Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, M.
Right arrow Articles by Garcea, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, M.
Right arrow Articles by Garcea, R. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 43, Issue of October 27, 1995 pp. 26006-26011
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
In Vitro Phosphorylation of the Polyomavirus Major Capsid Protein VP1 on Serine 66 by Casein Kinase II (*)

(Received for publication, May 25, 1995; and in revised form, August 30, 1995)

Maolin Li (1) Mary K. Lyon (2) Robert L. Garcea (1)(§)

From the  (1)Section of Pediatric Hematology/Oncology, Department of Pediatrics, University of Colorado School of Medicine, Box C229, Denver, Colorado 80262 and the (2)Department of Molecular, Cellular, and Developmental Biology, University of Colorado, Boulder, Colorado 80309

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Phosphorylation of the polyomavirus major capsid protein VP1 plays a role in virus assembly and may function in virus-cell recognition. Previous mapping of the in vivo phosphorylation sites on VP1 identified phosphorylation of threonine residues Thr-63 and Thr-156 (Li, M., and Garcea, R. L.(1994) J. Virol. 68, 320-327). Phosphoserine was detected in a tryptic phosphopeptide encompassing residues 58-78. Because of consensus casein kinase II (CK II) sites in this peptide, we examined the in vitro phosphorylation of the purified recombinant VP1 protein by CK II. CK II phosphorylated VP1 on serine, and the resulting tryptic phosphopeptide eluted in a 30-31 min high performance liquid chromatography fraction corresponding to residues 58-78. The VP1 tryptic phosphopeptide also co-migrated in two-dimensional peptide analysis with one of the tryptic peptides obtained from VP1 isolated after in vivoP labeling of virus-infected cells. A site-directed mutant VP1 protein, Ser-66 to Ala, was phosphorylated poorly by CK II in vitro. As determined by electron microscopy, all of the mutant proteins were isolated in pentameric form similar to the wild-type protein, although the Ala-66 pentamers had a tendency to self-assemble in vitro into tubular as well as capsid-like structures. These findings identify Ser-66 as a site of VP1 phosphorylation in vitro, and suggest that VP1 may serve as a substrate for CK II in vivo.


INTRODUCTION

The polyomavirus capsid is composed of 72 pentamers of the major coat protein VP1(1) . The minor capsid proteins VP2 and VP3 are present in approximately one-tenth the abundance of VP1 in the virion and play an unknown structural role(2) . VP1 is synthesized late in the viral lytic cycle and transported to the nucleus of the infected cells where encapsidation of the viral minichromosome occurs. Studies have suggested that post-translational modifications of VP1 play an important role in virus assembly and cell infection(3, 4, 5, 6) . VP1 is phosphorylated in serine and threonine residues(7, 8) . Recently, we mapped the phosphorylation sites of VP1 isolated from virus-infected mouse cells(9) . Threonine phosphorylation of VP1 was identified on residues Thr-63 and Thr-156 in the BC and DE loops, respectively, which are exposed on the exterior viral surface(10) . A defect in virus assembly was associated with a mutation at threonine 156(9) . Serine sites, although present in the same tryptic phosphopeptides as the threonine sites, could not be assigned because viruses reconstructed with mutations at these serine residues were nonviable.

Polyoma host-range nontransforming mutant viruses have genetic alterations in both middle and small tumor (T)-antigens, and are defective in cell transformation in vitro and tumor induction in vivo(11) . The host-range nontransforming mutant viruses are blocked in virus assembly when grown on nonpermissive cells(3) . The assembly defect of host-range nontransforming mutant viruses is associated with underphosphorylation of VP1 on threonine(8) . In vivo phosphate labeling of VP1 during host-range nontransforming mutant virus infections showed that phosphorylation of VP1 on both residues Thr-63 and Thr-156 was defective(9) . This regulation could be controlled by activation of a cellular kinase, e.g. pp60, or inactivation of a specific phosphatase, e.g. phosphatase 2A, both activities known to be associated with middle T-antigen(12, 13, 14) . VP1 serine phosphorylation appears constitutive, however, at least in the presence of an intact large T-antigen(8) .

Casein kinase II (CK II) (^1)is a ubiquitous cyclic nucleotide independent serine-threonine kinase present in the cell nucleus and cytoplasm(15, 16) . CK II is activated rapidly when cells are treated with certain growth factors such as serum, epidermal growth factor, and insulin-like growth factor (17, 18, 19) . These findings raise the possibility that CK II plays an important role in cellular activities related to cell growth and proliferation(20, 21) . This enzyme has a number of substrates including MYC and p53(22, 23) . In addition, CK II activity is stimulated by many of the agents that activate c-fos transcription(18, 24, 25) . These substrates suggest that CK II may link signal transduction pathways and nuclear proteins that control cell proliferation(26, 27) . CK II has also been found to phosphorylate structural and nonstructural viral proteins such as SV40 large T-antigen and varicella-zoster virus glycoprotein(28, 29) . The data presented in this report show that the polyomavirus major capsid protein VP1 is also phosphorylated by CK II.


MATERIALS AND METHODS

Cell Culture and Virus Infection

A31 (Balb/c3T3) mouse fibroblasts were grown in Dulbecco's modified Eagle's medium containing 10% fetal calf serum. Cell culture was performed as previously described(30) . The wild-type polyomavirus strain used was NG59RA. Virus infections were performed at multiplicities of 5-10 plaque forming units/cell in A31 mouse fibroblasts at approximately 50% confluence. Following adsorption of polyomavirus, fresh Dulbecco's modified Eagle's medium supplemented with 2% calf serum was added.

In Vivo [P]Orthophosphate Labeling

Cells were grown in 100-mm plates and infected with polyomavirus. At 25-28 h postinfection, cells were washed with phosphate-free Dulbecco's modified Eagle's medium and labeled with 2 mCi of [P]orthophosphate (specific activity 900 mCi/mmol) in 1 ml of phosphate-free Dulbecco's modified Eagle's medium with 2% dialyzed calf serum for 4-6 h(9) .

VP1 Immunoprecipitation

Polyomavirus-infected monolayers were lysed in radioimmunoprecipitation assay buffer (RIPA: 150 mM NaCl, 50 mM Tris-HCl, pH 7.2, 1% Nonidet P-40, 1% sodium deoxycholate, 0.1% SDS). Lysates were cleared by centrifugation at 12,000 times g for 20 min. The soluble lysate was incubated with a rabbit anti-VP1 polyclonal antiserum (I58) at 4 °C for 1 h(31, 32) . The immune complexes were adsorbed to protein A-Sepharose CL-4B beads (Pharmacia) by a further incubation for 1 h at 4 °C. The Sepharose beads were washed three times with phosphate-buffered saline and twice with water.

HPLC Phosphopeptide Mapping

Immunoprecipitated VP1 was removed from the protein A-Sepharose beads with SDS sample buffer (2% SDS, 5% 2-mercaptoethanol, 0.625 M Tris-HCl, pH 6.8, 10% glycerol) by heating for 5 min at 100 °C. VP1 was resolved by 7.5% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and electroblotted to nitrocellulose with a dry blot apparatus (Hoeffer) as described(9) . Proteins were stained with 0.1% Ponceau S in 1% acetic acid for 5 min and destained in 1% acetic acid and washed with water. The VP1 band was excised and incubated at 37 °C for 30 min in 0.5% polyvinylpyrrolidone-40 dissolved in 100 mM acetic acid(33) . Excess polyvinylpyrrolidone-40 was removed by washing with water 5 times, and the nitrocellulose paper was then cut into small pieces. VP1 on nitrocellulose was digested with trypsin in enzyme buffer (100 mM NaHCO(2), pH 8.2), acetonitrile, 95:5 (v/v), at 37 °C overnight. The ratio of trypsin to VP1 was approximately 1:20 (w/w). The nitrocellulose was removed by centrifugation at 10,000 times g for 5 min and the supernatant was transferred to a fresh tube and lyophilized under vacuum. The tryptic peptide pellets were dissolved in 0.1% trifluoroacetic acid and centrifuged for 5 min at 10,000 times g. The supernatant was then analyzed by reverse-phase HPLC using a C18 column. Peptides were separated with a linear gradient from 0 to 70% acetonitrile in 0.1% trifluoroacetic acid applied with a flow rate of 200 µl/min over 60 min. The fractions were collected every 1 min. Phosphorylated peptides were detected by scintillation counting.

Phosphoamino Acid Analysis

The P-labeled VP1 isolated by immunoprecipitation from in vivoP-labeled polyomavirus-infected cells or recombinant protein phosphorylated in vitro was used for phosphoamino acid analysis. After SDS-PAGE and electroblotting to Immobilon-P membrane, the VP1 band was hydrolyzed with HCl(34) . The hydrolysate was then dissolved in 5 ml of two-dimensional buffer (7.5% acetic acid, 2.5% formic acid, 0.1% Orange G) plus 1 mg/ml phosphoserine and phosphothreonine, and spotted onto Cel 300 TLC plates (Alltech). Electrophoresis was performed in 7.5% acetic acid, 2.5% formic acid (pH 1.9) for 60 min at 1200 V. Phosphoamino acids were stained by spraying with 0.1% ninhydrin in acetone, and developed at 80 °C. The plate was exposed to Kodak film at -70 °C.

Phosphopeptide Mapping by Two-dimensional Electrophoresis

Phosphopeptides of VP1 obtained either from direct tryptic digestion or after HPLC purification were used in two-dimensional phosphopeptide mapping. The peptide fragments were spotted to a Cell 300 TLC plate with 5 µl of two-dimensional buffer. The first dimension electrophoresis was performed in the buffer described for the phosphoamino acid analysis. The second dimension was thin-layer chromatography in 38% 1-butanol, 25% pyridine, 7.5% acetic acid orthogonal to the first dimension(9) . Phosphopeptides were detected by autoradiography.

Site-directed Mutagenesis and Construction of Mutant Viruses

Mutations were introduced into the VP1 coding region of polyomavirus using a Muta-Gene M13 in vitro Mutagenesis kit (Bio-Rad). The VP1 sequence of polyomavirus cloned into M13 mp19 was used as the template for mutagenesis(9) . A serine to alanine mutation was introduced at residue 66 of VP1 using the 25-mer CCCACCCCTGAAGCCCTAACAGAGG, and a serine to alanine change at residue 77 using CTATGGTTGGGCCAGAGGGATTAAT. The mutated VP1 sequence was verified by dideoxynucleotide chain termination sequencing using the Sequenase System (U. S. Biochemical Corp.). Mutant viruses Gly-63 and Ala-153 have been described(9) . Mutant polyomavirus genomes were reconstructed by ligation of the mutant fragment into a wild-type virus(9) . The reconstructed mutant virus DNA was transfected into A31 cells by using the DEAE-dextran method(35) . Virus lysates were obtained by subculturing the transfected cells every 3-4 days until an extensive cytopathic effect developed. Viral DNA was isolated by the method of Hirt (36) and purified using Geneclean II Kit (BIO 101).

Recombinant VP1 Expression and Purification

The vector ptacVP1 was used for expression of VP1 in Escherichia coli(37) . Vectors to express site-directed mutant and carboxyl-terminal deleted forms of VP1 in E. coli were prepared using ptacVP1. The site-directed mutant VP1 was constructed by inserting the HindIII-XbaI fragment of the reconstructed mutant polyomavirus into HindIII-XbaI-digested ptacVP1. Carboxyl-terminal deletions of VP1 were constructed as described (38) with slight modification. The plasmid ptacVP1 containing the introduced mutation was digested with NcoI, and the large DNA fragment was isolated using Geneclean II Kit (BIO 101). This fragment was then digested with S1 nuclease. The blunt-ended DNA was ligated with T4 DNA ligase. The truncated VP1 protein was purified as described (37) .

In Vitro Phosphorylation of VP1 and VP1 Peptides by Casein Kinase II

VP1 obtained after the phosphocellulose purification step was dialyzed into kinase buffer (10 mM MgCl(2), 150 mM KCl, 50 mM Tris-HCl, pH 7.5). The phosphorylation of VP1 was carried out in kinase buffer containing 30 µg of VP1, 10 µCi of [-P]ATP (specific activity 3000 Ci/mmol), and 20 ng of CK II (Upstate Biotechnology) or 200 microunits of CK II (Boehringer-Mannheim) for 1 h at 30 °C. Enzymes from both vendors gave equivalent results. CK II phosphorylation of VP1 immunoprecipitates from virus-infected cells was performed by washing the immunoprecipitates twice with phosphate-buffered saline and once with kinase buffer. 10 µCi of [-P]ATP was then added with or without CK II.

The peptides GQPPTPESLTEGGQYYGWSRGINC and DVHGFNKPTDTVNTKGISTPVEGC, corresponding to residues 59-81 and 138-160 of VP1, were reacted with CK II in kinase buffer. The P-labeled peptide was spotted on Immobilon-P membrane and free [-P]ATP eluted with water. The peptide was then subjected to phosphoamino acid analysis.

Electron Microscopy

VP1 proteins obtained after the phosphocellulose purification step were incubated in 2 M NaCl, 0.1 mM CaCl(2), 50 mM Tris-HCl (pH 7.2), for 4 days at 4 °C. Samples were applied to glow-discharged carbon-coated 400 mesh grids and stained with 2% uranyl acetate. Images were taken on a Philips CM 10 electron microscope at a magnification of approximately 40,000.


RESULTS

In Vitro Phosphorylation of VP1 by Casein Kinase II

Sequences in VP1 containing a CK II phosphorylation site motif ((S/T)XX(D/E)) were identified by inspection. The presence of these putative sites prompted us to investigate whether CK II could phosphorylate VP1 in vitro. Recombinant VP1 proteins, purified after expression in E. coli, were used as substrates in in vitro kinase reactions with CK II. These proteins are purified as pentamers which resemble the capsomeric subunits of the virion(39) . Because the full-length protein has the potential for self-assembly into capsid-like structures in vitro(39) , a carboxyl-terminal 63 amino acid deleted form of VP1 (DeltaNCOVP1;(38) ) which is unable to assemble into capsids but is otherwise structurally intact, was also tested as a substrate. As shown in Fig. 1, recombinant VP1 was phosphorylated by CK II. The minor Coomassie Blue-stained band in lanes 1 and 2 (Fig. 1A) migrating slightly above the position of the DeltaNCOVP1 band in lanes 3 and 4, represents a proteolytic cleavage product of VP1, which has deleted the first 27 amino acids of the protein(31) . Both the partially proteolyzed species and DeltaNCOVP1 were also substrates for CK II (Fig. 1B, lanes 2 and 4). Phosphoamino acid analysis of the kinased proteins revealed that CK II phosphorylated both VP1 and DeltaNCOVP1 on serine only (Fig. 1C).


Figure 1: In vitro phosphorylation of VP1 by CK II. Purified recombinant VP1 protein was incubated with CK II and [-P]ATP, and the products analyzed by SDS-PAGE and autoradiography. Panel A, Coomassie Blue stained; and panel B, autoradiogram. Full-length VP1 (lanes 1 and 2) and DeltaNCOVP1 (lanes 3 and 4) were incubated with (lanes 2 and 4) or without (lanes 1 and 3) CK II. Panel C, phosphoamino acid analysis of the P-labeled VP1 (full-length, lane 1; DeltaNCOVP1, lane 2).



Immunoprecipitates of VP1 from virus-infected cells were also tested for associated kinase activity by direct incubation with [-P]ATP (data not shown). No significant VP1 ``autophosphorylation'' was detected and the addition of CK II to the immunoprecipitates did not lead to increased VP1 phosphorylation. Mitogen-associated protein (p44), cdc2 (p34), and cdk2 kinases were also tested for their ability to phosphorylate VP1 in vitro. (^2)Mitogen-associated protein kinase did not phosphorylate VP1. cdc2 and cdk2 kinases did phosphorylate VP1 in vitro, but the tryptic phosphopeptides resulting from these reactions did not correspond with those seen in vivo (see below) and these enzymes were therefore not further characterized.

Analysis of Phosphopeptides by HPLC and Two-dimensional Peptide Mapping

To characterize the site(s) phosphorylated by CK II, we analyzed VP1 tryptic phosphopeptides by HPLC. Fig. 2shows that two phosphopeptide peaks (30-31 min and 36-37 min fractions) were detected in VP1 isolated after in vivoP labeling of polyomavirus-infected cells. In contrast, only one major phosphopeptide peak (30-31 min fraction) was detected for the recombinant VP1 protein phosphorylated by CK II in vitro, with a variable shoulder peak (28-29 min fraction). Tryptic phosphopeptides eluting in the 30-31 min and 36-37 min fractions have been previously identified as corresponding to residues 58-78 and 153-183, respectively(9) .


Figure 2: HPLC analysis of VP1 tryptic phosphopeptides. VP1 was either labeled in vivo with [P]orthophosphate or in vitro by CK II. Panel A, the tryptic peptides from in vivo (circle) and in vitro (bullet) P-labeled VP1 were fractionated by C18 reverse-phase HPLC. Panel B, phosphopeptides (30-31 min fraction) from in vivo (lane 1) and in vitro (lane 2) P labeling were subjected to phosphoamino acid analysis.



Phosphoamino acid analysis of VP1 isolated from polyomavirus-infected cells showed that the phosphopeptide in the 36-37 min fraction is phosphorylated only on threonine residues (9) and the phosphopeptide in the 30-31 min fraction is phosphorylated on both threonine and serine residues (Fig. 2B, lane 1). The phosphopeptide in the 30-31 min fraction of in vitro CK II-kinased recombinant VP1 contained only phosphoserine (Fig. 2B, lane 2). These results suggest that phosphorylation of VP1 by CK II was primarily on serine sites between residues 58 and 78. In order to verify that the in vivo and in vitro phosphopeptides were identical, they were further analyzed by two-dimensional phosphopeptide mapping (Fig. 3). The two-dimensional mapping showed that VP1 isolated from polyomavirus-infected mouse cells has three phosphopeptide spots (Fig. 3A)(9) . Phosphopeptide spots 1 and 2 contained phosphothreonine, and spot 3 phosphoserine (9) (data not shown). Recombinant VP1 protein phosphorylated by CK II showed a major phosphopeptide spot containing phosphoserine (Fig. 3B; data not shown). When P-labeled VP1 from polyomavirus-infected cells was mixed with the recombinant VP1 phosphorylated by CK II, spot 3 from the in vivo labeled VP1 co-migrated with the phosphopeptide generated by CK II (Fig. 3C). HPLC analysis showed that both spots 2 and 3 eluted in the 30-31 min fraction (9) (data not shown). This result may be due to two different peptides eluting coincidently from the 30-31 min fraction, or the same peptide which has been differentially modified. The two-dimensional chromatography analysis supports the latter, suggesting that the peptide from residues 58 to 78 is phosphorylated on either threonine or serine residues, but not both, and each of these modifications yields a distinctive species in the two-dimensional chromatogram (spot 2 or 3).


Figure 3: Two-dimensional mapping of VP1 tryptic phosphopeptides. The in vivoP-labeled VP1 and VP1 phosphorylated by CK II in vitro were digested with trypsin, and analyzed by two-dimensional phosphopeptide mapping. A, P-labeled VP1 from polyomavirusinfected cells; B, recombinant VP1 protein phosphorylated in vitro by CK II; C, a mixture of samples in panels A and B.



To confirm that VP1 residues 58-78 contained a serine that was a substrate for CK II, a peptide of VP1 corresponding to residues 59-81 was synthesized. This peptide was incubated with CK II in vitro, and phosphoamino acid analysis of the reaction product demonstrated phosphoserine (Fig. 4, lane 1). In addition, a peptide corresponding to residues 138-160 (the DE loop of VP1) was also phosphorylated by CK II (Fig. 4, lane 2). This peptide contains a potential consensus CK II site (residue Thr-156), a site phosphorylated in vivo. In vitro the intact protein is not phosphorylated in this region, but the synthetic peptide is phosphorylated on both serine and threonine. These results suggest that in the intact VP1 pentamer, potential CK II sites are conformationally distinct for kinase recognition.


Figure 4: BC and DE loop peptides of VP1 are phosphorylated by CK II in vitro. BC (lane 1) and DE (lane 2) loop peptides of VP1 were phosphorylated by CK II, and the phosphorylated peptides were analyzed for phosphoamino acids.



VP1 Is Phosphorylated by CK II on Serine 66

Two serine residues, Ser-66 and Ser-77, are found between residues 58 and 78. Serine 66 is a CK II phosphorylation site based on the motif of (S/T)XX(D/E), whereas Ser-77 is not a consensus CK II site. Site-directed mutations were introduced into the polyomavirus genome, substituting alanine for serine at these residues. Neither reconstructed mutant virus (Ala-66 and Ala-77) could be isolated (9) (data not shown), and therefore determination of the in vivo phosphorylation site could not be confirmed in this manner. Both the Ala-66 and Ala-77 mutations were also introduced into the VP1 expression vector, ptacVP1. The mutant recombinant VP1 proteins were purified, and analyzed for phosphorylation by CK II. The wild-type VP1 and two additional proteins Gly-63 (Thr-63 to Gly) and Ala-156 (Thr-156 to Ala) as well as Ala-77 were phosphorylated by CK II, both as full-length and carboxyl-terminal deleted proteins (Fig. 5B). The mutant protein Ala-66 was not significantly phosphorylated by CK II (Fig. 5B, lanes 2 and 7). This result demonstrates that VP1 is phosphorylated in vitro on Ser-66, and not Ser-77, by CK II.


Figure 5: In vitro phosphorylation of mutant VP1 proteins by CK II. Wild-type and mutant VP1 proteins were incubated with CK II, and the phosphorylated proteins analyzed by SDS-PAGE and autoradiography. Lanes 1 and 6, wild-type VP1; lanes 2 and 7, Ala-66 VP1; lane 3, Ala-77 VP1; lanes 4 and 8, Gly-63 VP1; lanes 5 and 9, Ala-156 VP1. Lanes 1-5, full-length; lanes 6-9, DeltaNCOVP1 variants of these proteins. A, Coomassie Blue stain; B, autoradiogram.



Electron Microscopy of Mutant VP1 Proteins

The purified recombinant VP1 protein is isolated as pentamers resembling viral capsomeres, which can self-assemble in vitro into capsid-like structures(39) . In order to assess the structural integrity of the mutant VP1 proteins they were analyzed by electron microscopy for pentamer structure and in vitro capsid self-assembly. All mutant proteins (Ala-66, Ala-77, Gly-63, and Ala-156) appeared as pentamers resembling wild-type pentamers (data not shown). However, when subjected to conditions which promote in vitro capsid assembly, i.e. high ionic strength and calcium(39, 40) , the Ala-66 mutant protein had a tendency to form tubular structures as well as capsid-like aggregates (Fig. 6). Thus, although the Ala-66 mutation did not affect pentamer formation, changes in the Ser-66 residue may influence the formation of higher order aggregates of VP1.


Figure 6: In vitro assembly of mutant VP1 proteins. The Ala-77 (A) and Ala-66 (B) mutant VP1 proteins were incubated under assembly conditions and examined by electron microscopy (see ``Materials and Methods''). The Ala-77 protein formed typical capsid-like aggregates similar to the wild-type protein, whereas the Ala-66 protein formed both tubular and capsid-like structures. Bar equals 100 nm.




DISCUSSION

These data demonstrate that the polyomavirus major capsid protein VP1 is an in vitro substrate for phosphorylation by CK II. VP1, purified after expression in E. coli, was phosphorylated in vitro by CK II, and phosphoamino acid analysis demonstrated only phosphoserine residues. The major phosphorylated serine site modified by casein kinase II was located in the tryptic peptide encompassing residues 58 to 78. A site-directed mutant VP1 protein, with a serine-to-alanine change at residue 66, was defective in CK II phosphorylation. Therefore, Ser-66 is the phosphorylation site modified by CK II in vitro, and the data suggest that the in vivo phosphopeptide representing residues 58-78 is also phosphorylated on Ser-66.

Recently the VP1 threonine phosphorylation sites were mapped(9) . Two major phosphopeptides, in residues 58-78 and residues 153-173, were identified from in vivoP labeling polyomavirus-infected cells. Viruses with site-directed mutations confirmed that VP1 was phosphorylated on Thr-63 and Thr-156. However, the serine phosphorylation site(s) was unidentified because mutant viruses with substitutions at possible serine residues (Ser-66 and Ser-77) were non-viable. We conclude from this previous result that Ser-66 is essential for virus growth. HPLC analysis from in vivoP labeling polyomavirus-infected cells showed that the peptides eluted in the 30-31 min fraction were phosphorylated on both threonine and serine residues. Two-dimensional peptide mapping showed that the peptide fragments eluted from this fraction migrated in different locations (Fig. 2). However, the fragments in the 30-31 min fraction contained only one peptide sequence from residue 58 to 78 determined by NH(2)-terminal sequencing and mass spectrometry(9) . Therefore, we conclude that phosphorylation of Thr-63 and Ser-66 occur in different VP1 monomers. VP1 isolated from polyomavirus-infected cells contains at least four isoelectric subspecies identified by two-dimensional protein gel analysis(3, 4) . Several of these subspecies may represent distinct monophosphorylated molecules rather than multiply modified forms.

In two other well characterized examples of the consequences of CK II phosphorylation, skeletal muscle glycogen synthase and acetyl-CoA carboxylase(41, 42) , the initial phosphorylation does not itself alter the activity of the substrate but is necessary for subsequent regulatory phosphorylation or dephosphorylation events. Serine phosphorylation of VP1 appears constitutive relative to the activity of middle T-antigen which appears to regulate VP1 threonine phophorylation (8, 30) . Because only a fraction, estimated by two-dimensional protein gel electrophoresis as 50% or less, of the VP1 monomers are modified it is possible that serine modification by a cellular CK II enzyme may affect the subsequent choice of VP1 molecules for threonine modification. This choice may dictate that a particular VP1 within a pentameric capsomere is phosphorylated either on serine or threonine but not both.

The in vitro assembly properties of the Ala-66 mutant VP1 protein demonstrated that this protein was structurally intact, although this mutant protein had a tendency to self-assemble into not only capsid-like but also tubular structures. Because inter-capsomere bonds are formed using the carboxyl termini of VP1 molecules between pentamers(38, 43) , this result suggests that changes in Ser-66, located on the surface of the VP1 pentamer(43) , may influence interactions between VP1 carboxyl termini. This structural interaction may be relevant to wild-type VP1 molecules phosphorylated at Ser-66, in that such a modification may facilitate formation of alternative carboxyl-terminal bonding interactions in the final capsid(43) . In addition, a perturbation of proper inter-capsomeric bonding may explain why a virus with the Ala-66 mutation could not be isolated(9) . However, additional studies of the Ala-66 mutant protein under a variety of assembly conditions (40) will be necessary before the significance of these structural interactions can be further assessed.

For the related SV40 virus, the large T-antigenbulletp53 complex isolated from virus-infected cells is associated (in immunoprecipitates) with a serine-specific kinase activity(44, 45) . This activity autophosphorylates T-antigen on many of the same sites seen for in vitro phosphorylation(29) . The two-dimensional phosphopeptide map of SV40 large T-antigen was nearly reproduced in vitro by the combination of CK I and CK II, and thus some of the associated kinase activity may be related to their association with the T-antigenbulletp53 complex(29, 46) . p53 is also a substrate for CK II phosphorylation in vitro(23) , consistent with the findings from the in vivo T-antigen associated kinase results. p53 is phosphorylated to a higher level (10-fold) in SV40-infected cells, suggesting that its growth suppressive activity may be inhibited by its phosphorylation(46) .

CK II phosphorylation has been associated with other virus infections. CK II levels are stimulated upon adenovirus infection (12-fold within 15 min) of baby rat kidney cells(47) . This activation paralleled that seen for CK II in serum stimulation of WI38 cells, and correlates with the serum response early gene induction of myc, fos, and jun. Polyomavirus infection induces the serum response (platelet-derived growth factor-inducible) genes in a biphasic manner, with accumulation of these mRNAs 1 to 2 h post-infection associated with capsid protein addition, and a second phase associated with middle T-antigen expression(48, 49) . It is possible that CK II may also be induced during polyomavirus infection so that capsid protein phosphorylation would be facilitated. Although the biological functions of VP1 phosphorylation remain undetermined, the position of these sites on the exterior virion surface suggest a role in cell attachment and entry. To accomplish such an important function the virus may require recruitment of specific cellular kinases such as CK II.


FOOTNOTES

*
This work was supported by Grant CA37667 from the National Cancer Institute (to R. L. G.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: University of Colorado Health Sciences Center, 4200 East Ninth Ave., Box C229, Denver, CO 80262. Tel.: 303-270-3247; Fax: 303-270-3244.

(^1)
The abbreviations used are: CK II, casein kinase II; HPLC, high performance liquid chromatography; PAGE, polyacrylamide gel electrophoresis.

(^2)
M. Li, personal observations.


ACKNOWLEDGEMENTS

We thank Jim Lee and Paul Morrison of the Dana-Farber Molecular Biology Core Facility for assistance with peptide synthesis, and Patti Estes for expert technical assistance.


REFERENCES

  1. Rayment, I., Baker, T. S., Caspar, D. L. D., and Murakami, W. T. (1982) Nature 295, 110-115 [CrossRef][Medline] [Order article via Infotrieve]
  2. Tooze, J. (1980) DNA Tumor Viruses, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  3. Garcea, R. L., and Benjamin, T. L. (1983) Proc. Natl. Acad. Sci. U. S. A. 80, 3613-3617 [Abstract/Free Full Text]
  4. Bolen, J. B., Anders, D. G., Trempy, J., and Consigli, R. (1981) J. Virol. 37, 80-91 [Abstract/Free Full Text]
  5. Bolen, J. B., and Consigli, R. A. (1979) J. Virol. 32, 679-683 [Abstract/Free Full Text]
  6. Ludlow, J. W., and Consigli, R. A. (1987) J. Virol. 61, 509-515 [Abstract/Free Full Text]
  7. Anders, D. G., and Consigli, R. A. (1983) J. Virol. 48, 206-217 [Abstract/Free Full Text]
  8. Garcea, R. L., Ballmer-Hofer, K., and Benjamin, T. L. (1985) J. Virol. 54, 311-316 [Abstract/Free Full Text]
  9. Li, M., and Garcea, R. L. (1994) J. Virol. 68, 320-327 [Abstract/Free Full Text]
  10. Stehle, T., Yan, Y., Benjamin, T. L., and Harrison, S. C. (1994) Nature 369, 160-163 [CrossRef][Medline] [Order article via Infotrieve]
  11. Benjamin, T. L. (1982) Biochim. Biophys. Acta 695, 69-95 [Medline] [Order article via Infotrieve]
  12. Courtneidge, S. A., and Smith, A. E. (1983) Nature 303, 435-439 [CrossRef][Medline] [Order article via Infotrieve]
  13. Pallas, D. C., Shahrik, L. K., Martin, B. L., Jaspers, S., Miller, T. B., Brautigan, D. L., and Roberts, T. M. (1990) Cell. 60, 167-176 [CrossRef][Medline] [Order article via Infotrieve]
  14. Walter, G., Ruediger, R., Slaughter, C., and Mumby, M. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 2521-2525 [Abstract/Free Full Text]
  15. Edelman, A. M., Blumenthal, D. K., and Krebs, E. G. (1987) Annu. Rev. Biochem. 56, 567-613 [Medline] [Order article via Infotrieve]
  16. Tuazon, P. T., and Traugh, J. A. (1991) Adv. Second Messenger Phosphoprotein Res. 23, 123-164 [Medline] [Order article via Infotrieve]
  17. Ackerman, P., and Osheroff, N. (1989) J. Biol. Chem. 264, 11958-11965 [Abstract/Free Full Text]
  18. Klarlund, J. K., and Czech, M. P. (1988) J. Biol. Chem. 263, 15872-15875 [Abstract/Free Full Text]
  19. Carroll, D., and Marshak, D. R. (1989) J. Biol. Chem. 264, 7345-7348 [Abstract/Free Full Text]
  20. Pinna, L. A. (1990) Biochim. Biophys. Acta 1054, 267-284 [Medline] [Order article via Infotrieve]
  21. Takio, K., Kuenzel, E. A., Walsh, K. A., and Krebs, E. G. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 4851-4855 [Abstract/Free Full Text]
  22. Lüscher, B., Kuenzel, E. A., Krebs, E. G., and Eisenman, R. N. (1989) EMBO J. 8, 1111-1119 [Medline] [Order article via Infotrieve]
  23. Meek, D. W., Simon, S., Kikkawa, U., and Eckhart, W. (1990) EMBO J. 9, 3253-3260 [Medline] [Order article via Infotrieve]
  24. Sommercorn, J., Mulligan, J. A., Lozeman, F. J., and Krebs, E. G. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 8834-8838 [Abstract/Free Full Text]
  25. Manak, J. R., and Prywes, R. (1993) Oncogene 8, 703-711 [Medline] [Order article via Infotrieve]
  26. Lorenz, P., Pepperkok, R., Ansorge, W., and Pyerin, W. (1993) J. Biol. Chem. 268, 2733-2739 [Abstract/Free Full Text]
  27. Pepperkok, R., Lorenz, P., Ansorge, W., and Pyerin, W. (1994) J. Biol. Chem. 269, 6986-6991 [Abstract/Free Full Text]
  28. Grose, C., Jackson, W., and Traugh, J. A. (1989) J. Virol. 63, 3912-3918 [Abstract/Free Full Text]
  29. Grèsser, F. A., Scheidtmann, K. H., Tuazon, P. T., Traugh, J. A., and Walter, G. (1988) Virology 165, 13-22 [CrossRef][Medline] [Order article via Infotrieve]
  30. Garcea, R. L., Talmage, D. A., Harmatz, A., Freund, R., and Benjamin, T. L. (1989) Virology 168, 312-319 [CrossRef][Medline] [Order article via Infotrieve]
  31. Moreland, R. B., Montross, L., and Garcea, R. L. (1991) J. Virol. 65, 1168-1176 [Abstract/Free Full Text]
  32. Montross, L., Watkins, S., Moreland, R. B., Mamon, H., Caspar, D. L. D., and Garcea, R. L. (1991) J. Virol. 65, 4991-4998 [Abstract/Free Full Text]
  33. Aebersold, R. (1989) in A Practical Guide to Protein and Peptide Purification for Microsequencing (Matsudaira, P., ed) pp. 73-88, Academic Press, New York
  34. LeGendre, N., and Matsudaira, P. (1989) in A Practical Guide to Protein and Peptide Purification for Microsequencing (Matsudaira, P., ed) pp. 51-69, Academic Press, New York
  35. McCutchan, J. H., and Pagano, J. S. (1968) J. Natl. Cancer Inst. 41, 351-357
  36. Hirt, B. (1967) J. Mol. Biol. 26, 365-369 [CrossRef][Medline] [Order article via Infotrieve]
  37. Leavitt, A. D., Roberts, T. M., and Garcea, R. L. (1985) J. Biol. Chem. 260, 12803-12809 [Abstract/Free Full Text]
  38. Garcea, R. L., Salunke, D. M., and Caspar, D. L. D. (1987) Nature 329, 86-87 [CrossRef][Medline] [Order article via Infotrieve]
  39. Salunke, D. M., Caspar, D. L. D., and Garcea, R. L. (1986) Cell 46, 895-904 [CrossRef][Medline] [Order article via Infotrieve]
  40. Salunke, D. M., Caspar, D. L. D., and Garcea, R. L. (1989) Biophys. J. 56, 887-900 [Medline] [Order article via Infotrieve]
  41. Parker, P. J., Caudwell, F. B., and Cohen, P. (1983) Eur. J. Biochem. 130, 227-234 [Medline] [Order article via Infotrieve]
  42. Witters, L. A., Tipper, J. P., and Bacon, G. W. (1983) J. Biol. Chem. 258, 5643-5648 [Abstract/Free Full Text]
  43. Liddington, R. C., Yan, Y., Moulai, J., Sahli, R., Benjamin, T. L., and Harrison, S. C. (1991) Nature 354, 278-284 [CrossRef][Medline] [Order article via Infotrieve]
  44. Griffin, J. D., Spangler, G., and Livingston, D. M. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 2610-2614 [Abstract/Free Full Text]
  45. Tjian, R., Robbins, A., and Clark, R. (1979) Cold Spring Harbor Symp. Quant. Biol. 44, 103-111
  46. Scheidtmann, K. H., and Haber, A. (1990) J. Virol. 64, 672-679 [Abstract/Free Full Text]
  47. Carroll, D., Santoro, N., and Marshak, D. R. (1988) Cold Spring Harbor Symp. Quant. Biol. 53, 91-95
  48. Zullo, J., Stiles, C. D., and Garcea, R. L. (1986) Proc. Natl. Acad. Sci. U. S. A. 84, 1210-1214
  49. Glenn, G. M., and Eckhart, W. (1990) J. Virol. 64, 2193-2201 [Abstract/Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
IOVSHome page
P. A. Knepper, A. M. Miller, J. Choi, R. D. Wertz, M. J. Nolan, W. Goossens, S. Whitmer, B. Y. J. T. Yue, R. Ritch, J. M. Liebmann, et al.
Hypophosphorylation of Aqueous Humor sCD44 and Primary Open-Angle Glaucoma
Invest. Ophthalmol. Vis. Sci., August 1, 2005; 46(8): 2829 - 2837.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
B. K. Ganser-Pornillos, U. K. von Schwedler, K. M. Stray, C. Aiken, and W. I. Sundquist
Assembly Properties of the Human Immunodeficiency Virus Type 1 CA Protein
J. Virol., March 1, 2004; 78(5): 2545 - 2552.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
L. Chen and M. M. Fluck
Role of Middle T-Small T in the Lytic Cycle of Polyomavirus: Control of the Early-to-Late Transcriptional Switch and Viral DNA Replication
J. Virol., September 15, 2001; 75(18): 8380 - 8389.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Li, M.
Right arrow Articles by Garcea, R. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Li, M.
Right arrow Articles by Garcea, R. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement