|
Volume 270,
Number 40,
Issue of October 06, pp. 23867-23874, 1995
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Structural
Requirements for the Binding of tRNA to
Reverse Transcriptase of the Human Immunodeficiency Virus Type 1 (*)
(Received for publication, June 9, 1995; and in revised form, August 2, 1995)
Belinda B. Oude
Essink
,
Atze
T.
Das
,
Ben
Berkhout (§)
From the Department of Virology, Academic Medical Center,
University of Amsterdam, Meibergdreef 15, 1105 AZ Amsterdam, the
Netherlands
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Reverse transcription of the human immunodeficiency virus type 1
(HIV-1) RNA genome is primed by the cellular
tRNA molecule. Packaging of this tRNA primer
during virion assembly is thought to be mediated by specific
interactions with the reverse transcriptase (RT) protein. Portions of
the tRNA molecule that are required for interaction with the RT protein
remain poorly defined. We have used an RNA gel mobility shift assay to
measure the in vitro binding of purified RT to mutant forms of
tRNA . The anticodon loop could be mutated
without eliminating RT recognition. However, mutations in the T C
stem were found to partially interfere with RT binding, and D arm
mutants were completely inactive in RT binding. Interestingly, binding
of the RT protein to tRNA facilitates the
subsequent annealing of template strand to the 3`-terminus of the tRNA
molecule. Consistent with this finding, we demonstrate that mutant
HIV-1 virions lacking the RT protein do contain a viral RNA genome
without an associated tRNA primer. We also
found that a preformed primer tRNA-template complex is efficiently
recognized by RT protein in vitro. Extension of the template
molecule over the T C loop did result in complete inhibition of RT
binding, suggesting the presence of additional recognition elements in
the T C loop. These results, combined with a comparative sequence
analysis of tRNA species present in HIV-1 virions and RNA motifs
selected in vitro for high affinity RT binding, suggest that
RT recognizes the central domain of the tRNA tertiary structure, which
is formed by interaction of the D and T C loops.
INTRODUCTION
Retroviruses contain large amounts of tRNA, which is a
non-random subset of the cellular tRNA pool (reviewed in (1) ).
One tRNA species can anneal to the viral RNA genome and acts as a
primer for cDNA synthesis by the viral reverse transcriptase enzyme
(RT), ( )and this priming species is generally dominant among
the tRNAs included in the particles. Different viruses use a different
tRNA primer; avian retroviruses (e.g. avian myeloblastosis
virus) use tRNA , most murine retroviruses and the human
T-cell leukemia viruses (HTLV-I and HTLV-II) use tRNA ,
and the human (HIV) and simian immunodeficiency viruses use
tRNA (1, 2, 3, 4, 5) .
There is accumulating evidence that packaging of the correct tRNA
primer is determined by the RT protein. First, the RT proteins of the
avian myeloblastosis virus and HIV-1 retroviruses have been shown to
bind to their respective tRNA primers in
vitro(6, 7) . Second, the primer tRNA is
apparently absent from virus particles that lack the RT
protein(8, 9, 10) . Alternatively, it is
conceivable that the primer is specifically co-packaged with the RNA
genome through annealing of the 3`-terminal 18 nucleotides of the tRNA
primer to a perfect complementary sequence on the viral genome, the
so-called primer binding site (PBS). This complex may be further
stabilized through additional base-pairing interactions between the two
RNA molecules (11, 12, 13, 14, 15, 53) .
For the Rous sarcoma virus and HIV-1, however, it was reported that the
tRNA primer is included in particles that lack viral RNA sequences
encoding the
PBS(3, 4, 10, 16, 17) .
These combined results suggest that the affinity for RT determines, at
least in part, which tRNA species will be packaged. A complex
between the HIV-1 RT protein and the tRNA primer has been identified in vitro using a variety of
experimental
approaches(7, 18, 19, 20, 21, 22, 23, 24, 25) .
However, the question of binding specificity of HIV-1 RT toward its
cognate primer remains unresolved. For instance, several studies
reported binding of other tRNA species with equal
affinity(13, 20, 23) . Based on UV
cross-linking experiments, Barat et al. (7) have
reported that HIV-1 RT interacts with its cognate primer
tRNA by virtue of specific contacts with the
anticodon stem-loop(7) . It remains to be established whether
solely the anticodon domain of tRNA is in
contact with the enzyme. For instance, nuclease footprinting analysis
suggested mild protection of all three loops by RT(25) . It
was demonstrated that an in vitro synthesized
tRNA transcript can functionally substitute
for its natural counterpart in RT binding studies and reverse
transcription
assays(13, 18, 24, 25) . It was also
shown that synthetic tRNA adopts the correct
L-shaped structure, suggesting that all base pairs and tertiary
interactions (e.g. between D and T C loops) are formed in
the absence of base modifications(25) . Apparently, synthetic
tRNA transcripts contain all sequence and structure requirements for
recognition by the RT enzyme, although modified nucleotides may be
important for fine tuning tRNA
identity(13, 18, 26) . Therefore, to a first
approximation, rules that apply to the selective recognition of
tRNA by the HIV-1 RT protein may be obtained
in in vitro experiments with synthetic tRNA species. This
allows a mutational analysis of the sequence and structure requirements
in tRNA for RT binding. Here, we probed
the binding site for RT on synthetic tRNA in
bandshift binding experiments with mutated tRNA molecules and
demonstrate that the anticodon loop is not important for RT binding. In
contrast, we found that mutations in the D-stem loop abolished RT
binding. Furthermore, we demonstrate that annealing of an antisense
oligonucleotide mimicking the PBS sequence to tRNA was possible at 37 °C with the RT-tRNA complex but not with
free tRNA, suggesting that RT opens the acceptor stem to allow
intermolecular base pairing. A preformed
tRNA -PBS complex, in which both acceptor and
T C stems will be disrupted, was efficiently recognized by RT
protein. Extension of this oligonucleotide by five nucleotides, thereby
forming a duplex with the T C loop nucleotides, was found to
completely block RT binding. These data, combined with results of a
recent SELEX experiment (27) and a comparative sequence
analysis of the tRNA species present in HIV-1 virions(4) ,
suggest that the tertiary tRNA structure and the sequence of the D arm
of tRNA is critically important for
recognition by the RT protein.
MATERIALS AND METHODS
Plasmids were constructed to facilitate transcription of the
tRNA gene with T7 RNA polymerase. Clones for
wild-type (wt) tRNA and several mutants were
constructed from a series of three overlapping DNA oligonucleotides
that contained the tRNA sequence flanked by an upstream T7 RNA
polymerase promoter and a downstream BanI restriction site to
allow run-off transcription. Oligonucleotide 1-wt contained the
wild-type tRNA sequence
5`-CTCACTATAGGCCCGGATAGCTCAGTCGGTAGAGCATCAGACTTTTAATCTGAGGGTCCAGGGTTCAAGTCCCTG-3`
(overlap regions underlined). Similar oligonucleotides with specific
mutations in different tRNA domains were synthesized (see Fig. 1). The central, sense oligomers 1 were individually
annealed to 3`-antisense oligonucleotide 2, which encoded BanI
and EcoRI restriction sites for transcription and cloning
purposes, respectively:
5`ATGGAATTCCCTGGCGCCCGAACAGGGACTTGAA-3` (sites in bold,
overlap underlined). The DNA duplex synthesized in a PCR reaction with
oligomers 1 and 2 was extended by the 5`-sense oligonucleotide 3,
containing a T7 promoter and a BamHI site:
5`CATGGATCCTAATACGACTCACTATAGGC-3` (site in bold, overlap
underlined). An initial PCR reaction was performed with 5 ng of central
oligonucleotide 1 and a molar excess of 5` and 3` oligonucelotides 2
and 3 (100 ng each, 35 cycles of 1 min, 95 °C; 1 min, 55 °C;
and 1 min, 72 °C). A sample was subsequently used in a second PCR
reaction with a 100 ng of primers 2 and 3 (100 ng each, PCR protocol as
indicated above). The final PCR product was digested with BamHI and EcoRI and inserted into plasmid pUC9. All
plasmids were checked directly by sequencing.
Figure 1:
Secondary structure models of natural
and synthetic tRNA . The shadedregions were mutated in synthetic
tRNA as indicated ( , deletion) and
studied in this work. Base modifications within the D, anticodon, and
T C arms in natural tRNA are indicated
according to standard nomenclature(36) ; A ,
1-methyladenosine; A9, N-((9- -D-ribofuranosyl-2-methylthiopurine-2-yl)-carbamoyl)threonine;
C , 5-methylcytidine; D, dihydrouridine; G , N -methylguanosine; G ,
7-methylguanosine; T , 2`-O-methyl-5-methyluridine;
U , 5-methoxycarbonylmethyl-2-thiouridine; ,
pseudouridine. The 5`- and 3`-extended tRNA forms contained 24 and 5
additional nucleotides, respectively (5`, ggauccuaauacgacucacuauag; 3`,
caggg).
The BanI
restriction site was used to allow run-off transcription of a
74-nucleotide-long tRNA transcript. We
initially failed to obtain BanI cleavage, which was shown to
result from methylation of an overlapping dcm recognition
sequence(28) . To circumvent this problem, we transformed all
pUC-tRNA plasmids into the dcm host GM48. Unlabeled T7 transcripts were
synthesized according to standard methods(29, 30) .
tRNA was internally labeled with
[ - P]UTP during in vitro synthesis
in a 2-h reaction with 1 µg of linearized DNA in 12 µl of T7
buffer (20 mM Tris-HCl, pH 7.5, 2 mM spermidine, 10
mM dithiothreitol, 12 mM MgCl ) containing
0.5 mM G/A/CTP, 0.16 mM UTP and 2 µl of
[ - P]UTP (800 Ci/mmol), 50 units of T7 RNA
polymerase and 10 units of RNase inhibitor. Upon DNase treatment and
phenol extraction, the RNA was ethanol precipitated, dissolved in
renaturation buffer (10 mM Tris-HCl, pH 7.5, 100 mM
NaCl), and refolded by incubation at 85 °C for 2 min, followed by
slow cooling to room temperature. The recombinant HIV-1 RT enzyme was
obtained from Dr. D. Stammers (Wellcome Research Labs, Beckenham,
Kent). This purified protein is in the 66,000 homodimer form and
supplied at a 0.13 µg/µl concentration (38,000 enzyme units/mg
protein) in 0.8 M ammonium sulfate, 20 mM Tris, 100
mM NaCl, 0.1 mM EDTA, 0.5 mM dithiothreitol.
Moloney murine leukemia virus RT was obtained from Life Technologies,
Inc., and avian myeloblastosis virus RT was from Boehringer Mannheim. The affinity of RT for tRNA was measured by gel-bandshift
assay(31) . In some experiments, tRNA was pre-incubated with
oligonucleotides as indicated in the figure legends. Oligonucleotide
PBS is 5`-TGGCGCCCGAACAGGGAC-3`, oligonucleotide 3 and
PBS , which is identical to oligonucleotide 2, were
described in the PCR protocol (see above). A standard RT binding
reaction mixture (20 µl) contained 10 ng of uniformly labeled
tRNA probe in buffer (20 mM Tris-HCl, pH 7.5, 50 mM
NaCl, 0.1 mM EDTA, and 5% glycerol) with 0.26 µg of RT
protein. The final concentration of HIV-1 RT was 100 nM,
that of the tRNA molecule was 20 nM, and that of
oligonucleotide was 500 nM. After incubation for 15 min at
20 °C, the samples were separated on a 5% non-denaturing
polyacrylamide gel in 0.25 TBE containing 5% glycerol.
Electrophoresis at 30 V was for approximately 18 h at room temperature.
Gels were dried and exposed to x-ray film at -80 °C using
intensifying screens. For quantitation, gels were exposed overnight in
a Molecular Dynamics phosphorimager. The full-length molecular HIV-1
clone pLAI was used to construct an RT-deficient viral genome
(RT ). Details of the DNA construction are presented
elsewhere(32) . All techniques (cell culture, DNA transfection,
virus purification, isolation of HIV-1 genomic RNA, and subsequent tRNA
or oligonucleotide primer extension assays) were previously
described(33) .
RESULTS
Binding of HIV-1 RT to tRNA Requires an Intact D Arm but No
Specific Anticodon Loop SequencesWe have used
gel-bandshift assays to establish that in vitro made human
tRNA (Fig. 1) can bind to the HIV-1 RT
protein in the absence of either the primer binding site on viral RNA
or additional protein factors. Complex formation was readily detected
as a shift in the mobility of the riboprobe in the gel (Fig. 2A, compare lanes1 and 2). A variety of parameters affecting the binding of the RT
protein to tRNA was studied, and binding
conditions were optimized (results not shown). For instance, binding
was found to be temperature independent (0-37 °C) and
completed in a 10-min incubation. Complex formation was strongly
inhibited by greater than 100 mM NaCl or 100 mM MgCl . Binding was observed in the presence of vast
excess of 5 S rRNA added as a nonspecific competitor (1 µg or
approximately 25 pmol). Furthermore, no RT-tRNA complexes were obtained with RT enzymes of the Moloney murine
leukemia and avian myeloblastosis viruses (data not shown).
Figure 2:
RT
binding activity of wt and mutant tRNA as
measured by the gel shift assay. A, the labeled
tRNA probes indicated on top of the panel were incubated in the presence and absence of HIV-1 RT
protein (+ and -) and subjected to electrophoresis on a
native polyacrylamide gel followed by autoradiography. The migration
positions of free and RT-associated tRNA are
indicated at the rightside of the panel. B, comparison of the relative RT binding capacity of wt and
mutant tRNA molecules. Gel shift assays as
shown in panelA were quantitated using a
phosphorimager. The amount of probe RNA bound to RT was calculated, and
binding activity obtained with wt tRNA was
set at 100%. Activities are means from at least four (5`ext) and up to
eight (wt, D) separate experiments. Variations in values between
experiments differed by <20%. The three point mutations (C3
U, G10 C, C13 U) are in the context of the AC
mutant.
The
specificity of the interaction between the HIV-1 RT protein and
tRNA implies that the tRNA molecule contains
features that distinguish it from other transcripts. In differentiating
among cellular tRNAs, the unique nucleotide sequence of the anticodon
loop may form such an identity element. Consistent with this idea,
cross-linking experiments revealed contacts between RT and the
anticodon loop of tRNA (7) . To assess
the sequence-specific contribution of this tRNA domain to RT
recognition, we constructed a 6-base substitution mutant (Fig. 1, AC mutant). Gel shift assays with wt and mutant
tRNA are shown in Fig. 2A and
quantitated in Fig. 2B. The AC mutant consistently
showed normal levels of RT binding when compared to wt
tRNA (Fig. 2A, lanes14 and 2, respectively). To further define the
sequence and structure requirements for the binding of RT to
tRNA , two additional mutants were made: one
substituting 4 bases in the T C stem (Fig. 1, T C
mutant), and the other carrying a 6-nucleotide deletion in the D arm (D
mutant). Mutations in the D arm affected RT binding most severely (Fig. 2A, lane4), and a partial
reduction in RT binding efficiency was measured for the T C mutant (lane6). We also analyzed the RT binding capacity
of 3-point mutants that were fortuitously obtained in the context of
the AC mutant (C3 U, G10 C, C13 U). Compared to
the AC mutant, we consistently measured reduced RT recognition
( 20-30%) for the two D arm mutants (G10 C and C13
U), whereas 70% binding was measured for the acceptor stem
mutant (C3 U). The results of these binding assays are
summarized in Fig. 2B. The combined data suggest that
the sequence and structure of the D arm in tRNA is critically important for RT binding. To investigate whether
RT could bind to extended forms of tRNA with
additional nucleotides added to either its 5`- or 3`-end, we
synthesized two different transcripts. First, we used an aberrant
plasmid construct with two tandem T7 promoter elements. Transcription
of this plasmid will produce a mixture of two RNAs, wt
tRNA and a 5`-elongated form with 24
additional nucleotides (Fig. 2A, lane11). RT binding assays indicated that this 5`-extended
tRNA did efficiently form a complex with the
RT protein (lane12). Second, we generated
3`-extended transcripts by using the downstream EcoRI
restriction site for run-off transcription. This results in the
synthesis of a 79-nucleotide-long transcript, which is 5 nucleotides
longer than wt tRNA (Fig. 2A, lane15). It should be noted that this 3`-elongated
transcript is only 3 nucleotides longer than natural
tRNA because our synthetic wt tRNA is lacking
the 3`-terminal CA dinucleotide (Fig. 1). In contrast to the
results obtained for 5`-extended tRNA, we consistently measured reduced
RT binding for the 3`-extended molecule (lane16).
Furthermore, we measured no binding activity for a transcript with 171
additional 3`-nucleotides (data not shown). We observed some
surprising effects of the tRNA size variants
on the electrophoretic mobility of the binary RT complexes. As
expected, the free 5`-extended tRNA molecule
migrated slower in the polyacrylamide gel compared to wt
tRNA (Fig. 2A, lane11). The complex of RT protein with this extended RNA
mutant, however, ran ahead of the wt tRNA -RT
complex (lane12). This result was confirmed in
binding experiments with a gel-eluted, purified form of the 5`-extended
tRNA (data not shown). It seems plausible that it is primarily the
conformation of the RNA-protein complex and not so much the molecular
weight of its constituents that determines the migration in a native
gel. Since it has been reported that the RT polypeptide is a flexible
protein and that substantial conformational changes occur upon primer
binding(34) , our findings may suggest that this primer-induced
conformational change in RT is affected by 5`-extension of the
tRNA primer. No such migration effect was
observed for the RT complexed with the 3`-extended form of
tRNA (lane16).
Reverse Transcriptase Can Recognize a Preformed
tRNA-PBS ComplexWe next tested whether a preformed
tRNA -PBS complex could still be specifically
recognized by the RT protein. We therefore synthesized an
oligonucleotide that mimics the PBS sequence of the HIV-1 template RNA.
This PBS oligonucleotide can form a 16-base pair duplex with the 3`-end
of synthetic tRNA (Fig. 1, nucleotide
positions 59-74), thereby disrupting both the acceptor and
T C stem regions. To follow both nucleic acid moieties, we
performed binding assays with P label on either the
tRNA primer or the PBS template (Fig. 3, A and B, respectively). Formation of
the tRNA-PBS complex was found to be dependent on a denaturation step (lanes3), which is expected because the tRNA
cloverleaf structure needs to be partially unfolded for the PBS
oligonucleotide to gain access to its target sequence in the acceptor
and T C stems. Most importantly, we detected a
``supershifted'' RT-tRNA-PBS complex upon subsequent
incubation with HIV-1 RT (lanes4). This ternary
complex can be visualized with either a labeled tRNA or PBS species.
These results indicate that RT can specifically recognize the preformed
tRNA-PBS complex. Alternatively, RT may have bound the tRNA and DNA
probes as individual molecules, perhaps by using different protein
domains. We can rule out this possibility because formation of the
ternary complex is dependent on the presence of a pre-assembled
tRNA-PBS complex and not seen with both RNA/DNA components present as
individual molecules due to a 0 °C pre-incubation (lanes5). Furthermore, ternary complex formation was specific
for the PBS oligonucleotide and not seen with unrelated probes that do
not bind tRNA (e.g. oligonucleotide
3 in Fig. 4A, lane6).
Figure 3:
RT
can recognize a preformed tRNA -PBS complex. A, gel shift assay with P-labeled
tRNA in the absence or presence of RT and the
primer binding site oligonucleotide PBS (indicated on top of
the panel). tRNA was pre-incubated
with excess PBS oligonucleotide (3 µg) either for 15 min at 0
°C or for 2 min at 85 °C, followed by slow cooling to 20
°C. The subsequent incubation with RT was for 15 min at 20 °C.
The migration position of the individual RNA/DNA components and the
binary and tertiary complexes are indicated. The slower migrating RNA
species present in the tRNA sample (lane1) is a tRNA
conformer that disappeared under denaturing gel electrophoresis
conditions (data not shown). B, gel shift assay with P-labeled PBS oligonucleotide in the absence or presence
of RT and the tRNA primer (indicated on top of the panel). tRNA was
pre-incubated with PBS either for 15 min at 0 °C or for 2 min at 85
°C, followed by slow cooling to 20 °C. The subsequent
incubation with RT was for 15 min at 20 °C. A longer exposure of lanes3 and 4 is shown to allow
identification of the P PBS oligonucleotide in the ternary
complex with RT and
tRNA .
Figure 4:
Inhibition of the
RT-tRNA binding by masking of the T C
loop. A, gel shift assay with P-labeled
tRNA in the absence or presence of RT, the
PBS , or the control oligonucleotide 3 (indicated on top of the panel). tRNA was
pre-incubated with 3 µg of the oligonucleotides indicated either
for 15 min at 0 °C or for 2 min at 85 °C, followed by slow
cooling to 20 °C. The subsequent incubation with RT was for 15 min
at 20 °C. The migration position of the individual RNA/DNA
components and the binary complexes are indicated. The slower migrating
RNA species present in the tRNA sample is a conformer that disappeared
under denaturing gel electrophoresis conditions (data not shown). B, gel shift assay with the P-labeled PBS oligonucleotide in the absence or presence of RT and the
tRNA primer (indicated on top of the panel). tRNA was pre-incubated with
PBS either for 15 min at 0 °C or for 2 min at 85 °C, followed
by slow cooling to 20 °C. The subsequent incubation with RT was for
15 min at 20 °C.
As
described earlier, we observed some unexpected gel migration effects
with RT-nucleic acid complexes. Although no linear relationship exists
between the size of a nucleic acid-protein complex and its
electrophoretic mobility on native gels, we do think that the shift
seen upon inclusion of the relatively small PBS oligonucleotide in the
RT-tRNA complex is rather dramatic. A plausible explanation is that the
RT polypeptide adopts a different conformation in the binary versus the ternary complex. Consistent with this idea, it has been
reported that RT binds a primer differently depending on the presence
or absence of template(35) . We next tested whether the
T C loop needs to be accessible for interaction with the RT
protein with an extended version of the PBS oligonucleotide;
PBS , which forms a duplex with the 3`-terminal 21
nucleotides of synthetic tRNA , thereby
blocking the complete T C loop (Fig. 1, nucleotide
positions 54-74). In contrast to the results obtained with the
PBS oligonucleotide, we found that RT could not recognize the preformed
tRNA-PBS complex (Fig. 4A, lane4; Fig. 4B, lane5).
These results suggest that the T C loop nucleotides are important
for recognition by the RT protein. It is important to note that the
PBS probe does not exert a general toxic effect on RT
activity because inhibition by PBS is restricted to the
situation in which the oligonucleotide is annealed to
tRNA in a 85 °C pre-incubation (Fig. 4A, lane4). The control 0
°C pre-incubation showed efficient RT-tRNA complex formation in the presence of a free PBS probe (Fig. 4A, lane3).
Furthermore, unrelated oligomers were unable to interfere with the
RT-tRNA interaction, even upon 85 °C pre-incubation with tRNA (Fig. 4A, lane6, and data not
shown).
RT Protein Facilitates the tRNA-PBS
AnnealingIt has been proposed that binding of the RT
protein to tRNA results in opening of the
acceptor stem, thus facilitating the subsequent annealing to the PBS
site(22) . We tested this idea by incubation of either the
preformed RT-tRNA complex or the free
tRNA with the PBS-mimicking oligonucleotide
at increasing temperatures (Fig. 5, panelsA and B, respectively, with quantified data in panelsC and D, respectively). The majority of the
binary RT-tRNA complex was supershifted to
the ternary RT-tRNA -PBS complex at a
relatively low temperature of 30 °C, and complete conversion was
observed at 35 °C (Fig. 5, A and C). We
note that the ternary complex disappeared at higher incubation
temperatures (50 °C, material present in the slot), which is most
likely due to the formation of insoluble protein aggregates. Most
importantly, a 50 °C incubation was required for significant PBS
binding to the free tRNA molecule (Fig. 5, B and D). This functional test suggests that RT directly influences
the PBS binding capacity of tRNA .
Figure 5:
RT protein facilitates binding of the
template PBS oligonucleotide to the tRNA primer. A, a preformed binary complex ( P-tRNA -RT) was incubated with
PBS oligonucleotide at increasing temperatures (0-50 °C,
indicated on top of the panel) and subsequently
analyzed on a native polyacrylamide gel. The position of free tRNA,
free PBS oligonucleotide, and the binary and ternary complexes are
indicated. B, The free tRNA was
incubated with P PBS oligonucleotide at the temperatures
indicated on top of the panel and analyzed in a
native polyacrylamide gel. C and D, The graphs shown
represent a quantitative analysis of panelsA and B, respectively. The different bands resolved on the native
gel were quantitated with a phosphorimager.
One
could argue that the in vitro binding assay does not
accurately reflect the in vivo situation, where it is the
Gag-Pol precursor protein instead of a processed RT form that is
involved in packaging of cellular tRNA(10) . Therefore, we
analyzed the status of the tRNA-viral RNA complex in mutant virions
lacking the RT protein. A large deletion was introduced into the RT
gene of the molecular HIV-1 clone pLAI. As expected, this
RT mutant is replication incompetent, but normal
levels of virions can be produced in transient transfection assays in
HeLa cells(32) . We isolated total RNA from purified virions
and scored for the presence of tRNA and vRNA with primer extension
assays (Fig. 6, lanes1-3 and 4-6, respectively). A normal level of viral RNA was
detected in RT compared with wild-type virus
particles (lanes6 and 4, respectively). In
contrast, we measured a dramatic reduction in the amount of tRNA primer
associated with the RNA genome of RT compared to
wild-type particles (lanes3 and 1,
respectively). A tRNA occupancy of only 2% was estimated from
overexposed gels (not shown). These combined results clearly
demonstrate that the RT domain, which is not required for virion
assembly and packaging of the viral RNA genome, is essential for the
establishment of a functional tRNA primer-template complex in
vivo.
Figure 6:
RT-deficient HIV-1 virions contain an
RNA genome lacking an associated tRNA primer.
Viruses were produced upon transfection of HeLa cells with either the
wild-type HIV-1 plasmid (WT, lanes1 and 4)
or an RT deletion mutant (RT ; lanes3 and 6). A sample of mock-transfected cells was used as a
negative control (lanes2 and 5). Viral RNA
genomes were extracted, and the associated tRNA primer was visualized
in a tRNA-extension assay upon addition of RT enzyme and
[ P]dNTPs (lanes1-3).
The viral RNA was analyzed in a standard primer extension assay with a
DNA oligonucleotide primer complementary to positions
+123/+151 of HIV-1 RNA (lanes4-6).
The position of the respective products is indicated; the tRNA-cDNA
molecule is 257 nucleotides, and the cDNA product is 151 nucleotides in
length.
A Comparative Analysis of RNA Molecules Specifically
Recognized by RT ProteinIt has been proposed that the RT
protein is responsible for the in vivo selection of tRNAs from
the pool of host cell tRNA species. This idea is supported by the
apparent absence of primer tRNA in RT-defective HIV-1
particles(10) . Wild-type HIV-1 virions contain 4
major-abundance tRNA species: tRNA primer,
the tRNA and tRNA isoacceptors, and tRNA (4) . To identify
features that the tRNAs may have in common, we present the sequence and
cloverleaf secondary structure of the 4 tRNAs in Fig. 7A and a consensus tRNA sequence in Fig. 7B. Despite
the fact that the D-stem loop is relatively well conserved among class
III tRNAs (Fig. 7B), some sequence variation is
allowed. Strikingly, the D-stem loop of the 4 tRNAs present in HIV-1
virions have similar loop sequences and share an identical stem region.
In contrast, the anticodon stem-loop sequences are less conserved among
the 4 tRNAs. This comparative analysis is consistent with our
experimental data showing that the D-stem loop, but not the anticodon
loop, is critical for RT binding.
Figure 7:
Sequence similarities between
tRNA and other HIV-1 virion tRNAs. A, the cloverleaf structure of the four tRNA species isolated
from HIV-1 virus particles are shown(4) . Sequence differences
when compared to tRNA are shaded.
tRNA and tRNA differ only by 1 base pair in the anticodon stem. tRNA contains 1 additional nucleotide in the D loop, which is
indicated by +D. B, consensus sequence of class III tRNA
molecules. The sequence of absolutely conserved nucleotides is
shown(37) . Pyrimidine, purine, and random positions are
indicated. C, comparison of the consensus pseudoknot structure
identified in an in vitro SELEX experiment (27) and
the D arm of tRNA . N is any
nucleotide. For both structures, we circled the four A residues that
flank the stem region. Tertiary interactions are indicated by thinlines. In the pseudoknot structure, four
``loop'' nucleotides base pair to sequences 3` to the
hairpin. In the D loop, four nucleotides are involved in tertiary
interactions, with the base pairing partner indicated in bold, e.g.U8.
Another class of RT-binding RNA
molecules was recently identified in a search for high affinity
inhibitors of the HIV-1 RT protein. Tuerk et al. (27) used the SELEX procedure (systematic evolution of ligands
by exponential enrichment) to isolate RT binding molecules from a
randomized RNA population. This selection procedure did enrich for
sequences with a pseudoknot structure, without an apparent homology to
tRNA or other naturally occurring sequences
available in the GenBank data base(27) . Reexamination of this
consensus motif, however, allowed us to recognize a striking similarity
to the D arm of tRNA (Fig. 7C). First, both structures consist of a
4-base pair stem and a loop of 8 nucleotides. Second, multiple loop
nucleotides in both structures are involved in tertiary base pairing
interactions with other segments of the same molecule. The SELEX RNA
motifs are characterized by a pseudoknot interaction between loop
nucleotides and sequences 3` of the hairpin. Likewise, the D-loop
nucleotides are known to interact with other nucleotides in the
formation of the typical L-shaped tertiary tRNA structure (e.g. A14-U8 and G18- 55). Although a significant variability in
the primary sequence of the collection of selected pseudoknots was
found, a well conserved stem and a strong bias for A nucleotides at
multiple single-stranded positions was reported(27) . Little
sequence similarity is apparent for the stem regions of the
SELEX-pseudoknot and the D arm of tRNA (only
1 out of 4 base pairs is identical), but 4 A nucleotides are flanking
both stems (circled in Fig. 7C). It should be
noted that only two of these A nucleotides are absolutely conserved
among different tRNA species (Fig. 7B), suggesting that
this characteristic may be one of the features used by RT to
discriminate between cellular tRNAs. The combined results of the SELEX
approach and our mutational analysis suggest that RT may recognize
certain features in the D-stem loop in the L-shaped tertiary structure
of tRNA .
DISCUSSION
Whereas detailed biochemical studies of the HIV-1
RT-tRNA binary complex have been
presented(7, 18, 19, 20, 21, 22, 23, 24, 25) ,
a limited number of mutagenesis experiments have been performed. Two
recent studies (38, 39) analyzed the RT protein
domain(s) involved in tRNA binding, and two studies reported binding
experiments with mutated forms of synthetic
tRNA (18, 24) . The binding
experiments presented by Barat et al. (18) and the
data presented in this manuscript indicate that the anticodon loop of
tRNA is not directly involved in the
interaction with RT. A similar conclusion was reached by Huang et
al. (40) based on the efficient incorporation into virus
particles of a mutant tRNA species with an
altered anticodon sequence. Our in vitro binding data do
suggest that the T C and especially the D arm nucleotides play a
critical role in selection of the tRNA primer
for reverse transcription of the HIV-1 viral genome. We like to note
that both stem loops are on the outside of a native tRNA molecule (41) and therefore readily accessible for interaction with RT
amino acids. The finding that the D arm is important for RT binding is
also supported both by a comparative sequence analysis of both the
subset of tRNA species that are abundantly present in HIV-1 particles (4) (Fig. 7A) and the RNA molecules selected
for RT binding in vitro(27) (Fig. 7C). The latter SELEX procedure did
enrich for RNA pseudoknot motifs that resemble the structure and
sequence of the D arm of tRNA . This RNA motif
was also shown to selectively inhibit the HIV-1 RT function. These
combined results strongly suggest an involvement of the D arm in
specific RT binding. Furthermore, Tuerk et al. (27) used two randomized starting templates, either with or
without the tRNA anticodon arm. No difference
in the affinity of these two RNA populations for HIV-1 RT was found,
and the subsequent selection process was indifferent to the presence of
the anticodon sequences. This result confirms that the anticodon loop
is not involved in the tRNA-RT interaction in a sequence-specific
manner. We showed efficient binding of RT protein to the binary
tRNA -PBS complex, suggesting that RT binding
requires neither the intact acceptor stem nor the intact T C stem.
It seems likely that the interaction of tRNA with the PBS sequence will still allow for the formation of both
the anticodon and D-stem loop structures(42) , but it is
unknown whether the tertiary D-T C loop interaction is maintained
in the PBS-tRNA complex. The finding that extension of the PBS
oligonucleotide over the T C loop did completely block RT
recognition may suggest that the T C loop contains critical
recognition nucleotides that interact with RT. Alternatively, the
importance of the T C loop may reflect recognition of the typical
L-shaped structure of tRNA molecules, which is dependent on the
D-T C loop interaction(41, 43) . As pointed out
in the results section (Fig. 7C), the RT SELEX
experiment suggests that the tertiary RNA folding is critical for RT
binding. Because all tRNAs are structurally quite similar,
tRNA -specific nucleotides are also expected
to contribute to the observed specificity of binding. We cannot
currently explain the differences between our results and the binding
data of Weiss et al.(24) , who reported efficient RT
binding with the 3`-terminal 24 nucleotides of
tRNA . It is possible that at least some of
the experimental discrepancies can be attributed to the use of
different RT and tRNA reagents. In general, binding studies have been
performed with synthetic or natural tRNA molecules and with many different forms of mature RT protein
(66,000 homodimer or 66,000/51,000 heterodimer, 66,000 or 51,000
monomer). In this respect, it should also be noted that, whereas all in vitro binding studies use these mature RT species, in
vivo primer selection is believed to occur during the initial
stages of virus assembly when only the precursor Gag-Pol fusion protein
Pr160K is available. Experiments with RT-deleted HIV-1 virus particles
clearly demonstrated the involvement of the RT domain in selective tRNA
packaging (10) and annealing of the tRNA primer to the viral
RNA genome (this study). We note that although it has been suggested
that tRNA binding may involve both subunits
of the RT dimer(44, 45) , it is currently unknown
whether the Gag-Pol precursor exists as a dimer. Upon packaging of
the tRNA primer, the cloverleaf RNA structure should be partially
melted to expose its 3`-end for binding to the complementary PBS
sequence on the viral RNA genome. Using footprint analysis,
Sarih-Cottin et al. (22) originally reported that
HIV-1 RT binding resulted in unwinding of the acceptor stem. In
contrast, Wöhrl et al. (25) saw
little evidence for such an effect and suggested that excessive
nuclease digestion could have hampered the former study. Our binding
experiments indicate that RT protein stimulates the annealing of a PBS
oligonucleotide to the binary RT-tRNA complex (Fig. 5). Consistent with this idea, we demonstrated that mutant
RT HIV-1 virions contain a viral RNA genome lacking
the complementary tRNA primer. A critical
role for the HIV-1 RT protein in packaging of the
tRNA primer is now well established based on in vitro binding
experiments(7, 18, 19, 20, 21, 22, 23, 24, 25) and
the phenotype of RT viruses(10, 32) . This may suggest that the
complementary PBS sequence on the viral RNA is less important for
encapsidation of the proper primer tRNA molecule. Interestingly, HIV-1
mutants with altered PBS identities were recently constructed and
tested for replication competence(33, 46) . Such PBS
mutants are forced to use primers other than tRNA and exhibit severe replication defects. Furthermore, reversion to
the wild-type tRNA was observed in both
studies upon prolonged culture(33, 46) . These results
convincingly demonstrate that tRNA primer selection is determined
primarily by the HIV-1 RT protein. This does not, however, rule out a
role for other RNA/protein factors in packaging or annealing of the
tRNA primer. First, distinct tRNA regions, especially the
single-stranded loop regions, may initially anchor the primer on the
template in the vicinity of the PBS by analogy to the
``kissing'' step in ColE1 plasmid replication(47) ,
and several non-PBS base-pairing interactions between HIV RNA and
tRNA have been proposed (11, 12, 13, 14, 15, 53) .
Second, the nucleocapsid protein NC has been suggested to bind and
unwind tRNA(26, 48) , although this interaction lacks
specificity for the tRNA
molecule(49) . Because both RT and NC domains are part of the
Gag-Pol precursor polyprotein, these subunits may cooperate in the
initial interactions with the tRNA primer. Finally, our experimental
data do suggest that tRNA packaging and tRNA-mediated initiation of
reverse transcription are not necessarily performed by the same RT
molecule since RT can efficiently recognize a pre-assembled tRNA-PBS
complex. According to this scenario, a Gag-Pol precursor may be
involved in tRNA packaging and annealing of the primer to the viral RNA
template, whereas a second, mature RT protein may play an active role
in initiation of reverse transcription on the pre-assembled tRNA-PBS
complex. Consistent with this hypothesis, these two reactions are
widely separated both in time and place. Whereas tRNA encapsidation
occurs on the surface of virus-producing cells, reverse transcription
is only initiated upon entry of the viral particle into cytoplasm of
newly infected cells, although a low level of cDNA was found in HIV-1
virus particles using sensitive PCR
techniques(50, 51) . In support of this
``multi-RT'' mechanism, retroviral particles have been
reported to contain a molar excess of RT
protein(1, 52) .
FOOTNOTES
- *
- This work was
supported in part by the Netherlands Organization for Scientific
Research (NWO). The costs of publication of this article were defrayed
in part by the payment of page charges. This article must therefore by
hereby marked ``advertisement'' in accordance with
18 U.S.C. Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
Tel.: 31-20-566-4854; Fax: 31-20-691-6531.
- (
) - The
abbreviations used are: RT, reverse transcriptase; HIV-1, human
immunodeficiency virus type 1; PBS, primer binding site; PCR,
polymerase chain reaction; wt, wild type.
ACKNOWLEDGEMENTS
We thank Dr. D. Stammers for the generous gift of
purified RT protein that was obtained through the MRC AIDS Reagent
Project. We thank Rein de Haan for technical assistance, Jeroen van
Wamel for oligonucleotide synthesis, Rob Benne for the gift of Escherichia coli strain GM48, and Wim van Est for artwork and
photography.
REFERENCES
- Varmus, H., and Swanstrom, R. (1985) in Molecular Biology of RNA Tumor Viruses (Weiss, R., Teich, N., Varmus, H., and Coffin, J., eds) 2nd Ed., Cold Spring Laboratory, Cold Spring Harbor, NY
- Rhim, H., Park, J., and Morrow, C. D. (1991) J. Virol. 65,4555-4564
[Abstract/Free Full Text]
- Nagashunmugam, T., Velpaldi, A., Goldsmith, C. S., Zaki, S. R., Kalyanaraman, V. S., and Srinivasan, A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,4114-4118
[Abstract/Free Full Text]
- Jiang, M., Mak, J., Ladha, A., Cohen, E., Klein, M., Rovinski, B., and Kleiman, L. (1993) J. Virol. 67,3246-3253
[Abstract/Free Full Text]
- Das, A. T., Koken, S. E. C., Oude Essink, B. B., van Wamel, J. L. B., and Berkhout, B. (1994) FEBS Lett. 341,49-53
[CrossRef][Medline]
[Order article via Infotrieve]
- Panet, A., and Berliner, H. (1978) J. Virol. 26,214-220
[Abstract/Free Full Text]
- Barat, C., Lullien, V., Schatz, O., Keith, G., Nugeyre, M. T., Gruninger-Leitch, F., Barre-Sinoussi, F., LeGrice, S. F. J., and Darlix, J. L. (1989) EMBO J. 8,3279-3285
[Medline]
[Order article via Infotrieve]
- Sawyer, R. C., and Hanafusa, H. (1979) J. Virol. 29,863-871
[Abstract/Free Full Text]
- Peters, G. G., and Hu, J. (1980) J. Virol. 36,692-700
[Abstract/Free Full Text]
- Mak, J., Jiang, M., Wainberg, M. A., Hammarskjold, M.-L., Rekosh, D., and Kleiman, L. (1994) J. Virol. 68,2065-2072
[Abstract/Free Full Text]
- Cobrinik, D., Aiyar, A., Ge, Z., Katzmann, M., Huang, H., and Leis, J. (1991) J. Virol. 65,3864-3872
[Abstract/Free Full Text]
- Aiyar, A., Cobrinik, D., Ge, Z., Kung, H.-J., and Leis, J. (1992) J. Virol. 66,2464-2472
[Abstract/Free Full Text]
- Kohlstaedt, L. A., and Steitz, T. A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,9652-9656
[Abstract/Free Full Text]
- Berkhout, B., and Schoneveld, I. (1993) Nucleic Acids Res. 21,1171-1178
[Abstract/Free Full Text]
- Isel, C., Marquet, R., Keith, G., Ehresmann, C., and Ehresmann, B. (1993) J. Biol. Chem. 268,25269-25272
[Abstract/Free Full Text]
- Gerwin, B., and Levin, J. G. (1977) J. Virol. 24,478-488
[Abstract/Free Full Text]
- Levin, J. G., and Seidman, J. G. (1979) J. Virol. 29,328-335
[Abstract/Free Full Text]
- Barat, C., LeGrice, S. F. J., and Darlix, J.-L. (1991) Nucleic Acids Res. 19,751-757
[Abstract/Free Full Text]
- Bordier, B., Tarrago-Litvak, L., Sallafranque-Andreola, M., Robert, D., Tharaud, D., Fournier, M., Barr, P. J., Litvak, S., and Sarih-Cottin, L. (1990) Nucleic Acids Res. 18,429-435
[Abstract/Free Full Text]
- Delahunty, M. D., Wilson, S. H., and Karpel, R. L. (1994) J. Mol. Biol. 236,469-479
[CrossRef][Medline]
[Order article via Infotrieve]
- Sallafranque-Andreola, M. L., Robert, D., Barr, P. J., Fournier, M., Litvak, S., Sarih-Cottin, L., and Tarrago-Litvak, L. (1989) Eur. J. Biochem. 184,367-374
[Medline]
[Order article via Infotrieve]
- Sarih-Cottin, L., Bordier, B., Musier-Forsyth, K., Andreola, M., Barr, P. J., and Litvak, S. (1992) J. Mol. Biol. 226,1-6
[CrossRef][Medline]
[Order article via Infotrieve]
- Sobol, R. W., Suhadolnik, R. J., Kumar, A., Lee, B. J., Hatfield, D. L., and Wilson, S. H. (1991) Biochemistry 30,10623-10631
[CrossRef][Medline]
[Order article via Infotrieve]
- Weiss, S., Konig, B., Muller, H. J., Seidel, H., and Goody, R. S. (1992) Gene (Amst.) 111,183-197
[CrossRef][Medline]
[Order article via Infotrieve]
- Wöhrl, B. M., Ehresmann, B., Keith, G., and LeGrice, S. F. J. (1993) J. Biol. Chem. 268,13617-13624
[Abstract/Free Full Text]
- Prats, A. C., Sarih, L., Gabus, C., Litvak, S., Keith, G., and Darlix, J. L. (1988) EMBO J. 7,1777-1783
[Medline]
[Order article via Infotrieve]
- Tuerk, C., MacDougal, S., and Gold, L. (1992) Proc. Natl. Acad. Sci. U. S. A. 89,6988-6992
[Abstract/Free Full Text]
- Oude Essink, B. B., and Berkhout, B. (1994) Nucleic Acids Res. 22,108
[Free Full Text]
- Gurerick, V. V., Pokrovskaya, I. D., Obukhova, T. A., and Zozulya, S. A. (1991) Anal. Biochem. 195,207-213
[CrossRef][Medline]
[Order article via Infotrieve]
- Berkhout, B., Oude Essink, B. B., and Schoneveld, I. (1993) FASEB J. 7,181-187
[Abstract]
- Fried, M., and Crothers, D. M. (1981) Nucleic Acids Res. 9,6505-6525
[Abstract/Free Full Text]
- Das A. T., and Berkhout, B. (1995) Nucleic Acids Res. 23,1319-1326
[Abstract/Free Full Text]
- Das A. T., Klaver, B., and Berkhout, B. (1995) J. Virol. 69,3090-3097
[Abstract]
- Arnold, E., Jacobo-Molina, A., Nanni, R. G., Williams, R. L., Lu, X., Ding, J., Clark, A. D., Zhang, A., Ferris, A. L., Clark, P., Hizi, A., and Hughes, S. H. (1992) Nature 357,85-89
[CrossRef][Medline]
[Order article via Infotrieve]
- Andreola, M.-L., Tarrago-Litvak, L., Levina, A. S., Kolocheva, T. I., El Dirani-Diab, R., Jamkovoj, V. I., Khalimskaya, N. L., Barr, P. J., Litvak, S., and Nevinsky, G. A. (1993) Biochemistry 32,3629-3637
[CrossRef][Medline]
[Order article via Infotrieve]
- Sprinzl, M., Hartman, T., Weber, J., Blank, J., and Zeidler, R. (1989) Nucleic Acids Res. 17,1-172
[Abstract/Free Full Text]
- Schimmel, P. R., S ö ll, D., and Abelson, J. N. (eds) Transfer-RNA: Structure, Properties, and Recognition (1979) Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Kumar, A., Kim, H.-R., Sobol, R. W., Becerra, S. P., Lee, B.-J., Hatfield, D. L., Suhadolnik, R. J., and Wilson, S. H. (1993) Biochemistry 32,7466-7474
[CrossRef][Medline]
[Order article via Infotrieve]
- Jacques, P. S., Wöhrl, B. M., Howard, K. J., and Le Grice, S. F. J. (1994) J. Biol. Chem. 269,1388-1393
[Abstract/Free Full Text]
- Huang, Y., Mak, J., Co, Q., Li, Z., Wainberg, M. A., and Kleiman, L. (1994) J. Virol. 68,7676-7683
[Abstract/Free Full Text]
- Kim, S. H., Suddath, F. L., Quigley, G. J., McPherson, A., Sussman, J. L., Wang, A. H. J., Seeman, N. C., and Rich, A. (1974) Science 185,435-440
[Abstract/Free Full Text]
- Eiden J. J., Quade, K., and Nichols, J. L. (1976) Nature 259,245-247
[CrossRef][Medline]
[Order article via Infotrieve]
- Ladner, J. E., Jack, A., Robertus, J. D., Brown, R. S., Rhodes, D., Clark, B. F. C., and Klug, A. (1975) Proc. Natl. Acad. Sci. U. S. A. 72,4414-4418
[Abstract/Free Full Text]
- Richter-Cook, N. J., Howard, K. J., Cirino, N. M., Wöhrl, B. M., and Le Grice, S. F. J. (1992) J. Biol. Chem. 267,15952-15957
[Abstract/Free Full Text]
- Kohlstaedt, L. A., Wang, J., Friedman, J. M., Rice, P. A., and Steitz, T. A. (1992) Science 256,1783-1790
[Abstract/Free Full Text]
- Li, X., Mak, J., Arts, E. J., Gu, Z., Kleiman, L., Wainberg, M. A., and Parniak, M. A. (1994) J. Virol. 68,6198-6206
[Abstract/Free Full Text]
- Tomizawa, J., and Som, T. (1984) Cell 38,871-878
[CrossRef][Medline]
[Order article via Infotrieve]
- Khan, R., and Giedroc, D. P. (1992) J. Biol. Chem. 267,6689-6695
[Abstract/Free Full Text]
- Mély, Y., de Rocquigny, H., Sorinas-Jimeno, M., Keith, G., Roques, B. P., Marquet, R., and Gérard, D. (1995) J. Biol. Chem. 270,1650-1656
[Abstract/Free Full Text]
- Trono, D. (1992) J. Virol. 66,4893-4900
[Abstract/Free Full Text]
- Lori, F., di Marzo Veronese, F., De Vico, A. L., Lusso, P., Reitz, M. S., and Gallo, R. C. (1992) J. Virol. 66,5067-5074
[Abstract/Free Full Text]
- Layne, S. P., Merges, M. J., Dembo, M., Spouge, J. L., Conley, S. R., Moore, J. P., Raina, J. L., Renz, H., Gelderblom, H. R., and Nara, P. L. (1992) Virology 189,695-714
[CrossRef][Medline]
[Order article via Infotrieve]
- Isel, C., Ehresmann, C., Keith, G., Ehresmann, B., and Marquet, R. (1995) J. Mol. Biol. 247,236-250
[CrossRef][Medline]
[Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
Y. Bilbille, F. A. P. Vendeix, R. Guenther, A. Malkiewicz, X. Ariza, J. Vilarrasa, and P. F. Agris
The structure of the human tRNALys3 anticodon bound to the HIV genome is stabilized by modified nucleosides and adjacent mismatch base pairs
Nucleic Acids Res.,
June 1, 2009;
37(10):
3342 - 3353.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Ooms, D. Cupac, T. E. M. Abbink, H. Huthoff, and B. Berkhout
The availability of the primer activation signal (PAS) affects the efficiency of HIV-1 reverse transcription initiation
Nucleic Acids Res.,
March 12, 2007;
35(5):
1649 - 1659.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. E. M. Abbink, N. Beerens, and B. Berkhout
Forced Selection of a Human Immunodeficiency Virus Type 1 Variant That Uses a Non-Self tRNA Primer for Reverse Transcription: Involvement of Viral RNA Sequences and the Reverse Transcriptase Enzyme
J. Virol.,
October 1, 2004;
78(19):
10706 - 10714.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Huthoff, K. Bugala, J. Barciszewski, and B. Berkhout
On the importance of the primer activation signal for initiation of tRNAlys3-primed reverse transcription of the HIV-1 RNA genome
Nucleic Acids Res.,
September 1, 2003;
31(17):
5186 - 5194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. W. Hooker, W. B. Lott, and D. Harrich
Inhibitors of Human Immunodeficiency Virus Type 1 Reverse Transcriptase Target Distinct Phases of Early Reverse Transcription
J. Virol.,
April 1, 2001;
75(7):
3095 - 3104.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
Q. Yu and C. D. Morrow
Essential regions of the tRNA primer required for HIV-1 infectivity
Nucleic Acids Res.,
December 1, 2000;
28(23):
4783 - 4789.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
N. Beerens and B. Berkhout
In Vitro Studies on tRNA Annealing and Reverse Transcription with Mutant HIV-1 RNA Templates
J. Biol. Chem.,
May 12, 2000;
275(20):
15474 - 15481.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Ulich, A. Dunne, E. Parry, C. W. Hooker, R. B. Gaynor, and D. Harrich
Functional Domains of Tat Required for Efficient Human Immunodeficiency Virus Type 1 Reverse Transcription
J. Virol.,
March 1, 1999;
73(3):
2499 - 2508.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. J. Arts, J. T. Miller, B. Ehresmann, and S. F. J. Le Grice
Mutating a Region of HIV-1 Reverse Transcriptase Implicated in tRNALys-3 Binding and the Consequences for (-)-Strand DNA Synthesis
J. Biol. Chem.,
June 5, 1998;
273(23):
14523 - 14532.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Lu, V. Planelles, X. Li, C. Palaniappan, B. Day, P. Challita-Eid, R. Amado, D. Stephens, D. B. Kohn, A. Bakker, et al.
Inhibition of HIV-1 Replication Using a Mutated tRNALys-3 Primer
J. Biol. Chem.,
June 6, 1997;
272(23):
14523 - 14531.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|