Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Im, W. B.
Right arrow Articles by Alberts, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Im, W. B.
Right arrow Articles by Alberts, G. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 44, Issue of November 3, 1995 pp. 26063-26066
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Chloride Channel Expression with the Tandem Construct of 6-2 GABA Receptor Subunit Requires a Monomeric Subunit of 6 or 2 (*)

(Received for publication, July 24, 1995)

Wha Bin Im (§) Jeffrey F. Pregenzer Jay A. Binder Glenn H. Dillon Glen L. Alberts

From the From CNS Diseases Research, The Upjohn Company, Kalamazoo, Michigan 49001

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
REFERENCES

ABSTRACT

Despite the presence of the multiple subunits (alpha, beta, , and ) and their isoforms for -aminobutyric acid, type A (GABA(A)) receptors in mammalian brains, the alphaxbeta22 subtypes appear to be the prototype GABA(A) receptors sharing many properties with native neuronal receptors. In order to gain insight into their subunit stoichiometry and orientation, we prepared a tandem construct of the alpha6 and beta2 subunit cDNAs where the carboxyl-terminal of alpha6 is linked to the amino-terminal of beta2 via a linker encoding 10 glutamine residues. Transfection of human embryonic kidney 293 cells with the tandem construct alone failed to induce GABA-dependent Cl currents, but its cotransfection with the cDNA for alpha6 or 2, but not beta2, led to the appearance of GABA currents which were picrotoxin-sensitive and, in the case of 2 containing receptors, responded to a benzodiazepine agonist, U-92330. The high affinity GABA site, however, was detected with [^3H]muscimol binding in all combinations of the receptor subunits, including the tandem construct alone or with the beta2. No appreciable differences were found in their K (2.5 nM) and B(max) values (1.4 pmol/mg of protein). These data are consistent with the view that the polypeptides arising from the tandem construct were expressed with the high affinity GABA site, but unable to form GABA channels. The requirement of a specific monomeric subunit (alpha6 or 2) for the tandem construct to express Cl currents supports a pentameric structure of GABA(A) receptors consisting of two alpha6, two beta2, and one 2 for the alpha6beta22 and three alpha6 and two beta2 for the alpha6beta2 subtype.


INTRODUCTION

GABA(A)(^1)receptors, responsible for inhibitory neurotransmission in mammalian brains, are ligand-gated Cl channels made of various subunits (alpha, beta, , and )(1, 2, 3) . Each subunit consists of several isoforms and contains four transmembrane-spanning segments (M1 to M4)(1, 2, 3, 4, 5) . Despite the existence of the multiple subunits and their isoforms, combinations of alphax, beta2, and 2 subunits produced Cl channels sharing many functional characteristics with native neuronal receptors and displaying the ability to respond to all the GABA(A) receptor ligands known up-to-date(1, 3, 6, 7) . Such cloned GABA(A) receptors have been proposed to be of pentameric structure with M2 lining the pore in analogy with another member of the four transmembrane ligand-gated channel family, acetylcholine receptors(1, 2, 3) . Recent studies, including immunoprecipitation with subunit specific antibodies, have shown the presence of two alpha subunits per GABA(A) receptor (8, 9, 10, 11) . Further experimental evidence is needed, however, about the stoichiometry of the recombinant GABA(A) receptors of alphaxbeta22 and their modes of association. One way to gain insight into this structural issue is to predetermine the alignment of subunits via gene fusion and to study such fused gene products. Similar approaches have been successful with potassium channels made of their subunits in concatameric or tandem linkages(12, 13) . In this study we prepared a tandem construct of alpha6 and beta2 subunit cDNAs of the GABA(A) receptor where the carboxyl-terminal of the alpha6 cDNA is linked to the amino-terminal of the beta2 cDNA via a synthetic oligonucleotide encoding 10 glutamine residues. In order to study their properties, the tandem construct alone or in combination of the monomeric alpha6, beta2, and 2 subunit cDNA was expressed in human embryonic kidney cells (HEK293 cells). Also, recombinant baculovirus carrying the tandem construct or monomeric subunits was prepared for high level of expression in Sf-9 cells.


MATERIALS AND METHODS

Construction of the alpha6-beta2 Tandem Subunit

The coding regions of the alpha6 and beta2 subunits were isolated upon digestion of the mammalian expression vectors containing the specific GABA(A) receptor subunit cDNA(14) . For alpha6, ClaI cut the vector at the molecular cloning site near the 5` end of the insert, and ScaI cut the vector at a site near the 3` end of the insert, which is 9 bases upstream from the stop codon. This restriction digestion yielded a fragment of expected size, 1377 bp. For beta2, Kpn2I cut the vector at a site near the 5` end, which is 11 bases downstream from the start codon, and EcoRI cut the vector at the 3` ends of the insert, including the stop codon. A double-stranded oligonucleotide (61-mer) was purchased (Genosys) with a sequence of 5`- ACTGTCGAGCAGCAGCAACAGCAGCAACAGCAGCAACAGATGTGGAGAGTCCGGAAAAGGG-3`. In this linker, the first 9 bp represent the alpha6 sequence before the stop codon beginning with the distal half of the ScaI recognition site, the next 30 bp represent 10 glutamine residues, and the last 22 bp represent the beta2 sequence, including the start codon (ATG) and the recognition site for Kpn2I with an overhang at the 3` end. The fragment representing the rest of the expression vector was isolated by digestion with ClaI and EcoRI. Ligation products were formed from all the four fragments with proper sticky ends and were used to transform the competent Epicurean coli SCS1 strain (Stratagene). The correct plasmid was selected with polymerase chain reaction (PCR) using a primer pair, one of which anneals to the glutamine linker, and was verified with sequencing. Human embryonic kidney cells (HEK293 cells, ATCC CRL 1573) were transfected with the vector carrying the tandem cDNA alone or with alpha6, beta2, or 2 cDNA in a 2:1 ratio (4 to 2 µg/36-mm culture dish), in the presence of a transfection reagent, DOTAP (Boehringer Mannheim Gmbh). For infection of insect Sf-9 cells, recombinant baculoviruses were prepared using a vector, PVL 1393 (Pharmingen), carrying the tandem alpha6-beta2 construct or the cDNA for alpha6, beta2, or 2. All other procedures for DNA analysis, construction, and purification were described elsewhere(15) .

Northern Blotting and 3`-RACE Assays

mRNAs were prepared in the presence of guanidium thiocyanate from HEK293 cells transfected with the carriers of indicated GABA(A) receptor subunit cDNAs. Northern blotting was carried out with nylon transfer membranes, following the procedures provided by Schleicher and Schuell. The P Probes for alpha6 and beta2 were prepared from PCR which were carried out in a 50-µl volume using 1 unit of Amplitaq DNA polymerase (Perkin-Elmer) in the vender-supplied buffer, 20 µM dNTP ([alpha-P]dCTP), the respective cDNA as a template, and selective primer pairs annealing to the 5` and 3` end of the coding region of the template cDNA. The cycle parameters were at 94 °C for 1 min, 55 °C for 30 s, and 72 °C for 1-3 min, depending on the expected product size, with a final extension at 72 °C for 10 min after 30 cycles. The radioactive probes were purified using a Qiagen column and used within a few days. Fig. 1shows Northern analysis of the mRNA preparations from HEK293 cells which were transfected with the tandem construct of alpha6 and beta2 subunits (alpha6-beta2) alone or in combination with 2. For the sake of comparison, authentic mRNAs for individual subunits were prepared using a transcription in vitro system with sp6 RNA polymerase (Promega) and linearized vectors at the 3` end of the coding region. In the analysis, stringent washing conditions were employed under which the P-labeled probe for the alpha6 subunit interacted only with alpha6 mRNA, but not with beta2 or 2 mRNA (Fig. 1A). In the mRNA preparations from HEK293 cells transfected with alpha6-beta2 alone or in combination with 2, the P-labeled alpha6 probe interacted with a single band of an estimated molecular mass of about 3.5 kDa (judging from RNA molecular mass standards and as compared with the alpha6 mRNA of 1.7 kDa) (Fig. 1A). The P-labeled beta2 probe detected the same band as expected from the tandem construct (data not shown). The mRNA species for the tandem construct was further confirmed by the 3`-RACE following the procedures provided by Life Technologies, Inc. (Fig. 1B). Briefly, following reverse transcription of the mRNA preparations using 3`-RACE adaptor primer ((dT)CATGATRCAGCTGCGCACCGG), PCR was carried out with a primer specific for the alpha6 or beta2 and the universal amplification primer (the vender provided). The primer for alpha6 was a 23-mer beginning at the base 400 of alpha6 (5`-CGGACACATTTTTCCACAATGGG) and that for beta2 was a 21-mer beginning at the base 1051 of beta2 (5`-GGTCAACTACATCTTCTTTGG). In HEK293 cells transfected with alpha6, beta2, and 2 subunits, PCR with the alpha6 primer and the universal primer produced one product with an expected size of 1491 bp and with the beta2 primer also produced a single product with an expected size of 1743 bp. In the cells transfected with the tandem construct, PCR with the alpha6 primer and the universal primer produced one product matching with the expected size of 3663 bp for the alpha6-beta2, and similar PCR with the beta2-specific primer and the universal primer produced the product of the same size (1743 bp) as the one found in the cells transfected with beta2 monomers. These data confirmed the proper construction of alpha6 and beta2 subunits in tandem as described above and have established its in vivo transcription.


Figure 1: Northern analysis and 3`-RACE assays with mRNAs from HEK293 cells transfected with the tandem construct of alpha6 and beta2 GABA(A) receptor subunit cDNAs. The cells were grown to about 70% confluence in a 75-cm^2 culture flask and incubated in the presence of the tandem construct of alpha6-beta2 (8 µg) or with the cDNA for 2 (4 µg) and DOTAP (60 µl) for 24 h. The cells were harvested 24 h later, and mRNAs were prepared in the presence of guanidium thiocyanate following the standard procedures. A, Northern blotting was carried out with nylon membranes containing 10 µg of extracted mRNAs after resolution on a 1% agarose gel, following the vender-provided procedures. The P-labeled probe for the alpha6 was prepared using PCR in the presence of [alpha-P]dCTP. The alpha6, beta2, and 2 mRNAs were prepared in vitro using a Promega transcription kit. B, 3`-RACE assays were carried out using the kit from Life Technologies, Inc., the universal primer and the alpha6 specific primer (a) or the beta2-specific primer (b). The detailed information for the primers and PCR reaction were described under ``Materials and Methods.''



Electrophysiology

The whole cell patch clamp technique (16) was used to record the GABA-mediated Cl currents in HEK293 cells (48 h after transfection), with the pipette solution containing (mM) 140 CsCl, 11 EGTA, 4 MgCl(2), 2 ATP, and 10 Hepes, pH 7.3, and with the external solution containing (mM) 135 NaCl, 5 KCl, 1 MgCl(2), 1.8 CaCl2, and 5 Hepes, pH 7.2 (17) . GABA and drugs were dissolved in the external solution and were applied through a U-tube placed within 100 µm of the target cell.

Binding Studies

Sf-9 cells were infected with the baculovirus carrying the recombinant cDNAs as described previously (18) . Binding of radioactive ligands was measured in the Sf-9 cell membranes, using filtration techniques as described elsewhere(19, 31) . Briefly, [^3H]muscimol or [^3H]Ro 15-4513 binding was measured in the medium containing 118 mM NaCl, 5 mM KCl, 2 mM CaCl(2), 2 mM MgCl(2), 20 mM Hepes/Tris, pH 7.3, the radioactive ligand at various concentrations (1-40 nM), 30 µg of membrane proteins in a total volume of 500 µl at 4 °C for 60 min. Nonspecific binding was estimated in the presence of excess unlabeled ligands and was subtracted to compute specific binding as described earlier(19, 31) .


RESULTS

We examined whether GABA induces Cl currents in HEK293 cells transfected with the GABA(A) receptor cDNAs, using the whole cell patch clamp technique. In the cells transfected with the tandem construct alone, no currents were detected upon application of GABA at 1-20 µM (with more than 30 patches). If GABA(A) receptors are pentameric as proposed, functional expression of the tandem construct of alpha6-beta2 would require the presence of monomeric subunits. Therefore, HEK293 cells were transfected with the alpha6-beta2 and one of the monomeric subunits. Addition of alpha6 or 2, but not beta2, led to the appearance of GABA-induced whole cell currents, which were sensitive to picrotoxin, a specific inhibitor of GABA(A) receptor Cl currents (Fig. 2). Moreover, a benzodiazepine agonist, U-92330(19, 31) , enhanced GABA currents by 136 ± 9% in the receptor made of alpha6-beta2 plus 2, but had no effect on that made of alpha6-beta2 plus alpha6 (0 ± 5%) (Fig. 2). The picrotoxin sensitivity and the 2-dependent interaction with the benzodiazepine site ligand have already been known in the alpha6beta2 and alpha6beta22 subtypes of GABA(A) receptors(16, 19, 31) . It should be also noted that no GABA-induced Cl currents were detected in the whole cell patch with HEK293 cells (or Sf-9 cells) transfected (or infected) with the subunit of alpha6, beta2, or 2 alone(19, 31) . GABA dose-dependently increased Cl currents in the cells transfected with alpha6-beta2 plus alpha6 or plus 2 (Fig. 3). Analysis of the data with a logistic equation of E/E(max) = [GABA]^n/(K(0.5)^n + [GABA]^n) yielded a half-maximal GABA concentration (K(0.5)) of 1.5 ± 0.1 and 1.5 ± 0.3 in the alpha6-beta2 plus alpha6 and the alpha6-beta2 plus 2 receptors, respectively. The slope factor (^n) was 1.3 for both. These values are in the same range as that for the alpha6beta22 subtype assembled with individual subunits, the K(0.5) of 1.7 ± 0.5 and ^n of 1.4.


Figure 2: Pharmacological characterizations of the GABA-induced currents in the cells transfected with the alpha6-beta2 in combination with alpha6 or 2 subunit cDNA. HEK293 cells were grown on coverslips in a 36-mm culture dish to 70% confluence and incubated with the mixture containing alpha6-beta2 construct (4 µg) with 2 µg of alpha6 or 2 plasmids and DOTAP for 24 h. GABA-induced Cl currents were measured 24 h after transfection in the whole cell patch clamp technique. The downward deflection represents the efflux of Cl upon application of GABA at 1 µM at a holding potential of -30 mV under a symmetrical Cl gradient. Picrotoxin (20 µM) and U-92330 (5 µM) were dissolved in the extracellular solution containing GABA (1 µM) and were applied to the cells. The vertical calibration bar represents 100 pA for the upper traces and 200 pA for the lower traces, and the horizontal bar = 30 s.




Figure 3: Dose-response profiles for GABA-induced Cl currents in recombinant GABA(A) receptors. HEK293 cells transfected with the alpha6, beta2, and 2 plasmids, or with the alpha6-beta2 tandem construct plus alpha6 or 2 plasmids, as described in the legend of Fig. 2. Cl currents were induced by a 10-s pulse of GABA at 0.5-10 µM, and the peak amplitude was plotted as a function of GABA concentrations. The data fit with a logistic equation (see text). The data represent the mean ± S.E. from at least three experiments.



Earlier electrophysiological and binding studies have shown that properties of the receptors expressed in HEK293 cells or Sf-9 cells are indistinguishable, but the latter, a high expression eucaryotic system, is more reliable for radioactive ligand binding experiments(18, 20) . Thus, Sf-9 cells were infected with recombinant baculovirus carrying the tandem construct alone or in combination with that for alpha6, beta2, or 2 cDNA. Binding experiments were carried out with [^3H]muscimol and [^3H]Ro 15-4513, the ligands for high affinity GABA site and the benzodiazepine site, respectively. The data were analyzed with Scatchard analysis (Table 1, Fig. 4). [^3H]Muscimol binding was observed in all the cell membranes, including the cells infected with alpha6-beta2 alone or in combination with one of the monomers. The K(d) value for [^3H]muscimol (the high affinity GABA site) was 2.5 ± 0.2, 2.6 ± 0.3, 2.7 ± 0.2, and 2.1 ± 0.2 nM for the receptors from alpha6-beta2 alone or with alpha6, beta2, or 2, respectively. Also, the maximal binding level was not noticeably variable among those receptors, ranging from 1.6 to 1.2 pmol/mg of protein. Despite the high expression of the high affinity GABA site, the Sf-9 cells expressing the alpha6-beta2 alone again failed to produce Cl currents upon GABA (5 µM) application.




Figure 4: Plots for [^3H]muscimol binding. Binding was measured in the membranes from the Sf-9 cells expressing the alpha6-beta2 alone (circle) or with 2 subunit cDNA (bullet) using filtration techniques as described under ``Materials and Methods'' The data were fit with a one-site binding isotherm and were also shown in a Scatchard analysis (inset). The data represent the average of three measurements, and the binding parameters are shown in Table 1.



Binding of [^3H]Ro 15-4513 (a benzodiazepine site ligand) was observed only in the membranes from the cells infected with alpha6-beta2 with 2 as expected (see above). The B(max) for the benzodiazepine site ligand was similar to that for [^3H]muscimol, suggesting all the receptors containing both the high affinity GABA site and benzodiazepine site.


DISCUSSION

In this study we have shown that expression of the tandem construct of alpha6-beta2 subunit cDNA alone failed to produce Cl currents in response to GABA application, but in the presence of the monomeric subunit of alpha6 or 2 subunit, its expression led to the appearance of GABA- and picrotoxin-sensitive Cl currents. This could be interpreted to mean that the tandem construct alone forms receptors with only even-numbered subunits, which are not functional (no chloride channels), but in the presence of the monomeric subunit of alpha6 or 2, forms a functional pentameric receptor with Cl channels. This interpretation led us to propose that the functional receptor/Cl channels may consist of two alpha6-beta2 and one alpha6 or 2. Since these receptors displayed similar functional and pharmacological properties with the monomeric alpha6beta22 or alpha6beta2 subtypes, we propose that the alpha6beta22 subtype consists of two alpha6, two beta2, and one 2 subunits and that the alpha6beta2 subtype consists of three alpha6 and two beta2 subunits. This proposal is in agreement with earlier immunoprecipitation studies which indicated the presence of two alpha subunits in the alphabeta subtypes of cloned GABA(A) receptors(8, 9, 10, 11) . An alternative interpretation of our results is that the functional receptors of alpha6beta22 would be made of one alpha6-beta2 and three monomeric 2, leading to one alpha6 subunit per receptor. This is incompatible with the presence of two alpha subunits per receptor already shown by the immunoprecipitation studies(8, 9, 10, 11) .

We also propose the orientation of the subunits in the alpha6beta22 subtype to be alpha6-beta2-alpha6-beta2-2. Such an arrangement could minimize interactions between homologous subunits and domains and accommodate two alpha6-beta2 tandem subunits per receptor. This arrangement is also compatible with the assignment of the benzodiazepine site at the interface between alpha6 and 2 subunits (22, 23, 24) , with the N-terminal of alpha6 involved in the formation of the benzodiazepine site(14, 25) . Future study with the tandem 2-alpha6, beta2-alpha6, and beta2-2, where the hyphen represents a C- to N-terminal linkage, will be useful to test this proposal.

Of considerable interest is the appearance of the high affinity GABA site without Cl channels in the cells expressing the alpha6-beta2 construct alone. Two types of GABA sites are known to be on GABA(A) receptors, the high affinity site with nanomolar dissociation constants and low affinity sites with micromolar dissociation constants(1, 21) . The high affinity GABA site has been reported on the beta subunit(1, 26) , and low affinity GABA sites were not localized yet, but their affinity was markedly affected by mutations on the beta subunit (27) and different alpha isoforms(7, 28, 29) . This indicates that low affinity GABA sites could be influenced by secondary, tertiary, and quaternary interactions among the subunits. Furthermore, its occupancy seems to lead to channel openings, because the Hill coefficient of near 2 was observed for GABA currents and no channel openings were observed with GABA at concentrations occupying nearly 70% of the high affinity sites(29, 30) . It appears that the formation of low affinity GABA sites and GABA-sensitive Cl channels require association of proper five receptor subunits, which could not be achieved with the tandem alpha6-beta2 construct alone.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: CNS Research 7251-209-114, The Upjohn Company, Kalamazoo, MI 49001. Tel.: 616-385-7533; Fax: 616-385-4525.

(^1)
The abbreviations used are: GABA(A), -aminobutyric acid, type A; bp, base pair(s); PCR, polymerase chain reaction; DOTAP, N-[1[(2-,3-dioleoyloxy)propyl]-N,N,N-trimethylammonium methyl sulfate; RACE, rapid amplification of cDNA ends.


REFERENCES

  1. DelOrey, T. M., and Olsen, R. W. (1992) J. Biol. Chem. 267, 16747-16750 [Free Full Text]
  2. Wisden, W., and Seeburg, P. H. (1992) Curr. Opin. Neurobiol. 2, 263-269 [CrossRef][Medline] [Order article via Infotrieve]
  3. Barnard, E. C., Sutherland, M., Zaman, M., Matsumoto, M., Nayeem, N., Green, T., Darlison, M. G., and Bateson, A. N. (1993) Ann. N. Y. Acad. Sci. 707, 117-125
  4. Bateson, A. N., Lasham, A., and Darlison, M. G. (1991) J. Neurochem. 56, 1437-1440 [Medline] [Order article via Infotrieve]
  5. Harvey, R. J., Kim, H.-C., and Darlison, M. G. (1993) FEBS Lett. 331, 211-216 [CrossRef][Medline] [Order article via Infotrieve]
  6. Pritchett, D. B., Sontheomer, H., Shivers, B. D., Ymer, S., Kettenmann, H., Schofield, P. R., and Seeburg, P. H. (1989) Nature 338, 582-585 [CrossRef][Medline] [Order article via Infotrieve]
  7. Puia, G., Vicini, S., Seeburg, P. H., and Costa, E. (1991) Mol. Pharmacol. 39, 691-696 [Abstract]
  8. Duggan, M. J., Pollard, S., and Stephenson, A. (1991) J. Biol. Chem. 266, 24778-24784 [Abstract/Free Full Text]
  9. Luddens, H., Killisch, I., and Seeburg, P. H. (1991) J. Recept. Res. 11, 535-551 [Medline] [Order article via Infotrieve]
  10. Pollard, S., Duggan, M. J., and Stephenson, F. A. (1993) J. Biol. Chem. 268, 3753-3757 [Abstract/Free Full Text]
  11. Verdoon, T. A. (1994) Mol. Pharmacol. 45, 475-480 [Abstract]
  12. Hurst, R. S., Kavanaugh, M. P., Yakel, J., Adelman, J. P., and North, A. (1992) J. Biol. Chem. 267, 23742-23745 [Abstract/Free Full Text]
  13. Liman, E. R., Tytgat, J., and Hess, P. (1992) Neuron 9, 861-871 [CrossRef][Medline] [Order article via Infotrieve]
  14. Pritchett, D. B., and Seeburg, P. H. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 1421-1425 [Abstract/Free Full Text]
  15. Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  16. Hamill, O. P., Marty, A., Neher, E., Sakmann, B., and Sigworth, F. J. (1981) Pfluegers Arch. 391, 85-100 [CrossRef][Medline] [Order article via Infotrieve]
  17. Draguhn, A., Verdoorn, T. A., Ewert, M., Seeburg, P. H., and Sakmann, B. (1990) Neuron 5, 781-788 [CrossRef][Medline] [Order article via Infotrieve]
  18. Carter, D. B., Thomsen, D. R., Im, W. B., Lennon, D. J., Ngo, D. M., Gale, W., Im, H. K., Seeburg, P. H., and Smith, M. W. (1992) Bio/Technology 10, 679-681 [CrossRef][Medline] [Order article via Infotrieve]
  19. Pregenzer, J. F., Im, W. B., Carter, D. B., and Thomsen, D. R. (1993) Mol. Pharmacol. 43, 801-806 [Abstract]
  20. Im, W. B., Pregenzer, J. F., and Thomsen, D. R. (1994) Br. J. Pharmacol. 112, 1025-1030 [Medline] [Order article via Infotrieve]
  21. Pregenzer, J. F., Im, W. B., Carter, D. B., and Thomsen, D. R. (1993) Mol. Pharmacol. 43, 801-806
  22. Stephensen, F. A., Duggan, M., and Pollard, S. (1990) J. Biol. Chem. 265, 21160-21165 [Abstract/Free Full Text]
  23. Wang, G., Sei, Y., and Skolinik, P. (1992) Mol. Pharmacol. 42, 996-1003 [Abstract]
  24. Im, H. K., Im, W. B., Hamilton, B. J., Carter, D. B., and VonVoigtlander, P. F. (1993) Mol. Pharmacol. 44, 866-870 [Abstract]
  25. Wieland, H. A., Luddens, H., and Seeburg, P. H. (1992) J. Biol. Chem. 267, 1426-1429 [Abstract/Free Full Text]
  26. Stauber, G. B., Ransom, R. W., Dilber, A. I., and Olsen, R. W. (1987) Eur. J. Biochem. 167, 125-133 [Medline] [Order article via Infotrieve]
  27. Amin, J., and Weiss, D. S. (1993) Nature 366, 565-569 [CrossRef][Medline] [Order article via Infotrieve]
  28. Verdoorn, T. A., Draguhn, A., Ymer, S., Seeburg, P. H., and Sakmann, B. (1990) Neuron 4, 919-928 [CrossRef][Medline] [Order article via Infotrieve]
  29. Dillon, G. H., Im, H. K., Hamilton, B. J., Carter, D. B., Gammil, R. B., Judge, T. M., and Im, W. B. (1993) Mol. Pharmacol. 44, 860-864 [Abstract]
  30. Sieghart, W. (1992) Trends Pharmacol. Sci. 13, 446-450 [CrossRef][Medline] [Order article via Infotrieve]
  31. Im, W. B., Im, H. K., Pregenzer, J. P., Hamilton, B. J., Carter, D. B., Jacobsen, E. J., TenBrink, R. E., and VonVoigtlander, P. F. (1993) Br. J. Pharmacol. 110, 677-680 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Pharmacol.Home page
G. Akk, P. Li, J. Bracamontes, and J. H. Steinbach
Activation and Modulation of Concatemeric GABA-A Receptors Expressed in Human Embryonic Kidney Cells
Mol. Pharmacol., June 1, 2009; 75(6): 1400 - 1411.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. R. Bracamontes and J. H. Steinbach
Steroid Interaction with a Single Potentiating Site Is Sufficient to Modulate GABA-A Receptor Function
Mol. Pharmacol., April 1, 2009; 75(4): 973 - 981.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
R. W. Olsen and W. Sieghart
International Union of Pharmacology. LXX. Subtypes of {gamma}-Aminobutyric AcidA Receptors: Classification on the Basis of Subunit Composition, Pharmacology, and Function. Update
Pharmacol. Rev., September 1, 2008; 60(3): 243 - 260.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Sarto-Jackson, R. Furtmueller, M. Ernst, S. Huck, and W. Sieghart
Spontaneous Cross-link of Mutated {alpha}1 Subunits during GABAA Receptor Assembly
J. Biol. Chem., February 16, 2007; 282(7): 4354 - 4363.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
P. J. Groot-Kormelink, S. Broadbent, M. Beato, and L. G. Sivilotti
Constraining the Expression of Nicotinic Acetylcholine Receptors by Using Pentameric Constructs
Mol. Pharmacol., February 1, 2006; 69(2): 558 - 563.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
A. J. Boileau, R. A. Pearce, and C. Czajkowski
Tandem Subunits Effectively Constrain GABAA Receptor Stoichiometry and Recapitulate Receptor Kinetics But Are Insensitive to GABAA Receptor-Associated Protein
J. Neurosci., December 7, 2005; 25(49): 11219 - 11230.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
J. G. Newell, R. A. McDevitt, and C. Czajkowski
Mutation of Glutamate 155 of the GABAA Receptor {beta}2 Subunit Produces a Spontaneously Open Channel: A Trigger for Channel Activation
J. Neurosci., December 15, 2004; 24(50): 11226 - 11235.
[Abstract] [Full Text] [PDF]


Home page
JGPHome page
P. J. Groot-Kormelink, S. D. Broadbent, J. P. Boorman, and L. G. Sivilotti
Incomplete Incorporation of Tandem Subunits in Recombinant Neuronal Nicotinic Receptors
J. Gen. Physiol., June 1, 2004; 123(6): 697 - 708.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
E. N. Goren, D. C. Reeves, and M. H. Akabas
Loose Protein Packing around the Extracellular Half of the GABAA Receptor {beta}1 Subunit M2 Channel-lining Segment
J. Biol. Chem., March 19, 2004; 279(12): 11198 - 11205.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
M. Bali and M. H. Akabas
Defining the Propofol Binding Site Location on the GABAA Receptor
Mol. Pharmacol., January 1, 2004; 65(1): 68 - 76.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Y. Zhou, M. E. Nelson, A. Kuryatov, C. Choi, J. Cooper, and J. Lindstrom
Human {alpha}4{beta}2 Acetylcholine Receptors Formed from Linked Subunits
J. Neurosci., October 8, 2003; 23(27): 9004 - 9015.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. Schorge and D. Colquhoun
Studies of NMDA Receptor Function and Stoichiometry with Truncated and Tandem Subunits
J. Neurosci., February 15, 2003; 23(4): 1151 - 1158.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
K. Bollan, D. King, L. A. Robertson, K. Brown, P. M. Taylor, S. J. Moss, and C. N. Connolly
GABAA Receptor Composition Is Determined by Distinct Assembly Signals within alpha and beta Subunits
J. Biol. Chem., February 7, 2003; 278(7): 4747 - 4755.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. Nicke, J. Rettinger, and G. Schmalzing
Monomeric and Dimeric Byproducts are the Principal Functional Elements of Higher Order P2X1 Concatamers
Mol. Pharmacol., January 1, 2003; 63(1): 243 - 252.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Sarto, T. Klausberger, N. Ehya, B. Mayer, K. Fuchs, and W. Sieghart
A Novel Site on gamma 3 Subunits Important for Assembly of GABAA Receptors
J. Biol. Chem., August 16, 2002; 277(34): 30656 - 30664.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
S. B. Christie, C. P. Miralles, and A. L. De Blas
GABAergic Innervation Organizes Synaptic and Extrasynaptic GABAA Receptor Clustering in Cultured Hippocampal Neurons
J. Neurosci., February 1, 2002; 22(3): 684 - 697.
[Abstract] [Full Text] [PDF]


Home page
J. Physiol.Home page
P. A Davies, E. F Kirkness, and T. G Hales
Evidence for the formation of functionally distinct {alpha}{beta}{gamma}{varepsilon} GABAA receptors
J. Physiol., November 15, 2001; 537(1): 101 - 113.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
A. J. Smith, L. Alder, J. Silk, C. Adkins, A. E. Fletcher, T. Scales, J. Kerby, G. Marshall, K. A. Wafford, R. M. McKernan, et al.
Effect of alpha Subunit on Allosteric Modulation of Ion Channel Function in Stably Expressed Human Recombinant gamma -Aminobutyric AcidA Receptors Determined Using 36Cl Ion Flux
Mol. Pharmacol., April 16, 2001; 59(5): 1108 - 1118.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
J. G. Newell, M. Davies, A. N. Bateson, and S. M. J. Dunn
Tyrosine 62 of the gamma -Aminobutyric Acid Type A Receptor beta 2 Subunit Is an Important Determinant of High Affinity Agonist Binding
J. Biol. Chem., May 5, 2000; 275(19): 14198 - 14204.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. E. Dalziel, G. B. Cox, P. W. Gage, and B. Birnir
Mutating the Highly Conserved Second Membrane-Spanning Region 9' Leucine Residue in the alpha 1 or beta 1 Subunit Produces Subunit-Specific Changes in the Function of Human alpha 1beta 1 gamma -Aminobutyric AcidA Receptors
Mol. Pharmacol., May 1, 2000; 57(5): 875 - 882.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
T. Klausberger, K. Fuchs, B. Mayer, N. Ehya, and W. Sieghart
GABAA Receptor Assembly. IDENTIFICATION AND STRUCTURE OF gamma 2 SEQUENCES FORMING THE INTERSUBUNIT CONTACTS WITH alpha 1 AND beta 3 SUBUNITS
J. Biol. Chem., March 17, 2000; 275(12): 8921 - 8928.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. Srinivasan, C. J. Nichols, G. M. Lawless, R. W. Olsen, and A. J. Tobin
Two Invariant Tryptophans on the alpha 1 Subunit Define Domains Necessary for GABAA Receptor Assembly
J. Biol. Chem., September 17, 1999; 274(38): 26633 - 26638.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. J. Farrar, P. J. Whiting, T. P. Bonnert, and R. M. McKernan
Stoichiometry of a Ligand-gated Ion Channel Determined by Fluorescence Energy Transfer
J. Biol. Chem., April 9, 1999; 274(15): 10100 - 10104.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. X. Connor, A. J. Boileau, and C. Czajkowski
A GABAA Receptor alpha 1 Subunit Tagged with Green Fluorescent Protein Requires a beta  Subunit for Functional Surface Expression
J. Biol. Chem., October 30, 1998; 273(44): 28906 - 28911.
[Abstract] [Full Text] [PDF]


Home page
Pharmacol. Rev.Home page
E. A. Barnard, P. Skolnick, R. W. Olsen, H. Mohler, W. Sieghart, G. Biggio, C. Braestrup, A. N. Bateson, and S. Z. Langer
International Union of Pharmacology. XV. Subtypes of gamma -Aminobutyric AcidA Receptors: Classification on the Basis of Subunit Structure and Receptor Function
Pharmacol. Rev., June 1, 1998; 50(2): 291 - 314.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
J. Horenstein and M. H. Akabas
Location of a High Affinity Zn2+ Binding Site in the Channel of alpha 1beta 1 gamma -Aminobutyric AcidA Receptors
Mol. Pharmacol., May 1, 1998; 53(5): 870 - 877.
[Abstract] [Full Text]


Home page
J. Neurosci.Home page
M. Jechlinger, R. Pelz, V. Tretter, T. Klausberger, and W. Sieghart
Subunit Composition and Quantitative Importance of Hetero-oligomeric Receptors: GABAA Receptors Containing alpha 6 Subunits
J. Neurosci., April 1, 1998; 18(7): 2449 - 2457.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Li and A. L. De Blas
Coexistence of Two beta  Subunit Isoforms in the Same gamma -Aminobutyric Acid Type A Receptor
J. Biol. Chem., June 27, 1997; 272(26): 16564 - 16569.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
V. Tretter, N. Ehya, K. Fuchs, and W. Sieghart
Stoichiometry and Assembly of a Recombinant GABAA Receptor Subtype
J. Neurosci., April 15, 1997; 17(8): 2728 - 2737.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Araujo, S. Tan, D. Ruano, H. Schoemaker, J. Benavides, and J. Vitorica
Molecular and Pharmacological Characterization of Native Cortical gamma -Aminobutyric AcidA Receptors Containing Both alpha 1 and alpha 3 Subunits
J. Biol. Chem., November 1, 1996; 271(44): 27902 - 27911.
[Abstract] [Full Text] [PDF]


Home page
J. Neurosci.Home page
Y. Chang, R. Wang, S. Barot, and D. S. Weiss
Stoichiometry of a Recombinant GABAA Receptor
J. Neurosci., September 1, 1996; 16(17): 5415 - 5424.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Klausberger, N. Ehya, K. Fuchs, T. Fuchs, V. Ebert, I. Sarto, and W. Sieghart
Detection and Binding Properties of GABAA Receptor Assembly Intermediates
J. Biol. Chem., May 4, 2001; 276(19): 16024 - 16032.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
S. W. Baumann, R. Baur, and E. Sigel
Subunit Arrangement of gamma -Aminobutyric Acid Type A Receptors
J. Biol. Chem., September 21, 2001; 276(39): 36275 - 36280.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. J. Boileau, J. G. Newell, and C. Czajkowski
GABAA Receptor beta 2 Tyr97 and Leu99 Line the GABA-binding Site. INSIGHTS INTO MECHANISMS OF AGONIST AND ANTAGONIST ACTIONS
J. Biol. Chem., January 18, 2002; 277(4): 2931 - 2937.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Im, W. B.
Right arrow Articles by Alberts, G. L.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Im, W. B.
Right arrow Articles by Alberts, G. L.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement