| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, May 19, 1995; and in revised form, July 19,
1995) From the
The rat angiotensin II type 1a receptor (AT1a-R) gene is
expressed in a cell-specific manner. We demonstrated that the negative
regulatory element (NRE) between -489 and -331 is active in
PC12 cells (Murasawa, S., Matsubara, H., Urakami, M., and Inada, M.
(1993) J. Biol. Chem. 268, 26996-27003). Gel retardation
assays confirmed that PC12 cells have a trans-acting factor bound to
the NRE. By means of a DNase I footprint assay we identified the core
of the NRE as an (A + T)-rich sequence (TAATCTTTTATTTTA) located
at nucleotides -456 to -442. Oligonucleotides corresponding
to the NRE core sequence bound to nuclear protein. Site-directed
mutagenesis at nucleotides -451 to -448 eliminated the
specific protein/DNA binding and restored expression of the AT1a-R in
transient transfection assays (2.7-fold increase). The NRE did not
negatively affect the thymidine kinase promoter. No homology was found
with known NREs, suggesting that this is a novel NRE. Southwestern
blotting revealed a 53-kDa, specific binding protein in PC12 cells and
the rat brain, but not in the liver, spleen, adrenal gland, and kidney.
These findings demonstrate that the NRE of the rat AT1a-R is an (A
+ T)-rich sequence located at nucleotides -456 to -442
and the 53-kDa protein is a specific binding protein, and suggest that
this protein may be a trans-acting factor which determines the
neuron-specific down-regulation of the AT1a-R gene.
Angiotensin II has multiple physiological effects in the
cardiovascular, endocrine, and nervous systems that are initiated by
binding to specific receptors located on the plasma
membrane(1) . Two major subtypes (type 1 and type 2) of
angiotensin II receptors have been revealed by their differential
affinity for nonpeptide drugs(2) . Angiotensin II type 1a
receptor (AT1a-R) ( We characterized one negative and three positive cis-regulatory
elements in the 5`-flanking region of the rat AT1a-R gene(7) .
The negative cis-regulatory element (NRE) was located between
-489 and -331 and inhibited the promoter activity of the
590-bp 5`-flanking region by a factor of 10. The trans-acting factor
that binds to the element was present in PC12, not in vascular smooth
muscle and glial cells. This suggested that the trans-acting factor is
a major determinant which regulates the expression of the rat AT1a-R
gene in PC12 cells. However, the NRE was located within 159 nucleotides
(nt) from -489 to -331 and the core sequence has not been
mapped in detail. Here, we identified the core sequence to clarify
the negative cis-regulation, using the gel retardation assay and the
DNase I footprint analysis. We showed that the core sequence is (A
+ T)-rich (TAATCTTTTATTTTA, nt -456 to -442).
Southwestern blotting revealed that a nuclear protein of about 53 kDa
bound to the NRE in PC12 cells and the rat brain, but not in vascular
smooth muscle cells, glial cells, kidney, spleen, adrenal gland, and
liver.
The 159-bp NRE fragment (nt -489 to
-331) obtained by XhoI and HindIII digestion
was labeled with [
Figure 2:
DNase I footprint analyses of the NRE
fragment. The NRE fragment (nt -489 to -331) was labeled at
the XhoI site (A) and the BssHII site (B) as the sense probes, and at the NotI site (C) as an antisense probe. These probes were incubated in the
presence or absence of nuclear extract from PC12 cells, and partially
digested with DNase I as described under ``Materials
Methods.'' Five µg of nuclear extract was used in panel A and increasing amounts of nuclear extract were used in panel B and C. G + A lane indicates the sequence ladder by
the Maxam-Gilbert reactions. The protected portion is shown in the left side of panels.
A mutation
corresponding to NRE mutation 2 was created by PCR overlap extension
mutagenesis(10) . Briefly, two DNA fragments having overlapping
ends were first amplified using two sets of primers (A and B, C and D),
from a AT1a 980-Bluescript construct into which a 1242-bp EcoRI-SacI fragment containing the 980-bp 5`-flanking
region (-980 to +262) had been subcloned(7) .
Primers A and D were T3 and T7 primers for pBluescriptKS(-),
respectively. Primers B and C had the following sequences: B,
5`-TTCAGAGCCGTAAAATACCAGATTA-3` (antisense: nt -432 to
-456); C, 5`-TATTTTACGGCTCTGAA-3` (sense: nt -448 to
-432). Primer B contained an oligo-NRE mutation 2 (Fig. 5A) at the 3` end, and primers B and C were
designed to overlap at the 5` end (underlined). The two respective PCR
products were mixed and amplified again with primers A and D. The
resultant PCR product was subcloned into the pGEM-T vector (Promega,
Madison, WI), and sequenced using T7 and T3 primers to confirm the
mutated NRE and other DNA sequences. The PCR product was further
subcloned into the 5` end of the CAT gene.
Figure 5:
Nucleotide sequences of NRE mutations and
functional analyses of NRE in the promoter activity. A,
nucleotide sequences of NRE mutations 1 (-452 and -447) and
2 (-451 to -448) are shown in comparison with wild NRE
sequences. B, the NRE fragment (nt -489 to -331)
was deleted from 980 bp of 5`-flanking region and fused to the CAT
reporter gene as described under ``Materials and Methods.'' A
mutation corresponding to NRE mutation 2 was designed by means of PCR
overlap extension mutagenesis. These CAT fusion genes (15 µg) were
co-transfected with 5 µg of
To construct a
NRE-thymidine kinase (TK)-CAT fusion gene, the NRE fragment (nt
-489 to -331), obtained by digestion with XhoI and BamHI, was blunt-ended at XhoI site by Klenow. The
TK-CAT construct (a gift from Dr. Y. Mori, Harvard Medical School) was
cut with HindIII and BamHI in the upstream linker
site and HindIII site was blunt-ended. The NRE fragment was
subcloned between blunt-end and BamHI sites of the TK-CAT
construct.
Fig. 1shows the result of gel retardation
analyses using 159 bp of the NRE fragment (nt -489 to -331)
as a probe. The NRE fragment formed five retarded bands (arrows A,
B, C, D, and E in Fig. 1) upon incubation with
cellular nuclear extract from PC12 cells. Although these bands differed
in mobility, the addition of a 100-fold molar excess of the same
unlabeled NRE fragment completely competed with the slowest band (arrow A). Other retarded bands (arrows C and D) also competed with the unlabeled NRE fragment, whereas the
inhibition was not complete even with a 100-fold molar excess of the
competitor. The arrow B and E bands were not
inhibited with an excess of the competitor. The retarded band
corresponding to arrow A was not detected in glial cells, A10
cells, and vascular smooth muscle cells. No specific band complex was
observed when the nuclear extract from glial cells, A10 cells, or
vascular smooth muscle cells were incubated with the NRE fragment.
Figure 1:
Gel retardation analysis of the NRE
fragment. The NRE fragment (nt -489 to -331) was labeled
and used in gel retardation analyses with nuclear extract (2 µg)
from PC12, glial cells, and A10 cells and primary cultured vascular
smooth muscle cells of rat aorta (VSMC). The unlabeled NRE
fragment at a 20
An oligonucleotide (oligo-NRE) was designed to
encompass the protected 15-bp sequences. With oligo-NRE as the labeled
probe, the nuclear extract from PC12 cells produced a single strong
band that was eliminated with an excess of the same oligo, but not by
an unrelated oligo (oligo I) encompassing from nt -489 to
-457 of the more upstream NRE region. The nuclear extract from
glial cells did not form a retarded band. The oligonucleotides known as
the NRE for the human major histocompatibility complex class I
(CCAAAATTATCTGAAAAAGGTTATTAAAA) (18) or the rat prolactin
(TATAATTTTATA) (19) did not compete with the DNA-binding
protein (Fig. 3A). Thus, oligo-NRE contains a binding
site for a sequence-specific DNA-binding protein.
Figure 3:
Gel retardation analyses of the oligo-NRE. A, the oligo-NRE (nt -456 to -442) was labeled and
used in gel retardation analyses with nuclear extract (2 µg) from
PC12 cells. Glia refers to gel retardation using nuclear extract (2
µg) from glial cells. Oligo I, II, and III show gel retardation
when oligonucleotides encompassing the more upstream region (oligo I,
nt -489 to -457) and the NRE sequences for the human major
histocompatibility complex class I gene (oligo II,
CCAAAATTATCTGAAAAAGGTTATTAAAA) (18) and the rat prolactin gene
(oligo III, TATAATTTTATA) (19) were used as competitors (molar
ratio, 100
Gel retardation
analyses were performed using the promoter NRE fragment as a probe, to
determine whether or not the retarded band could be competed by the
oligo-NRE. Excess oligo-NRE interfered with the protein-NRE binding and
reduced the amount of a slowest retarded product (Fig. 3B). These findings suggest that the slowest
retarded band (arrow A in Fig. 1) is due to the
interaction between nuclear protein and oligo-NRE sequence.
Figure 4:
Gel
retardation analyses of the oligo-NRE mutations. A, the NRE
mutation 1 (-452 and -447) was labeled and competed with
the unlabeled NRE mutation 1. B, the NRE mutation 2
(-451 to -448) was labeled and reacted with nuclear
extract. C, the wild oligo-NRE was the probe and competed with
wild oligo-NRE or unlabeled NRE mutation 2. Nuclear extract (2 µg)
was prepared from PC12 cells. The arrow indicates the retarded
band. Sequences for the wild oligo-NRE and the mutations are shown in Fig. 5.
Figure 6:
Southwestern blots of nuclear protein
prepared from PC12 cells and rat brain. Nuclear extracts (50 µg of
protein per lane) were separated by SDS-PAGE, blotted onto a
nitrocellulose membrane, then detected with the
Figure 7:
Effect
of the NRE on a heterologous promoter. PC12 cells were transiently
transfected with fusion genes containing the thymidine kinase (TK) promoter placed 5` to the CAT gene without NRE (top), with the NRE (solid bar) placed upstream of
the TK promoter (middle). The CAT activity levels were
normalized with
We demonstrated that three positive cis-regulatory elements
and one strong NRE are present in the 5`-flanking region of the rat
AT1a-R gene, and suggested that this NRE is one of major determinants
that regulate the level of gene expression in PC12 cells (7) .
Here, we discovered and mapped the core sequence of the NRE
(5`-TAATCTTTTATTTTA-3`) between -456 and -442. This element
reduced AT1a-R gene expression by a factor of 2.7 in transient
transfection assays using PC12 cells. Site-directed mutagenesis in this
core sequence affected the specific DNA-protein interaction and
eliminated the suppression of AT1a-R gene expression in the transient
transfection assays. These data demonstrated that specific protein-DNA
interaction at this sequence down-regulates the gene expression in PC12
cells. Although NREs have been detected in a variety of
genes(13) , the molecular mechanisms by which they exert their
effects remain obscure. While the NREs can exhibit enhancer-like
qualities and function on heterologous promoters in a distance and
orientation-independent fashion(14) , they often reduce rather
than abolish the activity of heterologous promoters and demonstrate a
preference for a specific promoter(15, 16) . The NRE
in the rat AT1a-R gene, when transferred to the TK promoter, had no
significant effect on the transcriptional activity, suggesting that the
NRE in the AT1a-R gene works more effectively in conjunction with the
native AT1a-R gene promoter than with the heterologous promoter. Recently, many cis-acting, negative transcriptional elements in
mammals have been identified(13) , some of which include (A
+ T)-rich sequences. These include human Ig heavy chain
(AATATTTT)(17) , human major histocompatibility complex class I
(CCAAAATTATCTGAAAAAGGTTATTAAAA)(18) , rat prolactin (AAATAAA,
TATAATTTTATA)(19) , and mouse Ig (ATTAATTTAT)(20) .
However, the (A + T)-rich NRE sequence identified in the rat
AT1a-R gene did not match these (A + T)-rich sequences and was not
competed with the NRE oligos for the human major histocompatibility
complex class I and rat prolactin (Fig. 3A), indicating
that this NRE is a novel negative element. The rat AT1a-R gene has a
subtype gene, AT1b-R, which has very high homology (96%) in the coding
sequence(21, 22, 23, 24) . Although
the receptor-mediated second signal was similar to that in the AT1a-R,
the profile for the tissue distribution between the AT1a-R and AT1b-R
mRNAs was quite distinct. The AT1a-R is the dominant form expressed in
the liver, kidney, vasculature, lung, ovary, testis, and heart, whereas
the AT1b-R is expressed in greater quantities in the adrenal gland,
anterior pituitary, and uterus(21, 22, 23) .
Very recently, Guo and Inagami (25) have sequenced the rat
AT1b-R promoter region, in which the homology between both subtypes was
low and the (A + T)-rich NRE sequence observed in the AT1a-R gene
was not detected. Since the abundant expression of the AT1b-R gene is
restricted in a few organs compared with that of the AT1a-R gene, a
much stronger NRE may be present and regulate a tissue-specific
expression. In the 5`-flanking region of the human AT1a-R gene, Guo et al.(26) and Takayanagi et al.(27) found that the cis-regulatory region inhibits the
gene transcription between -881 to -642, and -962 to
-114, respectively. However, the (A + T)-rich NRE sequence
observed in the rat AT1a-R gene was not located in these regions, and a
similar element (AAATTTATTTTA) was present more upstream. This study
demonstrated that the trans-acting protein bound to the NRE of the rat
AT1a-R gene is present in PC12, but not in vascular smooth muscle cells
and glial cells. Thus, whether the (A + T)-rich sequence in the
human AT1a-R gene can function as a NRE depends on a suitable cell
model containing an abundant amount of the specific trans-acting
protein. Southwestern blots suggested the involvement of a 53-kDa
protein in the AT1a-R promoter function in PC12 cells. We showed in a
previous study (7) that the expression of the AT1-R is very
low in PC12 cells: the mRNA level was detectable only by the reverse
transcriptase-PCR method, not by the Northern blot, and the AT1-R
protein was not quantified by the binding assay. Sumners et al.(28) have reported using the neonatal rat brain, that
glial cells predominantly express AT1-R, whereas neurons contain a
small amount of AT1-R. We also found that the promoter region of the
rat AT1a-R gene contains a positive cis-regulatory element active only
in glial and PC12 cells (7) , suggesting that the regulatory
mechanism of rat AT1a-R gene expression may differ between the central
and peripheral tissues. The finding that a nuclear protein bound to the
NRE in the brain, but not in vascular smooth muscle cells, glial cells,
the spleen, kidney, adrenal gland, and liver, also supports this
contention. The expression of the AT1a-R gene is also inhibited in the
adrenal gland and the pituitary gland, in which the AT1b-R subtype is
predominant. The 53-kDa protein was not detected in the adrenal gland,
suggesting that other regulatory mechanisms to suppress the AT1a-R gene
transcription may function in these tissues. Since the NRE has only a
2-3-fold effect in inhibiting the AT1a-R promoter activity and no
effect on the heterologous promoter, the inhibitory action of the
53-kDa protein may not be sufficient to determine the neuron-specific
down-regulation or tissue-specific regulation of the AT1a-R gene.
Recent evidence demonstrates that the blood pressure is effectively
reduced in the AT1a-R knock-out mice(29) . The cloning of a
gene encoding the 53-kDa protein bound to the NRE may help the
isolation of a novel nuclear protein that moderately reduces blood
pressure by inhibiting the expression of the AT1a-R gene.
Volume 270,
Number 41,
Issue of October 13, 1995 pp. 24282-24286
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
)cDNAs have been cloned from rat vascular
smooth muscle cells(3) , bovine adrenal zona glomerular
cells(4) , and rat kidney(5) . Angiotensin II mRNA is
expressed in a variety of cells and tissues including vascular smooth
muscle cells, liver, kidney, and spleen, while the mRNA abundance is
low in other tissues such as heart, brain, thymus, and testis. AT1a-R
gene expression is regulated in an ontogenic manner(6) . Thus,
the rat AT1a-R gene is cell-specifically and developmentally regulated.
Gel Retardation Assays
The gel retardation assay
was performed and nuclear extracts from culture cells were prepared as
described in (8) . The final protein concentration was
1-0.5 mg/ml. Nuclear extracts from the rat brain, liver, adrenal
gland, and kidney were prepared essentially as reported by Gorski et al.(9) . The final protein concentration was
1-2 mg/ml.
-P]dCTP using Klenow
fragment (Takara Shuzo, Kyoto, Japan) and purified as
reported(8) . Oligonucleotides corresponding to the NRE
(5`-TAATCTTTTATTTTA-3`), mutation 1 (5`-TAATATTTTCTTTTA-3`), and
mutation 2 (5`-TAATCGGGGATTTTA-3`) were synthesized, labeled with
[
-
P]ATP using T4 polynucleotide kinase
(Takara Shuzo, Kyoto), and annealed to make double-strand DNA. Nuclear
extracts were incubated for 15 min on ice in a 30-µl reaction
mixture containing 12 mM Hepes, pH 7.9, 60 mM KCl,
0.1 mM EDTA, 0.5 mM dithiothreitol, 0.5 mM
phenylmethylsulfonyl fluoride, 12% glycerol, and 2 µg of
double-stranded poly(dI-dC) in the presence or absence of excess
competitor DNA. A radiolabeled DNA probe was added (0.1
0.5 ng;
15,000 cpm), and the incubation was continued for 30 min at room
temperature. Thereafter, the mixture was loaded on a 6% polyacrylamide
gel in 1
TBE (90 mM Tris-HCl, pH 8.0, 89 mM boric acid, 2 mM EDTA), and electrophoresed at 140 V for
3 h followed by autoradiography.DNase I Footprint Analysis
DNase I footprinting
was performed using a modification of the procedure described in (8) . The 159-bp NRE fragment (nt -489 to -331) was
labeled only at the XhoI site (Fig. 2A) or BssHII site (Fig. 2B) in the polylinker site
of the pBluescript vector with Klenow fragment and
[-P]dCTP, then digested with HindIII (sense probes). The sizes of these sense probes were
159 and 211 bp, respectively. To obtain the antisense probe, the NRE
fragment was subcloned into pGEM vector and labeled at the NotI in the polylinker site of the vector. After gel
purification, the probe (
40,000 cpm) was incubated with nuclear
extracts in 100 µl containing 12 mM Hepes, pH 7.9, 60
mM KCl, 4 mM MgCl2, 0.1 mM EDTA, 0.5
mM dithiothreitol, 0.5 mM phenylmethylsulfonyl
fluoride, 10% glycerol, and 4 µg of dI-dC. The mixture was
incubated for 30 min at room temperature, then 50 µl of 12 mM Hepes, pH 7.9, containing 5 mM CaCl
, 5
mM MgCl, and 5 ng (Fig. 2A) or 20
ng (Fig. 2B) of DNase I (Life Technologies, Inc.) was
added and the incubation continued for 1 min at room temperature (Fig. 2A) or 15 °C (Fig. 2, B and C). The reaction was stopped with 100 mM Tris-HCl, pH
8, 100 mM NaCl, 1% sodium Sarkosyl, 10 mM EDTA, and 1
µg/ml tRNA. The DNA was extracted with phenol-chloroform,
precipitated with ethanol, and separated on a 6% polyacrylamide, 8 M urea sequencing gel. To define the position of the protected
region, G + A sequence ladders were prepared(8) .
Plasmid Construction
A chloramphenicol
acetyltransferase (CAT) plasmid with the 159-bp NRE fragment
(-489 to -331) deleted was constructed as follows. The AT1a
331-CAT construct (7) was digested with HindIII at the
5`-end of the 331 bp of 5`-flanking region, blunt-ended with Klenow,
and further digested with ClaI at the upstream linker site in
the Bluescript vector. The 5`-flanking region (-980 to
-489) was obtained from AT1a 980-CAT (7) by digestion
with ClaI and XhoI, the 3`-end of which was
blunt-ended with Klenow and subcloned between the ClaI and
blunt-ended sites of the AT1a 331-CAT construct.
-galactosidase genes into PC12
cells. The CAT activity levels were normalized with -galactosidase
activities and protein contents, and expressed as relative values to
those of the promoterless CAT construct. For quantitative comparison,
the relative value of the wild AT1a 980-CAT construct in PC12 cells is
assigned a value of 1.0. The mean activities and the standard error of
the mean from six separate assays are presented. Analysis of variance
and the Dunnet's test were used for multigroup comparisons. *, p < 0.01 versus value of wild CAT construct in
PC12 cells.
Southwestern (DNA-Protein) Blotting
Southwestern
blotting proceeded as follows. Crude nuclear extracts (50 µg of
protein each) mixed with 2.5% SDS, 2.5 mM Tris-HCl, pH 6.8,
100 mM dithiothreitol, 10% glycerol, 0.025% pyronin Y for 5
min at room temperature were separated by SDS-PAGE (10% polyacrylamide)
and blotted onto a nitrocellulose membrane. The membrane was incubated
in binding buffer (10 mM Hepes, pH 8.0, 100 mM KCl,
10 mM MgCl, 0.1 mM EDTA) containing 5%
nonfat dried milk for 30 min at room temperature, and then in the same
buffer containing salmon sperm DNA (300 µg/ml), 0.5% nonfat dried
milk, and P-labeled probe (1
10
cpm/ml) for 1 h at 30 °C. After washing three times for 10
min at room temperature in the binding buffer, the membrane was exposed
to x-ray film.DNA Transfection and CAT Assay
Plasmids were
banded in CsCl before transfection. Fifteen µg of CAT constructs
were transfected into PC12 or glial cells by means of calcium
phosphate/DNA precipitation as reported(7) . CAT activity was
determined by a dual phase diffusion assay that relies on the direct
diffusion of 
C-labeled acetylchloramphenicol into liquid
scintillation counting fluid(7) . During each procedure, 5
µg of Rous sarcoma virus -galactosidase was co-transfected.
CAT activity was normalized for transfection efficiency by means of the
-galactosidase activity and for cell density by the protein
concentration(7) , and expressed as a relative value to that of
the promoterless CAT construct. All transfection studies were
separately repeated six times.Cell Culture
Rat vascular smooth muscle cells were
isolated from adult male Wistar rats by the method of Chamly et al.(11) , A10 (Dainippon Pharmaceutical, Osaka, Japan), glial
cells prepared from neonatal Wistar rat brains(7) , and PC12
cells (RIKEN Cell Bank, Tsukuba, Japan) were cultured in
Dulbecco's modified Eagle's medium containing 10% fetal
calf serum, 10% horse serum (only for PC12 cells), 100 units/ml
penicillin G, and 100 µg/ml streptomycin as reported(7) .Reagents and Statistical Methods
All reagents were
purchased from Sigma unless otherwise indicated below. Results are
expressed as mean ± S.E. Analysis of variance and the
Dunnet's test were used for multigroup comparisons(12) .
Values of p < 0.05 were considered significant.
Gel Retardation Analysis of Negative Cis-regulatory
Element
Our previous study demonstrated that three positive
cis-regulatory elements and one strong NRE are present in the 980-bp
5`-flanking region of the rat AT1a-R gene(7) . However, the NRE
core sequence has not been mapped and the trans-acting factor has not
been identified.
to 100 molar excess was the
competitor.
Mapping the Core Sequence of the NRE
To better
define the protein-binding site in the region responsible for the
transcriptional inhibition, the NRE fragment (nt -489 to
-331) was analyzed by DNase I footprinting using a nuclear
extract from PC12 cells. A protected region between nt -456 and
-442 (5`-TAATCTTTTATTTTA-3`) was detected when a sense strand of
the NRE fragment was labeled (Fig. 2A). Since the
protected region was at the very end of the tested fragment, we
extended the 5` end of the NRE fragment by 52 bp using the nucleotide
sequences of the vector and move the protected region to the middle of
the gel. As shown in Fig. 2B, a protected region was
identical to that observed in Fig. 2A, and other
protected regions were not clearly characterized in this study. To
confirm the sequences protected by the sense probes (Fig. 2, A and B), an antisense strand of the NRE fragment was
used as a probe and partially digested with DNase I. Fig. 2C shows that the nucleotide sequences between -456 and
-442 were protected, which corresponded to the region identified
by the sense probes.
). B, the NRE fragment (nt -489 to
-331) and the oligo-NRE (nt -456 to -442) were used
as the probes and the competitors, respectively, and incubated with
nuclear extract (2 µg) from PC12 cells. Arrows indicate
the retarded products specifically bound to the
probe.
Site-directed Mutagenesis of the NRE
Two sets of
mutations were designed within the NRE core sequence; one (oligo-NRE
mutation 1) was mutated at -452 and -447 and the other
(oligo-NRE mutation 2) at -451 to -448 (Fig. 5A). Gel retardation analyses using oligo-NRE
mutation 1 as a probe showed that the mutation had no effect on
protein/oligo binding, whereas an oligo-NRE mutation 2 probe
efficiently reduced it (Fig. 4B). Next, we examined
whether the oligo-NRE mutation 2 interferes with the wild-type
oligo-NRE binding to the nuclear protein. As shown in Fig. 4C, mutation 2 had no effect on the
protein/wild-oligo interaction. These results confirmed the assignment
of this band to the oligo-NRE, and demonstrated that the
TT
T
T
sequences
in the middle of the NRE core sequence are important for the
protein/DNA binding.
Functional Significance of the NRE in Transcriptional
Regulation
We previously showed that the NRE fragment (nt
-489 to -331) inhibits the transcriptional activity of the
promoter region between -489 and -1 about
10-fold(7) . Since the relatively strong positive
cis-regulatory element was located between nt -560 to -489 (7) , we examined the inhibitory effect of the NRE fragment on
the 980 bp of promoter region using the NRE fragment-deleted CAT
construct. The CAT activity was normalized for transfection efficiency
by means of the co-transfected -galactosidase gene and for cell
density by the protein concentration, and expressed as a relative value
to that of the promoterless CAT construct(7) . The obtained
relative CAT value of the wild AT1a 980-CAT construct in PC12 cells was
arbitrarily assigned a value of 1.0 for quantitative comparison. The
results showed that deleting the NRE fragment from the promoter region
yielded about a 2.7-fold increase (p < 0.01, n = 6) in the relative CAT activity (Fig. 5B). In addition, we constructed an oligo-NRE
mutation 2 in the 980 bp of promoter region, and fused it to the CAT
gene. As shown in Fig. 5B, the relative CAT activity
significantly (p < 0.01, n = 6) increased
about 2.2-fold compared with the CAT construct containing the wild NRE,
indicating the functional significance of the NRE core sequence in the
transcriptional inhibition of PC12 cells.Southwestern Blots of the Trans-acting Factor in PC12
Cells
To characterize the binding factor, the nuclear extract
from PC12 cells was resolved by SDS-PAGE and Southwestern blotted with
the P-labeled NRE 159-bp fragment or oligo-NRE probes. As
shown in Fig. 6, three binding proteins with different molecular
sizes (53, 35, and 33 kDa) were detected by the NRE fragment probe,
while the oligo-NRE probe bound to a single protein (53 kDa). These
bands disappeared in the presence of excess cold probe and the
oligo-NRE mutation 2 (Fig. 5A) probe did not bind to
any protein. On the other hand, the nuclear extract from glial, A10
cells, or vascular smooth muscle cells did not contain the protein
bound to the NRE fragment and oligo-NRE (data not shown). We also
examined the presence of this nuclear protein in the rat brain, liver,
spleen, adrenal gland, and kidney using oligo-NRE as a probe. A single
band corresponding to the 53-kDa protein was found in the nuclear
extract from the rat brain, but not in the liver, spleen, adrenal
gland, and kidney (data for rat brain are shown). Thus, we concluded
that the 53-kDa protein specifically binds to the NRE core sequence.
The other bands (35 and 33 kDa) detected by the NRE fragment probe may
reflect the trans-acting proteins bound to the region other than the
NRE core sequence, or the proteins nonspecifically bound to this DNA
fragment.
P-labeled
NRE fragment (159 bp, nt -489 to -331), oligo-NRE (nt
-456 to -442,) or oligo-NRE mutation 2 (Fig. 5)
probes. The unlabeled NRE and wild oligo-NRE were used as competitors.
The arrow indicates the 53-kDa protein specifically bound to
the probe. Films were exposed for 7 (PC12 cells) or 30 days (rat brain)
at -80 °C with intensifying screens. Size markers are
indicated in kDa on the left side of
gels.
Action of the NRE Fragment upon a Heterologous
Promoter
To test whether the NRE fragment could regulate a
heterologous promoter, the fragment was subcloned upstream of the
thymidine kinase (TK) promoter fused to the CAT gene. In transient
assays using PC12 cells, the expression of the fusion gene containing
the TK promoter alone appreciably increased compared with the TK-less
CAT gene. When the 159-bp NRE fragment was added to the TK-CAT
construct and transfected into PC12 cells, the CAT activity was
unaffected, although the NRE fragment was placed immediately upstream
of the TK gene (Fig. 7). These results suggested that the NRE
sequence acts as a negative regulatory element of the rat AT1a gene,
rather than as a silencer element, and that it works in junction with
the native, rather than the heterologous promoter.
-galactosidase activities and protein contents,
and expressed as relative values to those of the promoterless CAT
construct (bottom). For quantitative comparison, the relative
value of the promoterless CAT construct is assigned a value of 1.0. Arrows indicate the transcription initiation sites. The
experiments were separately repeated five times and the results were
shown in the mean ± S.E.
)
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  H. Lu, C. M. Boustany-Kari, A. Daugherty, and L. A. Cassis Angiotensin II increases adipose angiotensinogen expression Am J Physiol Endocrinol Metab, May 1, 2007; 292(5): E1280 - E1287. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. E. Thomas and T. J. Thekkumkara Glucose Mediates Transcriptional Repression of the Human Angiotensin Type-1 Receptor Gene: Role for a Novel Cis-acting Element Mol. Biol. Cell, October 1, 2004; 15(10): 4347 - 4355. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Wong, N. R. Mahapatra, S. Chitbangonsyn, P. Mahboubi, M. Mahata, S. K. Mahata, and D. T. O'Connor The angiotensin II receptor (Agtr1a): functional regulatory polymorphisms in a locus genetically linked to blood pressure variation in the mouse Physiol Genomics, June 24, 2003; 14(1): 83 - 93. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Moriguchi, H. Matsubara, Y. Mori, S. Murasawa, H. Masaki, K. Maruyama, Y. Tsutsumi, Y. Shibasaki, Y. Tanaka, T. Nakajima, et al. Angiotensin II–Induced Transactivation of Epidermal Growth Factor Receptor Regulates Fibronectin and Transforming Growth Factor-ß Synthesis via Transcriptional and Posttranscriptional Mechanisms Circ. Res., May 14, 1999; 84(9): 1073 - 1084. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Matsubara Pathophysiological Role of Angiotensin II Type 2 Receptor in Cardiovascular and Renal Diseases Circ. Res., December 14, 1998; 83(12): 1182 - 1191. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Mori, H. Matsubara, S. Murasawa, K. Kijima, K. Maruyama, H. Tsukaguchi, N. Okubo, T. Hamakubo, T. Inagami, T. Iwasaka, et al. Translational Regulation of Angiotensin II Type 1A Receptor: Role of Upstream AUG Triplets Hypertension, November 1, 1996; 28(5): 810 - 817. [Abstract] [Full Text]
|
|
|
|
|
|
K. Kijima, H. Matsubara, S. Murasawa, K. Maruyama, Y. Mori, N. Ohkubo, I. Komuro, Y. Yazaki, T. Iwasaka, and M. Inada Mechanical Stretch Induces Enhanced Expression of Angiotensin II Receptor Subtypes in Neonatal Rat Cardiac Myocytes Circ. Res., October 1, 1996; 79(4): 887 - 897. [Abstract] [Full Text]
|
|
|
|
 |
|
 S. Murasawa, H. Matsubara, Y. Mori, H. Masaki, Y. Tsutsumi, Y. Shibasaki, I. Kitabayashi, Y. Tanaka, S. Fujiyama, Y. Koyama, et al. Angiotensin II Initiates Tyrosine Kinase Pyk2-dependent Signalings Leading to Activation of Rac1-mediated c-Jun NH2-terminal Kinase J. Biol. Chem., August 25, 2000; 275(35): 26856 - 26863. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
ABSTRACT
