Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, K.-I.
Right arrow Articles by Reddy, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, K.-I.
Right arrow Articles by Reddy, C. D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 41, Issue of October 13, 1995 pp. 24502-24508
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Cellular Factors Binding to a Novel cis-Acting Element Mediate Steroid Hormone Responsiveness of Mouse Mammary Tumor Virus Promoter (*)

(Received for publication, May 18, 1995; and in revised form, August 9, 1995)

Kyong-Il Lee ,  E. Premkumar Reddy (§),  ,  C. Damodara Reddy

From the Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, Philadelphia, Pennsylvania 19140

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

Steroid hormone receptors regulate mouse mammary tumor virus (MMTV) gene expression by binding to hormone response DNA elements present in the long terminal repeat. Tissue-specific expression of MMTV is unlikely to be regulated by steroid hormone-receptor complex alone, and mammary cell-specific factors might play a role in the hormone-induced transcriptional activation. In this report we have investigated the function of a novel cis-acting element designated Kil (-204 to -188) which is located adjacent to the distal glucocorticoid response element, in steroid hormone-induced transcription of MMTV. Electrophoretic mobility shift assays indicate that cellular factors bind to the Kil element, and dexamethasone stimulation results in alterations in the binding pattern of proteins in this region. By transient transfection assays using wild type and deletion mutants of the Kil element, we show that this novel cis-acting element is necessary for hormone-induced transcription of MMTV and functions in mammary tumor cells but not in NIH/3T3 cells. Mutagenesis of the Kil sequence suggests that the entire Kil element functioning as one unit is necessary for hormone-induced transcription of MMTV. When placed in the context of heterologous promoters, neither Kil element nor glucocorticoid response element is able to induce significant hormone-induced transcription of MMTV. The presence of both the DNA elements in tandem results in optimal induction of transcription in the presence of steroid hormones. Our results also indicate that the Kil element functions in human breast carcinoma cell lines such as T47D and MCF-7. These results suggest that Kil element in combination with distal glucocorticoid response element functions as a mammary cell-specific enhancer to regulate MMTV transcription.

INTRODUCTION

Steroid hormone receptors are cytoplasmic proteins, which, upon binding to their ligands, translocate into the nucleus and bind to DNA elements in a sequence-specific manner and modulate the transcription of cellular genes(1) . Transcription from the long terminal repeat (LTR) (^1)of mouse mammary tumor virus (MMTV) has been used extensively to understand the regulation of gene expression by steroid hormones. Glucocorticoids, progesterones, and androgens induce the transcription of MMTV (2, 3, 4) upon binding of their respective receptors to the hormone response elements. These elements are located between -202 and -59 bases upstream of the transcription initiation site in the MMTV promoter, which can be divided into the proximal and distal glucocorticoid response elements (GREs). The GRE consists of four repeats of the hexanucleotide 5`-TGTTCT-3` to which the steroid hormone receptors were shown to bind and exert their effects on transcription. The proximal glucocorticoid responsive element (GRE) contains three repeats of the hexanucleotide, while the distal GRE (-188 to -170) contains only one of the hexanucleotide.

Apart from steroid hormone-receptor complex, which is a major determinant of MMTV transcription, cellular factors have been implicated in determining this tissue specificity(5, 6, 7) . Growing evidence suggests that there exists functional interaction between hormone receptor molecules and other cellular transcription factors. A direct physical interaction of glucocorticoid receptor (GR) with transcription factors such as the p65 subunit of NF-kappaB(8) , Ets related factor(9) , octamer transcription factor 1(10) , Spi-1(11) , and SWI1 proteins (12) have been shown to modulate glucocorticoid receptor function. Transcription factors such as NF-1 (13) and Oct-1 (14, 15) which bind close to proximal GRE sites seem to modulate the MMTV promoter transcription. The glucocorticoid receptor bound to the distal GRE site (-186 to -170) of the MMTV LTR was found to cooperate with other binding sites to which transcription factors such as NF-1, octamer transcription factor (Oct-1), SP1, and CACCC box binding factor (15, 16, 17) were shown to bind. This synergism between the GRE and other cis-regulatory elements has been found to be dependent on the nature of the cells used, suggesting that different nuclear factors present in different cell types contribute to the tissue-specific expression of MMTV. In this respect, it is interesting to note that a majority of MMTV proviruses that cause T-cell lymphomas have alterations in the sequence near the distal GRE(18, 19, 20, 21, 22) , and these deletions or alterations seem to confer increased levels of LTR-directed transcription even in the absence of glucocorticoid hormones. It has been suggested that these deletions might result in an MMTV that allows preferential viral expression in T-cells (23) in the absence of hormonal stimulation. In addition, MMTV provirus DNA isolated from a kidney adenocarcinoma also contains alterations in this region(24) . Thus, an alteration in the U3 region (-350 to -186) of the viral LTR appears to alter the target cell specificity suggesting that this region might contain sequence elements for binding of mammary cell-specific factors.

In this report, we describe the identification of a novel cis-acting regulatory sequence within the MMTV promoter which is subject to frequent alterations in mutant MMTV proviral DNAs found in T-cell and kidney tumors. This sequence, designated as Kil, is located between -204 and -188 of the LTR, adjacent to the distal GRE. Electrophoretic mobility shift assays of the probes derived from this region indicate that cellular factors bind to this region and that the binding is modulated by the action of steroid hormones. Functional analysis by transient transfection assays in mouse and human cell lines indicates that this sequence is essential for hormone-dependent transcriptional activation of MMTV promoter. Hence, the distal GRE, in combination with the Kil site, function as an inducible enhancer.

MATERIALS AND METHODS

Plasmid Constructs

Wild type (Wt) MMTV promoter (-421 to +126) from GR MMTV LTR (25) was generated by PCR using two primers, M-XhoI (5`-CCCTCGAGCTAGACCTCCCTTGGTGT-3`) and MR-HindIII (5`-AAAAGCTTAGTCGGCCGACCTGAGG-3`). The resulting PCR product containing the 546-base pair MMTV promoter was cloned at 5` HindIII and 3` XhoI sites into a CAT vector designed to assess the function of promoter elements to produce the wild type MMTV-CAT. The sequence of the PCR fragment was verified by nucleotide sequence analysis. The mutants were constructed by overlap extension with the PCR method as described by Ho et al.(26) . The following oligonucleotides were used for the mutagenesis. Mt: MRX, 5`-AAGAACAGTTTGTAACCATGGGAACCGCAAGGTTGG-3`, and M-H, 5`-CCAACCTTGCGGTTCCCATGGTTACAAACTGTTCTT-3`; M1: M1-KIL-R, 5`-TAAACTTATTTCCCGGG TGGGAACCGCAAGGTTGG-3`, and M1-KIL-F, 5`-CCCGGGAAATAAGTTTA TGGTTACAAACTGTTCTT-3`; M2: M1-KIL-R, 5`-ACTAGTTATTTAAACCC TGGGAACCGCAAGGTTGG-3`, and M1-KIL-F, 5`-GGGTTTAAATAACTAGT TGGTTACAAACTGTTCTT-3`; M1.2: M1-KIL-R, 5`-ACTAGTTATTTCCCGGG TGGGAACCGCAAGGTTGG-3`, and M1-KIL-F, 5`-CCCGGGAAATAACTAGT TGGTTACAAACTGTTCTT-3`; Mu: M1-KIL-R, 5`-ACTAGTTATACTAGTCC TGGGAACCGCAAGGTTGG-3`, and M1-KIL-F, 5`-GGACTAGTATAACTAGT TGGTTACAAACTGTTCTT 3`.

The following is the sequence of various mutants of the Kil region in MMTV promoter confirmed by nucleotide sequencing.

CCCAAATTTATTCAAAT

Wt-Kil

GGGCCCTTTATTCAAAT

M1-Kil

CCCAAATTTATTGATCA

M2-Kil

GGGCCCTTTATTGATCA

M1.2-Kil

CCTGATCATATTGATCA

Mu-Kil

The following is the sequence of oligonucleotides cloned at the HindIII and XbaI sites of E1b-CAT vector so that these can be end labeled by Klenow enzyme and used in the mobility shift assay experiments.

3` AGGGTCCCAAATTTATTCAAATACAGATC 5`

Kil sequence

3` ACAATGTTTGACAAGAATTTTGCGAGATC 5`

GRE sequence

5` AGGGTCCCAAATTTATTCAAATTACCAATGTTTGACAAGAATTTTGCGAGATC 3`

Kil-GRE sequence

Cell Culture and Steroid Hormone Induction

GR cells (a mouse mammary tumor cell line which expresses MMTV) were grown in DMEM with 10% charcoal-treated fetal bovine serum (HIDCC-FBS). The cells were left in serum-free medium for 12 h and treated with 1 times 10M concentration of dexamethasone (Sigma) in DMEM containing 10% charcoal-treated fetal bovine serum. After 24 h, cells were harvested for preparing either whole cell extract or nuclear extracts. Charcoal-treated serum was prepared as described previously(27, 28) . The human breast carcinoma cell lines T47D and MCF-7 were grown in DMEM with 10% fetal bovine serum. For hormone induction, the cells were grown in charcoal-stripped fetal bovine serum for 16 h and stimulated with 10M concentration of the respective hormones. Dexamethasone and progesterone were purchased from Sigma.

Preparation of Nuclear Extracts and Whole Cell Extracts

The nuclear extracts were prepared from 1 times 10^9 cells by the method of Dignam et al.(29) with minor modifications. Following were the buffers used to make the nuclear extracts: buffer A (10 mM Tris-HCl, pH 7.5, 2 mM MgCl(2), 3 mM NaCl, 0.2% Nonidet P-40, 0.5 mM DTT, 0.5 mM PMSF, 2 µg/ml leupeptin, 2 µg/ml aprotinin), buffer B (10 mM Tris-HCl, pH 7.5, 0.5 mM DTT, 0.5 mM PMSF), buffer C (10 mM Tris-HCl, pH 7.5, 2 mM MgCl(2), 0.5 mM DTT, 0, 1 mM PMSF), and buffer D (10 mM Tris-HCl pH 7.5, 80 mM NaCl, 3 mM MgCl(2), 0.1 mM EDTA, 1 mM DTT, 1 mM PMSF, 10% glycerol). Whole cell extracts were prepared as described previously(30) .

Electrophoretic Mobility Shift Assays (EMSA)

E1b-CAT plasmids containing Kil, GRE, or Kil-GRE sites were digested with HindIII and labeled at this end with Klenow enzyme using [alpha-P]dCTP, and the labeled oligonucleotide was released by digesting with XbaI and purified on polyacrylamide gel. Different concentrations of whole cell extracts were incubated with end-labeled probe, and 1 µg of poly(dI-dC) in 30 µl of binding buffer (10 mM Tris-HCl, pH 7.5, 80 mM NaCl, 3 mM MgCl(2), 0.1 mM EDTA, 1 mM DTT, 1 mM PMSF, 5% glycerol). After a 30-min incubation at room temperature, the DNA-protein products were separated on 6% nondenaturing polyacrylamide gels.

CAT Assays

For transient transfections, 1 times 10^5 cells (GR, NIH/3T3, MCF-7, and T47D) were grown in DMEM containing 10% charcoal-treated fetal bovine serum (HIDCC-FBS). The next day, the cells were transfected with 10 µg of wild type and mutant MMTV LTR-CAT reporter plasmids using the calcium phosphate precipitation method(31) . After 16 h, the calcium phosphate was washed and the cells were left in serum-free medium for 12 h. At this point, the cells were treated with medium containing charcoal-treated serum, and the respective plates were treated with 1 times 10M concentration of the steroids. Sixteen hours later, the samples were harvested and assayed for CAT activity. Charcoal-treated serum was used in all the experiments involving the induction with hormones. Assay of CAT activity was performed as described previously(32) . Transfection efficiency was monitored by transfecting Rous sarcoma virus-beta-galactosidase plasmid as a control. Protein concentration was determined by the colorimetric method (Bio-Rad), and equal amounts of protein (corresponding to equal amounts of beta-galactosidase activity) from each sample was used in the CAT assays. The results of CAT activity was expressed as either relative CAT activity or fold increase in CAT activity, and the numbers represent the average of three independent experiments.

RESULTS

Dexamethasone Stimulation Results in Alterations in the DNA Binding Activity of Cellular Factors Near the Distal GRE Region

Fig. 1A provides a schematic representation of MMTV promoter. The position of transcription start site as well as proximal and distal GRE elements and the NF-1 and Oct-1 sites are indicated. Earlier workers have observed the DNase footprint using mouse liver nuclear extracts, and the protected area was from -206 to -170 upstream of transcription(33) . Competition experiments for the DNase footprinted region using different parts of the protected sequence (-206 to -189) showed that the nuclear factor binding to the 5` part of the footprinted region was distinct from glucocorticoid receptor binding(34, 35) . Interestingly, this region is subject to frequent alterations or deletions in kidney carcinoma (24) and in certain leukemias that arise in GR mice(18, 19, 20, 21, 22, 35) . In view of these observations, we have investigated whether induction of MMTV transcription by steroid hormone results in any alterations in the DNA binding activity of proteins in this region. We synthesized oligonucleotides corresponding to this region and used in the electrophoretic mobility shift assays with whole cell extracts from GR cells. In addition, we made the oligonucleotides corresponding to distal GRE alone and an oligonucleotide that spans both the distal GRE and the sequence that spans -204 to -188. We compared the binding pattern of whole cell extracts made from GR cells treated with and without dexamethasone. When the sequence from -204 to -188 was used in mobility shift assays with whole cell extracts, we could not detect any significant binding in the absence or presence of dexamethasone (Fig. 1B, lanes 2 and 3). It has been shown earlier that glucocorticoid receptors do not bind to these sequences. However, we could detect one shifted complex with GRE sequence in the presence or absence of dexamethasone (Fig. 1B, lanes 5 and 6) suggesting that the hormone receptors in the whole cell extracts bind to the GRE. Interestingly, when the -204 to -170 sequence was used as a probe in electrophoretic mobility shift assay, a similar band was observed with uninduced extracts (Fig. 1B, lane 9, complex C). However, when extracts from dexamethasone-treated cells were used in these assays, a new complex with a slower mobility was detected (Fig. 1B, lane 8, complex B). The supershifted complex could be due to the association of glucocorticoid receptor with proteins that require the presence of two elements composed of distal GRE and the adjacent 5` sequences (-204 to -188), referred to as Kil. We have performed the competition experiments using homologous and heterologous oligonucleotides to assess the specificity of complex B. Neither Kil alone nor GRE alone were effective in these competition experiments, whereas Kil-GRE effectively competed away the complex B. These results suggest that hormone treatment results in induction of novel nuclear factors or modification of pre-existing factors that specifically interact with the Kil-GRE sequence. Since previous studies have shown that purified GR does not bind to Kil sequences(34) , but binds to the GRE consensus sequence, we could conclude that GR binds to the Kil sequence indirectly in association with other nuclear factor(s).

Figure 1: A, schematic representation of the mouse mammary tumor virus long terminal repeat sequences. Three proximal GRE (-120 to -89) and the distal glucocorticoid response elements (-186 to -170) are indicated. The binding sites for NF-1 and Oct-1 sites near the TATA box are shown. The region which is subject to frequent changes in variant MMTV proviruses associated with T-cell and kidney tumors is shown by arrows. The Kil sequence (-204 to -188) and distal GRE sequences are shown below. B, electrophoretic mobility shift assay of Kil, GRE, and Kil-GRE probes with whole cell extracts from GR cells, uninduced or induced by dexamethasone. Lane 1 indicates the labeled Kil probe alone; lane 2 represents the Kil probe incubated with whole cell extract derived from dexamethasone-induced GR cells, while lane 3 shows uninduced GR cells. Lane 4 represents GRE probe alone, while lanes 5 and 6 represent GRE probe incubated with dexamethasone-induced and uninduced extracts. Lane 7 represents free Kil-GRE probe, while lanes 8 and 9 show Kil-GRE probe incubated with dexamethasone-induced and uninduced whole cell extracts, respectively. Note the altered slower mobility of complex B (induced extract) compared to complex C (uninduced extract).


Transient Transfection Studies Indicate That Kil Element Is Necessary for Steroid Hormone-induced Transcription of MMTV

To test if the protein factors binding to the Kil sequence are functionally significant for hormone induction and tissue-specific transcription of the MMTV promoter, we performed transient transfection experiments in mouse and human cell lines. Transient transfections were performed using the wild type (Wt) MMTV-CAT and the mutant (Mt) MMTV-CAT (the sequences -204 to -188 corresponding to Kil are deleted) reporter plasmids (Fig. 2A). These vectors were transfected into GR cells in which hormone (dexamethasone) induction of the MMTV promoter can be assessed easily. Following induction with dexamethasone, cell lysates were prepared and assayed for CAT activity. Results presented in Fig. 2B indicate that dexamethasone stimulated the transcription from the Wt-MMTV LTR by 4- to 5-fold in GR cells (lanes 2 and 3). However, deletion of the Kil sequence from the LTR resulted in the loss of hormone-induced transactivation (lanes 4 and 5), suggesting that the Kil sequence is critical for hormone-induced transcription.

Figure 2: A, schematic representation of the wild type MMTV-CAT and Kil deletion mutant used in the transactivation experiments. The wild type plasmid (Wt) contains MMTV LTR sequences from -421 to +126 base pairs linked to the CAT gene. In the mutant MMTV-CAT, the Kil sequences (-204 to -188) are deleted. B, deletion of Kil sequence affects the dexamethasone-stimulated transcription of MMTV in mouse cells. GR cells were transfected with wild type and mutant (Kil-deleted) MMTV-CAT, and the CAT activity was assayed 36 h after transfection. Wt represents the wild type MMTV and Mt the deletion mutant (-204 to -188). GR is the mouse mammary carcinoma cell line.(-) and (+) represent without and with dexamethasone treatment. C, dexamethasone is unable to induce MMTV-CAT transcription in NIH/3T3 cells. NIH/3T3 cells were transfected with wild type and mutant (Kil-deleted) MMTV-CAT, and the CAT activity was assayed 36 h after transfection. Wt represents the wild type MMTV and Mt the deletion mutant (-204 to -188).(-) and (+) represent without and with dexamethasone treatment.


To examine whether the observed transcriptional activation is tissue-specific, we transfected wild type and mutant vectors into NIH/3T3 cells and studied the induction of CAT activity in the presence and absence of dexamethasone. Results presented in Fig. 2C show that dexamethasone treatment of NIH/3T3 cells fails to induce MMTV transcription beyond the basal levels (Fig. 2C, lanes 2 and 3). When the Kil sequence was deleted, considerable reduction in the basal levels of CAT activity was observed (Fig. 2C, lanes 4 and 5) which did not increase with hormone treatment. These results suggest that dexamethasone might induce or associate with cellular factors in GR cells but not in NIH/3T3 cells. Absence of hormone induction in NIH/3T3 cells can be attributed to the absence or low levels of steroid receptors in this cell line or it could be due to the absence of specific cellular factor(s) that are induced by dexamethasone. It is possible that dexamethasone-inducible factors are expressed in mammary cell lines but not in fibroblasts.

Kil Element Is Essential for Dexamethasone and Progesterone Response in Human Breast Carcinoma Cell Lines

Progesterone receptors (PR) and glucocorticoid receptors (GR) have been shown to bind to distal GRE and activate the MMTV transcription(36, 37) . To determine if the Kil sequence affects the hormone-induced transcription in human cell lines, we have tested the activity of wild type and mutant MMTV-CAT constructs in T47D (expresses high levels of progesterone receptors) and MCF-7 cells which express significant levels of all the steroid receptors. To test the progesterone inducibility of MMTV-CAT and the synergism of Kil binding factor(s) with PR, we used T47D cells which expresses high levels of progesterone receptors, but low levels of other steroid receptors. Mutant and wild type MMTV-CAT vectors were transfected into these cells and tested for the induction of CAT activity in the presence or absence of PR. Results of these transient transfection experiments revealed that Wt-MMTV-CAT responds very efficiently to progesterone (Fig. 3A, lanes 2 and 4). This induction of CAT activity could not be observed with dexamethasone (Fig. 3A, lane 3). When the Kil deletion mutant was used in these studies, neither progesterone nor dexamethasone was capable of inducing CAT activity (Fig. 3A, lanes 6 and 7). These results indicate that deletion of the Kil sequence abolishes the progesterone-induced transcription activation suggesting that cellular factors binding to Kil sequences confer progesterone responsiveness to the MMTV promoter.

Figure 3: A, steroid hormone-induced MMTV transcription is dependent on the progesterone receptor content in the human breast carcinoma cell line T47D. Transient transfection and CAT assays were performed after transfecting the wild type and mutant MMTV-CAT constructs into the T47D cell line. D and P represent the cells treated with dexamethasone and progesterone, respectively. Mt represents the mutant MMTV-CAT in which the Kil sequences are deleted. CAT activity in cells transfected with beta-galactosidase expression vector alone was taken as one unit and the fold activity was calculated for comparison. B, steroid hormones induce MMTV transcription in MCF-7 cells. Wild type and Kil deletion mutants of MMTV-CAT plasmids were transfected into MCF-7 cells and induced with dexamethasone (D) and progesterone (P) and assayed for CAT activity.


To test if a similar kind of synergism exists between Kil binding proteins and the GR, we have used MCF-7 cells which express significant levels of all the steroid receptors. Wild type and mutant MMTV-CAT constructs were transfected into MCF-7 cells, and the ability of progesterone and dexamethasone to induce MMTV transcription was assayed. In the absence of hormone stimulation, low levels of CAT activity was observed (Fig. 3A, lane 2) and treatment of cells with dexamethasone or progesterone had a strong stimulatory effect on CAT activity (Fig. 3A, lanes 3 and 4). This activity was totally abolished in mutant MMTV-CAT constructs which lacked the Kil sequences (Fig. 3B, lanes 5, 6, and 7). Our results using progesterone and dexamethasone suggest that these hormones activate MMTV transcription and that Kil sequences are essential for this activity in human cell lines and are dependent on the steroid receptor content in the cells(38) . The results indicate that proteins binding to Kil sequences modulate the steroid receptor function and regulate MMTV transcription. It is interesting to note that the basal activity which was detectable in mouse cells, such as GR and NIH/3T3 cells with mutant MMTV-CAT (Kil deleted), could not be detected easily in human breast carcinoma cells.

Mutations in Kil Sequence Affects the Hormone Inducibility of MMTV Promoter

Transient transfections with wild type and deletion mutants suggest that the Kil element plays a critical role in hormone-induced transcriptional activation of MMTV in mouse and human cell lines. It is possible that such a deletion might drastically affect the stereospecific conformation. To rule out this possibility, we introduced mutations in the Kil sequence and assessed the effect of mutations on the hormone-induced transcription. It is interesting to note that a part of the Kil sequence, TAAGTTTA, with one mismatch constitutes the consensus binding site (TACGTTTA) for the transcription factor, Oct-1. To determine the role of this Oct-like sequence as well as the flanking sequence (GGGTTTAAA), we have carried out mutagenesis experiments where we have replaced the sequence GGGTTT with GGGCCC (M1), the putative Oct-1 site -TAAGTTTA- to -TAACTAGT- (M2). In addition, we created two additional mutants in which both M1 and M2 mutations were introduced (M1.2) or the entire Kil sequence was replaced with a random unrelated sequence (Mu). Using transient transfection assays in MCF-7 cells, we tested the effect of these mutations in the Kil site on hormone-induced transcription of MMTV (Fig. 4, A and B). Mutations in the 5` part of the Kil sequence (M1) completely abolished basal activity as well as hormone-stimulated transcription of the MMTV promoter indicating that this region is vital for MMTV LTR-mediated transcription (Fig. 4A, lanes 4, 10, and 16). Mutation of the Oct-1 site (M2) also results in a drastic reduction in the MMTV LTR-mediated transcription, but, unlike the M1 mutant, there was about 10-20% of the activity seen with wild type LTR (Fig. 4A, lanes 5, 11, and 17). These results suggest that the 5`-most part of the Kil sequence is more critical for dexamethasone- or progesterone-induced transcription compared to the 3` part which resembles an octamer-like sequence. Double mutations in both parts of the Kil element completely abolished basal as well as hormone-induced transcription (Fig. 4A, lanes 6, 12, and 18). Likewise, replacement of the Kil sequence with unrelated sequence also resulted in complete abolition of the basal and hormone-induced activity (Fig. 4A, lanes 7, 13, and 19). These results strongly suggest that the sequence integrity of the entire Kil sequence is critical for basal and hormone-stimulated transcriptional activity of the MMTV promoter. Quantitation of the CAT activity obtained with various mutants is represented in Fig. 4B. These results indicate that the 5`-most part of the Kil sequence is more critical compared to the 3` part of the Kil element. Since the central portion of the Kil element resembles the myocyte enhancer binding factor 2 (MEF2) binding site (39) and the 3` part is similar to the octamer site, it is possible that more than one protein binds to the Kil sequence.

Figure 4: A, mutations in the Kil sequence affects the steroid hormone-induced transcription of MMTV in human adenocarcinoma cell line MCF-7 cells. After introducing the mutations in the Kil sequence, the mutants were subcloned at HindIII and XbaI sites of MMTV-CAT and used in the transient transfection experiments in MCF-7 cells. Wt represents the unaltered Kil sequence. Mt represents the Kil deletion (-204 to -188) mutant. M1 represents the mutations in the 5` part of the Kil sequence in which the GGGTTT sequence is changed to CCCGGG. M2 indicates the mutant in which the (Oct-1 like) sequence AGTTTA is mutated to ACTAGT. M1.2 represents the presence of mutations in both the 5` part of the Kil sequence and the Oct-1-like sequence (a combination of both M1 and M2 mutants). Mu represents the presence of an unrelated sequence in place of Kil. Transient transfections were performed in the presence of dexamethasone and progesterone along with the control. B, schematic representation of the fold increase in the CAT activity of various mutants represented in A. The fold increase in CAT activity was calculated in comparison to the untransfected MCF-7 cells as a control which is equivalent to 1. The first set represents the basal activity of various constructs without any hormone treatment. Lanes 2-7 indicate the wild type MMTV-CAT, M1, M2, M1.2, and Mu, respectively. Different hormones used for induction are indicated at the bottom of each set. The fold activity is the average of three independent experiments.


Distal GRE and the Kil Element Function Synergistically in the Context of Heterologous Promoter

We have investigated whether the Kil element and the distal GRE function synergistically if placed upstream of a heterologous promoter. To determine if the minimal region that contains Kil and distal GRE sites can function as an inducible enhancer when placed upstream of heterologous promoters, oligonucleotides containing Kil and GRE sequences together or alone were cloned upstream of the E1b-TATA promoter at the HindIII and XbaI sites (Fig. 5A). These DNA constructs were transfected into GR cells and tested for transcriptional activation in the presence or absence of dexamethasone. When Kil alone or GRE alone was placed upstream of the E1b promoter, we could not detect significant CAT activity (Fig. 5B, lanes 8, 9, 10, and 11). However, when Kil-GRE sites were placed together upstream of the E1b promoter, very low levels of basal transcription were observed (Fig. 5B, lane 2), which was dramatically increased upon treatment of cells with dexamethasone (lane 3). In addition, the presence of serum and dexamethasone had an additive effect on the transactivation potential (lanes 4 and 5) suggesting that nuclear factors binding to the Kil sequence are induced by serum stimulation. These results suggest that the Kil element and the distal GRE unit function synergistically in the context of heterologous promoters and function as an inducible enhancer.

Figure 5: A, schematic representation of the E1b TATA-CAT vector in which the distal GRE and the Kil sequences are cloned at the HindIII and XbaI sites. CAT represents the E1b promoter driving the expression of CAT. Kil-GRE-CAT represents E1b CAT containing both Kil and GRE cloned upstream of E1b CAT at HindIII and XbaI sites. Kil-CAT represents E1b CAT containing only Kil sequences in E1b CAT whereas GRE-CAT indicate only GRE sequences cloned upstream of E1b-CAT at HindIII and XbaI sites. B, synergistic effect of the Kil and GRE sites of the MMTV promoter on the activation of a heterologous promoter E1b-CAT. 10 µg of each construct was transfected into GR cells and later on were subjected to hormone induction in the absence (lane 2) or presence of dexamethasone alone (lane 3) or serum alone (lanes 4, 6, 8, and 10) or dexamethasone and serum (lanes 5, 7, 9, and 11) and harvested after dexamethasone induction. D represents dexamethasone and S represents serum, SD represents serum plus dexamethasone.


DISCUSSION

In this communication, we have identified a novel cis-acting element in the MMTV promoter (5`-GGGTTTAAATAAGTTTA-3`) positioned at -204 to -188, adjacent to the distal glucocorticoid response element (GRE). This sequence, designated as the Kil element, is necessary for hormone-induced transcription of MMTV. Mobility shift assays show that the Kil element is a novel binding site for multiple nuclear factors and is distinct from the GRE site. In addition, our results show that distal GRE in combination with Kil functions as a hormone-inducible enhancer of MMTV transcription in mouse and human cell lines. Comparison of wild type MMTV LTR sequences with variant proviral MMTV LTR isolated from mouse kidney carcinoma indicate that sequences that encompass the Kil site are frequently altered in this region(24) . Frequent alterations or deletion of the Kil sequence was also observed in GR T-cell leukemia-42 and in several T-cell lymphomas that develop in GR mice(18, 19, 20, 21, 22, 35) . While the significance of these alterations is at present unclear, this change in the sequence appears to allow the expression of MMTV promoter-regulated genes in tumors in the absence of steroid hormone stimulation(19) . Our results show that this deleted region contains a cis-acting element which functions in cooperation with distal GRE and confers hormone responsiveness to the MMTV promoter in mammary cell lines.

Purified glucocorticoid receptor has been shown to bind to distal GRE and does not bind to the Kil sequence(33, 34) . DNase footprint experiments by other workers with nuclear extracts show protection of the area from -206 to -170 which consists of the Kil sequence and the distal GRE. To understand the DNA-protein interactions in this region, we have performed mobility shift experiments with whole cell extracts made from unstimulated and dexamethasone-stimulated GR cells using oligonucleotides spanning this region. Our results indicate that an oligonucleotide which contains both the distal GRE and Kil motifs forms a novel protein-DNA complex whose mobility is altered upon dexamethasone stimulation. It is possible that dexamethasone stimulation results in the association of GR with pre-existing or newly synthesized proteins and bind to Kil-GRE. Some of the proteins might be bridging between glucocorticoid receptor occupying the GRE and Kil binding proteins binding to Kil sequences. It is possible that the Kil element is responsible for binding of more than two proteins. This is supported by our mutational data which indicate that the Kil element consists of at least two or three binding sites. The sequence of the 5` end is not similar to any known DNA binding site and is therefore most likely occupied by a novel enhancer binding protein. The central binding site is A/T-rich and is similar to the recognition elements for myocyte-enhancer binding factor 2 (MEF2) or related serum response factor or a closely related protein(39, 40) , but expressed in mammary tissue. The 3` sequence resembles the binding site for Oct-1. These results suggest that multiple proteins might bind to the Kil element and regulate MMTV transcription. Steroid hormone stimulation results in alterations in the binding activity of any of these proteins, and the association of GR with these proteins might result in a multiprotein complex that exerts a strong regulatory influence on induced transcription of MMTV. The identity of the components of this multiprotein complex will provide further information on the protein-protein interactions between the GR bound to the distal GRE and Kil binding proteins.

When the GRE probe was incubated with whole cell extracts, one complex was observed, as the glucocorticoid receptors in the extract bind to the GRE sequence with high affinity. When the Kil site was used as a probe, we could not detect any complex formation, indicating that GR does not bind to the Kil site by itself. This is consistent with an earlier observation that purified GR does not bind to the Kil motif (33, 34) . However, it is interesting to note that some of the nuclear factors that bind to Kil can be competed away with unlabeled GRE (data not shown) suggesting that GR can bind to the Kil site, most likely in association with other nuclear factors. In fact, one such protein, SWI3, has previously been shown to interact with glucocorticoid receptors through its DNA binding domain(12) . This observation provides the possibility that glucocorticoid receptors can interact with unrelated DNA sequences in association with other DNA-binding factors. It is possible that dexamethasone stimulation results in hyperphosphorylation of the glucocorticoid receptors which in turn associate with a different set of transcription factors and bind to the Kil element. Support for this hypothesis comes from the observation that glucocorticoid receptors are hyperphosphorylated in hormone-treated cells(41) .

To understand if alterations in the binding activity near the Kil-GRE has a functional significance, we have systematically analyzed the function of the Kil sequences in hormone-induced transcription of MMTV. Linker scanning mutations carried out by Cato et al.(4) across the length of the MMTV promoter indicated that the region surrounding the distal GRE is important for glucocorticoid and androgen response in T47D cells. When part of this sequence, 5`-GGGTTTAAA-3`, was converted into 5`-CCCGGGAAA-3`, these mutations decreased the glucocorticoid and androgen but not the progesterone response. In addition, earlier studies had indicated that the 5` part of the Kil motif, 5`-TTTAAA-3`, is the binding site for a factor(s) present in MCF-7 cells(42) . In view of these observations and based on our preliminary results, we created mutations in the Kil sequence and performed transient transfections in MCF-7 cells. Our data suggest that the Kil binding site might be composed of at least two or three binding sites (Oct-1 and MEF2). It is possible that the Kil element might be responsible for binding of multiple factors as a complex. The 5` part might serve as a binding site for an unidentified protein. The middle portion of the Kil sequence (TTTAAATAAG) is similar to the MEF2 site (CTTTAAATAA) present in muscle gene promoters(39) . In addition, a TA-rich binding site, TATAAATA (distinct from the classical TATA box), and a TA-rich binding protein (TARP) has been shown to activate muscle and brain creatine kinase promoters(43) . It is possible that MEF2 or MEF2-like proteins or related serum response factors (40) present in mammary epithelium bind to Kil sequences. We are in the process of testing whether any of these proteins bind to Kil sequences and also interact with the steroid receptors. Mutations in the octamer sequence also drastically affect hormone-stimulated transcription, suggesting that the sequence integrity of the entire Kil element is essential for basal and hormone-stimulated transcriptional activity of the MMTV promoter. It is possible that more than two proteins might be binding to the Kil element and function as a multiprotein complex as observed with the Ban2 enhancer(44) .

The function of the Kil element is consistent with a model of Enhanson organization(45) : a tissue-specific regulatory unit consisting of many regulatory elements to create a unique function. An enhanson contains multiple levels of organization that permits a high degree of transcriptional regulation through a combinatorial binding with a limited set of transcription factors. The octamer family of transcription factors has been shown to be necessary for promoter and enhancer activity of a variety of genes and in tissue-specific expression of cellular genes. We propose that the octamer-like motif present as part of the Kil sequence near the distal GRE may be involved in tissue-specific and hormone-induced expression of MMTV in combination with other Kil-binding proteins. We propose that a combination of GRE with the Kil element acts as an inducible enhancer and functions synergistically with proximal promoter for tissue-specific expression of MMTV.

Taken together, our results suggest the presence of a novel regulatory element mediating transcriptional activity of MMTV promoter by steroid hormone receptors. Since MMTV induces mammary tumors by activating wnt genes and that this transcriptional activation is achieved through the enhancer element(s) in the LTR of the integrated proviruses(46, 47) , we speculate that the Kil enhancer element might contribute significantly to the activation of the wnt genes during the induction of mouse mammary tumors. Further analysis of the Kil binding proteins should provide valuable insights into our understanding of tissue-specific expression of MMTV.

FOOTNOTES

*
This work was supported by National Institutes of Health Grant CA 52009. The core facilities used in this application were supported by National Institutes of Health Grant CA 12227. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Fels Institute for Cancer Research and Molecular Biology, Temple University School of Medicine, 3420 N. Broad St., Philadelphia, PA 19140. Tel.: 215-707-4307; Fax: 215-707-1454.

(^1)
The abbreviations used are: LTR, long terminal repeat; MMTV, mouse mammary tumor virus; GRE, glucocorticoid response element; GR, glucocorticoid receptor; PR, progesterone receptor; D, dexamethasone; P, progesterone, NF-1, nuclear factor 1; Oct-1, octamer transcription factor 1; MEF2, myocyte-enhancer binding factor 2; CAT, chloramphenicol acetyltransferase; PCR, polymerase chain reaction; DMEM, Dulbecco's modified Eagle's medium; DTT, dithiothreitol; PMSF, phenylmethylsulfonyl fluoride.

REFERENCES

  1. Gustafsson, J. A., Carstedt-Duke, J., Poellinger, L., Okret, S., Wikstrom, A. C Bronnegard, M., Gillner, M., Dong, Y., Fuxe, K., Cintra, A., Harfstrand, A., and Agnati, L. (1987) Endocr. Rev. 8,185-234 [Abstract/Free Full Text]
  2. Ponta, H., Kennedy, N., Skroch, P., Hynes, N. E., and Groner, B. (1985) Proc. Natl. Acad. Aci. U. S. A. 82,1020-1024 [Abstract/Free Full Text]
  3. Herrlich, P., and Ponta, H. (1989) Trends Genet. 5,112-115 [CrossRef][Medline] [Order article via Infotrieve]
  4. Cato, A. C. B., Henderson, D., and Ponta, H. (1987) EMBO J. 6,363-368 [Medline] [Order article via Infotrieve]
  5. Cato, A. C. B., Skroch, P., Weinmann, J., Butkeraitis, P., and Ponta, H. (1988) EMBO J. 7,1403-1410 [Medline] [Order article via Infotrieve]
  6. Stewart, T. A., Hollingshead, P. G., and Pitts, S. L. (1988) Mol. Cell. Biol. 8,473-479 [Abstract/Free Full Text]
  7. Yanagawa, S., Tanaka, H., and Ishimoto, A. (1991) J. Virol. 65,526-531 [Abstract/Free Full Text]
  8. Ray, A., and Prefontaine, K. E. (1994) Proc. Natl. Acad. Aci. U. S. A. 91,752-756 [Abstract/Free Full Text]
  9. Espanas, M. L., Roux, J., Ghysdael, J., Pictet, R., and Grange, T. (1994) Mol. Cell. Biol. 14,4116-4125 [Abstract/Free Full Text]
  10. Kuto, E., Strömstedt, P. E., and Poellinger, L. (1992) Mol. Cell. Biol. 12,4960-4969 [Abstract/Free Full Text]
  11. Gauthier, J. M., Bourachot, B., Doucas, V., Yaniv, M., and Moreau-Gachelin, F. (1993) EMBO J 12,5089-5096 [Medline] [Order article via Infotrieve]
  12. Yoshinaga, S. K., Peterson, C. L., Herskowitz, I., and Yamamoto, K. R. (1992) Science 258,1598-1604 [Abstract/Free Full Text]
  13. Buetti, E., Kühnel, B., and Diggelmann, H. (1989) Nucleic Acids Res. 17,3065-3078 [Abstract/Free Full Text]
  14. Brüggemeier, U., Kalff, M., Franke, S., Scheidereit, C., and Beato, M. (1991) Cell 64,565-572 [CrossRef][Medline] [Order article via Infotrieve]
  15. Schüle, R., Muller, M., Kaltschmid, C., and Renkawitz, R. (1988) Science 242,1418-1420 [Abstract/Free Full Text]
  16. Schüle, R., Muller, M., Otsuka-Murakami, H., and Renkawitz, R. (1988) Nature 332,87-90 [CrossRef][Medline] [Order article via Infotrieve]
  17. Strähle, U., Schmid, W., and Schütz, G. (1988) EMBO J. 7,3389-3395 [Medline] [Order article via Infotrieve]
  18. Dudley, J., and Risser, R. (1984) J. Virol. 49,92-101 [Abstract/Free Full Text]
  19. Hsu, C. L., Fabritius, C., and Dudley, J. (1988) J. Virol 62,4644-4652 [Abstract/Free Full Text]
  20. Kwon, B. S., and Weissman, S. M. (1984) J. Virol. 52,1000-1004 [Abstract/Free Full Text]
  21. Michalides, R., Wagenaar, E., Hilkens, J., Hilgers, J., Groner, B., and Hynes, N. E., (1982) J Virol. 43,819-829 [Abstract/Free Full Text]
  22. Michalides, R., Wagenaar, E., and Weijers, P. (1985) Mol. Cell. Biol. 5,823-830 [Abstract/Free Full Text]
  23. Ball, J. K., Diggelmann, H., Dekaban, G. A., Grossi, G. F., Semmler, R., Waight, P. A., and Fletcher, R. F. (1988) J. Virol. 62,2985-2993 [Abstract/Free Full Text]
  24. Wellinger, R. J., Garcia, M., Vessaz, A., and Diggelmann, H. (1986) J. Virol. 60,1-11 [Abstract/Free Full Text]
  25. Mink, S., Ponta, H., and Cato, A. C. B. (1990) Nucleic Acids Res. 18,2017-2024 [Abstract/Free Full Text]
  26. Ho, S. N., Hunter, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene (Amst.) 77,51-59 [CrossRef][Medline] [Order article via Infotrieve]
  27. Horwitz, K. B., and McGuire, W. L. (1978) J. Biol. Chem. 253,8185-8191 [Free Full Text]
  28. Westly, B., and Rochefort, H (1980) Cell 20,353-362 [CrossRef][Medline] [Order article via Infotrieve]
  29. Dignam, J. D., Lebowitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 11,1475-1489 [Abstract/Free Full Text]
  30. Manley, J. L., Fire, A., Samuels, M., Sharp, P. A. (1983) Methods Enzymol. 101,568-582 [Medline] [Order article via Infotrieve]
  31. Wigler, M., Pellier, A., Silverstein, S., and Axel, R. (1978) Cell 14,725-731 [CrossRef][Medline] [Order article via Infotrieve]
  32. Gorman, C. M., Moffat, C. L., and Howard, B. H. (1982) Mol. Cell. Biol. 2,1044-1051 [Abstract/Free Full Text]
  33. Meulia, T., and Diggelmann, H. (1990) J. Mol. Biol. 216,850-872
  34. Scheidereit, C., Geisse, S., Westphal, H. M., and Beato, M. (1983) Nature 340,749-752
  35. Theunissen, H. J., Paardekooper, M., Maduro, L. J., Michalides, R. A. M., and Nusse, R. (1989) J. Virol. 63,3466-3471 [Abstract/Free Full Text]
  36. Kalff, M., Gross, B., and Beato, M. (1990) Nature 344,360-362 [CrossRef][Medline] [Order article via Infotrieve]
  37. Strähle, U., Kloch, G., and Schütz, G. (1987) Proc. Natl. Acad. Sci. U. S. A. 84,7871-7875 [Abstract/Free Full Text]
  38. Strähle, U., Boshart, M., Klock, G., Stewart, F., and Schütz, G. (1989) Nature 339,629-632 [CrossRef][Medline] [Order article via Infotrieve]
  39. Yu, Y. T., Breitbart, R. E., Smoot, L. B., Lee, Y., Mahdavi, V., and Nadal-Ginard, B. (1992) Genes & Dev. 6,1783-1798 [CrossRef]
  40. Pollock, R., and Triesman, R., (1991) Genes & Dev. 5,2327-2341 [CrossRef]
  41. Hoeck, W., Rusconi, S., and Groner, B. (1989) J. Biol. Chem. 264,14396-14402 [Abstract/Free Full Text]
  42. Lubon, H., and Henninghausen, L. (1987) Nucleic Acids Res. 15,2103-2121 [Abstract/Free Full Text]
  43. Horlick, R. A., Hobson, G. M., Patterson, J. H., Mitchell, M. T., and Benfield, P. A. (1990) Mol. Cell. Biol. 10,4826-4836 [Abstract/Free Full Text]
  44. Mellentin-Michelotti, J., John, S., Pennie, W. D., Williams, T., and Hager, G. L. (1994) J. Biol. Chem. 269,31893-31990
  45. Ondek, B., Gloss, L., and Herr, W. (1988) Nature 33,40-45
  46. Dickson, C., Smith, R., Brookes, S., and Peter, G. (1984) Cell 37,529-536 [CrossRef][Medline] [Order article via Infotrieve]
  47. Nusse, R., Van Ooyen, A., Cox, D., Fung, Y, K. T., and Varmus, H. (1984) Nature 307,131-136 [CrossRef][Medline] [Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
 Mol. Cell. Biol.Home page
G. Fragoso, W. D. Pennie, S. John, and G. L. Hager
The Position and Length of the Steroid-Dependent Hypersensitive Region in the Mouse Mammary Tumor Virus Long Terminal Repeat Are Invariant despite Multiple Nucleosome B Frames
Mol. Cell. Biol., June 1, 1998; 18(6): 3633 - 3644.
[Abstract] [Full Text]

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Lee, K.-I.
Right arrow Articles by Reddy, C. D.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Lee, K.-I.
Right arrow Articles by Reddy, C. D.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement