRNALys-3 Binding and the Consequences for (-)-Strand DNA Synthesis
J. Biol. Chem., June 5, 1998; 273(23): 14523 - 14532.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Lu, V. Planelles, X. Li, C. Palaniappan, B. Day, P. Challita-Eid, R. Amado, D. Stephens, D. B. Kohn, A. Bakker, et al.
Inhibition of HIV-1 Replication Using a Mutated tRNALys-3 Primer
J. Biol. Chem., June 6, 1997; 272(23): 14523 - 14531.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Essink, B. B. O.
Right arrow Articles by Berkhout, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Essink, B. B. O.
Right arrow Articles by Berkhout, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement