|
|
|
|||||||
|
|||||||||
(Received for publication, July 24, 1995) From the
Despite the presence of the multiple subunits (
GABA
Figure 1:
Northern analysis and 3`-RACE assays
with mRNAs from HEK293 cells transfected with the tandem construct of
We examined whether GABA induces Cl
Figure 2:
Pharmacological characterizations of the
GABA-induced currents in the cells transfected with the
Figure 3:
Dose-response profiles for GABA-induced
Cl
Earlier electrophysiological and binding studies have shown that
properties of the receptors expressed in HEK293 cells or Sf-9 cells are
indistinguishable, but the latter, a high expression eucaryotic system,
is more reliable for radioactive ligand binding
experiments(18, 20) . Thus, Sf-9 cells were infected
with recombinant baculovirus carrying the tandem construct alone or in
combination with that for
Figure 4:
Plots for
[
Binding of [ In this study we have shown that expression of the tandem
construct of We also
propose the orientation of the subunits in the Of considerable interest is the appearance of the high
affinity GABA site without Cl
Volume 270,
Number 44,
Issue of November 3, 1995 pp. 26063-26066
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
6-
2 GABA
Receptor Subunit Requires a Monomeric Subunit of
6 or
2 (*)
, 
,
, and
) and their isoforms for
-aminobutyric acid, type
A (GABA
) receptors in mammalian brains, the
x22 subtypes appear to be the prototype GABA
receptors sharing many properties with native neuronal receptors.
In order to gain insight into their subunit stoichiometry and
orientation, we prepared a tandem construct of the 6 and 2
subunit cDNAs where the carboxyl-terminal of 6 is linked to the
amino-terminal of 2 via a linker encoding 10 glutamine residues.
Transfection of human embryonic kidney 293 cells with the tandem
construct alone failed to induce GABA-dependent Cl currents, but its cotransfection with the cDNA for
6 or
2, but not
2, led to the appearance of GABA currents which
were picrotoxin-sensitive and, in the case of 2 containing
receptors, responded to a benzodiazepine agonist, U-92330. The high
affinity GABA site, however, was detected with
[
H]muscimol binding in all combinations of the
receptor subunits, including the tandem construct alone or with the
2. No appreciable differences were found in their K (2.5 nM) and B
values (1.4 pmol/mg of protein). These data
are consistent with the view that the polypeptides arising from the
tandem construct were expressed with the high affinity GABA site, but
unable to form GABA channels. The requirement of a specific monomeric
subunit (6 or 2) for the tandem construct to express
Cl
currents supports a pentameric structure of
GABA
receptors consisting of two 6, two 2, and
one 2 for the
622 and three
6 and two 2
for the 62 subtype.
(
)receptors, responsible for
inhibitory neurotransmission in mammalian brains, are ligand-gated
Cl channels made of various subunits (
, ,
, and
)(1, 2, 3) . Each subunit
consists of several isoforms and contains four transmembrane-spanning
segments (M1 to
M4)(1, 2, 3, 4, 5) .
Despite the existence of the multiple subunits and their isoforms,
combinations of
x, 2, and 2 subunits produced
Cl
channels sharing many functional characteristics
with native neuronal receptors and displaying the ability to respond to
all the GABA
receptor ligands known
up-to-date(1, 3, 6, 7) . Such cloned
GABA receptors have been proposed to be of pentameric
structure with M2 lining the pore in analogy with another member of the
four transmembrane ligand-gated channel family, acetylcholine
receptors(1, 2, 3) . Recent studies,
including immunoprecipitation with subunit specific antibodies, have
shown the presence of two subunits per GABA receptor (8, 9, 10, 11) . Further
experimental evidence is needed, however, about the stoichiometry of
the recombinant GABA receptors of x22 and
their modes of association. One way to gain insight into this
structural issue is to predetermine the alignment of subunits via gene
fusion and to study such fused gene products. Similar approaches have
been successful with potassium channels made of their subunits in
concatameric or tandem linkages(12, 13) . In this
study we prepared a tandem construct of
6 and 2 subunit cDNAs
of the GABA receptor where the carboxyl-terminal of the
6 cDNA is linked to the amino-terminal of the 2 cDNA via a
synthetic oligonucleotide encoding 10 glutamine residues. In order to
study their properties, the tandem construct alone or in combination of
the monomeric 6, 2, and 2 subunit cDNA was expressed in
human embryonic kidney cells (HEK293 cells). Also, recombinant
baculovirus carrying the tandem construct or monomeric subunits was
prepared for high level of expression in Sf-9 cells.
Construction of the
The coding regions of the 6-2 Tandem
Subunit6 and 2 subunits
were isolated upon digestion of the mammalian expression vectors
containing the specific GABA receptor subunit
cDNA(14) . For 6, ClaI cut the vector at the
molecular cloning site near the 5` end of the insert, and ScaI
cut the vector at a site near the 3` end of the insert, which is 9
bases upstream from the stop codon. This restriction digestion yielded
a fragment of expected size, 1377 bp. For 2, Kpn2I cut
the vector at a site near the 5` end, which is 11 bases downstream from
the start codon, and EcoRI cut the vector at the 3` ends of
the insert, including the stop codon. A double-stranded oligonucleotide
(61-mer) was purchased (Genosys) with a sequence of 5`-
ACTGTCGAGCAGCAGCAACAGCAGCAACAGCAGCAACAGATGTGGAGAGTCCGGAAAAGGG-3`. In
this linker, the first 9 bp represent the 6 sequence before the
stop codon beginning with the distal half of the ScaI
recognition site, the next 30 bp represent 10 glutamine residues, and
the last 22 bp represent the 2 sequence, including the start codon
(ATG) and the recognition site for Kpn2I with an overhang at
the 3` end. The fragment representing the rest of the expression vector
was isolated by digestion with ClaI and EcoRI.
Ligation products were formed from all the four fragments with proper
sticky ends and were used to transform the competent Epicurean coli SCS1 strain (Stratagene). The correct plasmid was selected with
polymerase chain reaction (PCR) using a primer pair, one of which
anneals to the glutamine linker, and was verified with sequencing.
Human embryonic kidney cells (HEK293 cells, ATCC CRL 1573) were
transfected with the vector carrying the tandem cDNA alone or with
6, 2, or 2 cDNA in a 2:1 ratio (4 to 2 µg/36-mm
culture dish), in the presence of a transfection reagent, DOTAP
(Boehringer Mannheim Gmbh). For infection of insect Sf-9 cells,
recombinant baculoviruses were prepared using a vector, PVL 1393
(Pharmingen), carrying the tandem
6-2 construct or the cDNA
for 6, 2, or 2. All other procedures for DNA analysis,
construction, and purification were described elsewhere(15) .
Northern Blotting and 3`-RACE Assays
mRNAs were
prepared in the presence of guanidium thiocyanate from HEK293 cells
transfected with the carriers of indicated GABA receptor
subunit cDNAs. Northern blotting was carried out with nylon transfer
membranes, following the procedures provided by Schleicher and Schuell.
The P Probes for
6 and 2 were prepared from PCR
which were carried out in a 50-µl volume using 1 unit of Amplitaq
DNA polymerase (Perkin-Elmer) in the vender-supplied buffer, 20
µM dNTP ([-P]dCTP), the
respective cDNA as a template, and selective primer pairs annealing to
the 5` and 3` end of the coding region of the template cDNA. The cycle
parameters were at 94 °C for 1 min, 55 °C for 30 s, and 72
°C for 1-3 min, depending on the expected product size, with
a final extension at 72 °C for 10 min after 30 cycles. The
radioactive probes were purified using a Qiagen column and used within
a few days. Fig. 1shows Northern analysis of the mRNA
preparations from HEK293 cells which were transfected with the tandem
construct of
6 and 2 subunits (6-2) alone or in
combination with 2. For the sake of comparison, authentic mRNAs
for individual subunits were prepared using a transcription in
vitro system with sp6 RNA polymerase (Promega) and linearized
vectors at the 3` end of the coding region. In the analysis, stringent
washing conditions were employed under which the
P-labeled
probe for the
6 subunit interacted only with 6 mRNA, but not
with 2 or 2 mRNA (Fig. 1A). In the mRNA
preparations from HEK293 cells transfected with
6-2 alone or
in combination with 2, the
P-labeled
6 probe
interacted with a single band of an estimated molecular mass of about
3.5 kDa (judging from RNA molecular mass standards and as compared with
the 6 mRNA of 1.7 kDa) (Fig. 1A). The P-labeled
2 probe detected the same band as expected
from the tandem construct (data not shown). The mRNA species for the
tandem construct was further confirmed by the 3`-RACE following the
procedures provided by Life Technologies, Inc. (Fig. 1B). Briefly, following reverse transcription of
the mRNA preparations using 3`-RACE adaptor primer
((dT)CATGATRCAGCTGCGCACCGG), PCR was carried out with a
primer specific for the
6 or 2 and the universal
amplification primer (the vender provided). The primer for 6 was a
23-mer beginning at the base 400 of 6 (5`-CGGACACATTTTTCCACAATGGG)
and that for 2 was a 21-mer beginning at the base 1051 of 2
(5`-GGTCAACTACATCTTCTTTGG). In HEK293 cells transfected with 6,
2, and 2 subunits, PCR with the
6 primer and the
universal primer produced one product with an expected size of 1491 bp
and with the 2 primer also produced a single product with an
expected size of 1743 bp. In the cells transfected with the tandem
construct, PCR with the 6 primer and the universal primer produced
one product matching with the expected size of 3663 bp for the
6-2, and similar PCR with the 2-specific primer and the
universal primer produced the product of the same size (1743 bp) as the
one found in the cells transfected with 2 monomers. These data
confirmed the proper construction of 6 and 2 subunits in
tandem as described above and have established its in vivo
transcription.
6 and 2 GABA receptor subunit cDNAs. The cells
were grown to about 70% confluence in a 75-cm
culture flask
and incubated in the presence of the tandem construct of 6-2
(8 µg) or with the cDNA for 2 (4 µg) and DOTAP (60 µl)
for 24 h. The cells were harvested 24 h later, and mRNAs were prepared
in the presence of guanidium thiocyanate following the standard
procedures. A, Northern blotting was carried out with nylon
membranes containing 10 µg of extracted mRNAs after resolution on a
1% agarose gel, following the vender-provided procedures. The
P-labeled probe for the
6 was prepared using PCR in
the presence of [-P]dCTP. The
6,
2, and 2 mRNAs were prepared in vitro using a
Promega transcription kit. B, 3`-RACE assays were carried out
using the kit from Life Technologies, Inc., the universal primer and
the
6 specific primer (a) or the 2-specific primer (b). The detailed information for the primers and PCR reaction
were described under ``Materials and
Methods.''
Electrophysiology
The whole cell patch clamp
technique (16) was used to record the GABA-mediated
Cl currents in HEK293 cells (48 h after
transfection), with the pipette solution containing (mM) 140
CsCl, 11 EGTA, 4 MgCl
, 2 ATP, and 10 Hepes, pH 7.3, and
with the external solution containing (mM) 135 NaCl, 5 KCl, 1
MgCl, 1.8 CaCl2, and 5 Hepes, pH 7.2 (17) . GABA
and drugs were dissolved in the external solution and were applied
through a U-tube placed within 100 µm of the target cell.Binding Studies
Sf-9 cells were infected with the
baculovirus carrying the recombinant cDNAs as described previously (18) . Binding of radioactive ligands was measured in the Sf-9
cell membranes, using filtration techniques as described
elsewhere(19, 31) . Briefly,
[H]muscimol or [H]Ro
15-4513 binding was measured in the medium containing 118 mM NaCl, 5 mM KCl, 2 mM CaCl, 2
mM MgCl, 20 mM Hepes/Tris, pH 7.3, the
radioactive ligand at various concentrations (1-40 nM),
30 µg of membrane proteins in a total volume of 500 µl at 4
°C for 60 min. Nonspecific binding was estimated in the presence of
excess unlabeled ligands and was subtracted to compute specific binding
as described earlier(19, 31) .
currents in HEK293 cells transfected with the GABA
receptor
cDNAs, using the whole cell patch clamp technique. In the cells
transfected with the tandem construct alone, no currents were detected
upon application of GABA at 1-20 µM (with more than
30 patches). If GABA receptors are pentameric as proposed,
functional expression of the tandem construct of 6-2 would
require the presence of monomeric subunits. Therefore, HEK293 cells
were transfected with the 6-2 and one of the monomeric
subunits. Addition of 6 or 2, but not
2, led to the
appearance of GABA-induced whole cell currents, which were sensitive to
picrotoxin, a specific inhibitor of GABA receptor
Cl currents (Fig. 2). Moreover, a
benzodiazepine agonist, U-92330(19, 31) , enhanced
GABA currents by 136 ± 9% in the receptor made of
6-2
plus 2, but had no effect on that made of
6-2 plus
6 (0 ± 5%) (Fig. 2). The picrotoxin sensitivity and
the 2-dependent interaction with the benzodiazepine site ligand
have already been known in the
62 and 622
subtypes of GABA
receptors(16, 19, 31) . It should be also
noted that no GABA-induced Cl currents were detected
in the whole cell patch with HEK293 cells (or Sf-9 cells) transfected
(or infected) with the subunit of
6, 2, or 2
alone(19, 31) . GABA dose-dependently increased
Cl
currents in the cells transfected with
6-2 plus 6 or plus 2 (Fig. 3). Analysis of
the data with a logistic equation of E/E
=
[GABA]
/(K
+ [GABA]) yielded a half-maximal GABA
concentration (K) of 1.5 ± 0.1 and 1.5
± 0.3 in the 6-2 plus 6 and the 6-2
plus 2 receptors, respectively. The slope factor (
)
was 1.3 for both. These values are in the same range as that for the
622 subtype assembled with individual subunits, the K
of 1.7 ± 0.5 and of 1.4.
6-2
in combination with 6 or 2 subunit cDNA. HEK293 cells were
grown on coverslips in a 36-mm culture dish to 70% confluence and
incubated with the mixture containing
6-2 construct (4
µg) with 2 µg of 6 or 2 plasmids and DOTAP for 24 h.
GABA-induced Cl
currents were measured 24 h after
transfection in the whole cell patch clamp technique. The downward
deflection represents the efflux of Cl
upon
application of GABA at 1 µM at a holding potential of
-30 mV under a symmetrical Cl
gradient.
Picrotoxin (20 µM) and U-92330 (5 µM) were
dissolved in the extracellular solution containing GABA (1
µM) and were applied to the cells. The vertical
calibration bar represents 100 pA for the upper traces and 200 pA for the lower traces, and the horizontal bar
= 30 s.
currents in recombinant GABA
receptors. HEK293 cells transfected with the 6, 2, and 2
plasmids, or with the
6-2 tandem construct plus 6 or
2 plasmids, as described in the legend of Fig. 2.
Cl
currents were induced by a 10-s pulse of GABA at
0.5-10 µM, and the peak amplitude was plotted as a
function of GABA concentrations. The data fit with a logistic equation
(see text). The data represent the mean ± S.E. from at least
three experiments.
6, 2, or 2 cDNA. Binding
experiments were carried out with [
H]muscimol and
[H]Ro 15-4513, the ligands for high
affinity GABA site and the benzodiazepine site, respectively. The data
were analyzed with Scatchard analysis (Table 1, Fig. 4).
[H]Muscimol binding was observed in all the cell
membranes, including the cells infected with 6-2 alone or in
combination with one of the monomers. The K
value
for [H]muscimol (the high affinity GABA site) was
2.5 ± 0.2, 2.6 ± 0.3, 2.7 ± 0.2, and 2.1 ±
0.2 nM for the receptors from 6-2 alone or with
6, 2, or 2, respectively. Also, the maximal binding
level was not noticeably variable among those receptors, ranging from
1.6 to 1.2 pmol/mg of protein. Despite the high expression of the high
affinity GABA site, the Sf-9 cells expressing the
6-2 alone
again failed to produce Cl currents upon GABA (5
µM) application.
H]muscimol binding. Binding was measured in the
membranes from the Sf-9 cells expressing the 6-2 alone
(
) or with 2 subunit cDNA (
) using filtration
techniques as described under ``Materials and Methods'' The
data were fit with a one-site binding isotherm and were also shown in a
Scatchard analysis (inset). The data represent the average of
three measurements, and the binding parameters are shown in Table 1.
H]Ro
15-4513 (a benzodiazepine site ligand) was observed only in the
membranes from the cells infected with 6-2 with 2 as
expected (see above). The B
for the
benzodiazepine site ligand was similar to that for
[H]muscimol, suggesting all the receptors
containing both the high affinity GABA site and benzodiazepine site.
6-2 subunit cDNA alone failed to produce
Cl currents in response to GABA application, but in
the presence of the monomeric subunit of
6 or 2 subunit, its
expression led to the appearance of GABA- and picrotoxin-sensitive
Cl
currents. This could be interpreted to mean that
the tandem construct alone forms receptors with only even-numbered
subunits, which are not functional (no chloride channels), but in the
presence of the monomeric subunit of
6 or 2, forms a
functional pentameric receptor with Cl
channels. This
interpretation led us to propose that the functional
receptor/Cl
channels may consist of two
6-2
and one 6 or 2. Since these receptors displayed similar
functional and pharmacological properties with the monomeric
622 or
62 subtypes, we propose that the
622 subtype consists of two
6, two 2, and one
2 subunits and that the
62 subtype consists of three
6 and two 2 subunits. This proposal is in agreement with
earlier immunoprecipitation studies which indicated the presence of two
subunits in the subtypes of cloned GABA
receptors(8, 9, 10, 11) . An
alternative interpretation of our results is that the functional
receptors of 622 would be made of one
6-2 and
three monomeric 2, leading to one
6 subunit per receptor.
This is incompatible with the presence of two subunits per
receptor already shown by the immunoprecipitation
studies(8, 9, 10, 11) .622
subtype to be
6-2-6-2-2. Such an arrangement
could minimize interactions between homologous subunits and domains and
accommodate two
6-2 tandem subunits per receptor. This
arrangement is also compatible with the assignment of the
benzodiazepine site at the interface between 6 and 2 subunits (22, 23, 24) , with the N-terminal of
6
involved in the formation of the benzodiazepine
site(14, 25) . Future study with the tandem
2-
6, 2-6, and 2-2, where the hyphen
represents a C- to N-terminal linkage, will be useful to test this
proposal.
channels in the cells
expressing the
6-2 construct alone. Two types of GABA sites
are known to be on GABA receptors, the high affinity site
with nanomolar dissociation constants and low affinity sites with
micromolar dissociation constants(1, 21) . The high
affinity GABA site has been reported on the
subunit(1, 26) , and low affinity GABA sites were not
localized yet, but their affinity was markedly affected by mutations on
the subunit (27) and different
isoforms(7, 28, 29) . This indicates that low
affinity GABA sites could be influenced by secondary, tertiary, and
quaternary interactions among the subunits. Furthermore, its occupancy
seems to lead to channel openings, because the Hill coefficient of near
2 was observed for GABA currents and no channel openings were observed
with GABA at concentrations occupying nearly 70% of the high affinity
sites(29, 30) . It appears that the formation of low
affinity GABA sites and GABA-sensitive Cl channels
require association of proper five receptor subunits, which could not
be achieved with the tandem
6-2 construct alone.
), -aminobutyric acid, type
A; bp, base pair(s); PCR, polymerase chain reaction; DOTAP, N-[1[(2-,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium
methyl sulfate; RACE, rapid amplification of cDNA ends.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
ABSTRACT
This article has been cited by other articles:
|
|
 |
|
  G. Akk, P. Li, J. Bracamontes, and J. H. Steinbach Activation and Modulation of Concatemeric GABA-A Receptors Expressed in Human Embryonic Kidney Cells Mol. Pharmacol., June 1, 2009; 75(6): 1400 - 1411. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. R. Bracamontes and J. H. Steinbach Steroid Interaction with a Single Potentiating Site Is Sufficient to Modulate GABA-A Receptor Function Mol. Pharmacol., April 1, 2009; 75(4): 973 - 981. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. W. Olsen and W. Sieghart International Union of Pharmacology. LXX. Subtypes of {gamma}-Aminobutyric AcidA Receptors: Classification on the Basis of Subunit Composition, Pharmacology, and Function. Update Pharmacol. Rev., September 1, 2008; 60(3): 243 - 260. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 I. Sarto-Jackson, R. Furtmueller, M. Ernst, S. Huck, and W. Sieghart Spontaneous Cross-link of Mutated {alpha}1 Subunits during GABAA Receptor Assembly J. Biol. Chem., February 16, 2007; 282(7): 4354 - 4363. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
P. J. Groot-Kormelink, S. Broadbent, M. Beato, and L. G. Sivilotti Constraining the Expression of Nicotinic Acetylcholine Receptors by Using Pentameric Constructs Mol. Pharmacol., February 1, 2006; 69(2): 558 - 563. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A. J. Boileau, R. A. Pearce, and C. Czajkowski Tandem Subunits Effectively Constrain GABAA Receptor Stoichiometry and Recapitulate Receptor Kinetics But Are Insensitive to GABAA Receptor-Associated Protein J. Neurosci., December 7, 2005; 25(49): 11219 - 11230. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. G. Newell, R. A. McDevitt, and C. Czajkowski Mutation of Glutamate 155 of the GABAA Receptor {beta}2 Subunit Produces a Spontaneously Open Channel: A Trigger for Channel Activation J. Neurosci., December 15, 2004; 24(50): 11226 - 11235. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. J. Groot-Kormelink, S. D. Broadbent, J. P. Boorman, and L. G. Sivilotti Incomplete Incorporation of Tandem Subunits in Recombinant Neuronal Nicotinic Receptors J. Gen. Physiol., June 1, 2004; 123(6): 697 - 708. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. N. Goren, D. C. Reeves, and M. H. Akabas Loose Protein Packing around the Extracellular Half of the GABAA Receptor {beta}1 Subunit M2 Channel-lining Segment J. Biol. Chem., March 19, 2004; 279(12): 11198 - 11205. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Bali and M. H. Akabas Defining the Propofol Binding Site Location on the GABAA Receptor Mol. Pharmacol., January 1, 2004; 65(1): 68 - 76. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Zhou, M. E. Nelson, A. Kuryatov, C. Choi, J. Cooper, and J. Lindstrom Human {alpha}4{beta}2 Acetylcholine Receptors Formed from Linked Subunits J. Neurosci., October 8, 2003; 23(27): 9004 - 9015. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Schorge and D. Colquhoun Studies of NMDA Receptor Function and Stoichiometry with Truncated and Tandem Subunits J. Neurosci., February 15, 2003; 23(4): 1151 - 1158. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
K. Bollan, D. King, L. A. Robertson, K. Brown, P. M. Taylor, S. J. Moss, and C. N. Connolly GABAA Receptor Composition Is Determined by Distinct Assembly Signals within alpha and beta Subunits J. Biol. Chem., February 7, 2003; 278(7): 4747 - 4755. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Nicke, J. Rettinger, and G. Schmalzing Monomeric and Dimeric Byproducts are the Principal Functional Elements of Higher Order P2X1 Concatamers Mol. Pharmacol., January 1, 2003; 63(1): 243 - 252. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Sarto, T. Klausberger, N. Ehya, B. Mayer, K. Fuchs, and W. Sieghart A Novel Site on gamma 3 Subunits Important for Assembly of GABAA Receptors J. Biol. Chem., August 16, 2002; 277(34): 30656 - 30664. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. B. Christie, C. P. Miralles, and A. L. De Blas GABAergic Innervation Organizes Synaptic and Extrasynaptic GABAA Receptor Clustering in Cultured Hippocampal Neurons J. Neurosci., February 1, 2002; 22(3): 684 - 697. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. A Davies, E. F Kirkness, and T. G Hales Evidence for the formation of functionally distinct {alpha}{beta}{gamma}{varepsilon} GABAA receptors J. Physiol., November 15, 2001; 537(1): 101 - 113. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Smith, L. Alder, J. Silk, C. Adkins, A. E. Fletcher, T. Scales, J. Kerby, G. Marshall, K. A. Wafford, R. M. McKernan, et al. Effect of alpha Subunit on Allosteric Modulation of Ion Channel Function in Stably Expressed Human Recombinant gamma -Aminobutyric AcidA Receptors Determined Using 36Cl Ion Flux Mol. Pharmacol., April 16, 2001; 59(5): 1108 - 1118. [Abstract] [Full Text]
|
|
|
|
|
|
J. G. Newell, M. Davies, A. N. Bateson, and S. M. J. Dunn Tyrosine 62 of the gamma -Aminobutyric Acid Type A Receptor beta 2 Subunit Is an Important Determinant of High Affinity Agonist Binding J. Biol. Chem., May 5, 2000; 275(19): 14198 - 14204. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. E. Dalziel, G. B. Cox, P. W. Gage, and B. Birnir Mutating the Highly Conserved Second Membrane-Spanning Region 9' Leucine Residue in the alpha 1 or beta 1 Subunit Produces Subunit-Specific Changes in the Function of Human alpha 1beta 1 gamma -Aminobutyric AcidA Receptors Mol. Pharmacol., May 1, 2000; 57(5): 875 - 882. [Abstract] [Full Text]
|
|
|
|
|
|
T. Klausberger, K. Fuchs, B. Mayer, N. Ehya, and W. Sieghart GABAA Receptor Assembly. IDENTIFICATION AND STRUCTURE OF gamma 2 SEQUENCES FORMING THE INTERSUBUNIT CONTACTS WITH alpha 1 AND beta 3 SUBUNITS J. Biol. Chem., March 17, 2000; 275(12): 8921 - 8928. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. Srinivasan, C. J. Nichols, G. M. Lawless, R. W. Olsen, and A. J. Tobin Two Invariant Tryptophans on the alpha 1 Subunit Define Domains Necessary for GABAA Receptor Assembly J. Biol. Chem., September 17, 1999; 274(38): 26633 - 26638. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. J. Farrar, P. J. Whiting, T. P. Bonnert, and R. M. McKernan Stoichiometry of a Ligand-gated Ion Channel Determined by Fluorescence Energy Transfer J. Biol. Chem., April 9, 1999; 274(15): 10100 - 10104. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. X. Connor, A. J. Boileau, and C. Czajkowski A GABAA Receptor alpha 1 Subunit Tagged with Green Fluorescent Protein Requires a beta Subunit for Functional Surface Expression J. Biol. Chem., October 30, 1998; 273(44): 28906 - 28911. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. A. Barnard, P. Skolnick, R. W. Olsen, H. Mohler, W. Sieghart, G. Biggio, C. Braestrup, A. N. Bateson, and S. Z. Langer International Union of Pharmacology. XV. Subtypes of gamma -Aminobutyric AcidA Receptors: Classification on the Basis of Subunit Structure and Receptor Function Pharmacol. Rev., June 1, 1998; 50(2): 291 - 314. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. Horenstein and M. H. Akabas Location of a High Affinity Zn2+ Binding Site in the Channel of alpha 1beta 1 gamma -Aminobutyric AcidA Receptors Mol. Pharmacol., May 1, 1998; 53(5): 870 - 877. [Abstract] [Full Text]
|
|
|
|
|
|
M. Jechlinger, R. Pelz, V. Tretter, T. Klausberger, and W. Sieghart Subunit Composition and Quantitative Importance of Hetero-oligomeric Receptors: GABAA Receptors Containing alpha 6 Subunits J. Neurosci., April 1, 1998; 18(7): 2449 - 2457. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Li and A. L. De Blas Coexistence of Two beta Subunit Isoforms in the Same gamma -Aminobutyric Acid Type A Receptor J. Biol. Chem., June 27, 1997; 272(26): 16564 - 16569. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Tretter, N. Ehya, K. Fuchs, and W. Sieghart Stoichiometry and Assembly of a Recombinant GABAA Receptor Subtype J. Neurosci., April 15, 1997; 17(8): 2728 - 2737. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
F. Araujo, S. Tan, D. Ruano, H. Schoemaker, J. Benavides, and J. Vitorica Molecular and Pharmacological Characterization of Native Cortical gamma -Aminobutyric AcidA Receptors Containing Both alpha 1 and alpha 3 Subunits J. Biol. Chem., November 1, 1996; 271(44): 27902 - 27911. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Chang, R. Wang, S. Barot, and D. S. Weiss Stoichiometry of a Recombinant GABAA Receptor J. Neurosci., September 1, 1996; 16(17): 5415 - 5424. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Klausberger, N. Ehya, K. Fuchs, T. Fuchs, V. Ebert, I. Sarto, and W. Sieghart Detection and Binding Properties of GABAA Receptor Assembly Intermediates J. Biol. Chem., May 4, 2001; 276(19): 16024 - 16032. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
S. W. Baumann, R. Baur, and E. Sigel Subunit Arrangement of gamma -Aminobutyric Acid Type A Receptors J. Biol. Chem., September 21, 2001; 276(39): 36275 - 36280. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. J. Boileau, J. G. Newell, and C. Czajkowski GABAA Receptor beta 2 Tyr97 and Leu99 Line the GABA-binding Site. INSIGHTS INTO MECHANISMS OF AGONIST AND ANTAGONIST ACTIONS J. Biol. Chem., January 18, 2002; 277(4): 2931 - 2937. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |