Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Feng, X.-H.
Right arrow Articles by Derynck, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feng, X.-H.
Right arrow Articles by Derynck, R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 41, Issue of October 13, 1995 pp. 24237-24245
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Transforming Growth Factor- (TGF-)-induced Down-regulation of Cyclin A Expression Requires a Functional TGF- Receptor Complex
CHARACTERIZATION OF CHIMERIC AND TRUNCATED TYPE I AND TYPE II RECEPTORS (*)

(Received for publication, March 30, 1995; and in revised form, July 13, 1995)

Xin-Hua Feng Ellen H. Filvaroff Rik Derynck (§)

From the Departments of Growth and Development and Anatomy, Programs in Cell Biology and Developmental Biology, University of California, San Francisco, California 94143

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Transforming growth factor-beta (TGF-beta) inhibits the proliferation of epithelial cells by altering the expression or function of various components of the cell cycle machinery. Expression of one of these components, cyclin A, is inhibited by TGF-beta treatment. We have identified a 760-base pair fragment of the human cyclin A gene promoter that is sufficient to confer TGF-beta responsiveness. Using this promoter fragment, we have developed a cyclin A-based luciferase reporter assay that quantitates the growth inhibitory effect of TGF-beta in transient transfection assays. This assay was used to determine which domains of the type I (RI) and type II (RII) receptors were required for the antiproliferative effect of TGF-beta. In parallel, the functionality of chimeric receptors, between RI and RII (RI-RII or RII-RI), was tested for TGF-beta effect on gene expression using a reporter assay based on the plasminogen activator inhibitor type 1 (PAI-1) promoter. We found that TGF-beta-induced inhibition of cyclin A expression was absent in RI or RII-deficient Mv1Lu cells and that this response was restored by expression of wild-type type I or type II receptors in these cells. Furthermore, expression of a single chimeric receptor, either RI-RII or RII-RI, did not confer cyclin A regulation by TGF-beta. However, expression of two reciprocal chimeras (RI-RII and RII-RI) resulted in growth inhibition, similarly to wild-type receptors. In addition, chimeric receptors as well as mutant receptors with a deleted cytoplasmic domain and kinase-negative receptors inhibited TGF-beta responsiveness in the cyclin A reporter assay in a dominant negative fashion. Finally, in both receptor types, the juxtamembrane domain preceding the kinase domain was essential for receptor function but the cytoplasmic tail was dispensable. Our results suggest that a functional TGF-beta receptor complex is required for TGF-beta-dependent down-regulation of cyclin A gene expression and illustrate the identical receptor requirements for TGF-beta-induced growth inhibition and gene expression.


INTRODUCTION

Transforming growth factor-beta (TGF-beta) (^1)is a secreted protein that induces a range of cell responses which affect growth and differentiation (for recent reviews see (1) and (2) ). TGF-beta treatment of epithelial cells results in cell cycle arrest in late G(1) coincident with an inhibition of synthesis and/or activity of some cyclins and cyclin-dependent kinases (3, 4, 5, 6) . In mink lung epithelial cells, TGF-beta decreases the activities of two G(1) cyclin-dependent kinases, cdk2 and cdk4(4, 6, 7) . TGF-beta down-regulates the synthesis of cdk4 and constitutive expression of cdk4 results in resistance to TGF-beta-induced growth arrest, suggesting that cdk4 is a major downstream target in TGF-beta-induced growth inhibition(4) . The inhibition of cdk2 activity by TGF-beta may involve the cdk inhibitor p27, which prevents complex formation of cyclin E/cdk2 as well as cyclin D/cdk 4(8, 9, 10) . Another cdk inhibitor p15, that is TGF-beta-inducible, interferes with the cyclin D/cdk 4 complex in keratinocytes(11) .

While down-regulation of cdk4 and activation of the cdk inhibitors correlates with TGF-beta-induced cell cycle arrest, other components of the cell cycle machinery are also inhibited by TGF-beta. Indeed, late G(1) arrest by TGF-beta is associated with decreased synthesis of cdc2 (12) and cyclin A(13, 14, 15, 16, 17) . Cyclin A plays a critical role in cell cycle progression by complexing with and regulating the activities of cdc2 and cdk2. Cyclin A/cdc2 and cyclin A/cdk2 complexes also interact with other proteins involved in the regulation of the G(1) to S transition, including pRB, the pRB-like proteins p107 and p130, and the transcription factor E2F(18, 19, 20, 21, 22) . Inhibition of pRB hyperphosphorylation by cyclin A/cdk2 may be involved in control of G(1) progression by TGF-beta(23) .

In addition to its antiproliferative effect, TGF-beta induces the expression of many genes, including those for extracellular matrix proteins. In fact, the induction of plasminogen activator inhibitor type 1 (PAI-1) expression is often used as a biochemical marker for TGF-beta responsiveness. Induction of PAI-1 expression can be easily measured using a reporter plasmid in which luciferase expression is driven from the PAI-1 promoter in a TGF-beta-dependent manner(24, 25) . This assay is often used in combination with transient transfection experiments to measure cellular responsiveness to TGF-beta and the corresponding receptor requirements. In contrast, no similarly convenient reporter assay has been developed to measure the growth inhibitory response of TGF-beta, even though considerable evidence suggests that TGF-beta's effects on growth inhibition and gene expression result from divergent signaling cascades (for review, see (26) ).

The early signaling events that lead to growth inhibition or extracellular matrix production by TGF-beta are largely unknown. TGF-beta interacts with a set of cell surface receptors (for review, see Refs. 26, 27), including the type I and type II receptors which are essential for signal transduction. Both receptor types belong to an expanding family of transmembrane serine/threonine kinases(26, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38) . Several structural features distinguish type I from type II receptors. The extracellular domain of the type I receptor is shorter than that of the type II receptor. The type I receptor also has a highly conserved GS motif (SGSGSGLP) in the juxtamembrane region preceding the kinase domain, which is absent in the type II receptor (for review, see (26) ). The type II receptor can bind TGF-beta by itself, but the type I receptors bind TGF-beta only when coexpressed with the type II receptor, presumably as a result of a physical interaction of these receptors. To date, only one type II receptor for TGF-beta has been identified(32) , while several type I receptors, i.e. R4/ALK5(34) , Tsk7L (33) , TSR1(31) , have been shown to bind TGF-beta when coexpressed with the type II TGF-beta receptor. Despite the structural similarity, certain functional differences among the different type I receptors have been found. For instance, only R4/ALK-5 transduces TGF-beta signals in Mv1Lu epithelial cells(34, 39) , while Tsk7L mediates TGF-beta signaling in another epithelial cell line(40) .

The type II receptors(41, 42) , and presumably also the type I receptors, constitutively homodimerize independent of ligand binding. In addition, these two receptor types interact with each other (25, 43, 44) and form a heteromeric (most likely tetrameric) complex which is stabilized by ligand binding(45) . The cytoplasmic domain of the type II receptor is constitutively phosphorylated, independent of ligand binding, due to both autophosphorylation and the activity of cytoplasmic kinases(46, 47) . In the heteromeric complex, the type II receptor kinase phosphorylates the type I receptor (46, 47) and the two types of cytoplasmic domains associate with each other(48) , further stabilizing the heteromeric interaction. This heteromeric complex is likely to be the signaling receptor unit which mediates the biological responses of TGF-beta.

Epithelial Mv1Lu cells lacking either type I or type II receptor are completely unresponsive to TGF-beta to induce growth inhibition and gene expression(49, 50) . But the TGF-beta responsiveness can be restored to these mutant cell lines by transfection with the missing receptor type (25, 39) . These findings support the notion that the two receptors are needed for both types of responses to TGF-beta. However, separate signaling pathways for the two types of responses have been observed in several studies(51, 52, 53) . For example, cells in which the type II receptor has been functionally inhibited by a truncated type II receptor are resistant to the antiproliferative effect of TGF-beta, yet still induce the expression of PAI-1 and other gene products(51) . Furthermore, a variety of cell lines, some of which contain defective type II receptors (e.g.(53) ), are resistant to TGF-beta-induced antiproliferation, but remain able to induce various genes including PAI-1 in response to TGF-beta (see ``Discussion'').

To gain insight into the role of the type I and II receptors in TGF-beta-mediated growth inhibition, we have developed a convenient assay to score the antiproliferative effect of TGF-beta using an expression plasmid in which a TGF-beta-responsive cyclin A promoter segment drives a luciferase reporter gene. We used this reporter system in transient transfection experiments to examine the function of the TGF-beta receptors in the growth inhibitory response of Mv1Lu cells. Using chimeric and mutant receptors, we have dissected the role of the two receptors in the growth inhibitory response of TGF-beta and compared the cyclin A reporter assay with the PAI-1 reporter assay with respect to TGF-beta responsiveness.


MATERIALS AND METHODS

Construction of the Cyclin A-Luciferase Reporter Plasmid

Plasmid pCAL2 was made by fusing a PCR-amplified cyclin A promoter (-516 to +245; for sequence see (54) ) to the luciferase coding sequence in the SstI-HindIII site of plasmid pGL (Promega). The sequences of primers used to amplify the cyclin A promoter from genomic DNA are: GACCGGTGAGCTCCGTGTTAAATAATTTA (sense) and AAGAAGCTTCACTGCTCACGGGAGTG (antisense). We also constructed plasmid pRKbetaGal, which expresses beta-galactosidase under the control of the cytomegalovirus promoter and can be included in all transfections as an internal standard to monitor transfection efficiency.

Construction of Mutant and Chimeric TGF-beta Receptors

The cDNAs encoding the type II receptor (RII) (55) and type I receptor Tsk7L (designated RI) (33) were of mouse origin, whereas the type I receptor R4 (designated RI) cDNA was a rat cDNA(35) . Specific domains of RI, RI, and RII were amplified using PCR methodology. In PCR primers listed below, restriction sites were incorporated to allow subcloning and fusion of different receptor domains. The underlined sequences indicate incorporated restriction sites and those in bold type are start or stop codons.

To amplify the RII extracellular/transmembrane (ET) domain: R2E5`, GATAGAATTCACC ATG GGT CGA GGA CTG CT; R2E3`, TCATGGATCC GAC ACG GTA GCA GTA GAA.

To amplify the RII cytoplasmic (C) domain: R2C5`, CTTAGGATCCATG CAC CGA CAG CAG AAG CTG AG; R2C3`, GATGAGGTCGACCTT GGT AGT GTT CAG AGA GC; R2K5`, TATTGGATCCATG CCC ATC GAG CTG GAC AC (for juxtamembrane deletion); R2K3`, ACTTGAGTCGAC GTC CAT ATG CTC CAG CTC AC (for tail deletion).

To amplify the RI ET domain: R4E5`, TAATCGATGAATTC ATG GAG GCA GCA TCG GC; R4E3`, AAAGATCTGGATCC GTT GTG GCA GAT ATA GAC.

To amplify the RI C domain: R4C5`, GATGAATTCATG CGC ACT GTC ATT CAC CAC CG; R4C3`, CAAACTCGAGGTCGAC CAT TTT GAT GCC TTC CTG; R4K5`, GCA GGATCC ATG GTG CTA CAA GAA AGC ATC (for juxtamembrane deletion); R4K3`, GAG GTCGAC CAA TGT CTT CTT AAT TCG CAA (for tail deletion).

To amplify the RI ET domain: R7E5`, AGCC GAATTCACATG GTC GAT GGA GTA AT; R7E3`, GTCTGGATCC CTT CCT GAG AGC AAC TCC.

To amplify the RI C domain: R7C5`, CCACGGATCCATG TTT AAG AGA CGC AAT CAA GA; R7C3`, GGCAGTCGAC ACA GTC AGT CTT CAA TTT GTC.

Amplified receptor cDNA sequences were cloned into the cytomegalovirus promoter-driven mammalian expression vectors pRK5F or pRK5M. These expression vectors are derived from pRK5 (56) but contain the sequences for a myc (57) or FLAG epitope tag (58) between the SalI and HindIII sites, respectively (data not shown). Three truncated receptors lacking the entire extracellular/transmembrane domain (ET) were generated. For example, RII(ET) contains residues 1-191 corresponding to the ET domain of RII, while RI(ET) and RI(ET) include the first 148 residues of RI or RI. Sequences containing ET domains were cloned between the EcoRI and BamHI sites, in frame with the downstream epitope tag, either myc for RI(ET) and RI(ET) or FLAG tag for RII(ET).

In the hybrid receptors, the cytoplasmic (C) domain of one receptor, as a BamHI-SalI fragment (in case of RI, the BglII site substituted for a BamHI site), was placed between the ET domain of a different receptor and the epitope tag. Considering the large number of plasmids, a detailed description of how they were made is not provided in this report; however, further details of the cloning strategies can be obtained upon request. A total of four chimeric receptors between RI and RII were created from the fusion of ET domain of one type to C domain of another. At the junction of these chimeric receptors, three extra amino acid residues (Gly Ser Met) were created corresponding to the restriction sites (BamHI/BglII and the introduced start codon ATG preceding cytoplasmic domain). The nomenclature of the chimeric receptors reflects the origin of the two fused domains. For example, RI(ET)-RII(C) contains ET domain of RI and C domain of RII receptor. All receptor clones were sequenced to ensure that there were no PCR-induced mutations.

Cell Culture

COS-1 cells (CRL 1650, American Type Culture Collection) were maintained in the Dulbecco's modified Eagle's medium containing 10% fetal bovine serum (FBS) at 37 °C in a 5% CO(2) incubator and the medium was changed every 3 days. Mink lung epithelial cells (Mv1Lu; CCL-64, American Type Culture Collection) and the derivative mutant lines DR26 and R1B, provided by Drs. J. Massagué and H. Lodish, were maintained in minimal essential Eagle's medium with Earle's balanced salt solution supplemented with non-essential amino acids and 10% FBS at 37 °C in a 5% CO(2) incubator.

Transfection of COS-1 Cells, Immunoprecipitations, and in Vitro Kinase Reactions

COS-1 cells were transfected using LipofectAMINE (Life Technologies, Inc.) according to the manufacturer's instruction. Forty-eight h after transfection, cells were starved for 1 h in methionine- and cysteine-free Dulbecco's modified Eagle's medium and then metabolically labeled overnight in the same medium containing 0.5 mCi Pro-mix (Amersham Corp.). Labeled cells were lysed in MLB lysis buffer (20 mM Tris-HCl, pH 8, 137 mM NaCl, 1% Nonidet P-40) for anti-myc antibody 9E10 (gift of J. M. Bishop), or FLB lysis buffer (25 mM Tris-HCl, 300 mM NaCl, 1% Triton X-100) for anti-FLAG antibody M2 (Kodak). Lysates were precleared in a mixture of rabbit anti-mouse IgG (Jackson Laboratories) and protein A-Sepharose CL4B (Pharmacia), and immunoprecipitated using monoclonal antibodies 9E10 (anti-myc) or M2 (anti-FLAG). Immunoprecipitated proteins were subjected to electrophoresis on SDS-PAGE and visualized by autoradiography.

For in vitro kinase assays, immunoprecipitated receptors with specific deletions in the cytoplasmic domains of RI and RII were split into two halves. While half was directly subjected to SDS-PAGE, the other half was used in a kinase autophosphorylation assay. The kinase assay was carried out at room temperature for 30 min in 1 times kinase buffer (10 mM HEPES-KOH, pH 7.5, 5 mM MgCl(2), and 5 mM CaCl(2)) containing 5 µCi of [-P]ATP (5000 µCi/mmol, Amersham) and then stopped by adding equal volume of 2 times SDS sample buffer (80 mM Tris, pH 6.8, 3.2% SDS, 16% glycerol, 200 mM dithiothreitol, 0.02% bromphenol blue).

I-TGF-beta Cross-linking of Receptor Proteins

COS-1 cells were transfected, with expression plasmids containing cDNAs of a single receptor or a combination of two receptors, as described above for immunoprecipitation. Forty-eight h after transfection, COS-1 cells were cross-linked with I-labeled TGF-beta1 (Amersham) as described(59) .

Functional Assays

Reporter assays were performed following transient co-expression of receptor and reporter expression plasmids in Mv1Lu cells, either the wild-type or the mutant lines. Reporter plasmid pCAL2 was used to monitor TGF-beta-dependent cyclin A down-regulation and the plasmid p800Luc to assay TGF-beta-induced PAI-1 induction. The latter plasmid, obtained from Dr. D. Loskutoff, contains a luciferase expression unit under the control of PAI-1 promoter(24) . Cells (3 times 10^6) were harvested and electroporated at 960 microfarads and 750 V/cm in a Bio-Rad electroporation apparatus, typically using 10 µg of pCAL2 or p800luc, 10 µg of pRKbetaGAL, 10 µg of receptor expression plasmid(s), and 10 µg of carrier DNA (pBluescript II SK+). Usually, 10 µg of receptor expression plasmid mix contained 5 µg of each receptor construct in co-transfections of two expression plasmids or, when only a single receptor expression plasmid was transfected, 5 µg of the mix was pRK5. After electroporation, cells were recovered for 4 h in MEM Eagle's with Earle's balance salt solution supplemented with non-essential amino acids and 10% FBS. The cells were then treated with or without 10 ng/ml TGF-beta1 in the same medium but containing 0.2% FBS. After 24 h (for PAI-1 assay) or 48 h (for cyclin A assay), the cells were harvested and lysed in reporter lysis buffer (Promega), and cell lysates were assayed for luciferase and beta-galactosidase activities. The luciferase assay was carried out using Analytic Luminescence Laboratory's assay reagents and luminometer monolight 2010. beta-Galactosidase was assayed in an assay buffer (Promega), and the activity was measured at 420 nm in a spectrophotometer. The luciferase activity which reflects the promoter activity of cyclin A or PAI-1 was normalized to beta-galactosidase to account for transfection efficiency.

R1B-L17 cells, a highly transfectable line of R1B cells were provided by Dr. J. Massagué. Transfection of L17 cells was carried out using the DEAE-dextran method as described (46) at 40% confluence in 6-well plates. For each transfection, 1 µg of receptor expression plasmid or vector control and 3 µg of reporter constructs (1.5 µg of pRKbetaGAL + 1.5 µg of luciferase expression plasmid) were used.


RESULTS

Down-regulation of Cyclin A Expression by TGF-beta in Mv1Lu Cells

Transcription of the PAI-1 gene has frequently been used as a marker for TGF-beta responsiveness. A reporter system in which the TGF-beta-inducible PAI-1 promoter drives luciferase expression has allowed the rapid evaluation of TGF-beta receptor function in transient transfection assays(25) . However, TGF-beta is often primarily studied for its growth inhibitory effect, and considerable evidence suggests that the effects on growth inhibition and gene expression result from different signaling cascades. Unfortunately, no reporter assay has been available to monitor the antiproliferative effect of TGF-beta. Since TGF-beta arrests epithelial cell proliferation in late G(1) phase, thereby preventing the induction of cyclin A gene expression (17) , we developed a cyclin A promoter-based reporter system to monitor the TGF-beta-induced growth inhibition response in transient transfection assays.

As a first step in developing this assay, we identified the 5` promoter fragment of the cyclin A gene that mediates down-regulation of cyclin A gene expression in response to TGF-beta. The upstream region of the human cyclin A gene corresponding to nucleotides -516 to +245 contains many potential regulatory elements (54) and was isolated by PCR-based amplification from human genomic DNA. We linked this promoter fragment to the luciferase coding sequence to generate plasmid pCAL2. The luciferase expression driven by this 760-bp fragment of the cyclin A promoter was compared with the luciferase activity from the 7.5-kilobase pair promoter region (nucleotides -7300 to +245) in plasmid CD1(54) . The cyclin A reporter plasmid and a beta-galactosidase expression plasmid pRKbetaGal were transiently transfected into TGF-beta-responsive Mv1Lu cells, and the luciferase activity was measured 48 h after transfection. Inclusion of pRKbetaGal allowed calibration of the luciferase activity against the beta-galactosidase activity, providing normalization of transfection efficiency. Both cyclin A plasmids pCAL2 and pCD1 were found to express luciferase, and the luciferase activity was even somewhat higher when using plasmid pCAL2 (see 0 h point in Fig. 1A), indicating that this 760-bp cyclin A promoter fragment is functional in Mv1Lu cells.


Figure 1: A, cyclin A-luciferase reporter assay. Cyclin A-luciferase plasmid pCAL2 or pCD1, together with a beta-galactosidase expression plasmid pRKbetaGal, were transfected into Mv1Lu cells. Four h after transfection, TGF-beta was added at 400 pM to the media for the defined times. Luciferase and beta-galactosidase activity were determined as described under ``Materials and Methods.'' Data are from two experiments with each point determined in triplicates. The vertical bars show the standard deviations. pCAL2 and pCD1 contain the human cyclin A promoter sequence from nucleotide -516 to +245 and from -7300 to +245, respectively. B, regulation of cyclin A-luciferase activity by TGF-beta in wild-type and mutant Mv1Lu cells. Untransfected cells or DR26 cells transfected with RII or R1B cells transfected with RI were treated (+) or untreated(-) with TGF-beta. Transfections, TGF-beta treatment (48 h), and reporter assays were carried out as in panel A. RII, type II TGF-beta receptor; RI, type I TGF-beta receptor; Mv1Lu, wild-type Mv1Lu cells; DR26, RII-deficient cells; R1B, RI-deficient cells.



To evaluate the TGF-beta responsiveness of the cyclin A promoter, both luciferase plasmids were transfected into Mv1Lu cells, and the normalized luciferase activity was calculated at defined time points after initiation of TGF-beta treatment. In Mv1Lu cells transfected with pCAL2, the luciferase activity was down-regulated by TGF-beta (Fig. 1A) in a manner similar to that in pCD1-transfected cells. This decreased expression from the cyclin A promoter parallels the inhibition of cyclin A expression by TGF-beta in Mv1Lu (15, 16, 17) and other epithelial cell lines(13) . The TGF-beta-induced inhibition of luciferase expression was most evident when TGF-beta treatment was initiated within 6 h after release from contact inhibition (data not shown), and the cyclin A promoter response was maximal when the cells were exposed to TGF-beta for 48 h (Fig. 1A). These results indicate that the 760-bp cyclin A promoter fragment in pCAL2 contains the TGF-beta-responsive element(s) and that this cyclin A-luciferase assay can be used as transcriptional reporter system to measure the antiproliferative effect of TGF-beta in transient transfection assays.

Down-regulation of Cyclin A Expression by TGF-beta Requires Both Type I and Type II TGF-beta Receptors

As shown in Fig. 1A, cyclin A transcriptional down-regulation by TGF-beta was apparent in wild-type Mv1Lu cells, which possess functional type I (RI) and type II (RII) receptors. To further characterize the requirement of receptors in TGF-beta-dependent cyclin A expression, we investigated whether the luciferase activity driven from the cyclin A promoter in pCAL2 is down-regulated by TGF-beta treatment in Mv1Lu mutant cell lines lacking functional receptors(49, 50) . In both the RII-deficient DR26 cells and RI-deficient R1B cells, the cyclin A promoter-driven luciferase expression was unchanged upon TGF-beta treatment (Fig. 1B). In contrast, reintroduction of RII in DR26 cells or RI, but not RI, in R1B cells restored the response to TGF-beta in the cyclin A-luciferase assay (Fig. 1B). These results suggest that the TGF-beta-induced growth inhibition requires both RI and RII receptors.

The Cytoplasmic Domains of Both Receptors Are Required for TGF-beta Responsiveness in the Cyclin A-Luciferase Assay

To further examine the role of specific domains of TGF-beta receptors in TGF-beta-dependent down-regulation of cyclin A expression, we generated chimeras between the extracellular/transmembrane (ET) and cytoplasmic (C) domains of RII and RI or RI as well as mutant receptors with cytoplasmic truncations of RI, RI and RII, as shown in Fig. 2. These mutant receptors were engineered to incoporate a C-terminal myc- or FLAG-epitope tag which allows immunoprecipitation with tag-specific antisera. We first examined whether these chimeric and truncated receptors were efficiently expressed in COS-1 or 293 cells. Following metabolic S-labeling of the cells, the receptors were immunoprecipitated and analyzed by SDS-PAGE followed by autoradiography. All truncated and chimeric receptors were expressed at significant levels and had the expected molecular weights, although degradation products were often apparent (Fig. 3A). According to the mobility on SDS-PAGE gels, RII had the expected size of 80 kDa, and the R4 and Tsk7L type I receptors, expressed by plasmids RI and RI, respectively, had the expected size of 70 kDa. Transfection of the plasmids for the truncated receptors lacking the C domain generated a polypeptide of 35 kDa for RII(ET) and 30 kDa for both RI(ET) and RI(ET). The hybrids between RI (either RI or RI) and RII comigrated with a size of 80 kDa for the RII(ET)-RI(C) chimeras and 75 kDa for RI(ET)-RII(C) chimeras.


Figure 2: Schematic presentation of mutant TGF-beta receptors. The construction and nomenclature of the receptor mutants is described under ``Materials and Methods'' and ``Results.'' RI, type I TGF-beta receptor R4; RI, type I receptor Tsk 7L; RII, type II TGF-beta receptor. ET, extracellular/transmembrane domain; C, cytoplasmic domain; DeltaJM, juxtamembrane domain deletion; DeltaT, cytoplasmic tail deletion; DeltaJMT, deletion of juxtamembrane domain and cytoplasmic tail.




Figure 3: A, expression of mutant receptors in COS-1 cells. COS-1 cells were transfected with pRK5 (lane 1) or receptor expression plasmids (lanes 2-11). The receptors were immunoprecipitated from S-labeled cell lysates using antibodies specific for the FLAG (F) or myc (M) epitope as indicated. The immunoprecipitated proteins were analyzed by SDS-PAGE and autoradiography. The positions of the receptors and molecular weight markers are shown on the side. Lane 2, RII; lane 3, RI; lane 4, RI; lane 5, RII(ET)-RI(C); lane 6, RII(ET)-RI(C); lane 7, RI(ET)-RII(C); lane 8, RI(ET)-RII(C); lane 9, RII(ET); lane 10, RI(ET); lane 11, RI(ET). B, ligand binding of mutant receptors expressed in COS-1 cells. Binding of I-TGF-beta to COS-1 cells transfected with plasmids expressing wild-type or mutant receptors was examined. Cross-linked complexes were subjected to SDS-PAGE and autoradiography. Each lane represents an equal amount of protein lysate as determined by BCA assay (Bio-Rad). Migration of the receptors are indicated using the same abreviations for receptors as in Fig. 3A. Lane 1, pRK5; lane 2, RII; lane 3, RI; lane 4, RI and RII; lane 5, RI; lane 6, RIand RII; lane 7, RII(ET)-RI(C); lane 8, RII(ET)-RI(C); lane 9, RI(ET)-RII(C); lane 10, RI(ET)-RII(C) and RII; lane 11, RI(ET)-RII(C); lane 12, RI(ET)-RII(C) and RII; lane 13, RII(ET); lane 14, RI(ET); lane 15, RI(ET) and RII; lane 16, RI(ET); lane 17, RI(ET) and RII.



The ability of the mutant receptors to bind TGF-beta at the cell surface was determined by binding and cross-linking of I-TGF-beta. As shown in Fig. 3B, both RII and RII(ET)-RI(C) chimeras with their type II extracellular domain bound I-TGF-beta (lanes 2, 7, and 8). In contrast, RI and RI(ET)-RII(C) chimeras which have RI extracellular domains did not bind TGF-beta when expressed alone (lanes 3, 5, 9, and 11). However, these receptors bound ligand when cotransfected with RII (lanes 4, 6, 10, and 12). Similarly, RI(ET) and RI(ET) bound ligand only in the presence of RII (compare lanes 14 and 16 to 15 and 17), whereas RII(ET) bound TGF-beta by itself (lane 13). Taken together, these results indicate that the mutant receptors were readily expressed at the cell surface and displayed normal ligand binding.

The ability of the mutant TGF-beta receptor to signal was then examined in the cyclin A-luciferase assay using receptor-deficient Mv1Lu mutant cells. Although wild-type RII restored TGF-beta-dependent down-regulation of cyclin A transcription in RII-deficient DR26 cells, none of the chimeric receptors (RI-RII, RI-RII, RII-RI or RII-RI), when expressed alone, induced transcriptional regulation of cyclin A-luciferase in response to TGF-beta (Fig. 4, left panel). Similarly, the chimeric receptors did not restore TGF-beta responsiveness in the RI-deficient R1B cells which contain endogenous RII, even though RI was able to restore the TGF-beta-induced inhibition of cyclin A-luciferase activity to the cells (Fig. 4, right panel). While a single chimeric receptor was unable to confer TGF-beta responsiveness in the mutant cell lines, coexpression of the two chimeric receptors RII(ET)-RI(C) and RI(ET)-RII(C) resulted in TGF-beta-dependent inhibition of luciferase expression in these cells (Fig. 4). Similarly, coexpression of both chimeric receptors led to TGF-beta-dependent increases of transcription from the PAI-1 promoter in a PAI-1-luciferase assay (data not shown; Table 1). While the coexpression of both chimeras in mutant cells restored the TGF-beta-dependent responses, significant levels of cyclin A inhibition and PAI-1 up-regulation were already observed in the absence of TGF-beta in these cells. This constitutive signaling in the absence of TGF-beta resulted in the lower relative level of inhibition of cyclin A expression in the presence of TGF-beta, when compared with that in the absence of TGF-beta (Fig. 4). In fact, TGF-beta-independent signaling was also apparent when the two types of cytoplasmic domains (RII and RI) were expressed regardless of what extracellular domains they were fused to (data not shown). These results suggest that the high level expression of both cytoplasmic domains is responsible for ligand-independent signaling and that the two receptor types have an intrinsic heteromeric affinity for each other which is consistent with previous findings(48) . In contrast to the chimeric receptors derived from RI, cotransfection of RII(ET)-RI(C) with RI(ET)-RII(C) did not lead to TGF-beta responsiveness in the cyclin A-luciferase assay, consistent with the inactivity of the Tsk7L type I receptor in Mv1Lu cells(31, 39) .


Figure 4: Signaling activity of chimeric receptors in mutant Mv1Lu cells using TGF-beta-dependent cyclin A-luciferase reporter assay. Receptor expression plasmids were transfected in DR26 or R1B cells together with the cyclin A-luciferase plasmid pCAL2. Cyclin A-luciferase data are shown as the percentage decrease in luciferase activity relative to cells that did not receive TGF-beta. In the cases when the cyclin A activity was higher after TGF-beta treatment, a negative value for the percentage inhibition was observed. The vertical bars show the standard deviations. Receptors are abbreviated as in Fig. 2except that hRII represents wild-type human RII.





Dominant Negative Effect of Chimeric and Truncated Receptors on TGF-beta-dependent Down-regulation of Cyclin A Expression

We further characterized the role of RI and RII in TGF-beta-induced down-regulation of cyclin A expression by examining the function of the chimeras in wild-type Mv1Lu cells which contain endogenous RI and RII. Because of the TGF-beta responsiveness associated with endogenous receptors, overexpression of wild-type RI or RII did not alter cyclin A transcription. In contrast, expression of chimeric receptors RI(ET)-RII(C), RII(ET)-RI(C) or RII(ET)-RI(C), but not RI(ET)-RII(C), abolished TGF-beta-dependent inhibition of cyclin A transcription (Fig. 5, left panel), indicating that chimeras with either RI- or RII-derived ET domains inhibited the activities of the endogenous receptors in a dominant negative fashion. Furthermore, in transfections with the RII(ET)-RI(C) or RII(ET)-RI(C) chimeric receptors, the cyclin A activity was even higher after TGF-beta treatment (resulting in the negative value for the percentage inhibition, Fig. 5). Dominant negative inhibition was also observed with the kinase-deficient point mutants RIIKR and RIKR, in which the Lys in the ATP-binding sites of RII and RI was replaced by Arg (Fig. 5, middle panel). The dominant negative effect of these mutant receptors in wild type Mv1Lu cells was also apparent in the PAI-1-luciferase assay (data not shown; Table 1).


Figure 5: Dominant negative inhibition of TGF-beta-dependent cyclin A down-regulation by mutant receptors in wild-type Mv1Lu cells. Plasmids used for transfection of Mv1Lu cells are as in Fig. 2except that plasmids RIKR and RIIKR represent the kinase-negative mutants of RI and RII, respectively. Data are presented as in Fig. 4.



Using the TGF-beta-responsive wild-type Mv1Lu cells and the cyclin A-luciferase assay, we also evaluated the effect of expression of truncated receptors lacking the cytoplasmic domain (Fig. 5, right panel). Consistent with the results using a truncated human type II receptor(51, 60) , expression of the mouse RII lacking its cytoplasmic domain, RII(ET), also blocked TGF-beta-dependent inhibition of cyclin A transcription in a dominant negative manner. Overexpression of the truncated RI(ET) type I receptor lacking its cytoplasmic domain, but not RI(ET), in Mv1Lu cells also abolished TGF-beta responsiveness (Fig. 5, right panel). This effect was also seen in the PAI-1 assay (Table 1). However, the inhibitory effect of RI(ET) was less effective than RII(ET) in the PAI-1 assay (Table 1, data not shown).

Juxtamembrane Domains of Type I and Type II TGF-beta Receptors Are Required for TGF-beta Responsiveness

Finally, we evaluated the signaling ability of RII and RI receptor mutants in which the juxtamembrane segment (between the transmembrane and the kinase domain) or the C-terminal tail following the kinase domain, or both, were deleted. We also included kinase-deficient point mutants of RII and RI, i.e. RIIKR and RIKR, for comparison. Expression plasmids for the RII mutants were transfected into DR26 cells and plasmids for the RI mutants into R1B cells. These receptors were then tested for their ability to restore TGF-beta responsiveness using both cyclin A- and PAI-1-luciferase assays (Fig. 6; Table 1). Both RI and RII with the deletion of the cytoplasmic tail (amino acids 491-501 in RIDeltaT and 546-567 in RIIDeltaT) conferred TGF-beta responsiveness to the corresponding mutant cell lines. In contrast, deletion of the juxtamembrane domains inactivated the signaling activity of both receptor types in the two assays, as shown by transfecting the mutant receptors RIDeltaJM in R1B cells or RIIDeltaJM in DR26 cells. Accordingly, deletion of both the juxtamembrane and the cytoplasmic tail in both receptors also inactivated both receptor types. As expected, RIKR and RIIKR were also biologically inactive (Fig. 6, Table 1).


Figure 6: Biological effects of deletion of the cytoplasmic segments of TGF-beta receptors on TGF-beta-dependent down-regulation of cyclin A-luciferase expression. Cytoplasmic deletion mutants of both RI and RII were as shown in Fig. 2and in legend to Fig. 5. Data are presented as in Fig. 4.



When expression plasmids for these mutant receptors were transfected into COS-1 cells and the kinase activity of the immunoprecipitated receptors was tested in vitro, we observed a correlation between the receptor kinase activity and their biological functions (Fig. 7). While RIDeltaT and RIIDeltaT maintained their kinase and signaling activities similarly to wild-type receptors, RIDeltaJM and RIIDeltaJM, like the kinase-negative mutants RIKR and RIIKR, were also kinase inactive and unable to autophosphorylate. Thus, mutant receptors which were inactive in the biological assays were also inactive in the kinase assay.


Figure 7: Expression and in vitro kinase activity of mutant receptors with cytoplasmic deletions. COS-1 cells were transfected with the plasmids indicated and the receptors were immunoprecipitated from S-lysates as described in Fig. 3A. Half of the immunoprecipitated proteins were analyzed by SDS-PAGE (left panels), whereas the other half was subjected to in vitro kinase assay using [gamma]P]ATP prior to gel analysis (right panels). The positions of the receptors and molecular weight markers are shown.




DISCUSSION

Roles of TGF-beta Receptors in TGF-beta-dependent Down-regulation of Cyclin A Transcription

During the cell cycle, cyclin A transcription is suppressed in late G(1) phase and activated during S phase(16, 17) . Thus, cyclin A expression is considered to be an indicator of the cell growth status. Inhibition of cyclin A expression is sufficient to cause cell cycle arrest before G(1)/S transition(61, 62) , and deregulated cyclin A expression is apparent in many cancers and transformed cells(14, 62, 63) . Cyclin A expression is down-regulated by many factors, including TGF-beta (13, 14, 15, 16, 17) and contact inhibition(64) , which both arrest cell growth in late G(1). The TGF-beta-dependent down-regulation may play a critical role in TGF-beta-induced growth arrest(17) . To generate a convenient and rapid reporter system that allows a measurement of growth inhibition by TGF-beta and other factors, we created a plasmid in which luciferase expression is driven by a 760-bp segment of the cyclin A promoter. Treatment of Mv1Lu cells with TGF-beta resulted in a rapid inhibition of luciferase expression, indicating that this short sequence confers TGF-beta responsiveness. Several potential regulatory sequence elements, including four Sp1 sites, one cAMP-responsive element (CRE), two Yi sites, two E2F-binding sites, one AP1 site, and one p53 binding site, are contained within this short promoter sequence(54) . Although the CRE sequence (also called activating transcription factor site, or ATF site) is critical in the down-regulation of cyclin A expression during contact inhibition (64) , the promoter elements which mediate TGF-beta-induced inhibition of cyclin A expression in cultured cells are not known. However, contact inhibition and TGF-beta-mediated growth arrest have several features in common, e.g. p27, an inhibitor of cdk2 and cdk4, is activated in both contact-inhibited and TGF-beta-inhibited cells(9) , implicating a similar mechanistic basis for down-regulation of cyclin A expression under both conditions.

Based on the TGF-beta responsiveness of the 760-bp cyclin A promoter element, we have developed a functional assay to monitor cyclin A regulation in response to TGF-beta. This assay can be used in transient transfection assays to allow a functional evaluation of TGF-beta receptors and other signaling proteins involved in the antiproliferative effect of TGF-beta. In spite of the many TGF-beta-induced responses, transcriptional activation of the PAI-1 gene is frequently used as the only indicator for TGF-beta signaling and receptor function, primarily because of the availability of a highly sensitive and convenient reporter assay that measures luciferase expression from a TGF-beta-responsive promoter element(25) . Before this study, no facile reporter assay has been available to measure the antiproliferative effect of TGF-beta, even though considerable evidence suggests that the growth inhibition and the induction of gene expression by TGF-beta result from divergent signaling cascades. The availability of a cyclin A luciferase reporter system allowed us to characterize the role of specific domains of TGF-beta receptors during TGF-beta-mediated growth inhibition using transient transfection assays.

Our results demonstrate that inhibition of cyclin A transcription by TGF-beta requires both RII and RI receptors. The cyclin A transcription is inhibited by TGF-beta in Mv1Lu cells which contain endogenous RI and RII receptors but not in the two mutant cell lines lacking either RI or RII. Introduction of wild-type RI into RI-deficient cells or RII into RII-deficient cells restores TGF-beta-dependent cyclin A transcription. In contrast, various mutant receptors including the chimeric receptors RII(ET)-RI(C), RI(ET)-RII(C), RII(ET)-RI(C), and RI(ET)-RII(C) as well as the kinase-negative point mutants RIKR and RIIKR, and receptors lacking the juxtamembrane domain RIDeltaJM and RIIDeltaJM, are unable to rescue the ability of mutant cells to respond to TGF-beta. However, coexpression of RII(ET)-RI(C) and RI(ET)-RII(C), which allows heteromerization of both extracellular and intracellular domains(48) , restores TGF-beta-dependent down-regulation of cyclin A expression in either mutant cell line. In wild-type Mv1Lu cells, individual expression of these mutant receptors inhibits TGF-beta-induced cyclin A down-regulation in a dominant negative fashion. These results suggest that cyclin A expression and, thus, the growth inhibitory effect of TGF-beta need the cooperative interaction between type I and type II TGF-beta receptors.

Functional Analysis of TGF-beta Receptor Domains Using Both Cyclin A and PAI-1 Assays

Several recent studies have addressed the functions of the two receptor types (25, 34, 39) and their cytoplasmic domains in TGF-beta signaling(46, 66) . Transfection of RII receptor in DR26 cells or R4/ALK-5 type I receptor (termed RI in this study) in R1B cells restores TGF-beta responsiveness, suggesting that both receptor types are required for TGF-beta responsiveness(25, 34, 39) . The ability of the two receptor types to undergo heteromeric interactions and the phosphorylation of the type I receptor cytoplasmic domain by the type II receptor kinase further reinforces the assumption that both cytoplasmic domains are required for TGF-beta responsiveness (46, 47) . Thus a heteromeric complex is thought to be the signaling unit for the multiple responses to TGF-beta(25, 44) .

In our study, we tested in parallel the TGF-beta-dependent cyclin A response and PAI-1 transcriptional response and did not observe an uncoupling of these responses (see Table 1), which is consistent with the proposed requirement of both cytoplasmic domains for full TGF-beta responsiveness. More specifically, homomerization of cytoplasmic domains, resulting from expression of the RII(ET)-RI(C) chimera in DR26 cells or the RI(ET)-RII(C) chimera in R1B cells, is not sufficient for TGF-beta-induced regulation of cyclin A and PAI-1 expression, suggesting that a functional interaction of the two types of cytoplasmic domains is a prerequisite for TGF-beta responsiveness. In addition, despite the heteromeric combination of both cytoplasmic domains, homomeric combination of the extracellular/transmembrane domains of type I or type II receptors also fails to restore TGF-beta responsiveness. In the case of the RI(ET)-RII(C) chimera in DR26 cells which express endogenous RI, this lack of signaling might be due to the inability of the RI extracellular domains to bind ligand in the absence of RII. However, expression of the RII(ET)-RI(C) chimera in R1B cells which have endogenous RII yet lack functional RI also does not activate TGF-beta responsiveness even though these receptors bind TGF-beta efficiently. This suggests an active function of the RI extracellular domain in TGF-beta signaling.

Coexpression of the RII(ET)-RI(C) and RI(ET)-RII(C) chimeras in DR26 or R1B cells results in TGF-beta responsiveness in both reporter assays, suggesting that the coexistence of both extracellular and cytoplasmic domains in trans provides a functional TGF-beta receptor unit. TGF-beta is likely to induce a conformational change in the heteromeric complex of these chimeras in a manner similar to the complex of wild-type RI and RII receptors. The resulting activation promotes the interaction of the receptors with downstream effectors. Our data are in agreement with the recent findings of Okadame et al.(66) , who showed the requirement of both cytoplasmic domains for TGF-beta-induced PAI-1 transcription. We extended their findings by using the cyclin A reporter assay and by examining the effects of chimeric receptors in wild-type Mv1Lu cells.

In wild-type Mv1Lu cells, expression of the RI(ET)-RII(C) or RII(ET)-RI(C) chimera inhibits TGF-beta-induced regulation of cyclin A and PAI-1 expression in a dominant negative manner. This inhibition is likely due to the fact that overexpression of the RI(ET)-RII(C) or RII(ET)-RI(C) chimera sequesters endogenous RII and/or RI away from functional RI-RII receptor complexes. The resulting homomeric complexes of chimeric receptors and the heteromeric complexes between endogenous receptors and the chimeras are then unable to transduce the TGF-beta signals. This dominant negative interference resembles the inhibitory effect of truncated receptors lacking their cytoplasmic domain and the kinase-negative mutant receptors. The inhibition of TGF-beta responsiveness by RII(ET) is in accordance with previous results(51, 60, 67) . A dominant negative inhibition, albeit to a lesser extent, was also apparent with overexpression of RI(ET) in Mv1Lu cells, but not with RI(ET) even though the truncated form of Tsk7L inhibited TGF-beta-induced mesenchymal transdifferentiation in NMuMG cells(40) . Thus, overexpression of chimeric, truncated, or kinase-defective receptors derived from RII or RI results in dominant negative interference with TGF-beta receptor signaling, most likely by interfering with the assembly of functional homo- and heteromeric complexes. After the submission of this manuscript, Vivien et al.(68) and Brand and Schneider (69) reported dominant negative inhibition of TGF-beta signaling by chimeric and kinase-defective receptors, using assays for TGF-beta-induced gene expression. Their conclusions and our findings based on cyclin A and PAI-1 assays are in agreement; moreover, our cyclin A assay results further extend their observations to TGF-beta-induced growth inhibition.

Finally, we characterized the function of the RI and RII receptor cytoplasmic domains containing defined deletions. Deletion of the C-terminal tail of either receptor did not affect the kinase and signaling activity of RI and RII in both cyclin A and PAI-1 reporter assays. A similar result has been observed in the case of RII using the PAI-1 reporter assay(60) . We also demonstrated that deletion of the juxtamembrane domain inactivates the signaling function of both receptor types. This correlates with a loss of kinase activity as measured by autophosphorylation. In the case of the type I receptor, the juxtamembrane domain contains a conserved SGSGSGLP sequence. This sequence is a major site of phosphorylation by the type II receptor, and its deletion has been shown to inactivate TGF-beta signaling(46) . Thus, our results indicate the requirement of the juxtamembrane domains for the function and kinase activity of both receptors. These domains may also represent binding sites for cytoplasmic effector proteins.

Coincident Responsiveness in the Cyclin A and PAI-1 Reporter Assays

In this study we did not observe a divergence of the pathways leading to growth inhibition and gene expression using the cyclin A and PAI-1 assays. This supports the conclusion of Wrana et al.(25) and Bassing et al.(44) who showed that the activities of both RI and RII are required for TGF-beta-induced gene expression and growth inhibition. Solely based on these studies, we would conclude that cytoplasmic domains of both RI and RII are required for both types of TGF-beta responses. However, uncoupling of the two types of responses has been observed in several systems. We have previously shown that stable expression of a truncated RII in Mv1Lu cells abolished the antiproliferative effect of TGF-beta but not its induction of gene expression(51) . Also, a Phe to Ala mutation at position 498 in RII does not affect the induction of transcription by TGF-beta, yet reduces significantly its antiproliferative effect(60) . In addition, several cell lines lacking detectable levels of RII expression or with a defective RII display TGF-beta responsiveness in gene expression assays but are not growth inhibited by TGF-beta(53, 70) . Furthermore, various tumor cell lines also lack a growth inhibitory response to TGF-beta yet respond to TGF-beta by the induction of gene expression(52) . Finally, differentiating osteoblasts undergo alterations in RI and RII expression and ligand binding and concomitantly show phenotypic changes in their responsiveness to TGF-beta(71) . Thus, these studies suggest that both signaling pathways should be considered as distinct and that in some cases, but not all, uncoupling can occur at the receptor level and that specific changes in functionality of TGF-beta receptors correlate with induction of specific downstream signaling pathways. How all these observations can be reconciled in a simple model is unclear. However, the apparent discrepancy between both sets of observations might be explained by a threshold model. In such a model, both receptor types are required but the TGF-beta-induced growth arrest requires full activity of endogenous RII (and maybe RI receptor), whereas changes in TGF-beta-induced gene expression can be mediated at a much reduced level of receptor activity, i.e. at a low threshold level. For example, overexpression of a truncated RII in Mv1Lu cells (51) strongly interferes with endogenous RII, but the remaining activity might still suffice to confer the transcriptional response to TGF-beta but not growth inhibition. This threshold model could also explain the diminished activity of RII defective in N-glycosylation (53) and RII mutated at position 498 (60) in the antiproliferative response but not in TGF-beta-induced gene expression. Accordingly, we have observed that some chimeric and kinase-negative mutants derived from RI and RII completely abolished TGF-beta-dependent cyclin A regulation but only reduced TGF-beta-induced PAI-1 transcription (data not shown). Thus, changes in expression or activity of receptors could possibly determine which downstream pathways are activated. Recently, a threshold model has also been proposed for the response of PC12 cells to receptor tyrosine kinase activation (for review see (72) ). In PC12 cells, transient versus sustained ERK activation by growth factors has very different consequences for nuclear translocation of ERK, gene expression, and subsequent proliferation or differentiation(72) . An additional complexity in the current models for TGF-beta receptor signaling is imposed by evidence that ligand binding to RI and RII is differentially regulated. This is apparent from the altered receptor binding in differentiating osteoblasts (71) as well as the observation that a mutated, monomeric TGF-beta binds much less efficiently to type II than type I receptor. This mutated TGF-beta is still 20% as active as native TGF-beta1 in PAI-1 induction, but it is less than 1% potent as native TGF-beta1 in growth inhibition in Mv1Lu cells(73) , which may be consistent with the threshold model. Further assessment of receptor expression patterns, characterization of the cytoplasmic domains of the TGF-beta receptors, and their interactions as well as the identification of interacting cytoplasmic proteins should bring insight into the mechanism of TGF-beta receptor signaling.


FOOTNOTES

*
This work was supported by Grant CA63101 from the National Cancer Institute (to R. D.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Dept. of Growth and Development, University of California at San Francisco, San Francisco, CA 94143-0640. Tel.: 1-415-476-7322; Fax: 1-415-476-1499.

(^1)
The abbreviations used are: TGF-beta, transforming growth factor-beta; PAI-1, plasminogen activator inhibitor type 1; PCR, polymerase chain reaction; FBS, fetal bovine serum; PAGE, polyacrylamide gel electrophoresis; bp, base pair(s).


ACKNOWLEDGEMENTS

We thank Drs. P. Donahoe for the rat R4 cDNA and X.-F. Wang for the cDNAs encoding kinase-negative mutants of R4 and human type II receptor, Drs. J. Massagué and H. Lodish for mutant Mv1Lu cells, Dr. D. J. Loskutoff for the PAI-1-luciferase reporter plasmid and Dr. C. Bréchot for plasmid pCD1. We also thank Dr. J. M. Bishop for the anti-myc antibody 9E10 and Dr. D. Littman for the use of his luminometer for luciferase assays. We are grateful to Drs. Ruey-Hwa Chen, Irene Griswold-Prenner, Lisa Choy, and other members of the laboratory for helpful discussion and critical review of the manuscript.


REFERENCES

  1. Derynck, R. (1994) in The Cytokine Handbook (Thomson, A. W., ed) pp. 319-342, Academic Press, San Diego
  2. Kingsley, D. M. (1994) Genes & Dev. 8,133-146 [CrossRef]
  3. Egan, S. E., and Weinberg, R. A. (1993) Nature 365,781-783 [CrossRef][Medline] [Order article via Infotrieve]
  4. Ewen, M. E., Sluss, H. K., Whitehouse, L. L., and Livingston, D. M. (1993) Cell 74,1009-1020 [CrossRef][Medline] [Order article via Infotrieve]
  5. Geng, Y., and Weinberg, R. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,10315-10319 [Abstract/Free Full Text]
  6. Koff, A., Ohtsuki, M., Polyak, K., Roberts, J. M., and Massagué, J. (1993) Science 260,536-539 [Abstract/Free Full Text]
  7. Slingerland, J., Hengst, L., Pan, C.-H., Alexander, D., Stampfer, M., and Reed, S. (1994) Mol. Cell. Biol. 14,3683-3694 [Abstract/Free Full Text]
  8. Polyak, K., Lee, M.-H., Erdjument-Bromage, H., Koff, A., Roberts, J. M., Tempst, P., and Massagué, J. (1994) Cell 78,59-66 [CrossRef][Medline] [Order article via Infotrieve]
  9. Polyak, K., Kato, J., Solomon, M. J., Sherr, C. J., Massagué, J., Roberts, J. M., and Koff, A. (1994) Genes & Dev. 8,9-22
  10. Toyoshima, H., and Hunter, T. (1994) Cell 78,67-74 [CrossRef][Medline] [Order article via Infotrieve]
  11. Hannon, G. J., and Beach, D. (1994) Nature 371,257-260 [CrossRef][Medline] [Order article via Infotrieve]
  12. Eblen, S. T., Fautsch, M. P., Burnette, R. J., Joshi, P., and Leof, E. B. (1994) Cell Growth Differ. 5,109-116 [Abstract]
  13. Landesman, Y., Pagano, M., Draetta, G., Rotter, V., Fusenig, N. E., and Kimchi, A. (1992) Oncogene 7,1661-1665 [Medline] [Order article via Infotrieve]
  14. Barlat, I., Fesquet, D., Bréchot, C., Henglein, B., Dupuy, d. A., Vie, A., and Blanchard, J. M. (1993) Cell Growth Differ. 4,105-113 [Abstract]
  15. Ralph, D., McClelland, M., and Welsh, J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,10710-10714 [Abstract/Free Full Text]
  16. Reddy, K. B., Hocevar, B. A., and Howe, P. H. (1994) J. Cell. Biochem. 56,418-425 [CrossRef][Medline] [Order article via Infotrieve]
  17. Satterwhite, D. J., Aakre, M. E., Gorska, A. E., and Moses, H. L. (1994) Cell Growth Differ. 5,789-799 [Abstract]
  18. Mudryj, M., Devoto, S. H., Hiebert, S. W., Hunter, T., Pines, J., and Nevins, J. R. (1991) Cell 65,1243-1253 [CrossRef][Medline] [Order article via Infotrieve]
  19. Devoto, S. H., Mudryj, M., Pines, J., Hunter, T., and Nevins, J. R. (1992) Cell 68,167-176 [CrossRef][Medline] [Order article via Infotrieve]
  20. Shirodkar, S., Ewen, M., DeCaprio, J. A., Morgan, J., Livingston, D. M., and Chittenden, T. (1992) Cell 68,157-166 [CrossRef][Medline] [Order article via Infotrieve]
  21. Schwarz, J. K., Devoto, S. H., Smith, E. J., Chellappan, S. P., Jakoi, L., and Nevins, J. R. (1993) EMBO J. 12,1013-1020 [Medline] [Order article via Infotrieve]
  22. Zhu, L., Enders, G., Lees, J. A., Beijersbergen, R. L., Bernards, R., and Harlow, E. (1995) EMBO J. 14,1904-1913 [Medline] [Order article via Infotrieve]
  23. Laiho, M., DeCaprio, J. A., Ludlow, J. W., and Livingston, D. M. (1990) Cell 62,175-185 [CrossRef][Medline] [Order article via Infotrieve]
  24. Keeton, M. R., Curriden, S. A., van, Z. A., and Loskutoff, D. J. (1991) J. Biol. Chem. 266,23048-23052 [Abstract/Free Full Text]
  25. Wrana, J. L., Attisano, L., Cárcamo, J., Zentella, A., Doody, J., Laiho, M., Wang, X. F., and Massagué, J. (1992) Cell 71,1003-1014 [CrossRef][Medline] [Order article via Infotrieve]
  26. Derynck, R. (1994) Trends Biochem. Sci. 19,548-553 [CrossRef][Medline] [Order article via Infotrieve]
  27. Massagué, J. (1990) Annu. Rev. Cell Biol. 6,597-641 [CrossRef]
  28. Mathews, L. S., and Vale, W. W. (1991) Cell 65,973-982 [CrossRef][Medline] [Order article via Infotrieve]
  29. Mathews, L. S., Vale, W. W., and Kintner, C. R. (1992) Science 255,1702-1705 [Abstract/Free Full Text]
  30. Attisano, L., Wrana, J. L., Cheifetz, S., and Massagué, J. (1992) Cell 68,97-108 [CrossRef][Medline] [Order article via Infotrieve]
  31. Attisano, L., Cárcamo, J., Ventura, F., Weis, F. M., Massagué, J., and Wrana, J. L. (1993) Cell 75,671-680 [CrossRef][Medline] [Order article via Infotrieve]
  32. Lin, H. Y., Wang, X.-F., Ng-Eaton, E., Weinberg, R. A., and Lodish, H. F. (1992) Cell 68,775-785 [CrossRef][Medline] [Order article via Infotrieve]
  33. Ebner, R., Chen, R.-H., Shum, L., Lawler, S., Zioncheck, T. F., Lee, A., Lopez, A. R., and Derynck, R. (1993) Science 260,1344-1348 [Abstract/Free Full Text]
  34. Franzén, P., ten Dijke, P., Ichijo, H., Yamashita, H., Schulz, P., Heldin, C.-H., and Miyazono, K. (1993) Cell 75,681-692 [CrossRef][Medline] [Order article via Infotrieve]
  35. He, W., Gustafson, M., Hirobe, S., and Donahoe, P. (1993) Dev. Dynam. 196,133-142 [Medline] [Order article via Infotrieve]
  36. ten Dijke, P., Ichijo, H., Franzén, P., Schulz, P., Saras, J., Toyoshima, H., Heldin, C.-H., and Miyazono, K. (1993) Oncogene 8,2879-2887 [Medline] [Order article via Infotrieve]
  37. ten Dijke, P., Yamashita, H., Ichijo, H., Franzén, P., Laiho, M., Miyanozo, K., and Heldin, C.-H. (1994) Science 264,101-104 [Abstract/Free Full Text]
  38. ten Dijke, P., Yamashita, H., Sampath, T. K., Reddi, A. H., Estevez, M., Riddle, D. L., Ichojo, H., Heldin, C.-H., and Miyazono, K. (1994) J. Biol. Chem. 269,16985-16988 [Abstract/Free Full Text]
  39. Bassing, C. H., Yingling, J. M., Howe, D. J., Wang, T., He, W. W., Gustafson, M. L., Shah, P., Donahoe, P. K., and Wang, X.-F. (1994) Science 263,87-89 [Abstract/Free Full Text]
  40. Miettinen, P. J., Ebner, R., Lopez, A. R., and Derynck, R. (1994) J. Cell Biol. 127,2021-2036 [Abstract/Free Full Text]
  41. Chen, R.-H., and Derynck, R. (1994) J. Biol. Chem. 269,22868-22874 [Abstract/Free Full Text]
  42. Henis, Y. I., Moustakas, A., Lin, H. Y., and Lodish, H. F. (1994) J. Cell Biol. 126,139-154 [Abstract/Free Full Text]
  43. Ebner, R., Chen, R.-H., Lawler, S., Zioncheck, T., and Derynck, R. (1993) Science 262,900-902 [Abstract/Free Full Text]
  44. Bassing, C. H., Howe, D. J., Segarini, P. R., Donahoe, P. K., and Wang, X.-F. (1994) J. Biol. Chem. 269,14861-14864 [Abstract/Free Full Text]
  45. Yamashita, H., ten Dijke, P., Franzén, P., Miyazono, K., and Heldin, C.-H. (1994) J. Biol. Chem. 269,20172-20178 [Abstract/Free Full Text]
  46. Wrana, J. L., Attisano, L., Wieser, R., Ventura, F., and Massagué, J. (1994) Nature 370,341-347 [CrossRef][Medline] [Order article via Infotrieve]
  47. Chen, F., and Weinberg, R. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92,1565-1569 [Abstract/Free Full Text]
  48. Chen, R.-H., Moses, H. L., Maruoka, E. M., Derynck, R., and Kawabata, M. (1995) J. Biol. Chem. 270,12235-12241 [Abstract/Free Full Text]
  49. Laiho, M., Weis, M. B., and Massagué, J. (1990) J. Biol. Chem. 265,18518-18524 [Abstract/Free Full Text]
  50. Laiho, M., Weis, F. M., Boyd, F. T., Ignotz, R. A., and Massagué, J. (1991) J. Biol. Chem. 266,9108-9112 [Abstract/Free Full Text]
  51. Chen, R.-H., Ebner, R., and Derynck, R. (1993) Science 260,1335-1338 [Abstract/Free Full Text]
  52. Laiho, M., Ronnstrand, L., Heino, J., DeCaprio, J. A., Ludlow, J. W., Livingston, D. M., and Massagué, J. (1991) Mol. Cell. Biol. 11,972-978 [Abstract/Free Full Text]
  53. Fafeur, V., O'Hara, B., and Böhlen, P. (1993) Mol. Biol. Cell 4,135-144 [Abstract]
  54. Henglein, B., Chenivesse, X., Wang, J., Eick, D., and Bréchot, C. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,5490-5494 [Abstract/Free Full Text]
  55. Lawler, S., Candia, A., Ebner, R., Shum, L., Lopez, A., Moses, H., Wright, C., and Derynck, R. (1994) Development 120,165-175 [Abstract]
  56. Graycar, J. L., Miller, D. A., Arrick, B. A., Lyons, R. M., Moses, H. L., and Derynck, R. (1989) Mol. Endocrinol. 3,1977-1986 [Abstract/Free Full Text]
  57. Evan, G., Lewis, G., Ramsay, G., and Bishop, J. M. (1985) Mol. Cell. Biol. 5,3610-3616 [Abstract/Free Full Text]
  58. Hopp, T. P., Prickett, K. S., Price, V., Libby, R. T., March, C. J., Cerretti, P., Urdal, D. L., and Conlon, P. J. (1988) BioTechniques 6,1205-1210
  59. Gazit, D., Ebner, R., Kahn, A., and Derynck, R. (1993) Mol. Endocrinol. 7,189-198 [Abstract/Free Full Text]
  60. Wieser, R., Attisano, L., Wrana, J. L., and Massagué, J. (1993) Mol. Cell. Biol. 13,7239-7247 [Abstract/Free Full Text]
  61. Zindy, F., Lamas, E., Chenivesse, X., Sobczak, J., Wang, J., Fesquet, D., Henglein, B., and Bréchot, C. (1991) Biochem. Biophys. Res. Commun. 182,1144-1154
  62. Pagano, M., Pepperkok, R., Verde, F., Ansorge, W., and Draetta, G. (1992) EMBO J. 11,961-971 [Medline] [Order article via Infotrieve]
  63. Faha, B., Ewen, M., Tsai, L., Livingston, D., and Harlow, E. (1992) Science 255,87-90 [Abstract/Free Full Text]
  64. Yoshizumi, M., Hsieh, C.-M., Zhou, F., Tsai, J.-C., Patterson, C., Perrella, M., and Lee, M.-E. (1995) Mol. Cell. Biol. 15,3266-3272 [Abstract]
  65. Wrana, J. L., Cárcamo, J., Attisano, L., Cheifetz, S., Zentella, A., Lopez, C. F., and Massagué, J. (1992) Cold Spring Harb. Symp. Quant. Biol. 57,81-86 [Abstract/Free Full Text]
  66. Okadame, T., Yamashita, H., Franzén, P., Morén, A., Heldin, C.-H., and Miyazono, K. (1994) J. Biol. Chem. 269,30753-30756 [Abstract/Free Full Text]
  67. Brand, T., MacLellan, W. R., and Schneider, M. D. (1993) J. Biol. Chem. 268,11500-11503 [Abstract/Free Full Text]
  68. Vivien, D., Attisano, L., Wrana, J. L., and Massagué, J. (1995) J. Biol. Chem. 270,7134-7141 [Abstract/Free Full Text]
  69. Brand, T., and Schneider, M. (1995) J. Biol. Chem. 270,8274-8284 [Abstract/Free Full Text]
  70. Arrick, B. A., Lopez, A. R., Elfman, F., Ebner, R., Damsky, C. H., and Derynck, R. (1992) J. Cell Biol. 118,715-726 [Abstract/Free Full Text]
  71. Centrella, M., Kim, J., Phang, T. S., Cascendino, J., Rosen, V., Wozney, J., and McCarthy, T. (1995) Mol. Cell. Biol. 15,3273-3281 [Abstract]
  72. Marshall, C. (1995) Cell 80,179-185 [CrossRef][Medline] [Order article via Infotrieve]
  73. Amatayakul-Chantler, S., Qian, S. W., Gakenheimer, K., Bottinger, E. P., Roberts, A. B., and Sporn, M. B. (1994) J. Biol. Chem. 269,27687-27691 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
C. Millet, M. Yamashita, M. Heller, L.-R. Yu, T. D. Veenstra, and Y. E. Zhang
A Negative Feedback Control of Transforming Growth Factor-{beta} Signaling by Glycogen Synthase Kinase 3-mediated Smad3 Linker Phosphorylation at Ser-204
J. Biol. Chem., July 24, 2009; 284(30): 19808 - 19816.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. Karydis, M. Jimenez-Vidal, S. P. Denker, and D. L. Barber
Mislocalized Scaffolding by the Na-H Exchanger NHE1 Dominantly Inhibits Fibronectin Production and TGF-{beta} Activation
Mol. Biol. Cell, April 15, 2009; 20(8): 2327 - 2336.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
K. H. Wrighton, X. Lin, and X.-H. Feng
Critical regulation of TGF{beta} signaling by Hsp90
PNAS, July 8, 2008; 105(27): 9244 - 9249.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
C. P. Castro, D. Piscopo, T. Nakagawa, and R. Derynck
Cornichon regulates transport and secretion of TGF{alpha}-related proteins in metazoan cells
J. Cell Sci., July 15, 2007; 120(14): 2454 - 2466.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. Kamiya, K. Sakakibara, E. J. Ryer, R. P. Hom, E. B. Leof, K. C. Kent, and B. Liu
Phosphorylation of the Cyclic AMP Response Element Binding Protein Mediates Transforming Growth Factor {beta}-Induced Downregulation of Cyclin A in Vascular Smooth Muscle Cells
Mol. Cell. Biol., May 1, 2007; 27(9): 3489 - 3498.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Alliston, T. C. Ko, Y. Cao, Y.-Y. Liang, X.-H. Feng, C. Chang, and R. Derynck
Repression of Bone Morphogenetic Protein and Activin-inducible Transcription by Evi-1
J. Biol. Chem., June 24, 2005; 280(25): 24227 - 24237.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Fritah, C. Saucier, J. Mester, G. Redeuilh, and M. Sabbah
p21WAF1/CIP1 Selectively Controls the Transcriptional Activity of Estrogen Receptor {alpha}
Mol. Cell. Biol., March 15, 2005; 25(6): 2419 - 2430.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang, N. Sergina, T. C. Ko, J. Gong, and M. G. Brattain
Autocrine and Exogenous Transforming Growth Factor {beta} Control Cell Cycle Inhibition through Pathways with Different Sensitivity
J. Biol. Chem., September 17, 2004; 279(38): 40237 - 40244.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. Liang, Y.-Y. Liang, K. Wrighton, D. Ungermannova, X.-P. Wang, F. C. Brunicardi, X. Liu, X.-H. Feng, and X. Lin
Ubiquitination and Proteolysis of Cancer-Derived Smad4 Mutants by SCFSkp2
Mol. Cell. Biol., September 1, 2004; 24(17): 7524 - 7537.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
S. Ammanamanchi, M. P. M. Tillekeratne, T. C. Ko, and M. G. Brattain
Endogenous Control of Cell Cycle Progression by Autocrine Transforming Growth Factor {beta} in Breast Cancer Cells
Cancer Res., April 1, 2004; 64(7): 2509 - 2515.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. Osman, E. G. Niles, and P. T. LoVerde
Expression of Functional Schistosoma mansoni Smad4: ROLE IN ERK-MEDIATED TRANSFORMING GROWTH FACTOR {beta} (TGF-{beta}) DOWN-REGULATION
J. Biol. Chem., February 20, 2004; 279(8): 6474 - 6486.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Qing, C. Liu, L. Choy, R.-Y. Wu, J. S. Pagano, and R. Derynck
Transforming Growth Factor {beta}/Smad3 Signaling Regulates IRF-7 Function and Transcriptional Activation of the Beta Interferon Promoter
Mol. Cell. Biol., February 1, 2004; 24(3): 1411 - 1425.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
X. Lin, Y.-Y. Liang, B. Sun, M. Liang, Y. Shi, F. C. Brunicardi, Y. Shi, and X.-H. Feng
Smad6 Recruits Transcription Corepressor CtBP To Repress Bone Morphogenetic Protein-Induced Transcription
Mol. Cell. Biol., December 15, 2003; 23(24): 9081 - 9093.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
G. Marques, T. E. Haerry, M. L. Crotty, M. Xue, B. Zhang, and M. B. O'Connor
Retrograde Gbb signaling through the Bmp type 2 receptor Wishful Thinking regulates systemic FMRFa expression in Drosophila
Development, November 15, 2003; 130(22): 5457 - 5470.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
B. J. Schiemann, J. R. Neil, and W. P. Schiemann
SPARC Inhibits Epithelial Cell Proliferation in Part through Stimulation of the Transforming Growth Factor-{beta}-Signaling System
Mol. Biol. Cell, October 1, 2003; 14(10): 3977 - 3988.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Jono, H. Xu, H. Kai, D. J. Lim, Y. S. Kim, X.-H. Feng, and J.-D. Li
Transforming Growth Factor-{beta}-Smad Signaling Pathway Negatively Regulates Nontypeable Haemophilus influenzae-induced MUC5AC Mucin Transcription via Mitogen-activated Protein Kinase (MAPK) Phosphatase-1-dependent Inhibition of p38 MAPK
J. Biol. Chem., July 18, 2003; 278(30): 27811 - 27819.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. S. W. Lee, C. Chang, D. Liu, and R. Derynck
Sumoylation of Smad4, the Common Smad Mediator of Transforming Growth Factor-{beta} Family Signaling
J. Biol. Chem., July 18, 2003; 278(30): 27853 - 27863.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
J. Gong, S. Ammanamanchi, T. C. Ko, and M. G. Brattain
Transforming Growth Factor {beta}1 Increases the Stability of p21/WAF1/CIP1 Protein and Inhibits CDK2 Kinase Activity in Human Colon Carcinoma FET Cells
Cancer Res., June 15, 2003; 63(12): 3340 - 3346.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. Sharma, N. Fatma, E. Kubo, T. Shinohara, L. T. Chylack Jr., and D. P. Singh
Lens Epithelium-derived Growth Factor Relieves Transforming Growth Factor-{beta}1-induced Transcription Repression of Heat Shock Proteins in Human Lens Epithelial Cells
J. Biol. Chem., May 23, 2003; 278(22): 20037 - 20046.
[Abstract] [Full Text] [PDF]


Home page
CROBMHome page
Y. Chai, Y. Ito, and J. Han
TGF-{beta} SIGNALING AND ITS FUNCTIONAL SIGNIFICANCE IN REGULATING THE FATE OF CRANIAL NEURAL CREST CELLS
Critical Reviews in Oral Biology & Medicine, March 1, 2003; 14(2): 78 - 88.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H. Jono, T. Shuto, H. Xu, H. Kai, D. J. Lim, J. R. Gum Jr., Y. S. Kim, S. Yamaoka, X.-H. Feng, and J.-D. Li
Transforming Growth Factor-beta -Smad Signaling Pathway Cooperates with NF-kappa B to Mediate Nontypeable Haemophilus influenzae-induced MUC2 Mucin Transcription
J. Biol. Chem., November 15, 2002; 277(47): 45547 - 45557.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. P. Schiemann, G. C. Blobe, D. E. Kalume, A. Pandey, and H. F. Lodish
Context-specific Effects of Fibulin-5 (DANCE/EVEC) on Cell Proliferation, Motility, and Invasion. FIBULIN-5 IS INDUCED BY TRANSFORMING GROWTH FACTOR-beta AND AFFECTS PROTEIN KINASE CASCADES
J. Biol. Chem., July 19, 2002; 277(30): 27367 - 27377.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Z. Yan, G.-Y. Kim, X. Deng, and E. Friedman
Transforming Growth Factor beta 1 Induces Proliferation in Colon Carcinoma Cells by Ras-dependent, smad-independent Down-regulation of p21cip1
J. Biol. Chem., March 15, 2002; 277(12): 9870 - 9879.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
D. L. Buchanan, S. Ohsako, C. Tohyama, P. S. Cooke, and T. Iguchi
Dioxin Inhibition of Estrogen-Induced Mouse Uterine Epithelial Mitogenesis Involves Changes in Cyclin and Transforming Growth Factor-{beta} Expression
Toxicol. Sci., March 1, 2002; 66(1): 62 - 68.
[Abstract] [Full Text] [PDF]


Home page
Mol. Endocrinol.Home page
J. A. Visser, R. Olaso, M. Verhoef-Post, P. Kramer, A. P. N. Themmen, and H. A. Ingraham
The Serine/Threonine Transmembrane Receptor ALK2 Mediates Mullerian Inhibiting Substance Signaling
Mol. Endocrinol., June 1, 2001; 15(6): 936 - 945.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C.-F. Huang, Y.-C. Wang, D.-A. Tsao, S.-F. Tung, Y.-S. Lin, and C.-W. Wu
Antagonism between Members of the CNC-bZIP Family and the Immediate-Early Protein IE2 of Human Cytomegalovirus
J. Biol. Chem., April 14, 2000; 275(16): 12313 - 12320.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y.-T. Tsai, Y.-H. Su, S.-S. Fang, T.-N. Huang, Y. Qiu, Y.-S. Jou, H.-m. Shih, H.-J. Kung, and R.-H. Chen
Etk, a Btk Family Tyrosine Kinase, Mediates Cellular Transformation by Linking Src to STAT3 Activation
Mol. Cell. Biol., March 15, 2000; 20(6): 2043 - 2054.
[Abstract] [Full Text]


Home page
ScienceHome page
G. Wu, Y. Chen, B. Ozdamar, C. A. Gyuricza, P. A. Chong, J. L. Wrana, J. Massagué, and Y. Shi
Structural Basis of Smad2 Recognition by the Smad Anchor for Receptor Activation
Science, January 7, 2000; 287(5450): 92 - 97.
[Abstract] [Full Text]


Home page
Cell Growth Differ.Home page
S. Larisch-Bloch, D. Danielpour, N. S. Roche, R. Lotan, A. Y. Hsing, H. Kerner, T. Hajouj, R. J. Lechleider, and A. B. Roberts
Selective Loss of the Transforming Growth Factor-{beta} Apoptotic Signaling Pathway in Mutant NRP-154 Rat Prostatic Epithelial Cells
Cell Growth Differ., January 1, 2000; 11(1): 1 - 10.
[Abstract] [Full Text]


Home page
FASEB J.Home page
E. PIEK, C.-H. HELDIN, and P. TEN DIJKE
Specificity, diversity, and regulation in TGF-{beta} superfamily signaling
FASEB J, December 1, 1999; 13(15): 2105 - 2124.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
K. S. Choi, Y. W. Eom, Y. Kang, M. J. Ha, H. Rhee, J.-W. Yoon, and S.-J. Kim
Cdc2 and Cdk2 Kinase Activated by Transforming Growth Factor-beta 1 Trigger Apoptosis through the Phosphorylation of Retinoblastoma Protein in FaO Hepatoma Cells
J. Biol. Chem., November 5, 1999; 274(45): 31775 - 31783.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
H.-J. Zhu and A. M. Sizeland
Extracellular Domain of the Transforming Growth Factor-beta Receptor Negatively Regulates Ligand-independent Receptor Activation
J. Biol. Chem., October 8, 1999; 274(41): 29220 - 29227.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R.-H. Chen, M.-C. Chang, Y.-H. Su, Y.-T. Tsai, and M.-L. Kuo
Interleukin-6 Inhibits Transforming Growth Factor-beta -induced Apoptosis through the Phosphatidylinositol 3-Kinase/Akt and Signal Transducers and Activators of Transcription 3 Pathways
J. Biol. Chem., August 13, 1999; 274(33): 23013 - 23019.
[Abstract] [Full Text] [PDF]


Home page
Cancer Res.Home page
C. Go, P. Li, and X.-J. Wang
Blocking Transforming Growth Factor {beta} Signaling in Transgenic Epidermis Accelerates Chemical Carcinogenesis: A Mechanism Associated with Increased Angiogenesis
Cancer Res., June 1, 1999; 59(12): 2861 - 2868.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Wang, L. Sun, E. Zborowska, J. K. V. Willson, J. Gong, J. Verraraghavan, and M. G. Brattain
Control of Type II Transforming Growth Factor-beta Receptor Expression by Integrin Ligation
J. Biol. Chem., April 30, 1999; 274(18): 12840 - 12847.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-F. Tung, J.-Y. Chuang, C.-T. Lin, M.-Y. Lai, C.-W. Wu, and Y.-S. Lin
Inhibition of hTAFII32-binding Implicated in the Transcriptional Repression by Central Regions of Mutant p53 Proteins
J. Biol. Chem., March 19, 1999; 274(12): 7748 - 7755.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Choy and R. Derynck
The Type II Transforming Growth Factor (TGF)-beta Receptor-interacting Protein TRIP-1 Acts as a Modulator of the TGF-beta Response
J. Biol. Chem., November 20, 1998; 273(47): 31455 - 31462.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
I. Griswold-Prenner, C. Kamibayashi, E. M. Maruoka, M. C. Mumby, and R. Derynck
Physical and Functional Interactions between Type I Transforming Growth Factor beta  Receptors and Balpha , a WD-40 Repeat Subunit of Phosphatase 2A
Mol. Cell. Biol., November 1, 1998; 18(11): 6595 - 6604.
[Abstract] [Full Text]


Home page
Genes Dev.Home page
X.-H. Feng, Y. Zhang, R.-Y. Wu, and R. Derynck
The tumor suppressor Smad4/DPC4 and transcriptional adaptor CBP/p300 are coactivators for Smad3 in TGF-beta -induced transcriptional activation
Genes & Dev., July 15, 1998; 12(14): 2153 - 2163.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
G. Wu, R. S. Fan, W. Li, V. Srinivas, and M. G. Brattain
Regulation of Transforming Growth Factor-beta Type II Receptor Expression in Human Breast Cancer MCF-7 Cells by Vitamin D3 and Its Analogues
J. Biol. Chem., March 27, 1998; 273(13): 7749 - 7756.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
X. Li, R. T. C. Su, H.-t. Hsu, and H. Sze
The Molecular Chaperone Calnexin Associates with the Vacuolar H+-ATPase from Oat Seedlings
PLANT CELL, January 1, 1998; 10(1): 119 - 130.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
M. Yoshizumi, H. Wang, C.-M. Hsieh, N. E. S. Sibinga, M. A. Perrella, and M.-E. Lee
Down-regulation of the Cyclin A Promoter by Transforming Growth Factor-beta 1 Is Associated with a Reduction in Phosphorylated Activating Transcription Factor-1 and Cyclic AMP-responsive Element-binding Protein
J. Biol. Chem., August 29, 1997; 272(35): 22259 - 22264.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
U. Persson, S. Souchelnytskyi, P. Franzen, K. Miyazono, P. ten Dijke, and C.-H. Heldin
Transforming Growth Factor (TGF-beta )-specific Signaling by Chimeric TGF-beta Type II Receptor with Intracellular Domain of Activin Type IIB Receptor
J. Biol. Chem., August 22, 1997; 272(34): 21187 - 21194.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Lawler, X.-H. Feng, R.-H. Chen, E. M. Maruoka, C. W. Turck, I. Griswold-Prenner, and R. Derynck
The Type II Transforming Growth Factor-beta Receptor Autophosphorylates Not Only on Serine and Threonine but Also on Tyrosine Residues
J. Biol. Chem., June 6, 1997; 272(23): 14850 - 14859.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
X.-J. Wang, D. A. Greenhalgh, J. R. Bickenbach, A. Jiang, D. S. Bundman, T. Krieg, R. Derynck, and D. R. Roop
Expression of a dominant-negative type II transforming growth factor beta  (TGF-beta ) receptor in the epidermis of transgenic mice blocks TGF-beta -mediated growth inhibition
PNAS, March 18, 1997; 94(6): 2386 - 2391.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. W. Qian, J. K. Burmester, M. L.-S. Tsang, J. A. Weatherbee, A. P. Hinck, D. J. Ohlsen, M. B. Sporn, and A. B. Roberts
Binding Affinity of Transforming Growth Factor-beta for Its Type II Receptor Is Determined by the C-terminal Region of the Molecule
J. Biol. Chem., November 29, 1996; 271(48): 30656 - 30662.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-J. Charng, P. Kinnunen, J. Hawker, T. Brand, and M. D. Schneider
FKBP-12 Recognition Is Dispensable For Signal Generation by Type I Transforming Growth Factor-beta Receptors
J. Biol. Chem., September 20, 1996; 271(38): 22941 - 22944.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. T. Hartsough, R. S. Frey, P. A. Zipfel, A. Buard, S. J. Cook, F. McCormick, and K. M. Mulder
Altered Transforming Growth Factor beta Signaling in Epithelial Cells when Ras Activation Is Blocked
J. Biol. Chem., September 13, 1996; 271(37): 22368 - 22375.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. A. Anders and E. B. Leof
Chimeric Granulocyte/Macrophage Colony-stimulating Factor/Transforming Growth Factor-beta (TGF-beta ) Receptors Define a Model System for Investigating the Role of Homomeric and Heteromeric Receptors in TGF-beta Signaling
J. Biol. Chem., September 6, 1996; 271(36): 21758 - 21766.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang, W. Han, E. Zborowska, J. Liang, X. Wang, J. K.V. Willson, L. Sun, and M. G. Brattain
Reduced Expression of Transforming Growth Factor beta Type I Receptor Contributes to the Malignancy of Human Colon Carcinoma Cells
J. Biol. Chem., July 19, 1996; 271(29): 17366 - 17371.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X.-H. Feng and R. Derynck
Ligand-independent Activation of Transforming Growth Factor (TGF) beta Signaling Pathways by Heteromeric Cytoplasmic Domains of TGF-beta Receptors
J. Biol. Chem., May 31, 1996; 271(22): 13123 - 13129.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
X. Lin, M. Liang, and X.-H. Feng
Smurf2 Is a Ubiquitin E3 Ligase Mediating Proteasome-dependent Degradation of Smad2 in Transforming Growth Factor-beta Signaling
J. Biol. Chem., November 17, 2000; 275(47): 36818 - 36822.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S.-F. Lee, C.-T. Wang, J. Y.-P. Liang, S.-L. Hong, C.-C. Huang, and S. S.-L. Chen
Multimerization Potential of the Cytoplasmic Domain of the Human Immunodeficiency Virus Type 1 Transmembrane Glycoprotein gp41
J. Biol. Chem., May 19, 2000; 275(21): 15809 - 15819.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
C. Rodriguez, L. J.-S. Huang, J. K. Son, A. McKee, Z. Xiao, and H. F. Lodish
Functional Cloning of the Proto-oncogene Brain Factor-1 (BF-1) As a Smad-binding Antagonist of Transforming Growth Factor-beta Signaling
J. Biol. Chem., August 3, 2001; 276(32): 30224 - 30230.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Feng, X.-H.
Right arrow Articles by Derynck, R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Feng, X.-H.
Right arrow Articles by Derynck, R.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement