|
Volume 270,
Number 41,
Issue of October 13, 1995 pp. 24237-24245
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Transforming
Growth Factor- (TGF- )-induced Down-regulation of Cyclin A
Expression Requires a Functional TGF- Receptor Complex
CHARACTERIZATION OF CHIMERIC AND TRUNCATED TYPE I AND TYPE II
RECEPTORS (*)
(Received for publication, March 30, 1995; and in revised form, July
13, 1995)
Xin-Hua
Feng
,
Ellen
H.
Filvaroff
,
Rik
Derynck (§)
From the Departments of Growth and Development and Anatomy,
Programs in Cell Biology and Developmental Biology, University of
California, San Francisco, California 94143
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Transforming growth factor- (TGF- ) inhibits the
proliferation of epithelial cells by altering the expression or
function of various components of the cell cycle machinery. Expression
of one of these components, cyclin A, is inhibited by TGF-
treatment. We have identified a 760-base pair fragment of the human
cyclin A gene promoter that is sufficient to confer TGF-
responsiveness. Using this promoter fragment, we have developed a
cyclin A-based luciferase reporter assay that quantitates the growth
inhibitory effect of TGF- in transient transfection assays. This
assay was used to determine which domains of the type I (RI) and type
II (RII) receptors were required for the antiproliferative effect of
TGF- . In parallel, the functionality of chimeric receptors,
between RI and RII (RI-RII or RII-RI), was tested for TGF- effect
on gene expression using a reporter assay based on the plasminogen
activator inhibitor type 1 (PAI-1) promoter. We found that
TGF- -induced inhibition of cyclin A expression was absent in RI or
RII-deficient Mv1Lu cells and that this response was restored by
expression of wild-type type I or type II receptors in these cells.
Furthermore, expression of a single chimeric receptor, either RI-RII or
RII-RI, did not confer cyclin A regulation by TGF- . However,
expression of two reciprocal chimeras (RI-RII and RII-RI) resulted in
growth inhibition, similarly to wild-type receptors. In addition,
chimeric receptors as well as mutant receptors with a deleted
cytoplasmic domain and kinase-negative receptors inhibited TGF-
responsiveness in the cyclin A reporter assay in a dominant negative
fashion. Finally, in both receptor types, the juxtamembrane domain
preceding the kinase domain was essential for receptor function but the
cytoplasmic tail was dispensable. Our results suggest that a functional
TGF- receptor complex is required for TGF- -dependent
down-regulation of cyclin A gene expression and illustrate the
identical receptor requirements for TGF- -induced growth inhibition
and gene expression.
INTRODUCTION
Transforming growth factor- (TGF- ) ( )is a
secreted protein that induces a range of cell responses which affect
growth and differentiation (for recent reviews see (1) and (2) ). TGF- treatment of epithelial cells results in cell
cycle arrest in late G coincident with an inhibition of
synthesis and/or activity of some cyclins and cyclin-dependent kinases (3, 4, 5, 6) . In mink lung
epithelial cells, TGF- decreases the activities of two G cyclin-dependent kinases, cdk2 and
cdk4(4, 6, 7) . TGF- down-regulates the
synthesis of cdk4 and constitutive expression of cdk4 results in
resistance to TGF- -induced growth arrest, suggesting that cdk4 is
a major downstream target in TGF- -induced growth
inhibition(4) . The inhibition of cdk2 activity by TGF-
may involve the cdk inhibitor p27, which prevents complex formation of
cyclin E/cdk2 as well as cyclin D/cdk
4(8, 9, 10) . Another cdk inhibitor p15, that
is TGF- -inducible, interferes with the cyclin D/cdk 4 complex in
keratinocytes(11) . While down-regulation of cdk4 and
activation of the cdk inhibitors correlates with TGF- -induced cell
cycle arrest, other components of the cell cycle machinery are also
inhibited by TGF- . Indeed, late G arrest by TGF-
is associated with decreased synthesis of cdc2 (12) and cyclin
A(13, 14, 15, 16, 17) .
Cyclin A plays a critical role in cell cycle progression by complexing
with and regulating the activities of cdc2 and cdk2. Cyclin A/cdc2 and
cyclin A/cdk2 complexes also interact with other proteins involved in
the regulation of the G to S transition, including pRB, the
pRB-like proteins p107 and p130, and the transcription factor
E2F(18, 19, 20, 21, 22) .
Inhibition of pRB hyperphosphorylation by cyclin A/cdk2 may be involved
in control of G progression by TGF- (23) . In addition to its antiproliferative effect, TGF- induces the
expression of many genes, including those for extracellular matrix
proteins. In fact, the induction of plasminogen activator inhibitor
type 1 (PAI-1) expression is often used as a biochemical marker for
TGF- responsiveness. Induction of PAI-1 expression can be easily
measured using a reporter plasmid in which luciferase expression is
driven from the PAI-1 promoter in a TGF- -dependent
manner(24, 25) . This assay is often used in
combination with transient transfection experiments to measure cellular
responsiveness to TGF- and the corresponding receptor
requirements. In contrast, no similarly convenient reporter assay has
been developed to measure the growth inhibitory response of TGF- ,
even though considerable evidence suggests that TGF- 's
effects on growth inhibition and gene expression result from divergent
signaling cascades (for review, see (26) ). The early
signaling events that lead to growth inhibition or extracellular matrix
production by TGF- are largely unknown. TGF- interacts with a
set of cell surface receptors (for review, see Refs. 26, 27), including
the type I and type II receptors which are essential for signal
transduction. Both receptor types belong to an expanding family of
transmembrane serine/threonine
kinases(26, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38) .
Several structural features distinguish type I from type II receptors.
The extracellular domain of the type I receptor is shorter than that of
the type II receptor. The type I receptor also has a highly conserved
GS motif (SGSGSGLP) in the juxtamembrane region preceding the kinase
domain, which is absent in the type II receptor (for review, see (26) ). The type II receptor can bind TGF- by itself, but
the type I receptors bind TGF- only when coexpressed with the type
II receptor, presumably as a result of a physical interaction of these
receptors. To date, only one type II receptor for TGF- has been
identified(32) , while several type I receptors, i.e. R4/ALK5(34) , Tsk7L (33) , TSR1(31) , have
been shown to bind TGF- when coexpressed with the type II
TGF- receptor. Despite the structural similarity, certain
functional differences among the different type I receptors have been
found. For instance, only R4/ALK-5 transduces TGF- signals in
Mv1Lu epithelial cells(34, 39) , while Tsk7L mediates
TGF- signaling in another epithelial cell line(40) . The type II receptors(41, 42) , and presumably also
the type I receptors, constitutively homodimerize independent of ligand
binding. In addition, these two receptor types interact with each other (25, 43, 44) and form a heteromeric (most
likely tetrameric) complex which is stabilized by ligand
binding(45) . The cytoplasmic domain of the type II receptor is
constitutively phosphorylated, independent of ligand binding, due to
both autophosphorylation and the activity of cytoplasmic
kinases(46, 47) . In the heteromeric complex, the type
II receptor kinase phosphorylates the type I receptor (46, 47) and the two types of cytoplasmic domains
associate with each other(48) , further stabilizing the
heteromeric interaction. This heteromeric complex is likely to be the
signaling receptor unit which mediates the biological responses of
TGF- . Epithelial Mv1Lu cells lacking either type I or type II
receptor are completely unresponsive to TGF- to induce growth
inhibition and gene expression(49, 50) . But the
TGF- responsiveness can be restored to these mutant cell lines by
transfection with the missing receptor type (25, 39) .
These findings support the notion that the two receptors are needed for
both types of responses to TGF- . However, separate signaling
pathways for the two types of responses have been observed in several
studies(51, 52, 53) . For example, cells in
which the type II receptor has been functionally inhibited by a
truncated type II receptor are resistant to the antiproliferative
effect of TGF- , yet still induce the expression of PAI-1 and other
gene products(51) . Furthermore, a variety of cell lines, some
of which contain defective type II receptors (e.g.(53) ), are resistant to TGF- -induced
antiproliferation, but remain able to induce various genes including
PAI-1 in response to TGF- (see ``Discussion''). To
gain insight into the role of the type I and II receptors in
TGF- -mediated growth inhibition, we have developed a convenient
assay to score the antiproliferative effect of TGF- using an
expression plasmid in which a TGF- -responsive cyclin A promoter
segment drives a luciferase reporter gene. We used this reporter system
in transient transfection experiments to examine the function of the
TGF- receptors in the growth inhibitory response of Mv1Lu cells.
Using chimeric and mutant receptors, we have dissected the role of the
two receptors in the growth inhibitory response of TGF- and
compared the cyclin A reporter assay with the PAI-1 reporter assay with
respect to TGF- responsiveness.
MATERIALS AND METHODS
Construction of the Cyclin A-Luciferase Reporter
PlasmidPlasmid pCAL2 was made by fusing a PCR-amplified cyclin
A promoter (-516 to +245; for sequence see (54) ) to
the luciferase coding sequence in the SstI-HindIII
site of plasmid pGL (Promega). The sequences of primers used to amplify
the cyclin A promoter from genomic DNA are:
GACCGGTGAGCTCCGTGTTAAATAATTTA (sense) and AAGAAGCTTCACTGCTCACGGGAGTG
(antisense). We also constructed plasmid pRK Gal, which expresses
-galactosidase under the control of the cytomegalovirus promoter
and can be included in all transfections as an internal standard to
monitor transfection efficiency.
Construction of Mutant and Chimeric TGF-
ReceptorsThe cDNAs encoding the type II receptor (RII) (55) and type I receptor Tsk7L (designated
RI ) (33) were of mouse origin, whereas
the type I receptor R4 (designated RI ) cDNA was a rat
cDNA(35) . Specific domains of RI ,
RI , and RII were amplified using PCR methodology.
In PCR primers listed below, restriction sites were incorporated to
allow subcloning and fusion of different receptor domains. The
underlined sequences indicate incorporated restriction sites and those
in bold type are start or stop codons.To amplify the RII
extracellular/transmembrane (ET) domain: R2E5`, GATAGAATTCACC ATG GGT CGA GGA CTG CT; R2E3`, TCATGGATCC GAC ACG GTA GCA GTA GAA. To amplify the RII cytoplasmic (C) domain: R2C5`, CTTAGGATCCATG CAC CGA CAG CAG AAG CTG AG; R2C3`, GATGAGGTCGACCTT GGT AGT GTT CAG
AGA GC; R2K5`, TATTGGATCCATG CCC ATC GAG CTG GAC AC (for
juxtamembrane deletion); R2K3`, ACTTGAGTCGAC GTC CAT ATG CTC CAG CTC AC
(for tail deletion). To amplify the RI ET domain:
R4E5`, TAATCGATGAATTC ATG GAG GCA GCA TCG GC; R4E3`,
AAAGATCTGGATCC GTT GTG GCA GAT ATA GAC. To amplify the RI C domain: R4C5`, GATGAATTCATG CGC ACT GTC ATT CAC CAC CG;
R4C3`, CAAACTCGAGGTCGAC CAT TTT GAT GCC TTC CTG; R4K5`, GCA GGATCC ATG GTG CTA CAA GAA AGC ATC (for juxtamembrane deletion); R4K3`,
GAG GTCGAC CAA TGT CTT CTT AAT TCG CAA (for tail deletion). To
amplify the RI ET domain: R7E5`, AGCC
GAATTCACATG GTC GAT GGA GTA AT; R7E3`, GTCTGGATCC CTT CCT GAG
AGC AAC TCC. To amplify the RI C
domain: R7C5`, CCACGGATCCATG TTT AAG AGA CGC AAT CAA GA; R7C3`,
GGCAGTCGAC ACA GTC AGT CTT CAA TTT GTC. Amplified receptor cDNA
sequences were cloned into the cytomegalovirus promoter-driven
mammalian expression vectors pRK5F or pRK5M. These expression vectors
are derived from pRK5 (56) but contain the sequences for a myc (57) or FLAG epitope tag (58) between the SalI
and HindIII sites, respectively (data not shown). Three
truncated receptors lacking the entire extracellular/transmembrane
domain (ET) were generated. For example, RII(ET) contains residues
1-191 corresponding to the ET domain of RII, while
RI (ET) and RI (ET) include the first
148 residues of RI or RI . Sequences
containing ET domains were cloned between the EcoRI and BamHI sites, in frame with the downstream epitope tag, either
myc for RI (ET) and RI (ET) or FLAG
tag for RII(ET). In the hybrid receptors, the cytoplasmic (C) domain
of one receptor, as a BamHI-SalI fragment (in case of
RI , the BglII site substituted for a BamHI site), was placed between the ET domain of a different
receptor and the epitope tag. Considering the large number of plasmids,
a detailed description of how they were made is not provided in this
report; however, further details of the cloning strategies can be
obtained upon request. A total of four chimeric receptors between RI
and RII were created from the fusion of ET domain of one type to C
domain of another. At the junction of these chimeric receptors, three
extra amino acid residues (Gly Ser Met) were created corresponding to
the restriction sites (BamHI/BglII and the introduced
start codon ATG preceding cytoplasmic domain). The nomenclature of the
chimeric receptors reflects the origin of the two fused domains. For
example, RI (ET)-RII(C) contains ET domain of RI and C domain of RII receptor. All receptor clones were sequenced
to ensure that there were no PCR-induced mutations.
Cell CultureCOS-1 cells (CRL 1650, American Type
Culture Collection) were maintained in the Dulbecco's modified
Eagle's medium containing 10% fetal bovine serum (FBS) at 37
°C in a 5% CO incubator and the medium was changed
every 3 days. Mink lung epithelial cells (Mv1Lu; CCL-64, American Type
Culture Collection) and the derivative mutant lines DR26 and R1B,
provided by Drs. J. Massagué and H. Lodish, were
maintained in minimal essential Eagle's medium with Earle's
balanced salt solution supplemented with non-essential amino acids and
10% FBS at 37 °C in a 5% CO incubator.
Transfection of COS-1 Cells, Immunoprecipitations, and in
Vitro Kinase ReactionsCOS-1 cells were transfected using
LipofectAMINE (Life Technologies, Inc.) according to the
manufacturer's instruction. Forty-eight h after transfection,
cells were starved for 1 h in methionine- and cysteine-free
Dulbecco's modified Eagle's medium and then metabolically
labeled overnight in the same medium containing 0.5 mCi Pro-mix
(Amersham Corp.). Labeled cells were lysed in MLB lysis buffer (20
mM Tris-HCl, pH 8, 137 mM NaCl, 1% Nonidet P-40) for
anti-myc antibody 9E10 (gift of J. M. Bishop), or FLB lysis buffer (25
mM Tris-HCl, 300 mM NaCl, 1% Triton X-100) for
anti-FLAG antibody M2 (Kodak). Lysates were precleared in a mixture of
rabbit anti-mouse IgG (Jackson Laboratories) and protein A-Sepharose
CL4B (Pharmacia), and immunoprecipitated using monoclonal antibodies
9E10 (anti-myc) or M2 (anti-FLAG). Immunoprecipitated proteins were
subjected to electrophoresis on SDS-PAGE and visualized by
autoradiography.For in vitro kinase assays,
immunoprecipitated receptors with specific deletions in the cytoplasmic
domains of RI and RII were split into two halves. While
half was directly subjected to SDS-PAGE, the other half was used in a
kinase autophosphorylation assay. The kinase assay was carried out at
room temperature for 30 min in 1 kinase buffer (10 mM HEPES-KOH, pH 7.5, 5 mM MgCl , and 5 mM CaCl ) containing 5 µCi of
[ - P]ATP (5000 µCi/mmol, Amersham) and
then stopped by adding equal volume of 2 SDS sample buffer (80
mM Tris, pH 6.8, 3.2% SDS, 16% glycerol, 200 mM dithiothreitol, 0.02% bromphenol blue).
I-TGF- Cross-linking of Receptor
ProteinsCOS-1 cells were transfected, with expression plasmids
containing cDNAs of a single receptor or a combination of two
receptors, as described above for immunoprecipitation. Forty-eight h
after transfection, COS-1 cells were cross-linked with I-labeled TGF- 1 (Amersham) as
described(59) .
Functional AssaysReporter assays were performed
following transient co-expression of receptor and reporter expression
plasmids in Mv1Lu cells, either the wild-type or the mutant lines.
Reporter plasmid pCAL2 was used to monitor TGF- -dependent cyclin A
down-regulation and the plasmid p800Luc to assay TGF- -induced
PAI-1 induction. The latter plasmid, obtained from Dr. D. Loskutoff,
contains a luciferase expression unit under the control of PAI-1
promoter(24) . Cells ( 3 10 ) were
harvested and electroporated at 960 microfarads and 750 V/cm in a
Bio-Rad electroporation apparatus, typically using 10 µg of pCAL2
or p800luc, 10 µg of pRK GAL, 10 µg of receptor expression
plasmid(s), and 10 µg of carrier DNA (pBluescript II SK+).
Usually, 10 µg of receptor expression plasmid mix contained 5
µg of each receptor construct in co-transfections of two expression
plasmids or, when only a single receptor expression plasmid was
transfected, 5 µg of the mix was pRK5. After electroporation, cells
were recovered for 4 h in MEM Eagle's with Earle's balance
salt solution supplemented with non-essential amino acids and 10% FBS.
The cells were then treated with or without 10 ng/ml TGF- 1 in the
same medium but containing 0.2% FBS. After 24 h (for PAI-1 assay) or 48
h (for cyclin A assay), the cells were harvested and lysed in reporter
lysis buffer (Promega), and cell lysates were assayed for luciferase
and -galactosidase activities. The luciferase assay was carried
out using Analytic Luminescence Laboratory's assay reagents and
luminometer monolight 2010. -Galactosidase was assayed in an assay
buffer (Promega), and the activity was measured at 420 nm in a
spectrophotometer. The luciferase activity which reflects the promoter
activity of cyclin A or PAI-1 was normalized to -galactosidase to
account for transfection efficiency.R1B-L17 cells, a highly
transfectable line of R1B cells were provided by Dr. J.
Massagué. Transfection of L17 cells was carried
out using the DEAE-dextran method as described (46) at 40%
confluence in 6-well plates. For each transfection, 1 µg of
receptor expression plasmid or vector control and 3 µg of reporter
constructs (1.5 µg of pRK GAL + 1.5 µg of luciferase
expression plasmid) were used.
RESULTS
Down-regulation of Cyclin A Expression by TGF- in
Mv1Lu CellsTranscription of the PAI-1 gene has frequently been
used as a marker for TGF- responsiveness. A reporter system in
which the TGF- -inducible PAI-1 promoter drives luciferase
expression has allowed the rapid evaluation of TGF- receptor
function in transient transfection assays(25) . However,
TGF- is often primarily studied for its growth inhibitory effect,
and considerable evidence suggests that the effects on growth
inhibition and gene expression result from different signaling
cascades. Unfortunately, no reporter assay has been available to
monitor the antiproliferative effect of TGF- . Since TGF-
arrests epithelial cell proliferation in late G phase,
thereby preventing the induction of cyclin A gene expression (17) , we developed a cyclin A promoter-based reporter system
to monitor the TGF- -induced growth inhibition response in
transient transfection assays.As a first step in developing this
assay, we identified the 5` promoter fragment of the cyclin A gene that
mediates down-regulation of cyclin A gene expression in response to
TGF- . The upstream region of the human cyclin A gene corresponding
to nucleotides -516 to +245 contains many potential
regulatory elements (54) and was isolated by PCR-based
amplification from human genomic DNA. We linked this promoter fragment
to the luciferase coding sequence to generate plasmid pCAL2. The
luciferase expression driven by this 760-bp fragment of the cyclin A
promoter was compared with the luciferase activity from the
7.5-kilobase pair promoter region (nucleotides -7300 to
+245) in plasmid CD1(54) . The cyclin A reporter plasmid
and a -galactosidase expression plasmid pRK Gal were
transiently transfected into TGF- -responsive Mv1Lu cells, and the
luciferase activity was measured 48 h after transfection. Inclusion of
pRK Gal allowed calibration of the luciferase activity against the
-galactosidase activity, providing normalization of transfection
efficiency. Both cyclin A plasmids pCAL2 and pCD1 were found to express
luciferase, and the luciferase activity was even somewhat higher when
using plasmid pCAL2 (see 0 h point in Fig. 1A), indicating that this 760-bp cyclin A promoter
fragment is functional in Mv1Lu cells.
Figure 1:
A, cyclin A-luciferase
reporter assay. Cyclin A-luciferase plasmid pCAL2 or pCD1, together
with a -galactosidase expression plasmid pRK Gal, were
transfected into Mv1Lu cells. Four h after transfection, TGF- was
added at 400 pM to the media for the defined times. Luciferase
and -galactosidase activity were determined as described under
``Materials and Methods.'' Data are from two experiments with
each point determined in triplicates. The vertical bars show
the standard deviations. pCAL2 and pCD1 contain the human cyclin A
promoter sequence from nucleotide -516 to +245 and from
-7300 to +245, respectively. B, regulation of
cyclin A-luciferase activity by TGF- in wild-type and mutant Mv1Lu
cells. Untransfected cells or DR26 cells transfected with RII or R1B
cells transfected with RI were treated (+)
or untreated(-) with TGF- . Transfections, TGF-
treatment (48 h), and reporter assays were carried out as in panel
A. RII, type II TGF- receptor; RI , type I TGF- receptor; Mv1Lu, wild-type Mv1Lu cells; DR26, RII-deficient
cells; R1B, RI -deficient
cells.
To evaluate the TGF-
responsiveness of the cyclin A promoter, both luciferase plasmids were
transfected into Mv1Lu cells, and the normalized luciferase activity
was calculated at defined time points after initiation of TGF-
treatment. In Mv1Lu cells transfected with pCAL2, the luciferase
activity was down-regulated by TGF- (Fig. 1A) in a
manner similar to that in pCD1-transfected cells. This decreased
expression from the cyclin A promoter parallels the inhibition of
cyclin A expression by TGF- in Mv1Lu (15, 16, 17) and other epithelial cell
lines(13) . The TGF- -induced inhibition of luciferase
expression was most evident when TGF- treatment was initiated
within 6 h after release from contact inhibition (data not shown), and
the cyclin A promoter response was maximal when the cells were exposed
to TGF- for 48 h (Fig. 1A). These results indicate
that the 760-bp cyclin A promoter fragment in pCAL2 contains the
TGF- -responsive element(s) and that this cyclin A-luciferase assay
can be used as transcriptional reporter system to measure the
antiproliferative effect of TGF- in transient transfection assays.
Down-regulation of Cyclin A Expression by TGF-
Requires Both Type I and Type II TGF- ReceptorsAs shown in Fig. 1A, cyclin A transcriptional down-regulation by
TGF- was apparent in wild-type Mv1Lu cells, which possess
functional type I (RI) and type II (RII) receptors. To further
characterize the requirement of receptors in TGF- -dependent cyclin
A expression, we investigated whether the luciferase activity driven
from the cyclin A promoter in pCAL2 is down-regulated by TGF-
treatment in Mv1Lu mutant cell lines lacking functional
receptors(49, 50) . In both the RII-deficient DR26
cells and RI -deficient R1B cells, the cyclin A
promoter-driven luciferase expression was unchanged upon TGF-
treatment (Fig. 1B). In contrast, reintroduction of RII
in DR26 cells or RI , but not RI , in R1B cells
restored the response to TGF- in the cyclin A-luciferase assay (Fig. 1B). These results suggest that the
TGF- -induced growth inhibition requires both RI and
RII receptors.
The Cytoplasmic Domains of Both Receptors Are Required
for TGF- Responsiveness in the Cyclin A-Luciferase AssayTo
further examine the role of specific domains of TGF- receptors in
TGF- -dependent down-regulation of cyclin A expression, we
generated chimeras between the extracellular/transmembrane (ET) and
cytoplasmic (C) domains of RII and RI or RI as well as mutant receptors with cytoplasmic truncations of
RI , RI and RII, as shown in Fig. 2.
These mutant receptors were engineered to incoporate a C-terminal myc-
or FLAG-epitope tag which allows immunoprecipitation with tag-specific
antisera. We first examined whether these chimeric and truncated
receptors were efficiently expressed in COS-1 or 293 cells. Following
metabolic S-labeling of the cells, the receptors were
immunoprecipitated and analyzed by SDS-PAGE followed by
autoradiography. All truncated and chimeric receptors were expressed at
significant levels and had the expected molecular weights, although
degradation products were often apparent (Fig. 3A).
According to the mobility on SDS-PAGE gels, RII had the expected size
of 80 kDa, and the R4 and Tsk7L type I receptors, expressed by
plasmids RI and RI , respectively, had the
expected size of 70 kDa. Transfection of the plasmids for the
truncated receptors lacking the C domain generated a polypeptide of
35 kDa for RII(ET) and 30 kDa for both RI (ET)
and RI (ET). The hybrids between RI (either RI or RI ) and RII comigrated with a size of 80 kDa
for the RII(ET)-RI (C) chimeras and 75 kDa for
RI(ET)-RII(C) chimeras.
Figure 2:
Schematic presentation of mutant TGF-
receptors. The construction and nomenclature of the receptor mutants is
described under ``Materials and Methods'' and
``Results.'' RI , type I
TGF- receptor R4; RI , type I
receptor Tsk 7L; RII, type II TGF- receptor. ET,
extracellular/transmembrane domain; C, cytoplasmic domain;
JM, juxtamembrane domain deletion; T,
cytoplasmic tail deletion; JMT, deletion of juxtamembrane
domain and cytoplasmic tail.
Figure 3:
A, expression of mutant receptors in COS-1
cells. COS-1 cells were transfected with pRK5 (lane 1) or
receptor expression plasmids (lanes 2-11). The receptors
were immunoprecipitated from S-labeled cell lysates using
antibodies specific for the FLAG (F) or myc (M)
epitope as indicated. The immunoprecipitated proteins were analyzed by
SDS-PAGE and autoradiography. The positions of the receptors and
molecular weight markers are shown on the side. Lane 2, RII; lane 3, RI ; lane 4,
RI ; lane 5,
RII(ET)-RI (C); lane 6,
RII(ET)-RI (C); lane 7,
RI (ET)-RII(C); lane 8,
RI (ET)-RII(C); lane 9, RII(ET); lane
10, RI (ET); lane 11,
RI (ET). B, ligand binding of mutant
receptors expressed in COS-1 cells. Binding of I-TGF- to COS-1 cells transfected with plasmids
expressing wild-type or mutant receptors was examined. Cross-linked
complexes were subjected to SDS-PAGE and autoradiography. Each lane
represents an equal amount of protein lysate as determined by BCA assay
(Bio-Rad). Migration of the receptors are indicated using the same
abreviations for receptors as in Fig. 3A. Lane
1, pRK5; lane 2, RII; lane 3,
RI ; lane 4, RI and
RII; lane 5, RI ; lane 6,
RI and RII; lane 7,
RII(ET)-RI (C); lane 8,
RII(ET)-RI (C); lane 9,
RI (ET)-RII(C); lane 10,
RI (ET)-RII(C) and RII; lane 11,
RI (ET)-RII(C); lane 12,
RI (ET)-RII(C) and RII; lane 13, RII(ET); lane 14, RI (ET); lane 15,
RI (ET) and RII; lane 16,
RI (ET); lane 17,
RI (ET) and RII.
The ability of the mutant receptors to bind
TGF- at the cell surface was determined by binding and
cross-linking of I-TGF- . As shown in Fig. 3B, both RII and RII(ET)-RI(C) chimeras with their
type II extracellular domain bound I-TGF- (lanes
2, 7, and 8). In contrast, RI and RI(ET)-RII(C)
chimeras which have RI extracellular domains did not bind TGF-
when expressed alone (lanes 3, 5, 9, and 11). However, these receptors bound ligand when cotransfected
with RII (lanes 4, 6, 10, and 12).
Similarly, RI (ET) and RI (ET) bound ligand
only in the presence of RII (compare lanes 14 and 16 to 15 and 17), whereas RII(ET) bound TGF-
by itself (lane 13). Taken together, these results indicate
that the mutant receptors were readily expressed at the cell surface
and displayed normal ligand binding. The ability of the mutant
TGF- receptor to signal was then examined in the cyclin
A-luciferase assay using receptor-deficient Mv1Lu mutant cells.
Although wild-type RII restored TGF- -dependent down-regulation of
cyclin A transcription in RII-deficient DR26 cells, none of the
chimeric receptors (RI -RII, RI -RII,
RII-RI or RII-RI ), when expressed alone,
induced transcriptional regulation of cyclin A-luciferase in response
to TGF- (Fig. 4, left panel). Similarly, the
chimeric receptors did not restore TGF- responsiveness in the
RI-deficient R1B cells which contain endogenous RII, even though
RI was able to restore the TGF- -induced inhibition of
cyclin A-luciferase activity to the cells (Fig. 4, right
panel). While a single chimeric receptor was unable to confer
TGF- responsiveness in the mutant cell lines, coexpression of the
two chimeric receptors RII(ET)-RI (C) and
RI (ET)-RII(C) resulted in TGF- -dependent inhibition
of luciferase expression in these cells (Fig. 4). Similarly,
coexpression of both chimeric receptors led to TGF- -dependent
increases of transcription from the PAI-1 promoter in a
PAI-1-luciferase assay (data not shown; Table 1). While the
coexpression of both chimeras in mutant cells restored the
TGF- -dependent responses, significant levels of cyclin A
inhibition and PAI-1 up-regulation were already observed in the absence
of TGF- in these cells. This constitutive signaling in the absence
of TGF- resulted in the lower relative level of inhibition of
cyclin A expression in the presence of TGF- , when compared with
that in the absence of TGF- (Fig. 4). In fact,
TGF- -independent signaling was also apparent when the two types of
cytoplasmic domains (RII and RI ) were expressed regardless
of what extracellular domains they were fused to (data not shown).
These results suggest that the high level expression of both
cytoplasmic domains is responsible for ligand-independent signaling and
that the two receptor types have an intrinsic heteromeric affinity for
each other which is consistent with previous findings(48) . In
contrast to the chimeric receptors derived from RI ,
cotransfection of RII(ET)-RI (C) with
RI (ET)-RII(C) did not lead to TGF- responsiveness in
the cyclin A-luciferase assay, consistent with the inactivity of the
Tsk7L type I receptor in Mv1Lu cells(31, 39) .
Figure 4:
Signaling activity of chimeric receptors
in mutant Mv1Lu cells using TGF- -dependent cyclin A-luciferase
reporter assay. Receptor expression plasmids were transfected in DR26
or R1B cells together with the cyclin A-luciferase plasmid pCAL2.
Cyclin A-luciferase data are shown as the percentage decrease in
luciferase activity relative to cells that did not receive TGF- .
In the cases when the cyclin A activity was higher after TGF-
treatment, a negative value for the percentage inhibition was observed.
The vertical bars show the standard deviations. Receptors are
abbreviated as in Fig. 2except that hRII represents wild-type
human RII.
Dominant Negative Effect of Chimeric and Truncated
Receptors on TGF- -dependent Down-regulation of Cyclin A
ExpressionWe further characterized the role of RI and RII in
TGF- -induced down-regulation of cyclin A expression by examining
the function of the chimeras in wild-type Mv1Lu cells which contain
endogenous RI and RII. Because of the TGF- responsiveness
associated with endogenous receptors, overexpression of wild-type RI or
RII did not alter cyclin A transcription. In contrast, expression of
chimeric receptors RI (ET)-RII(C),
RII(ET)-RI (C) or RII(ET)-RI (C), but not
RI (ET)-RII(C), abolished TGF- -dependent inhibition of
cyclin A transcription (Fig. 5, left panel), indicating
that chimeras with either RI - or RII-derived ET domains
inhibited the activities of the endogenous receptors in a dominant
negative fashion. Furthermore, in transfections with the
RII(ET)-RI (C) or RII(ET)-RI (C) chimeric
receptors, the cyclin A activity was even higher after TGF-
treatment (resulting in the negative value for the percentage
inhibition, Fig. 5). Dominant negative inhibition was also
observed with the kinase-deficient point mutants RIIKR and
RI KR, in which the Lys in the ATP-binding sites of RII and
RI was replaced by Arg (Fig. 5, middle
panel). The dominant negative effect of these mutant receptors in
wild type Mv1Lu cells was also apparent in the PAI-1-luciferase assay
(data not shown; Table 1).
Figure 5:
Dominant negative inhibition of
TGF- -dependent cyclin A down-regulation by mutant receptors in
wild-type Mv1Lu cells. Plasmids used for transfection of Mv1Lu cells
are as in Fig. 2except that plasmids RI KR
and RIIKR represent the kinase-negative mutants of RI and RII, respectively. Data are presented as in Fig. 4.
Using the TGF- -responsive
wild-type Mv1Lu cells and the cyclin A-luciferase assay, we also
evaluated the effect of expression of truncated receptors lacking the
cytoplasmic domain (Fig. 5, right panel). Consistent
with the results using a truncated human type II
receptor(51, 60) , expression of the mouse RII lacking
its cytoplasmic domain, RII(ET), also blocked TGF- -dependent
inhibition of cyclin A transcription in a dominant negative manner.
Overexpression of the truncated RI (ET) type I receptor
lacking its cytoplasmic domain, but not RI (ET), in Mv1Lu
cells also abolished TGF- responsiveness (Fig. 5, right
panel). This effect was also seen in the PAI-1 assay (Table 1). However, the inhibitory effect of RI (ET)
was less effective than RII(ET) in the PAI-1 assay (Table 1, data
not shown).
Juxtamembrane Domains of Type I and Type II TGF-
Receptors Are Required for TGF- ResponsivenessFinally, we
evaluated the signaling ability of RII and RI receptor
mutants in which the juxtamembrane segment (between the transmembrane
and the kinase domain) or the C-terminal tail following the kinase
domain, or both, were deleted. We also included kinase-deficient point
mutants of RII and RI , i.e. RIIKR and
RI KR, for comparison. Expression plasmids for the RII
mutants were transfected into DR26 cells and plasmids for the RI mutants into R1B cells. These receptors were then tested for
their ability to restore TGF- responsiveness using both cyclin A-
and PAI-1-luciferase assays (Fig. 6; Table 1). Both
RI and RII with the deletion of the cytoplasmic tail
(amino acids 491-501 in RI T and 546-567
in RII T) conferred TGF- responsiveness to the corresponding
mutant cell lines. In contrast, deletion of the juxtamembrane domains
inactivated the signaling activity of both receptor types in the two
assays, as shown by transfecting the mutant receptors
RI JM in R1B cells or RII JM in DR26 cells.
Accordingly, deletion of both the juxtamembrane and the cytoplasmic
tail in both receptors also inactivated both receptor types. As
expected, RI KR and RIIKR were also biologically inactive (Fig. 6, Table 1).
Figure 6:
Biological effects of deletion of the
cytoplasmic segments of TGF- receptors on TGF- -dependent
down-regulation of cyclin A-luciferase expression. Cytoplasmic deletion
mutants of both RI and RII were as shown in Fig. 2and in legend to Fig. 5. Data are presented as in Fig. 4.
When expression plasmids for these
mutant receptors were transfected into COS-1 cells and the kinase
activity of the immunoprecipitated receptors was tested in
vitro, we observed a correlation between the receptor kinase
activity and their biological functions (Fig. 7). While
RI T and RII T maintained their kinase and
signaling activities similarly to wild-type receptors,
RI JM and RII JM, like the kinase-negative mutants
RI KR and RIIKR, were also kinase inactive and unable to
autophosphorylate. Thus, mutant receptors which were inactive in the
biological assays were also inactive in the kinase assay.
Figure 7:
Expression and in vitro kinase
activity of mutant receptors with cytoplasmic deletions. COS-1 cells
were transfected with the plasmids indicated and the receptors were
immunoprecipitated from S-lysates as described in Fig. 3A. Half of the immunoprecipitated proteins were
analyzed by SDS-PAGE (left panels), whereas the other half was
subjected to in vitro kinase assay using
[gamma] P]ATP prior to gel analysis (right panels). The positions of the receptors and molecular
weight markers are shown.
DISCUSSION
Roles of TGF- Receptors in TGF- -dependent
Down-regulation of Cyclin A TranscriptionDuring the cell cycle,
cyclin A transcription is suppressed in late G phase and
activated during S phase(16, 17) . Thus, cyclin A
expression is considered to be an indicator of the cell growth status.
Inhibition of cyclin A expression is sufficient to cause cell cycle
arrest before G /S transition(61, 62) , and
deregulated cyclin A expression is apparent in many cancers and
transformed cells(14, 62, 63) . Cyclin A
expression is down-regulated by many factors, including TGF- (13, 14, 15, 16, 17) and
contact inhibition(64) , which both arrest cell growth in late
G . The TGF- -dependent down-regulation may play a
critical role in TGF- -induced growth arrest(17) . To
generate a convenient and rapid reporter system that allows a
measurement of growth inhibition by TGF- and other factors, we
created a plasmid in which luciferase expression is driven by a 760-bp
segment of the cyclin A promoter. Treatment of Mv1Lu cells with
TGF- resulted in a rapid inhibition of luciferase expression,
indicating that this short sequence confers TGF- responsiveness.
Several potential regulatory sequence elements, including four Sp1
sites, one cAMP-responsive element (CRE), two Yi sites, two E2F-binding
sites, one AP1 site, and one p53 binding site, are contained within
this short promoter sequence(54) . Although the CRE sequence
(also called activating transcription factor site, or ATF site) is
critical in the down-regulation of cyclin A expression during contact
inhibition (64) , the promoter elements which mediate
TGF- -induced inhibition of cyclin A expression in cultured cells
are not known. However, contact inhibition and TGF- -mediated
growth arrest have several features in common, e.g. p27, an
inhibitor of cdk2 and cdk4, is activated in both contact-inhibited and
TGF- -inhibited cells(9) , implicating a similar
mechanistic basis for down-regulation of cyclin A expression under both
conditions.Based on the TGF- responsiveness of the 760-bp
cyclin A promoter element, we have developed a functional assay to
monitor cyclin A regulation in response to TGF- . This assay can be
used in transient transfection assays to allow a functional evaluation
of TGF- receptors and other signaling proteins involved in the
antiproliferative effect of TGF- . In spite of the many
TGF- -induced responses, transcriptional activation of the PAI-1
gene is frequently used as the only indicator for TGF- signaling
and receptor function, primarily because of the availability of a
highly sensitive and convenient reporter assay that measures luciferase
expression from a TGF- -responsive promoter element(25) .
Before this study, no facile reporter assay has been available to
measure the antiproliferative effect of TGF- , even though
considerable evidence suggests that the growth inhibition and the
induction of gene expression by TGF- result from divergent
signaling cascades. The availability of a cyclin A luciferase reporter
system allowed us to characterize the role of specific domains of
TGF- receptors during TGF- -mediated growth inhibition using
transient transfection assays. Our results demonstrate that
inhibition of cyclin A transcription by TGF- requires both RII and
RI receptors. The cyclin A transcription is inhibited by
TGF- in Mv1Lu cells which contain endogenous RI and
RII receptors but not in the two mutant cell lines lacking either
RI or RII. Introduction of wild-type RI into
RI-deficient cells or RII into RII-deficient cells restores
TGF- -dependent cyclin A transcription. In contrast, various mutant
receptors including the chimeric receptors RII(ET)-RI (C),
RI (ET)-RII(C), RII(ET)-RI (C), and
RI (ET)-RII(C) as well as the kinase-negative point mutants
RI KR and RIIKR, and receptors lacking the juxtamembrane
domain RI JM and RII JM, are unable to rescue the
ability of mutant cells to respond to TGF- . However, coexpression
of RII(ET)-RI (C) and RI (ET)-RII(C), which
allows heteromerization of both extracellular and intracellular
domains(48) , restores TGF- -dependent down-regulation of
cyclin A expression in either mutant cell line. In wild-type Mv1Lu
cells, individual expression of these mutant receptors inhibits
TGF- -induced cyclin A down-regulation in a dominant negative
fashion. These results suggest that cyclin A expression and, thus, the
growth inhibitory effect of TGF- need the cooperative interaction
between type I and type II TGF- receptors.
Functional Analysis of TGF- Receptor Domains Using
Both Cyclin A and PAI-1 AssaysSeveral recent studies have
addressed the functions of the two receptor types (25, 34, 39) and their cytoplasmic domains in
TGF- signaling(46, 66) . Transfection of RII
receptor in DR26 cells or R4/ALK-5 type I receptor (termed RI in this study) in R1B cells restores TGF- responsiveness,
suggesting that both receptor types are required for TGF-
responsiveness(25, 34, 39) . The ability of
the two receptor types to undergo heteromeric interactions and the
phosphorylation of the type I receptor cytoplasmic domain by the type
II receptor kinase further reinforces the assumption that both
cytoplasmic domains are required for TGF- responsiveness (46, 47) . Thus a heteromeric complex is thought to be
the signaling unit for the multiple responses to
TGF- (25, 44) .In our study, we tested in
parallel the TGF- -dependent cyclin A response and PAI-1
transcriptional response and did not observe an uncoupling of these
responses (see Table 1), which is consistent with the proposed
requirement of both cytoplasmic domains for full TGF-
responsiveness. More specifically, homomerization of cytoplasmic
domains, resulting from expression of the RII(ET)-RI (C)
chimera in DR26 cells or the RI (ET)-RII(C) chimera in R1B
cells, is not sufficient for TGF- -induced regulation of cyclin A
and PAI-1 expression, suggesting that a functional interaction of the
two types of cytoplasmic domains is a prerequisite for TGF-
responsiveness. In addition, despite the heteromeric combination of
both cytoplasmic domains, homomeric combination of the
extracellular/transmembrane domains of type I or type II receptors also
fails to restore TGF- responsiveness. In the case of the
RI (ET)-RII(C) chimera in DR26 cells which express
endogenous RI , this lack of signaling might be due to the
inability of the RI extracellular domains to bind ligand
in the absence of RII. However, expression of the
RII(ET)-RI (C) chimera in R1B cells which have endogenous
RII yet lack functional RI also does not activate
TGF- responsiveness even though these receptors bind TGF-
efficiently. This suggests an active function of the RI extracellular domain in TGF- signaling. Coexpression of
the RII(ET)-RI (C) and RI (ET)-RII(C) chimeras
in DR26 or R1B cells results in TGF- responsiveness in both
reporter assays, suggesting that the coexistence of both extracellular
and cytoplasmic domains in trans provides a functional TGF-
receptor unit. TGF- is likely to induce a conformational change in
the heteromeric complex of these chimeras in a manner similar to the
complex of wild-type RI and RII receptors. The resulting
activation promotes the interaction of the receptors with downstream
effectors. Our data are in agreement with the recent findings of
Okadame et al.(66) , who showed the requirement of
both cytoplasmic domains for TGF- -induced PAI-1 transcription. We
extended their findings by using the cyclin A reporter assay and by
examining the effects of chimeric receptors in wild-type Mv1Lu cells. In wild-type Mv1Lu cells, expression of the
RI (ET)-RII(C) or RII(ET)-RI (C) chimera
inhibits TGF- -induced regulation of cyclin A and PAI-1 expression
in a dominant negative manner. This inhibition is likely due to the
fact that overexpression of the RI (ET)-RII(C) or
RII(ET)-RI (C) chimera sequesters endogenous RII and/or
RI away from functional RI -RII receptor
complexes. The resulting homomeric complexes of chimeric receptors and
the heteromeric complexes between endogenous receptors and the chimeras
are then unable to transduce the TGF- signals. This dominant
negative interference resembles the inhibitory effect of truncated
receptors lacking their cytoplasmic domain and the kinase-negative
mutant receptors. The inhibition of TGF- responsiveness by RII(ET)
is in accordance with previous
results(51, 60, 67) . A dominant negative
inhibition, albeit to a lesser extent, was also apparent with
overexpression of RI (ET) in Mv1Lu cells, but not with
RI (ET) even though the truncated form of Tsk7L inhibited
TGF- -induced mesenchymal transdifferentiation in NMuMG
cells(40) . Thus, overexpression of chimeric, truncated, or
kinase-defective receptors derived from RII or RI results
in dominant negative interference with TGF- receptor signaling,
most likely by interfering with the assembly of functional homo- and
heteromeric complexes. After the submission of this manuscript, Vivien et al.(68) and Brand and Schneider (69) reported dominant negative inhibition of TGF-
signaling by chimeric and kinase-defective receptors, using assays for
TGF- -induced gene expression. Their conclusions and our findings
based on cyclin A and PAI-1 assays are in agreement; moreover, our
cyclin A assay results further extend their observations to
TGF- -induced growth inhibition. Finally, we characterized the
function of the RI and RII receptor cytoplasmic domains
containing defined deletions. Deletion of the C-terminal tail of either
receptor did not affect the kinase and signaling activity of RI and RII in both cyclin A and PAI-1 reporter assays. A similar
result has been observed in the case of RII using the PAI-1 reporter
assay(60) . We also demonstrated that deletion of the
juxtamembrane domain inactivates the signaling function of both
receptor types. This correlates with a loss of kinase activity as
measured by autophosphorylation. In the case of the type I receptor,
the juxtamembrane domain contains a conserved SGSGSGLP sequence. This
sequence is a major site of phosphorylation by the type II receptor,
and its deletion has been shown to inactivate TGF-
signaling(46) . Thus, our results indicate the requirement of
the juxtamembrane domains for the function and kinase activity of both
receptors. These domains may also represent binding sites for
cytoplasmic effector proteins.
Coincident Responsiveness in the Cyclin A and PAI-1
Reporter AssaysIn this study we did not observe a divergence of
the pathways leading to growth inhibition and gene expression using the
cyclin A and PAI-1 assays. This supports the conclusion of Wrana et
al.(25) and Bassing et al.(44) who
showed that the activities of both RI and RII are required
for TGF- -induced gene expression and growth inhibition. Solely
based on these studies, we would conclude that cytoplasmic domains of
both RI and RII are required for both types of TGF-
responses. However, uncoupling of the two types of responses has been
observed in several systems. We have previously shown that stable
expression of a truncated RII in Mv1Lu cells abolished the
antiproliferative effect of TGF- but not its induction of gene
expression(51) . Also, a Phe to Ala mutation at position 498 in
RII does not affect the induction of transcription by TGF- , yet
reduces significantly its antiproliferative effect(60) . In
addition, several cell lines lacking detectable levels of RII
expression or with a defective RII display TGF- responsiveness in
gene expression assays but are not growth inhibited by
TGF- (53, 70) . Furthermore, various tumor cell
lines also lack a growth inhibitory response to TGF- yet respond
to TGF- by the induction of gene expression(52) . Finally,
differentiating osteoblasts undergo alterations in RI and RII
expression and ligand binding and concomitantly show phenotypic changes
in their responsiveness to TGF- (71) . Thus, these studies
suggest that both signaling pathways should be considered as distinct
and that in some cases, but not all, uncoupling can occur at the
receptor level and that specific changes in functionality of TGF-
receptors correlate with induction of specific downstream signaling
pathways. How all these observations can be reconciled in a simple
model is unclear. However, the apparent discrepancy between both sets
of observations might be explained by a threshold model. In such a
model, both receptor types are required but the TGF- -induced
growth arrest requires full activity of endogenous RII (and maybe RI
receptor), whereas changes in TGF- -induced gene expression can be
mediated at a much reduced level of receptor activity, i.e. at
a low threshold level. For example, overexpression of a truncated RII
in Mv1Lu cells (51) strongly interferes with endogenous RII,
but the remaining activity might still suffice to confer the
transcriptional response to TGF- but not growth inhibition. This
threshold model could also explain the diminished activity of RII
defective in N-glycosylation (53) and RII mutated at
position 498 (60) in the antiproliferative response but not in
TGF- -induced gene expression. Accordingly, we have observed that
some chimeric and kinase-negative mutants derived from RI and RII completely abolished TGF- -dependent cyclin A
regulation but only reduced TGF- -induced PAI-1 transcription (data
not shown). Thus, changes in expression or activity of receptors could
possibly determine which downstream pathways are activated. Recently, a
threshold model has also been proposed for the response of PC12 cells
to receptor tyrosine kinase activation (for review see (72) ).
In PC12 cells, transient versus sustained ERK activation by
growth factors has very different consequences for nuclear
translocation of ERK, gene expression, and subsequent proliferation or
differentiation(72) . An additional complexity in the current
models for TGF- receptor signaling is imposed by evidence that
ligand binding to RI and RII is differentially regulated. This is
apparent from the altered receptor binding in differentiating
osteoblasts (71) as well as the observation that a mutated,
monomeric TGF- binds much less efficiently to type II than type I
receptor. This mutated TGF- is still 20% as active as native
TGF- 1 in PAI-1 induction, but it is less than 1% potent as native
TGF- 1 in growth inhibition in Mv1Lu cells(73) , which may
be consistent with the threshold model. Further assessment of receptor
expression patterns, characterization of the cytoplasmic domains of the
TGF- receptors, and their interactions as well as the
identification of interacting cytoplasmic proteins should bring insight
into the mechanism of TGF- receptor signaling.
FOOTNOTES
- *
- This work was supported by Grant CA63101
from the National Cancer Institute (to R. D.). The costs of publication
of this article were defrayed in part by the payment of page charges.
This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
Dept. of Growth and Development, University of California at San
Francisco, San Francisco, CA 94143-0640. Tel.: 1-415-476-7322; Fax:
1-415-476-1499.
- (
) - The abbreviations used are:
TGF-
, transforming growth factor- ; PAI-1, plasminogen
activator inhibitor type 1; PCR, polymerase chain reaction; FBS, fetal
bovine serum; PAGE, polyacrylamide gel electrophoresis; bp, base
pair(s).
ACKNOWLEDGEMENTS
We thank Drs. P. Donahoe for the rat R4 cDNA and X.-F.
Wang for the cDNAs encoding kinase-negative mutants of R4 and human
type II receptor, Drs. J. Massagué and H. Lodish
for mutant Mv1Lu cells, Dr. D. J. Loskutoff for the PAI-1-luciferase
reporter plasmid and Dr. C. Bréchot for plasmid
pCD1. We also thank Dr. J. M. Bishop for the anti-myc antibody 9E10 and
Dr. D. Littman for the use of his luminometer for luciferase assays. We
are grateful to Drs. Ruey-Hwa Chen, Irene Griswold-Prenner, Lisa Choy,
and other members of the laboratory for helpful discussion and critical
review of the manuscript.
REFERENCES
- Derynck, R. (1994) in The Cytokine Handbook (Thomson, A. W., ed) pp. 319-342, Academic Press, San Diego
- Kingsley, D. M. (1994) Genes & Dev. 8,133-146
[CrossRef]
- Egan, S. E., and Weinberg, R. A. (1993) Nature 365,781-783
[CrossRef][Medline]
[Order article via Infotrieve]
- Ewen, M. E., Sluss, H. K., Whitehouse, L. L., and Livingston, D. M. (1993) Cell 74,1009-1020
[CrossRef][Medline]
[Order article via Infotrieve]
- Geng, Y., and Weinberg, R. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,10315-10319
[Abstract/Free Full Text]
- Koff, A., Ohtsuki, M., Polyak, K., Roberts, J. M., and Massagué, J. (1993) Science 260,536-539
[Abstract/Free Full Text]
- Slingerland, J., Hengst, L., Pan, C.-H., Alexander, D., Stampfer, M., and Reed, S. (1994) Mol. Cell. Biol. 14,3683-3694
[Abstract/Free Full Text]
- Polyak, K., Lee, M.-H., Erdjument-Bromage, H., Koff, A., Roberts, J. M., Tempst, P., and Massagué, J. (1994) Cell 78,59-66
[CrossRef][Medline]
[Order article via Infotrieve]
- Polyak, K., Kato, J., Solomon, M. J., Sherr, C. J., Massagué, J., Roberts, J. M., and Koff, A. (1994) Genes & Dev. 8,9-22
- Toyoshima, H., and Hunter, T. (1994) Cell 78,67-74
[CrossRef][Medline]
[Order article via Infotrieve]
- Hannon, G. J., and Beach, D. (1994) Nature 371,257-260
[CrossRef][Medline]
[Order article via Infotrieve]
- Eblen, S. T., Fautsch, M. P., Burnette, R. J., Joshi, P., and Leof, E. B. (1994) Cell Growth Differ. 5,109-116
[Abstract]
- Landesman, Y., Pagano, M., Draetta, G., Rotter, V., Fusenig, N. E., and Kimchi, A. (1992) Oncogene 7,1661-1665
[Medline]
[Order article via Infotrieve]
- Barlat, I., Fesquet, D., Bréchot, C., Henglein, B., Dupuy, d. A., Vie, A., and Blanchard, J. M. (1993) Cell Growth Differ. 4,105-113
[Abstract]
- Ralph, D., McClelland, M., and Welsh, J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90,10710-10714
[Abstract/Free Full Text]
- Reddy, K. B., Hocevar, B. A., and Howe, P. H. (1994) J. Cell. Biochem. 56,418-425
[CrossRef][Medline]
[Order article via Infotrieve]
- Satterwhite, D. J., Aakre, M. E., Gorska, A. E., and Moses, H. L. (1994) Cell Growth Differ. 5,789-799
[Abstract]
- Mudryj, M., Devoto, S. H., Hiebert, S. W., Hunter, T., Pines, J., and Nevins, J. R. (1991) Cell 65,1243-1253
[CrossRef][Medline]
[Order article via Infotrieve]
- Devoto, S. H., Mudryj, M., Pines, J., Hunter, T., and Nevins, J. R. (1992) Cell 68,167-176
[CrossRef][Medline]
[Order article via Infotrieve]
- Shirodkar, S., Ewen, M., DeCaprio, J. A., Morgan, J., Livingston, D. M., and Chittenden, T. (1992) Cell 68,157-166
[CrossRef][Medline]
[Order article via Infotrieve]
- Schwarz, J. K., Devoto, S. H., Smith, E. J., Chellappan, S. P., Jakoi, L., and Nevins, J. R. (1993) EMBO J. 12,1013-1020
[Medline]
[Order article via Infotrieve]
- Zhu, L., Enders, G., Lees, J. A., Beijersbergen, R. L., Bernards, R., and Harlow, E. (1995) EMBO J. 14,1904-1913
[Medline]
[Order article via Infotrieve]
- Laiho, M., DeCaprio, J. A., Ludlow, J. W., and Livingston, D. M. (1990) Cell 62,175-185
[CrossRef][Medline]
[Order article via Infotrieve]
- Keeton, M. R., Curriden, S. A., van, Z. A., and Loskutoff, D. J. (1991) J. Biol. Chem. 266,23048-23052
[Abstract/Free Full Text]
- Wrana, J. L., Attisano, L., Cárcamo, J., Zentella, A., Doody, J., Laiho, M., Wang, X. F., and Massagué, J. (1992) Cell 71,1003-1014
[CrossRef][Medline]
[Order article via Infotrieve]
- Derynck, R. (1994) Trends Biochem. Sci. 19,548-553
[CrossRef][Medline]
[Order article via Infotrieve]
- Massagué, J. (1990) Annu. Rev. Cell Biol. 6,597-641
[CrossRef]
- Mathews, L. S., and Vale, W. W. (1991) Cell 65,973-982
[CrossRef][Medline]
[Order article via Infotrieve]
- Mathews, L. S., Vale, W. W., and Kintner, C. R. (1992) Science 255,1702-1705
[Abstract/Free Full Text]
- Attisano, L., Wrana, J. L., Cheifetz, S., and Massagué, J. (1992) Cell 68,97-108
[CrossRef][Medline]
[Order article via Infotrieve]
- Attisano, L., Cárcamo, J., Ventura, F., Weis, F. M., Massagué, J., and Wrana, J. L. (1993) Cell 75,671-680
[CrossRef][Medline]
[Order article via Infotrieve]
- Lin, H. Y., Wang, X.-F., Ng-Eaton, E., Weinberg, R. A., and Lodish, H. F. (1992) Cell 68,775-785
[CrossRef][Medline]
[Order article via Infotrieve]
- Ebner, R., Chen, R.-H., Shum, L., Lawler, S., Zioncheck, T. F., Lee, A., Lopez, A. R., and Derynck, R. (1993) Science 260,1344-1348
[Abstract/Free Full Text]
- Franzén, P., ten Dijke, P., Ichijo, H., Yamashita, H., Schulz, P., Heldin, C.-H., and Miyazono, K. (1993) Cell 75,681-692
[CrossRef][Medline]
[Order article via Infotrieve]
- He, W., Gustafson, M., Hirobe, S., and Donahoe, P. (1993) Dev. Dynam. 196,133-142
[Medline]
[Order article via Infotrieve]
- ten Dijke, P., Ichijo, H., Franzén, P., Schulz, P., Saras, J., Toyoshima, H., Heldin, C.-H., and Miyazono, K. (1993) Oncogene 8,2879-2887
[Medline]
[Order article via Infotrieve]
- ten Dijke, P., Yamashita, H., Ichijo, H., Franzén, P., Laiho, M., Miyanozo, K., and Heldin, C.-H. (1994) Science 264,101-104
[Abstract/Free Full Text]
- ten Dijke, P., Yamashita, H., Sampath, T. K., Reddi, A. H., Estevez, M., Riddle, D. L., Ichojo, H., Heldin, C.-H., and Miyazono, K. (1994) J. Biol. Chem. 269,16985-16988
[Abstract/Free Full Text]
- Bassing, C. H., Yingling, J. M., Howe, D. J., Wang, T., He, W. W., Gustafson, M. L., Shah, P., Donahoe, P. K., and Wang, X.-F. (1994) Science 263,87-89
[Abstract/Free Full Text]
- Miettinen, P. J., Ebner, R., Lopez, A. R., and Derynck, R. (1994) J. Cell Biol. 127,2021-2036
[Abstract/Free Full Text]
- Chen, R.-H., and Derynck, R. (1994) J. Biol. Chem. 269,22868-22874
[Abstract/Free Full Text]
- Henis, Y. I., Moustakas, A., Lin, H. Y., and Lodish, H. F. (1994) J. Cell Biol. 126,139-154
[Abstract/Free Full Text]
- Ebner, R., Chen, R.-H., Lawler, S., Zioncheck, T., and Derynck, R. (1993) Science 262,900-902
[Abstract/Free Full Text]
- Bassing, C. H., Howe, D. J., Segarini, P. R., Donahoe, P. K., and Wang, X.-F. (1994) J. Biol. Chem. 269,14861-14864
[Abstract/Free Full Text]
- Yamashita, H., ten Dijke, P., Franzén, P., Miyazono, K., and Heldin, C.-H. (1994) J. Biol. Chem. 269,20172-20178
[Abstract/Free Full Text]
- Wrana, J. L., Attisano, L., Wieser, R., Ventura, F., and Massagué, J. (1994) Nature 370,341-347
[CrossRef][Medline]
[Order article via Infotrieve]
- Chen, F., and Weinberg, R. A. (1995) Proc. Natl. Acad. Sci. U. S. A. 92,1565-1569
[Abstract/Free Full Text]
- Chen, R.-H., Moses, H. L., Maruoka, E. M., Derynck, R., and Kawabata, M. (1995) J. Biol. Chem. 270,12235-12241
[Abstract/Free Full Text]
- Laiho, M., Weis, M. B., and Massagué, J. (1990) J. Biol. Chem. 265,18518-18524
[Abstract/Free Full Text]
- Laiho, M., Weis, F. M., Boyd, F. T., Ignotz, R. A., and Massagué, J. (1991) J. Biol. Chem. 266,9108-9112
[Abstract/Free Full Text]
- Chen, R.-H., Ebner, R., and Derynck, R. (1993) Science 260,1335-1338
[Abstract/Free Full Text]
- Laiho, M., Ronnstrand, L., Heino, J., DeCaprio, J. A., Ludlow, J. W., Livingston, D. M., and Massagué, J. (1991) Mol. Cell. Biol. 11,972-978
[Abstract/Free Full Text]
- Fafeur, V., O'Hara, B., and Böhlen, P. (1993) Mol. Biol. Cell 4,135-144
[Abstract]
- Henglein, B., Chenivesse, X., Wang, J., Eick, D., and Bréchot, C. (1994) Proc. Natl. Acad. Sci. U. S. A. 91,5490-5494
[Abstract/Free Full Text]
- Lawler, S., Candia, A., Ebner, R., Shum, L., Lopez, A., Moses, H., Wright, C., and Derynck, R. (1994) Development 120,165-175
[Abstract]
- Graycar, J. L., Miller, D. A., Arrick, B. A., Lyons, R. M., Moses, H. L., and Derynck, R. (1989) Mol. Endocrinol. 3,1977-1986
[Abstract/Free Full Text]
- Evan, G., Lewis, G., Ramsay, G., and Bishop, J. M. (1985) Mol. Cell. Biol. 5,3610-3616
[Abstract/Free Full Text]
- Hopp, T. P., Prickett, K. S., Price, V., Libby, R. T., March, C. J., Cerretti, P., Urdal, D. L., and Conlon, P. J. (1988) BioTechniques 6,1205-1210
- Gazit, D., Ebner, R., Kahn, A., and Derynck, R. (1993) Mol. Endocrinol. 7,189-198
[Abstract/Free Full Text]
- Wieser, R., Attisano, L., Wrana, J. L., and Massagué, J. (1993) Mol. Cell. Biol. 13,7239-7247
[Abstract/Free Full Text]
- Zindy, F., Lamas, E., Chenivesse, X., Sobczak, J., Wang, J., Fesquet, D., Henglein, B., and Bréchot, C. (1991) Biochem. Biophys. Res. Commun. 182,1144-1154
- Pagano, M., Pepperkok, R., Verde, F., Ansorge, W., and Draetta, G. (1992) EMBO J. 11,961-971
[Medline]
[Order article via Infotrieve]
- Faha, B., Ewen, M., Tsai, L., Livingston, D., and Harlow, E. (1992) Science 255,87-90
[Abstract/Free Full Text]
- Yoshizumi, M., Hsieh, C.-M., Zhou, F., Tsai, J.-C., Patterson, C., Perrella, M., and Lee, M.-E. (1995) Mol. Cell. Biol. 15,3266-3272
[Abstract]
- Wrana, J. L., Cárcamo, J., Attisano, L., Cheifetz, S., Zentella, A., Lopez, C. F., and Massagué, J. (1992) Cold Spring Harb. Symp. Quant. Biol. 57,81-86
[Abstract/Free Full Text]
- Okadame, T., Yamashita, H., Franzén, P., Morén, A., Heldin, C.-H., and Miyazono, K. (1994) J. Biol. Chem. 269,30753-30756
[Abstract/Free Full Text]
- Brand, T., MacLellan, W. R., and Schneider, M. D. (1993) J. Biol. Chem. 268,11500-11503
[Abstract/Free Full Text]
- Vivien, D., Attisano, L., Wrana, J. L., and Massagué, J. (1995) J. Biol. Chem. 270,7134-7141
[Abstract/Free Full Text]
- Brand, T., and Schneider, M. (1995) J. Biol. Chem. 270,8274-8284
[Abstract/Free Full Text]
- Arrick, B. A., Lopez, A. R., Elfman, F., Ebner, R., Damsky, C. H., and Derynck, R. (1992) J. Cell Biol. 118,715-726
[Abstract/Free Full Text]
- Centrella, M., Kim, J., Phang, T. S., Cascendino, J., Rosen, V., Wozney, J., and McCarthy, T. (1995) Mol. Cell. Biol. 15,3273-3281
[Abstract]
- Marshall, C. (1995) Cell 80,179-185
[CrossRef][Medline]
[Order article via Infotrieve]
- Amatayakul-Chantler, S., Qian, S. W., Gakenheimer, K., Bottinger, E. P., Roberts, A. B., and Sporn, M. B. (1994) J. Biol. Chem. 269,27687-27691
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
C. Millet, M. Yamashita, M. Heller, L.-R. Yu, T. D. Veenstra, and Y. E. Zhang
A Negative Feedback Control of Transforming Growth Factor-{beta} Signaling by Glycogen Synthase Kinase 3-mediated Smad3 Linker Phosphorylation at Ser-204
J. Biol. Chem.,
July 24, 2009;
284(30):
19808 - 19816.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Karydis, M. Jimenez-Vidal, S. P. Denker, and D. L. Barber
Mislocalized Scaffolding by the Na-H Exchanger NHE1 Dominantly Inhibits Fibronectin Production and TGF-{beta} Activation
Mol. Biol. Cell,
April 15, 2009;
20(8):
2327 - 2336.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. H. Wrighton, X. Lin, and X.-H. Feng
Critical regulation of TGF{beta} signaling by Hsp90
PNAS,
July 8, 2008;
105(27):
9244 - 9249.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. P. Castro, D. Piscopo, T. Nakagawa, and R. Derynck
Cornichon regulates transport and secretion of TGF{alpha}-related proteins in metazoan cells
J. Cell Sci.,
July 15, 2007;
120(14):
2454 - 2466.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Kamiya, K. Sakakibara, E. J. Ryer, R. P. Hom, E. B. Leof, K. C. Kent, and B. Liu
Phosphorylation of the Cyclic AMP Response Element Binding Protein Mediates Transforming Growth Factor {beta}-Induced Downregulation of Cyclin A in Vascular Smooth Muscle Cells
Mol. Cell. Biol.,
May 1, 2007;
27(9):
3489 - 3498.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
T. Alliston, T. C. Ko, Y. Cao, Y.-Y. Liang, X.-H. Feng, C. Chang, and R. Derynck
Repression of Bone Morphogenetic Protein and Activin-inducible Transcription by Evi-1
J. Biol. Chem.,
June 24, 2005;
280(25):
24227 - 24237.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Fritah, C. Saucier, J. Mester, G. Redeuilh, and M. Sabbah
p21WAF1/CIP1 Selectively Controls the Transcriptional Activity of Estrogen Receptor {alpha}
Mol. Cell. Biol.,
March 15, 2005;
25(6):
2419 - 2430.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, N. Sergina, T. C. Ko, J. Gong, and M. G. Brattain
Autocrine and Exogenous Transforming Growth Factor {beta} Control Cell Cycle Inhibition through Pathways with Different Sensitivity
J. Biol. Chem.,
September 17, 2004;
279(38):
40237 - 40244.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Liang, Y.-Y. Liang, K. Wrighton, D. Ungermannova, X.-P. Wang, F. C. Brunicardi, X. Liu, X.-H. Feng, and X. Lin
Ubiquitination and Proteolysis of Cancer-Derived Smad4 Mutants by SCFSkp2
Mol. Cell. Biol.,
September 1, 2004;
24(17):
7524 - 7537.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Ammanamanchi, M. P. M. Tillekeratne, T. C. Ko, and M. G. Brattain
Endogenous Control of Cell Cycle Progression by Autocrine Transforming Growth Factor {beta} in Breast Cancer Cells
Cancer Res.,
April 1, 2004;
64(7):
2509 - 2515.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Osman, E. G. Niles, and P. T. LoVerde
Expression of Functional Schistosoma mansoni Smad4: ROLE IN ERK-MEDIATED TRANSFORMING GROWTH FACTOR {beta} (TGF-{beta}) DOWN-REGULATION
J. Biol. Chem.,
February 20, 2004;
279(8):
6474 - 6486.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Qing, C. Liu, L. Choy, R.-Y. Wu, J. S. Pagano, and R. Derynck
Transforming Growth Factor {beta}/Smad3 Signaling Regulates IRF-7 Function and Transcriptional Activation of the Beta Interferon Promoter
Mol. Cell. Biol.,
February 1, 2004;
24(3):
1411 - 1425.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Lin, Y.-Y. Liang, B. Sun, M. Liang, Y. Shi, F. C. Brunicardi, Y. Shi, and X.-H. Feng
Smad6 Recruits Transcription Corepressor CtBP To Repress Bone Morphogenetic Protein-Induced Transcription
Mol. Cell. Biol.,
December 15, 2003;
23(24):
9081 - 9093.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Marques, T. E. Haerry, M. L. Crotty, M. Xue, B. Zhang, and M. B. O'Connor
Retrograde Gbb signaling through the Bmp type 2 receptor Wishful Thinking regulates systemic FMRFa expression in Drosophila
Development,
November 15, 2003;
130(22):
5457 - 5470.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. J. Schiemann, J. R. Neil, and W. P. Schiemann
SPARC Inhibits Epithelial Cell Proliferation in Part through Stimulation of the Transforming Growth Factor-{beta}-Signaling System
Mol. Biol. Cell,
October 1, 2003;
14(10):
3977 - 3988.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Jono, H. Xu, H. Kai, D. J. Lim, Y. S. Kim, X.-H. Feng, and J.-D. Li
Transforming Growth Factor-{beta}-Smad Signaling Pathway Negatively Regulates Nontypeable Haemophilus influenzae-induced MUC5AC Mucin Transcription via Mitogen-activated Protein Kinase (MAPK) Phosphatase-1-dependent Inhibition of p38 MAPK
J. Biol. Chem.,
July 18, 2003;
278(30):
27811 - 27819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. S. W. Lee, C. Chang, D. Liu, and R. Derynck
Sumoylation of Smad4, the Common Smad Mediator of Transforming Growth Factor-{beta} Family Signaling
J. Biol. Chem.,
July 18, 2003;
278(30):
27853 - 27863.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Gong, S. Ammanamanchi, T. C. Ko, and M. G. Brattain
Transforming Growth Factor {beta}1 Increases the Stability of p21/WAF1/CIP1 Protein and Inhibits CDK2 Kinase Activity in Human Colon Carcinoma FET Cells
Cancer Res.,
June 15, 2003;
63(12):
3340 - 3346.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Sharma, N. Fatma, E. Kubo, T. Shinohara, L. T. Chylack Jr., and D. P. Singh
Lens Epithelium-derived Growth Factor Relieves Transforming Growth Factor-{beta}1-induced Transcription Repression of Heat Shock Proteins in Human Lens Epithelial Cells
J. Biol. Chem.,
May 23, 2003;
278(22):
20037 - 20046.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Chai, Y. Ito, and J. Han
TGF-{beta} SIGNALING AND ITS FUNCTIONAL SIGNIFICANCE IN REGULATING THE FATE OF CRANIAL NEURAL CREST CELLS
Critical Reviews in Oral Biology & Medicine,
March 1, 2003;
14(2):
78 - 88.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Jono, T. Shuto, H. Xu, H. Kai, D. J. Lim, J. R. Gum Jr., Y. S. Kim, S. Yamaoka, X.-H. Feng, and J.-D. Li
Transforming Growth Factor-beta -Smad Signaling Pathway Cooperates with NF-kappa B to Mediate Nontypeable Haemophilus influenzae-induced MUC2 Mucin Transcription
J. Biol. Chem.,
November 15, 2002;
277(47):
45547 - 45557.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
W. P. Schiemann, G. C. Blobe, D. E. Kalume, A. Pandey, and H. F. Lodish
Context-specific Effects of Fibulin-5 (DANCE/EVEC) on Cell Proliferation, Motility, and Invasion. FIBULIN-5 IS INDUCED BY TRANSFORMING GROWTH FACTOR-beta AND AFFECTS PROTEIN KINASE CASCADES
J. Biol. Chem.,
July 19, 2002;
277(30):
27367 - 27377.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Z. Yan, G.-Y. Kim, X. Deng, and E. Friedman
Transforming Growth Factor beta 1 Induces Proliferation in Colon Carcinoma Cells by Ras-dependent, smad-independent Down-regulation of p21cip1
J. Biol. Chem.,
March 15, 2002;
277(12):
9870 - 9879.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. L. Buchanan, S. Ohsako, C. Tohyama, P. S. Cooke, and T. Iguchi
Dioxin Inhibition of Estrogen-Induced Mouse Uterine Epithelial Mitogenesis Involves Changes in Cyclin and Transforming Growth Factor-{beta} Expression
Toxicol. Sci.,
March 1, 2002;
66(1):
62 - 68.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. A. Visser, R. Olaso, M. Verhoef-Post, P. Kramer, A. P. N. Themmen, and H. A. Ingraham
The Serine/Threonine Transmembrane Receptor ALK2 Mediates Mullerian Inhibiting Substance Signaling
Mol. Endocrinol.,
June 1, 2001;
15(6):
936 - 945.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C.-F. Huang, Y.-C. Wang, D.-A. Tsao, S.-F. Tung, Y.-S. Lin, and C.-W. Wu
Antagonism between Members of the CNC-bZIP Family and the Immediate-Early Protein IE2 of Human Cytomegalovirus
J. Biol. Chem.,
April 14, 2000;
275(16):
12313 - 12320.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-T. Tsai, Y.-H. Su, S.-S. Fang, T.-N. Huang, Y. Qiu, Y.-S. Jou, H.-m. Shih, H.-J. Kung, and R.-H. Chen
Etk, a Btk Family Tyrosine Kinase, Mediates Cellular Transformation by Linking Src to STAT3 Activation
Mol. Cell. Biol.,
March 15, 2000;
20(6):
2043 - 2054.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Wu, Y. Chen, B. Ozdamar, C. A. Gyuricza, P. A. Chong, J. L. Wrana, J. Massagué, and Y. Shi
Structural Basis of Smad2 Recognition by the Smad Anchor for Receptor Activation
Science,
January 7, 2000;
287(5450):
92 - 97.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
S. Larisch-Bloch, D. Danielpour, N. S. Roche, R. Lotan, A. Y. Hsing, H. Kerner, T. Hajouj, R. J. Lechleider, and A. B. Roberts
Selective Loss of the Transforming Growth Factor-{beta} Apoptotic Signaling Pathway in Mutant NRP-154 Rat Prostatic Epithelial Cells
Cell Growth Differ.,
January 1, 2000;
11(1):
1 - 10.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
E. PIEK, C.-H. HELDIN, and P. TEN DIJKE
Specificity, diversity, and regulation in TGF-{beta} superfamily signaling
FASEB J,
December 1, 1999;
13(15):
2105 - 2124.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
K. S. Choi, Y. W. Eom, Y. Kang, M. J. Ha, H. Rhee, J.-W. Yoon, and S.-J. Kim
Cdc2 and Cdk2 Kinase Activated by Transforming Growth Factor-beta 1 Trigger Apoptosis through the Phosphorylation of Retinoblastoma Protein in FaO Hepatoma Cells
J. Biol. Chem.,
November 5, 1999;
274(45):
31775 - 31783.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-J. Zhu and A. M. Sizeland
Extracellular Domain of the Transforming Growth Factor-beta Receptor Negatively Regulates Ligand-independent Receptor Activation
J. Biol. Chem.,
October 8, 1999;
274(41):
29220 - 29227.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R.-H. Chen, M.-C. Chang, Y.-H. Su, Y.-T. Tsai, and M.-L. Kuo
Interleukin-6 Inhibits Transforming Growth Factor-beta -induced Apoptosis through the Phosphatidylinositol 3-Kinase/Akt and Signal Transducers and Activators of Transcription 3 Pathways
J. Biol. Chem.,
August 13, 1999;
274(33):
23013 - 23019.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Go, P. Li, and X.-J. Wang
Blocking Transforming Growth Factor {beta} Signaling in Transgenic Epidermis Accelerates Chemical Carcinogenesis: A Mechanism Associated with Increased Angiogenesis
Cancer Res.,
June 1, 1999;
59(12):
2861 - 2868.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Wang, L. Sun, E. Zborowska, J. K. V. Willson, J. Gong, J. Verraraghavan, and M. G. Brattain
Control of Type II Transforming Growth Factor-beta Receptor Expression by Integrin Ligation
J. Biol. Chem.,
April 30, 1999;
274(18):
12840 - 12847.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-F. Tung, J.-Y. Chuang, C.-T. Lin, M.-Y. Lai, C.-W. Wu, and Y.-S. Lin
Inhibition of hTAFII32-binding Implicated in the Transcriptional Repression by Central Regions of Mutant p53 Proteins
J. Biol. Chem.,
March 19, 1999;
274(12):
7748 - 7755.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Choy and R. Derynck
The Type II Transforming Growth Factor (TGF)-beta Receptor-interacting Protein TRIP-1 Acts as a Modulator of the TGF-beta Response
J. Biol. Chem.,
November 20, 1998;
273(47):
31455 - 31462.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
I. Griswold-Prenner, C. Kamibayashi, E. M. Maruoka, M. C. Mumby, and R. Derynck
Physical and Functional Interactions between Type I Transforming Growth Factor beta Receptors and Balpha , a WD-40 Repeat Subunit of Phosphatase 2A
Mol. Cell. Biol.,
November 1, 1998;
18(11):
6595 - 6604.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
X.-H. Feng, Y. Zhang, R.-Y. Wu, and R. Derynck
The tumor suppressor Smad4/DPC4 and transcriptional adaptor CBP/p300 are coactivators for Smad3 in TGF-beta -induced transcriptional activation
Genes & Dev.,
July 15, 1998;
12(14):
2153 - 2163.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
G. Wu, R. S. Fan, W. Li, V. Srinivas, and M. G. Brattain
Regulation of Transforming Growth Factor-beta Type II Receptor Expression in Human Breast Cancer MCF-7 Cells by Vitamin D3 and Its Analogues
J. Biol. Chem.,
March 27, 1998;
273(13):
7749 - 7756.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Li, R. T. C. Su, H.-t. Hsu, and H. Sze
The Molecular Chaperone Calnexin Associates with the Vacuolar H+-ATPase from Oat Seedlings
PLANT CELL,
January 1, 1998;
10(1):
119 - 130.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
M. Yoshizumi, H. Wang, C.-M. Hsieh, N. E. S. Sibinga, M. A. Perrella, and M.-E. Lee
Down-regulation of the Cyclin A Promoter by Transforming Growth Factor-beta 1 Is Associated with a Reduction in Phosphorylated Activating Transcription Factor-1 and Cyclic AMP-responsive Element-binding Protein
J. Biol. Chem.,
August 29, 1997;
272(35):
22259 - 22264.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
U. Persson, S. Souchelnytskyi, P. Franzen, K. Miyazono, P. ten Dijke, and C.-H. Heldin
Transforming Growth Factor (TGF-beta )-specific Signaling by Chimeric TGF-beta Type II Receptor with Intracellular Domain of Activin Type IIB Receptor
J. Biol. Chem.,
August 22, 1997;
272(34):
21187 - 21194.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Lawler, X.-H. Feng, R.-H. Chen, E. M. Maruoka, C. W. Turck, I. Griswold-Prenner, and R. Derynck
The Type II Transforming Growth Factor-beta Receptor Autophosphorylates Not Only on Serine and Threonine but Also on Tyrosine Residues
J. Biol. Chem.,
June 6, 1997;
272(23):
14850 - 14859.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-J. Wang, D. A. Greenhalgh, J. R. Bickenbach, A. Jiang, D. S. Bundman, T. Krieg, R. Derynck, and D. R. Roop
Expression of a dominant-negative type II transforming growth factor beta (TGF-beta ) receptor in the epidermis of transgenic mice blocks TGF-beta -mediated growth inhibition
PNAS,
March 18, 1997;
94(6):
2386 - 2391.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. W. Qian, J. K. Burmester, M. L.-S. Tsang, J. A. Weatherbee, A. P. Hinck, D. J. Ohlsen, M. B. Sporn, and A. B. Roberts
Binding Affinity of Transforming Growth Factor-beta for Its Type II Receptor Is Determined by the C-terminal Region of the Molecule
J. Biol. Chem.,
November 29, 1996;
271(48):
30656 - 30662.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M.-J. Charng, P. Kinnunen, J. Hawker, T. Brand, and M. D. Schneider
FKBP-12 Recognition Is Dispensable For Signal Generation by Type I Transforming Growth Factor-beta Receptors
J. Biol. Chem.,
September 20, 1996;
271(38):
22941 - 22944.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Hartsough, R. S. Frey, P. A. Zipfel, A. Buard, S. J. Cook, F. McCormick, and K. M. Mulder
Altered Transforming Growth Factor beta Signaling in Epithelial Cells when Ras Activation Is Blocked
J. Biol. Chem.,
September 13, 1996;
271(37):
22368 - 22375.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. A. Anders and E. B. Leof
Chimeric Granulocyte/Macrophage Colony-stimulating Factor/Transforming Growth Factor-beta (TGF-beta ) Receptors Define a Model System for Investigating the Role of Homomeric and Heteromeric Receptors in TGF-beta Signaling
J. Biol. Chem.,
September 6, 1996;
271(36):
21758 - 21766.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, W. Han, E. Zborowska, J. Liang, X. Wang, J. K.V. Willson, L. Sun, and M. G. Brattain
Reduced Expression of Transforming Growth Factor beta Type I Receptor Contributes to the Malignancy of Human Colon Carcinoma Cells
J. Biol. Chem.,
July 19, 1996;
271(29):
17366 - 17371.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-H. Feng and R. Derynck
Ligand-independent Activation of Transforming Growth Factor (TGF) beta Signaling Pathways by Heteromeric Cytoplasmic Domains of TGF-beta Receptors
J. Biol. Chem.,
May 31, 1996;
271(22):
13123 - 13129.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Lin, M. Liang, and X.-H. Feng
Smurf2 Is a Ubiquitin E3 Ligase Mediating Proteasome-dependent Degradation of Smad2 in Transforming Growth Factor-beta Signaling
J. Biol. Chem.,
November 17, 2000;
275(47):
36818 - 36822.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S.-F. Lee, C.-T. Wang, J. Y.-P. Liang, S.-L. Hong, C.-C. Huang, and S. S.-L. Chen
Multimerization Potential of the Cytoplasmic Domain of the Human Immunodeficiency Virus Type 1 Transmembrane Glycoprotein gp41
J. Biol. Chem.,
May 19, 2000;
275(21):
15809 - 15819.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Rodriguez, L. J.-S. Huang, J. K. Son, A. McKee, Z. Xiao, and H. F. Lodish
Functional Cloning of the Proto-oncogene Brain Factor-1 (BF-1) As a Smad-binding Antagonist of Transforming Growth Factor-beta Signaling
J. Biol. Chem.,
August 3, 2001;
276(32):
30224 - 30230.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|