|
|
|
|||||||
|
|||||||||
(Received for publication, May 25, 1995; and in revised form, August 30, 1995) From the
Phosphorylation of the polyomavirus major capsid protein VP1
plays a role in virus assembly and may function in virus-cell
recognition. Previous mapping of the in vivo phosphorylation
sites on VP1 identified phosphorylation of threonine residues Thr-63
and Thr-156 (Li, M., and Garcea, R. L.(1994) J. Virol. 68,
320-327). Phosphoserine was detected in a tryptic phosphopeptide
encompassing residues 58-78. Because of consensus casein kinase
II (CK II) sites in this peptide, we examined the in vitro phosphorylation of the purified recombinant VP1 protein by CK II.
CK II phosphorylated VP1 on serine, and the resulting tryptic
phosphopeptide eluted in a 30-31 min high performance liquid
chromatography fraction corresponding to residues 58-78. The VP1
tryptic phosphopeptide also co-migrated in two-dimensional peptide
analysis with one of the tryptic peptides obtained from VP1 isolated
after in vivo
The polyomavirus capsid is composed of 72 pentamers of the major
coat protein VP1(1) . The minor capsid proteins VP2 and VP3 are
present in approximately one-tenth the abundance of VP1 in the virion
and play an unknown structural role(2) . VP1 is synthesized
late in the viral lytic cycle and transported to the nucleus of the
infected cells where encapsidation of the viral minichromosome occurs.
Studies have suggested that post-translational modifications of VP1
play an important role in virus assembly and cell
infection(3, 4, 5, 6) . VP1 is
phosphorylated in serine and threonine
residues(7, 8) . Recently, we mapped the
phosphorylation sites of VP1 isolated from virus-infected mouse
cells(9) . Threonine phosphorylation of VP1 was identified on
residues Thr-63 and Thr-156 in the BC and DE loops, respectively, which
are exposed on the exterior viral surface(10) . A defect in
virus assembly was associated with a mutation at threonine
156(9) . Serine sites, although present in the same tryptic
phosphopeptides as the threonine sites, could not be assigned because
viruses reconstructed with mutations at these serine residues were
nonviable. Polyoma host-range nontransforming mutant viruses have
genetic alterations in both middle and small tumor (T)-antigens, and
are defective in cell transformation in vitro and tumor
induction in vivo(11) . The host-range nontransforming
mutant viruses are blocked in virus assembly when grown on
nonpermissive cells(3) . The assembly defect of host-range
nontransforming mutant viruses is associated with underphosphorylation
of VP1 on threonine(8) . In vivo phosphate labeling of
VP1 during host-range nontransforming mutant virus infections showed
that phosphorylation of VP1 on both residues Thr-63 and Thr-156 was
defective(9) . This regulation could be controlled by
activation of a cellular kinase, e.g. pp60 Casein kinase II (CK II) (
The peptides
GQPPTPESLTEGGQYYGWSRGINC and DVHGFNKPTDTVNTKGISTPVEGC, corresponding to
residues 59-81 and 138-160 of VP1, were reacted with CK II
in kinase buffer. The
Figure 1:
In vitro phosphorylation of VP1 by CK II. Purified recombinant VP1 protein
was incubated with CK II and [
Immunoprecipitates of VP1 from
virus-infected cells were also tested for associated kinase activity by
direct incubation with [
Figure 2:
HPLC analysis of VP1 tryptic
phosphopeptides. VP1 was either labeled in vivo with
[
Phosphoamino acid analysis of VP1 isolated
from polyomavirus-infected cells showed that the phosphopeptide in the
36-37 min fraction is phosphorylated only on threonine residues (9) and the phosphopeptide in the 30-31 min fraction is
phosphorylated on both threonine and serine residues (Fig. 2B, lane 1). The phosphopeptide in the
30-31 min fraction of in vitro CK II-kinased recombinant
VP1 contained only phosphoserine (Fig. 2B, lane 2).
These results suggest that phosphorylation of VP1 by CK II was
primarily on serine sites between residues 58 and 78. In order to
verify that the in vivo and in vitro phosphopeptides
were identical, they were further analyzed by two-dimensional
phosphopeptide mapping (Fig. 3). The two-dimensional mapping
showed that VP1 isolated from polyomavirus-infected mouse cells has
three phosphopeptide spots (Fig. 3A)(9) .
Phosphopeptide spots 1 and 2 contained phosphothreonine, and spot 3
phosphoserine (9) (data not shown). Recombinant VP1 protein
phosphorylated by CK II showed a major phosphopeptide spot containing
phosphoserine (Fig. 3B; data not shown). When
Figure 3:
Two-dimensional mapping of VP1 tryptic
phosphopeptides. The in vivo
To confirm that VP1 residues 58-78
contained a serine that was a substrate for CK II, a peptide of VP1
corresponding to residues 59-81 was synthesized. This peptide was
incubated with CK II in vitro, and phosphoamino acid analysis
of the reaction product demonstrated phosphoserine (Fig. 4, lane 1). In addition, a peptide corresponding to residues
138-160 (the DE loop of VP1) was also phosphorylated by CK II (Fig. 4, lane 2). This peptide contains a potential
consensus CK II site (residue Thr-156), a site phosphorylated in
vivo. In vitro the intact protein is not phosphorylated
in this region, but the synthetic peptide is phosphorylated on both
serine and threonine. These results suggest that in the intact VP1
pentamer, potential CK II sites are conformationally distinct for
kinase recognition.
Figure 4:
BC and DE loop peptides of VP1 are
phosphorylated by CK II in vitro. BC (lane 1) and DE (lane 2) loop peptides of VP1 were phosphorylated by CK II,
and the phosphorylated peptides were analyzed for phosphoamino
acids.
Figure 5:
In vitro phosphorylation of
mutant VP1 proteins by CK II. Wild-type and mutant VP1 proteins were
incubated with CK II, and the phosphorylated proteins analyzed by
SDS-PAGE and autoradiography. Lanes 1 and 6,
wild-type VP1; lanes 2 and 7, Ala-66 VP1; lane
3, Ala-77 VP1; lanes 4 and 8, Gly-63 VP1; lanes 5 and 9, Ala-156 VP1. Lanes 1-5,
full-length; lanes 6-9,
Figure 6:
In vitro assembly of mutant VP1
proteins. The Ala-77 (A) and Ala-66 (B) mutant VP1
proteins were incubated under assembly conditions and examined by
electron microscopy (see ``Materials and Methods''). The
Ala-77 protein formed typical capsid-like aggregates similar to the
wild-type protein, whereas the Ala-66 protein formed both tubular and
capsid-like structures. Bar equals 100
nm.
These data demonstrate that the polyomavirus major capsid
protein VP1 is an in vitro substrate for phosphorylation by CK
II. VP1, purified after expression in E. coli, was
phosphorylated in vitro by CK II, and phosphoamino acid
analysis demonstrated only phosphoserine residues. The major
phosphorylated serine site modified by casein kinase II was located in
the tryptic peptide encompassing residues 58 to 78. A site-directed
mutant VP1 protein, with a serine-to-alanine change at residue 66, was
defective in CK II phosphorylation. Therefore, Ser-66 is the
phosphorylation site modified by CK II in vitro, and the data
suggest that the in vivo phosphopeptide representing residues
58-78 is also phosphorylated on Ser-66. Recently the VP1
threonine phosphorylation sites were mapped(9) . Two major
phosphopeptides, in residues 58-78 and residues 153-173,
were identified from in vivo In two other well characterized examples of the
consequences of CK II phosphorylation, skeletal muscle glycogen
synthase and acetyl-CoA carboxylase(41, 42) , the
initial phosphorylation does not itself alter the activity of the
substrate but is necessary for subsequent regulatory phosphorylation or
dephosphorylation events. Serine phosphorylation of VP1 appears
constitutive relative to the activity of middle T-antigen which appears
to regulate VP1 threonine phophorylation (8, 30) .
Because only a fraction, estimated by two-dimensional protein gel
electrophoresis as 50% or less, of the VP1 monomers are modified it is
possible that serine modification by a cellular CK II enzyme may affect
the subsequent choice of VP1 molecules for threonine modification. This
choice may dictate that a particular VP1 within a pentameric capsomere
is phosphorylated either on serine or threonine but not both. The in vitro assembly properties of the Ala-66 mutant VP1 protein
demonstrated that this protein was structurally intact, although this
mutant protein had a tendency to self-assemble into not only
capsid-like but also tubular structures. Because inter-capsomere bonds
are formed using the carboxyl termini of VP1 molecules between
pentamers(38, 43) , this result suggests that changes
in Ser-66, located on the surface of the VP1 pentamer(43) , may
influence interactions between VP1 carboxyl termini. This structural
interaction may be relevant to wild-type VP1 molecules phosphorylated
at Ser-66, in that such a modification may facilitate formation of
alternative carboxyl-terminal bonding interactions in the final
capsid(43) . In addition, a perturbation of proper
inter-capsomeric bonding may explain why a virus with the Ala-66
mutation could not be isolated(9) . However, additional studies
of the Ala-66 mutant protein under a variety of assembly conditions (40) will be necessary before the significance of these
structural interactions can be further assessed. For the related
SV40 virus, the large T-antigen CK II phosphorylation has been
associated with other virus infections. CK II levels are stimulated
upon adenovirus infection (12-fold within 15 min) of baby rat kidney
cells(47) . This activation paralleled that seen for CK II in
serum stimulation of WI38 cells, and correlates with the serum response
early gene induction of myc, fos, and jun.
Polyomavirus infection induces the serum response (platelet-derived
growth factor-inducible) genes in a biphasic manner, with accumulation
of these mRNAs 1 to 2 h post-infection associated with capsid protein
addition, and a second phase associated with middle T-antigen
expression(48, 49) . It is possible that CK II may
also be induced during polyomavirus infection so that capsid protein
phosphorylation would be facilitated. Although the biological functions
of VP1 phosphorylation remain undetermined, the position of these sites
on the exterior virion surface suggest a role in cell attachment and
entry. To accomplish such an important function the virus may require
recruitment of specific cellular kinases such as CK II.
Volume 270,
Number 43,
Issue of October 27, 1995 pp. 26006-26011
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
P labeling of virus-infected cells.
A site-directed mutant VP1 protein, Ser-66 to Ala, was phosphorylated
poorly by CK II in vitro. As determined by electron
microscopy, all of the mutant proteins were isolated in pentameric form
similar to the wild-type protein, although the Ala-66 pentamers had a
tendency to self-assemble in vitro into tubular as well as
capsid-like structures. These findings identify Ser-66 as a site of VP1
phosphorylation in vitro, and suggest that VP1 may serve as a
substrate for CK II in vivo.
, or inactivation of a specific
phosphatase, e.g. phosphatase 2A, both activities known to be
associated with middle
T-antigen(12, 13, 14) . VP1 serine
phosphorylation appears constitutive, however, at least in the presence
of an intact large T-antigen(8) .
)is a ubiquitous cyclic nucleotide independent
serine-threonine kinase present in the cell nucleus and
cytoplasm(15, 16) . CK II is activated rapidly when
cells are treated with certain growth factors such as serum, epidermal
growth factor, and insulin-like growth factor (17, 18, 19) . These findings raise the
possibility that CK II plays an important role in cellular activities
related to cell growth and proliferation(20, 21) .
This enzyme has a number of substrates including MYC and
p53(22, 23) . In addition, CK II activity is
stimulated by many of the agents that activate c-fos transcription(18, 24, 25) . These
substrates suggest that CK II may link signal transduction pathways and
nuclear proteins that control cell
proliferation(26, 27) . CK II has also been found to
phosphorylate structural and nonstructural viral proteins such as SV40
large T-antigen and varicella-zoster virus
glycoprotein(28, 29) . The data presented in this
report show that the polyomavirus major capsid protein VP1 is also
phosphorylated by CK II.
Cell Culture and Virus Infection
A31 (Balb/c3T3)
mouse fibroblasts were grown in Dulbecco's modified Eagle's
medium containing 10% fetal calf serum. Cell culture was performed as
previously described(30) . The wild-type polyomavirus strain
used was NG59RA. Virus infections were performed at multiplicities of
5-10 plaque forming units/cell in A31 mouse fibroblasts at
approximately 50% confluence. Following adsorption of polyomavirus,
fresh Dulbecco's modified Eagle's medium supplemented with
2% calf serum was added.In Vivo [
Cells were grown in 100-mm plates and infected
with polyomavirus. At 25-28 h postinfection, cells were washed
with phosphate-free Dulbecco's modified Eagle's medium and
labeled with 2 mCi of [P]Orthophosphate
Labeling
P]orthophosphate
(specific activity 900 mCi/mmol) in 1 ml of phosphate-free
Dulbecco's modified Eagle's medium with 2% dialyzed calf
serum for 4-6 h(9) .
VP1 Immunoprecipitation
Polyomavirus-infected
monolayers were lysed in radioimmunoprecipitation assay buffer (RIPA:
150 mM NaCl, 50 mM Tris-HCl, pH 7.2, 1% Nonidet P-40,
1% sodium deoxycholate, 0.1% SDS). Lysates were cleared by
centrifugation at 12,000 
g for 20 min. The soluble
lysate was incubated with a rabbit anti-VP1 polyclonal antiserum (I58)
at 4 °C for 1 h(31, 32) . The immune complexes
were adsorbed to protein A-Sepharose CL-4B beads (Pharmacia) by a
further incubation for 1 h at 4 °C. The Sepharose beads were washed
three times with phosphate-buffered saline and twice with water.HPLC Phosphopeptide Mapping
Immunoprecipitated VP1
was removed from the protein A-Sepharose beads with SDS sample buffer
(2% SDS, 5% 2-mercaptoethanol, 0.625 M Tris-HCl, pH 6.8, 10%
glycerol) by heating for 5 min at 100 °C. VP1 was resolved by 7.5%
SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and electroblotted to
nitrocellulose with a dry blot apparatus (Hoeffer) as
described(9) . Proteins were stained with 0.1% Ponceau S in 1%
acetic acid for 5 min and destained in 1% acetic acid and washed with
water. The VP1 band was excised and incubated at 37 °C for 30 min
in 0.5% polyvinylpyrrolidone-40 dissolved in 100 mM acetic
acid(33) . Excess polyvinylpyrrolidone-40 was removed by
washing with water 5 times, and the nitrocellulose paper was then cut
into small pieces. VP1 on nitrocellulose was digested with trypsin in
enzyme buffer (100 mM NaHCO
, pH 8.2),
acetonitrile, 95:5 (v/v), at 37 °C overnight. The ratio of trypsin
to VP1 was approximately 1:20 (w/w). The nitrocellulose was removed by
centrifugation at 10,000 g for 5 min and the
supernatant was transferred to a fresh tube and lyophilized under
vacuum. The tryptic peptide pellets were dissolved in 0.1%
trifluoroacetic acid and centrifuged for 5 min at 10,000 g. The supernatant was then analyzed by reverse-phase HPLC
using a C18 column. Peptides were separated with a linear gradient from
0 to 70% acetonitrile in 0.1% trifluoroacetic acid applied with a flow
rate of 200 µl/min over 60 min. The fractions were collected every
1 min. Phosphorylated peptides were detected by scintillation counting. Phosphoamino Acid Analysis
The P-labeled VP1 isolated by immunoprecipitation from in
vivo
P-labeled polyomavirus-infected cells or
recombinant protein phosphorylated in vitro was used for
phosphoamino acid analysis. After SDS-PAGE and electroblotting to
Immobilon-P membrane, the VP1 band was hydrolyzed with
HCl(34) . The hydrolysate was then dissolved in 5 ml of
two-dimensional buffer (7.5% acetic acid, 2.5% formic acid, 0.1% Orange
G) plus 1 mg/ml phosphoserine and phosphothreonine, and spotted onto
Cel 300 TLC plates (Alltech). Electrophoresis was performed in 7.5%
acetic acid, 2.5% formic acid (pH 1.9) for 60 min at 1200 V.
Phosphoamino acids were stained by spraying with 0.1% ninhydrin in
acetone, and developed at 80 °C. The plate was exposed to Kodak
film at -70 °C.
Phosphopeptide Mapping by Two-dimensional
Electrophoresis
Phosphopeptides of VP1 obtained either from
direct tryptic digestion or after HPLC purification were used in
two-dimensional phosphopeptide mapping. The peptide fragments were
spotted to a Cell 300 TLC plate with 5 µl of two-dimensional
buffer. The first dimension electrophoresis was performed in the buffer
described for the phosphoamino acid analysis. The second dimension was
thin-layer chromatography in 38% 1-butanol, 25% pyridine, 7.5% acetic
acid orthogonal to the first dimension(9) . Phosphopeptides
were detected by autoradiography.Site-directed Mutagenesis and Construction of Mutant
Viruses
Mutations were introduced into the VP1 coding region of
polyomavirus using a Muta-Gene M13 in vitro Mutagenesis kit
(Bio-Rad). The VP1 sequence of polyomavirus cloned into M13 mp19 was
used as the template for mutagenesis(9) . A serine to alanine
mutation was introduced at residue 66 of VP1 using the 25-mer
CCCACCCCTGAAGCCCTAACAGAGG, and a serine to alanine change at residue 77
using CTATGGTTGGGCCAGAGGGATTAAT. The mutated VP1 sequence was verified
by dideoxynucleotide chain termination sequencing using the Sequenase
System (U. S. Biochemical Corp.). Mutant viruses Gly-63 and Ala-153
have been described(9) . Mutant polyomavirus genomes were
reconstructed by ligation of the mutant fragment into a wild-type
virus(9) . The reconstructed mutant virus DNA was transfected
into A31 cells by using the DEAE-dextran method(35) . Virus
lysates were obtained by subculturing the transfected cells every
3-4 days until an extensive cytopathic effect developed. Viral
DNA was isolated by the method of Hirt (36) and purified using
Geneclean II Kit (BIO 101).Recombinant VP1 Expression and Purification
The
vector ptacVP1 was used for expression of VP1 in Escherichia coli(37) . Vectors to express site-directed mutant and
carboxyl-terminal deleted forms of VP1 in E. coli were
prepared using ptacVP1. The site-directed mutant VP1 was constructed by
inserting the HindIII-XbaI fragment of the
reconstructed mutant polyomavirus into HindIII-XbaI-digested ptacVP1. Carboxyl-terminal
deletions of VP1 were constructed as described (38) with slight
modification. The plasmid ptacVP1 containing the introduced mutation
was digested with NcoI, and the large DNA fragment was
isolated using Geneclean II Kit (BIO 101). This fragment was then
digested with S1 nuclease. The blunt-ended DNA was ligated with T4 DNA
ligase. The truncated VP1 protein was purified as described (37) .In Vitro Phosphorylation of VP1 and VP1 Peptides by
Casein Kinase II
VP1 obtained after the phosphocellulose
purification step was dialyzed into kinase buffer (10 mM
MgCl, 150 mM KCl, 50 mM Tris-HCl, pH
7.5). The phosphorylation of VP1 was carried out in kinase buffer
containing 30 µg of VP1, 10 µCi of
[-
P]ATP (specific activity 3000 Ci/mmol),
and 20 ng of CK II (Upstate Biotechnology) or 200 microunits of CK II
(Boehringer-Mannheim) for 1 h at 30 °C. Enzymes from both vendors
gave equivalent results. CK II phosphorylation of VP1
immunoprecipitates from virus-infected cells was performed by washing
the immunoprecipitates twice with phosphate-buffered saline and once
with kinase buffer. 10 µCi of [
-
P]ATP
was then added with or without CK II.
P-labeled peptide was spotted on
Immobilon-P membrane and free [
-
P]ATP
eluted with water. The peptide was then subjected to phosphoamino acid
analysis.
Electron Microscopy
VP1 proteins obtained after
the phosphocellulose purification step were incubated in 2 M NaCl, 0.1 mM CaCl, 50 mM Tris-HCl
(pH 7.2), for 4 days at 4 °C. Samples were applied to
glow-discharged carbon-coated 400 mesh grids and stained with 2% uranyl
acetate. Images were taken on a Philips CM 10 electron microscope at a
magnification of approximately 40,000.
In Vitro Phosphorylation of VP1 by Casein Kinase
II
Sequences in VP1 containing a CK II phosphorylation site
motif ((S/T)XX(D/E)) were identified by inspection. The
presence of these putative sites prompted us to investigate whether CK
II could phosphorylate VP1 in vitro. Recombinant VP1 proteins,
purified after expression in E. coli, were used as substrates
in in vitro kinase reactions with CK II. These proteins are
purified as pentamers which resemble the capsomeric subunits of the
virion(39) . Because the full-length protein has the potential
for self-assembly into capsid-like structures in
vitro(39) , a carboxyl-terminal 63 amino acid deleted form
of VP1 (
NCOVP1;(38) ) which is unable to assemble into
capsids but is otherwise structurally intact, was also tested as a
substrate. As shown in Fig. 1, recombinant VP1 was
phosphorylated by CK II. The minor Coomassie Blue-stained band in lanes 1 and 2 (Fig. 1A) migrating
slightly above the position of the NCOVP1 band in lanes 3 and 4, represents a proteolytic cleavage product of VP1,
which has deleted the first 27 amino acids of the protein(31) .
Both the partially proteolyzed species and NCOVP1 were also
substrates for CK II (Fig. 1B, lanes 2 and 4).
Phosphoamino acid analysis of the kinased proteins revealed that CK II
phosphorylated both VP1 and NCOVP1 on serine only (Fig. 1C).
-
P]ATP, and
the products analyzed by SDS-PAGE and autoradiography. Panel
A, Coomassie Blue stained; and panel B, autoradiogram.
Full-length VP1 (lanes 1 and 2) and
NCOVP1 (lanes 3 and 4) were incubated with (lanes 2 and 4) or without (lanes 1 and 3) CK
II. Panel C, phosphoamino acid analysis of the P-labeled VP1 (full-length, lane 1;
NCOVP1, lane 2).
-
P]ATP (data not
shown). No significant VP1 ``autophosphorylation'' was
detected and the addition of CK II to the immunoprecipitates did not
lead to increased VP1 phosphorylation. Mitogen-associated protein
(p44), cdc2 (p34), and cdk2 kinases were also tested for their ability
to phosphorylate VP1 in vitro. (
)Mitogen-associated
protein kinase did not phosphorylate VP1. cdc2 and cdk2 kinases did
phosphorylate VP1 in vitro, but the tryptic phosphopeptides
resulting from these reactions did not correspond with those seen in vivo (see below) and these enzymes were therefore not
further characterized.Analysis of Phosphopeptides by HPLC and Two-dimensional
Peptide Mapping
To characterize the site(s) phosphorylated by CK
II, we analyzed VP1 tryptic phosphopeptides by HPLC. Fig. 2shows that two phosphopeptide peaks (30-31 min and
36-37 min fractions) were detected in VP1 isolated after in
vivoP labeling of polyomavirus-infected cells. In
contrast, only one major phosphopeptide peak (30-31 min fraction)
was detected for the recombinant VP1 protein phosphorylated by CK II in vitro, with a variable shoulder peak (28-29 min
fraction). Tryptic phosphopeptides eluting in the 30-31 min and
36-37 min fractions have been previously identified as
corresponding to residues 58-78 and 153-183,
respectively(9) .
P]orthophosphate or in vitro by CK II. Panel A, the tryptic peptides from in vivo (
)
and in vitro (
) P-labeled VP1 were
fractionated by C18 reverse-phase HPLC. Panel B,
phosphopeptides (30-31 min fraction) from in vivo (lane 1) and in vitro (lane 2)
P labeling were subjected to phosphoamino acid
analysis.
P-labeled VP1 from polyomavirus-infected cells was mixed
with the recombinant VP1 phosphorylated by CK II, spot 3 from the in vivo labeled VP1 co-migrated with the phosphopeptide
generated by CK II (Fig. 3C). HPLC analysis showed that
both spots 2 and 3 eluted in the 30-31 min fraction (9) (data not shown). This result may be due to two different
peptides eluting coincidently from the 30-31 min fraction, or the
same peptide which has been differentially modified. The
two-dimensional chromatography analysis supports the latter, suggesting
that the peptide from residues 58 to 78 is phosphorylated on either
threonine or serine residues, but not both, and each of these
modifications yields a distinctive species in the two-dimensional
chromatogram (spot 2 or 3).
P-labeled VP1 and
VP1 phosphorylated by CK II in vitro were digested with
trypsin, and analyzed by two-dimensional phosphopeptide mapping. A,
P-labeled VP1 from polyomavirusinfected cells; B, recombinant VP1 protein phosphorylated in vitro by
CK II; C, a mixture of samples in panels A and B.
VP1 Is Phosphorylated by CK II on Serine 66
Two
serine residues, Ser-66 and Ser-77, are found between residues 58 and
78. Serine 66 is a CK II phosphorylation site based on the motif of
(S/T)XX(D/E), whereas Ser-77 is not a consensus CK II site.
Site-directed mutations were introduced into the polyomavirus genome,
substituting alanine for serine at these residues. Neither
reconstructed mutant virus (Ala-66 and Ala-77) could be isolated (9) (data not shown), and therefore determination of the in
vivo phosphorylation site could not be confirmed in this manner.
Both the Ala-66 and Ala-77 mutations were also introduced into the VP1
expression vector, ptacVP1. The mutant recombinant VP1 proteins were
purified, and analyzed for phosphorylation by CK II. The wild-type VP1
and two additional proteins Gly-63 (Thr-63 to Gly) and Ala-156 (Thr-156
to Ala) as well as Ala-77 were phosphorylated by CK II, both as
full-length and carboxyl-terminal deleted proteins (Fig. 5B). The mutant protein Ala-66 was not
significantly phosphorylated by CK II (Fig. 5B, lanes 2 and 7). This result demonstrates that VP1 is
phosphorylated in vitro on Ser-66, and not Ser-77, by CK II.
NCOVP1 variants of these
proteins. A, Coomassie Blue stain; B,
autoradiogram.
Electron Microscopy of Mutant VP1 Proteins
The
purified recombinant VP1 protein is isolated as pentamers resembling
viral capsomeres, which can self-assemble in vitro into
capsid-like structures(39) . In order to assess the structural
integrity of the mutant VP1 proteins they were analyzed by electron
microscopy for pentamer structure and in vitro capsid
self-assembly. All mutant proteins (Ala-66, Ala-77, Gly-63, and
Ala-156) appeared as pentamers resembling wild-type pentamers (data not
shown). However, when subjected to conditions which promote in
vitro capsid assembly, i.e. high ionic strength and
calcium(39, 40) , the Ala-66 mutant protein had a
tendency to form tubular structures as well as capsid-like aggregates (Fig. 6). Thus, although the Ala-66 mutation did not affect
pentamer formation, changes in the Ser-66 residue may influence the
formation of higher order aggregates of VP1.
P labeling
polyomavirus-infected cells. Viruses with site-directed mutations
confirmed that VP1 was phosphorylated on Thr-63 and Thr-156. However,
the serine phosphorylation site(s) was unidentified because mutant
viruses with substitutions at possible serine residues (Ser-66 and
Ser-77) were non-viable. We conclude from this previous result that
Ser-66 is essential for virus growth. HPLC analysis from in vivo
P labeling polyomavirus-infected cells showed that
the peptides eluted in the 30-31 min fraction were phosphorylated
on both threonine and serine residues. Two-dimensional peptide mapping
showed that the peptide fragments eluted from this fraction migrated in
different locations (Fig. 2). However, the fragments in the
30-31 min fraction contained only one peptide sequence from
residue 58 to 78 determined by NH
-terminal sequencing and
mass spectrometry(9) . Therefore, we conclude that
phosphorylation of Thr-63 and Ser-66 occur in different VP1 monomers.
VP1 isolated from polyomavirus-infected cells contains at least four
isoelectric subspecies identified by two-dimensional protein gel
analysis(3, 4) . Several of these subspecies may
represent distinct monophosphorylated molecules rather than multiply
modified forms.p53 complex isolated from
virus-infected cells is associated (in immunoprecipitates) with a
serine-specific kinase activity(44, 45) . This
activity autophosphorylates T-antigen on many of the same sites seen
for in vitro phosphorylation(29) . The two-dimensional
phosphopeptide map of SV40 large T-antigen was nearly reproduced in
vitro by the combination of CK I and CK II, and thus some of the
associated kinase activity may be related to their association with the
T-antigenp53 complex(29, 46) . p53 is also a
substrate for CK II phosphorylation in vitro(23) ,
consistent with the findings from the in vivo T-antigen
associated kinase results. p53 is phosphorylated to a higher level
(10-fold) in SV40-infected cells, suggesting that its growth
suppressive activity may be inhibited by its
phosphorylation(46) .
))
We thank Jim Lee and Paul Morrison of the Dana-Farber
Molecular Biology Core Facility for assistance with peptide synthesis,
and Patti Estes for expert technical assistance.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  P. A. Knepper, A. M. Miller, J. Choi, R. D. Wertz, M. J. Nolan, W. Goossens, S. Whitmer, B. Y. J. T. Yue, R. Ritch, J. M. Liebmann, et al. Hypophosphorylation of Aqueous Humor sCD44 and Primary Open-Angle Glaucoma Invest. Ophthalmol. Vis. Sci., August 1, 2005; 46(8): 2829 - 2837. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. K. Ganser-Pornillos, U. K. von Schwedler, K. M. Stray, C. Aiken, and W. I. Sundquist Assembly Properties of the Human Immunodeficiency Virus Type 1 CA Protein J. Virol., March 1, 2004; 78(5): 2545 - 2552. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Chen and M. M. Fluck Role of Middle T-Small T in the Lytic Cycle of Polyomavirus: Control of the Early-to-Late Transcriptional Switch and Viral DNA Replication J. Virol., September 15, 2001; 75(18): 8380 - 8389. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |