JBC Transcription and Nuclear Factor Monoclonals

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Adler, V.
Right arrow Articles by Ronai, Z.'e.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Adler, V.
Right arrow Articles by Ronai, Z.'e.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 44, Issue of November 3, 1995 pp. 26071-26077
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
UV Irradiation and Heat Shock Mediate JNK Activation via Alternate Pathways (*)

(Received for publication, August 3, 1995)

Victor Adler Andràs Schaffer Jeanette Kim Lisa Dolan Ze'ev Ronai (§)

From the Molecular Carcinogenesis Program, American Health Foundation, Valhalla, New York 10595

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

To elucidate cellular pathways involved in Jun-NH(2)-terminal kinase (JNK) activation by different forms of stress, we have compared the effects of UV irradiation, heat shock, and H(2)O(2). Using mouse fibroblast cells (3T3-4A) we show that while H(2)O(2) is ineffective, UV and heat shock (HS) are potent inducers of JNK. The cellular pathways that mediate JNK activation after HS or UV exposure are distinctly different as can be concluded from the following observations: (i) H(2)O(2) is a potent inhibitor of HS-induced but not of UV-induced JNK activation; (ii) Triton X-100-treated cells abolish the ability of UV, but not HS, to activate JNK; (iii) the free radical scavenger N-acetylcysteine inhibits UV- but not HS-mediated JNK activation; (iv) N-acetylcysteine inhibition is blocked by H(2)O(2) in a dose-dependent manner; (v) a Cockayne syndrome-derived cell line exhibits JNK activation upon UV exposure, but not upon HS treatment. The significance of Jun phosphorylation by JNK after treatment with UV, HS, or H(2)O(2) was evaluated by measuring Jun phosphorylation in vivo and also its binding activity in gel shifts. HS and UV, which are potent inducers of JNK, increased the level of c-Jun phosphorylation when this was measured by [P]orthophosphate labeling of 3T3-4A cultures. H(2)O(2) had no such effect. Although H(2)O(2) failed to activate JNK in vitro and to phosphorylate c-Jun in vivo, all three forms of stress were found to be potent inducers of binding to the AP1 target sequence. Overall, our data indicate that both membrane-associated components and oxidative damage are involved in JNK activation by UV irradiation, whereas HS-mediated JNK activation, which appears to be mitochondrial-related, utilizes cellular sensors.


INTRODUCTION

The response of mammalian cells to stress in the form of UV irradiation or heat shock (HS) (^1)involves key regulatory proteins such as p53(1) , GADD45(2, 3) , WAF1/p21/cip(4, 5) , NFkappaB(6, 7) , and c-Jun(8, 9, 10) . Changes in the expression and activities of the stress-modulated cellular proteins affect cell cycle distribution(11) , rate of repair, and DNA replication(12) . Such changes also lead to temporal growth arrest (2, 13) or apoptosis(14) . While the primary sensors that trigger the stress response are not known, a subset of ras-dependent protein kinases(15, 16, 17) , including Src(18) , Raf(19) , Jun-NH(2)-terminal kinase(19, 20) , and mitogen-activated protein kinase(21) , as well as growth factor receptors(22) , were shown to participate.

To understand the nature of the stress response, one needs to identify the mechanisms involved in the activation of stress-related protein kinases. Pathways that were thus far shown to mediate the stress response include cell surface receptors, such as epidermal growth factor receptor. These are capable of activating mitogen-activated protein kinase (22) through ras, raf-1, MEK, and ERK, leading to the phosphorylation and activation of the transcription factors TCF/ELK1 and c-Fos(23) . A second pathway includes yet unidentified cytoplasmic components that can activate JNK via its own kinases, including MKK4,(17) , which leads to the phosphorylation of c-Jun. Interestingly, JNK is also activated by osmotic shock as was demonstrated in Chinese hamster ovary cells(24) . Upstream JNK kinases also phosphorylate p38-MpK2 (25) which is able to reconstitute osmotic response in yeast strains that lack HOG1, the yeast homologue of p38 (24) . HOG1 was reported to share similarity with the mitogen-activated protein kinase activating protein 2-reactivating kinase that mediates the response to heat shock and phosphorylates small heat shock proteins (26) . Augmented by ras, mitogen-activated protein kinase and JNK activities contribute to the overall phosphorylation of c-Jun(20, 27) . JNK phosphorylates c-Jun and ATF2 on their NH(2)-terminal region, whereby these transcription factors are enabled to mediate transcription, replication, and transformation activities(28, 29) . To exert such activities, JNK requires interaction with the domain of c-Jun(30) . This key component is deleted in c-Jun's oncogenic counterpart v-Jun(31, 32) .

In elucidating mechanisms involved in the cellular response to UV irradiation and HS treatment as two different forms of stress, we have focused on the role of JNK. Although UV and HS are potent inducers of JNK, they are expected to damage cells via alternate pathways.

To distinguish between the effects of UV and HS, we have evaluated the role of oxidative stress which is induced by UV to a greater extent than by HS. Oxidative stress can induce c-Jun, c-Fos, NFkappaB, early growth response gene (EGR1), and heme oxygenase expression at the transcriptional level(33, 34) . This induction correlates with transcriptional activities as demonstrated for Jun, and NFkappaB(35, 36) , and it appears to be mediated via tyrosine kinases in a protein kinase C-dependent manner(37, 38) . Poly-(ADP-ribosylation) was also shown to participate in AP1 activation by H(2)O(2)(39) . Hydrogen peroxide-mediated cellular changes can be suppressed by Bcl-2 through inhibitory effects on lipid peroxidation at the site of free radical generation within the mitochondria(40) . Suppression of mitochondrial activities has been associated with elevated levels of oxidative damage and uncoupling of electron transport from ATP production. It is also linked to the induction of apoptosis(39, 41, 42) .

The role of oxygen radicals and membrane components, which are involved in cellular stress response, was evaluated to enable the identification of mechanisms involved in JNK activation by different forms of stress. The degree of JNK activation by either UV or HS was further correlated with c-Jun phosphorylation and DNA binding activities as measures for the functional significance of JNK activity.


MATERIALS AND METHODS

Cell Culture

3T3-4A cells are a mouse fibroblast cell line (carrying an integrated copy of temperature-sensitive polyoma virus; (43) ) kindly provided by Dr. Claudio Basilico. These cells are maintained in Dulbecco's modified Eagle's medium, supplemented with 10% fetal bovine serum and antibiotics. JC133 are fibroblast cells, provided through the courtesy of Dr. Alan Lehman. They were obtained from skin biopsies of a patient with Cockayne syndrome. These cells were maintained in minimum Eagle's medium, supplemented with 20% fetal bovine serum and basal amino acids. Cells that were depleted of mtDNA (143B206) were maintained in Dulbecco's modified Eagle's medium supplemented with 5% fetal bovine serum and uridine (50 µg/ml). Chemicals such as genistein (ICN), sodium vanadate, hydrogen peroxide, N-acetylcysteine, Triton X-100, or glutathione in oxidized or reduced forms (Sigma) were dissolved/diluted in 0.1 M Hepes, pH 7.4, and added individually or in combination to the cells (as indicated under ``Results''). In all cases, solutions were freshly prepared for each experiment.

UV Irradiation and Heat Shock Treatment

Cells were exposed to UV irradiation as described previously(44) . Briefly, prior to irradiation, the cells were washed with phosphate-buffered saline, and, with the lids off, the culture dishes were placed in marked areas in the tissue culture hood. These areas were precalibrated for the dose of UV, using a germicidal lamp (254 nm) and a UV-C probe (UVP, San Diego, CA). The medium was removed before UV exposure and added again immediately after irradiation. The cells were harvested at the indicated time points. Heat shock treatments were performed by placing the tissue cultures in a 42 °C incubator for 1 h. When Triton X-100 was used in the protocol, the indicated concentration was added to the medium either before or after the UV or HS treatments, as indicated under ``Results.'' In all cases, cultures were washed three times before treatment.

Oligonucleotide Synthesis

Oligonucleotides representing a dimer of the AP1 (CTGACTCATCCGTGACTAACT) and NFkappaB (ATGGGGACTTTCCCAT-ATGGGGACTTTCCCAT) target sequences were synthesized in-house with the aid of a Cyclone Plus DNA synthesizer (Milligen Biosearch, Milford, MA). Complementary DNA strands were purified and annealed by standard procedures.

Electrophoretic Mobility Shift Assay (EMSA)

The synthetic AP1 and NFkappaB sequences were labeled with [-P]dATP (3000 Ci/mol, DuPont NEN) using polynucleotide kinase (Promega, Madison, OH) according to standard procedures. The labeled DNA (0.4 ng, 4400 cpm) was incubated with nuclear proteins (as specified in the Results section) for 20 min at room temperature, in the presence of 100 ng of poly(dI-dC) oligomer (Boehringer Mannheim) and DNA binding buffer as described previously (45) . The complexes were then separated on 5% polyacrylamide gel and autoradiographed.

RNA Preparation and Analysis

Total RNA was prepared from sham- and UV-treated 3T3-4A and JC133 cells using a cesium chloride cushion and standard procedures. Ten micrograms of RNA were separated on a 1% formaldehyde gel and were subsequently blotted onto a nylon membrane prior to hybridization with a 1.2-kb fragment of mouse c-Jun that was labeled with the aid of random primers and the Klenow fragment of DNA polymerase I (Prime-A-Gene Kit; Promega) using alpha-P. The hybridized signals were visualized through autoradiography.

In Vivo Cell Labeling

In vivo labeling with [P]orthophosphate was carried out as follows: 3T3-4A cells grown to about 90% confluence in 150-mm dishes (15 times 10^6 cells/plate) were incubated for 60 min at 37 °C in phosphate-free medium containing 5% dialyzed fetal calf serum. The medium was removed, plates were washed with 20 mM Hepes, pH 7.6, and exposed to UV-C (40 J/m^2). The medium was added again with 100 µCi/ml of [P]orthophosphate for 60-90 min (as indicated under ``Results''). Cells were then washed and proteins were prepared with radioimmune precipitation buffer. To prevent nonspecific binding, proteins were first incubated with protein A/G beads. The supernatant was incubated with 3 µl of polyclonal antibodies to c-Jun (Santa Cruz, San Diego, CA) for 6 h at 4 °C. With the aid of protein A/G beads (60 µl) that were added to the mixture for 1 h at 4 °C, the immunocomplexes were precipitated, and the pellet was washed three times with radioimmune precipitation buffer. The pellet was then resuspended in 40 µl of SDS-sample buffer, separated by SDS-PAGE (10%), and analyzed by autoradiography.

JNK Assays

Protein kinase assays were carried out using a fusion protein between glutathione S-transferase (GST) and c-Jun (amino acids 5-89) as a substrate. The JNK was purified from phorbol ester-treated U937 leukemic cells over a GST column, followed by a heparin-Sepharose and GST-c-Jun affinity column(46) . For further purification, the c-Jun amino-terminal protein kinase was eluted from the affinity column with 3% n-octyl beta-D-glucopyranoside (Sigma). Eluted proteins were further purified by chromatography on a Superdex 200 (Pharmacia Biotech Inc.) 16 times 60-mm column, and fractions with the highest protein kinase activity were combined. Glycerol was added to give a final concentration of 50%, and the enzyme solution was stored at -20 °C. The protein kinase assay was carried out as described previously(30, 46) . Briefly the GST-Jun fusion proteins were bound to glutathione Sepharose beads and incubated for 15 min at room temperature with the cellular extract that contains JNK, in the presence of kinase buffer (20 mM Hepes, pH 7.6, 1 mM EGTA, 1 mM dithiothreitol, 2 mM MgCl(2), 2 mM MnCl(2), 5 mM NaF, 1 mM NaVO(3), 50 mM NaCl). The beads were pelleted and thoroughly washed with PBST (150 mM NaCl, 16 mM sodium phosphate, pH 7.5, 1% Triton X-100, 2 mM EDTA, 0.1% beta-MeOH, 0.2 mM phenylmethylsulfonyl fluoride, and 5 mM benzamidine), before they were incubated with [-P]ATP (50 cpm/fmol) in the presence of kinase buffer. These steps were undertaken to ensure that c-Jun phosphorylation is carried out by JNK which is known to exhibit high affinity to this portion of c-Jun under these conditions (30, 46, 47) . Following extensive washing, the phosphorylated GST-Jun was boiled in SDS sample buffer, and the eluted proteins were run on a 15% SDS-polyacrylamide gel. The gel was dried, and phosphorylation of the Jun substrate was determined by autoradiography. The radioactive signal was quantified with a computerized radioimaging blot analyzer (AMBIS, San Diego, CA). A variation of the phosphorylation assay was performed on in vitro synthesized c-Jun. With the aid of wheat germ extract (Promega) full-length c-Jun was transcribed and translated. This product was phosphorylated with purified JNK of U937 cells, followed by its immunoprecipitation with antibodies to c-Jun and analysis on SDS-PAGE via autoradiography.

An in-gel kinase assay was performed by embedding the c-Jun NH(2)-terminal region that was purified from the pGEX-jun within the acrylamide gel (10 µg/ml). Equal amounts of proteins (50 µg) were separated in a routine 10% SDS-PAGE. To remove SDS, the gels were washed for 4-12 h in Hepes (40 mM, pH 7.4) with 0.2 M EDTA. The gel was then incubated in kinase buffer (see above) in the presence of 1 mCi of [-P]ATP (specific activity, 6000 Ci/mol) for 30 min. Followed by extensive washings in the presence of Dowex 2-X8 (Bio-Rad), mixed with DEAE-650 (Supelco), and packed within a dialysis bag (to compete for nonspecific bound [-P]ATP), the gel was silver-stained to ensure proper distribution and that equal amounts of protein substrate were loaded, dried, and autoradiographed.

Immunoprecipitation and Western Blot Analysis

Protein extracts (as indicated under ``Results'') were incubated with pGEX-Jun under conditions used for kinase reactions described above. Following three extensive washings, bound JNK was eluted from pGEX-Jun with the aid of 3% N-octyl-beta-D-glucopyranoside (Sigma). Eluted proteins were separated on 10% SDS-PAGE, electroblotted onto a polyvinylidene difluoride membrane that was blocked (1% Triton X-100, 1.5% non-fat milk) and incubated with antibodies to JNK (final dilution 1/3000) for 12 h at 4 °C. These antibodies recognize both JNK1 and JNK2 (kindly provided as a gift from PharMingen). A chemiluminescence kit (ECL, Amersham Corp.) with secondary antibodies (diluted 1/10,000) was used for detection.


RESULTS

Selective Activation of JNK by UV but Not by HS in Cells of a CS Patient

In studying the activation of JNK in radiation-related disorders, including melanoma, Xeroderma pigmentosum, and Cockayne syndrome, we have identified cells of a Cockayne syndrome patient that exhibited deregulation of c-Jun (47) . (^2)When assaying for JNK activation, we found that the low basal activity of JNK in these CS-derived cells is induced to considerable levels following UV irradiation, in a pattern similar to that previously observed in HeLa cells(30) . Surprisingly, however, heat shock was not able to activate JNK in these CS cells (Fig. 1A).


Figure 1: Cockayne syndrome and mtDNA cells exhibit JNK activation by UV but not by HS. A, cells of a Cockayne syndrome patient were exposed to HS or UV-C treatment, and JNK activity was measured. In all cases, proteins were prepared 30 min after UV and 60 min after HS treatment, and JNK assays were performed using pGEX-Jun as a substrate in the presence of [-P]ATP and the respective kinase buffer. The phosphorylated Jun was identified as a 35-kDa band representing the fusion protein Gst-NH(2)-terminal c-Jun after its separation on SDS-PAGE and detection by autoradiography. B, analysis of kinases present in these cellular proteins that can phosphorylate c-Jun was performed via an ``in-gel kinase'' assay (see ``Materials and Methods'') in which NH(2)-terminal Jun was embedded in the acrylamide. The arrow points to the position of one of the JNK isozymes with a molecular mass of 54 kDa, which appears as a doublet. The upper component of this doublet, seen in HeLa cells, is probably another JNK isozyme which is also seen in respective immunoprecipitations (not shown).



To further elucidate this observation, we have performed in-gel kinase reactions. To this end, Jun (corresponding to the NH(2)-terminal region which was eluted from the GST-Jun construct) was fixed in the acrylamide gel prior to separation of proteins prepared from control and UV- or HS-treated CS cells. As shown in Fig. 1B, a 54-kDa band appeared as a doublet; it corresponded to the M(r) of JNK2 (48, 49) and was thus identified as the kinase that phosphorylates c-Jun. The lower component of this 54-kDa doublet was clearly induced, thus exhibiting greater intensity in the proteins of UV-treated cells, but substantially lower intensity in HS-treated CS cells. JNK2 was also identified in HeLa cell proteins which we used as an internal control (Fig. 1B). That equal amounts of proteins were separated on each lane was verified via silver staining of the gel before the autoradiography (not shown). The 54-kDa doublet may represent different JNK isozymes that are expressed in these cells (see below) and exhibit different kinase activities. A similar pattern of JNK activation by UV, but not by HS, treatment was observed in cells that were depleted of their mitochondrial DNA (Fig. 1B). The 54-kDa band was also noticed in HS-treated HeLa cells, whereas both 54- and 46-kDa bands (46 kDa corresponding to JNK1) were identified in HS-treated 3T3-4A cells (not shown).

JNK Isozymes Expressed and Bound to c-Jun

To identify JNK isozymes that are expressed in the cells used in the present study, we have performed Western blot analysis on pGEX-Jun-bound proteins. To this end, protein extracts prepared after UV, HS, or sham treatments were incubated with pGEX-Jun as for the kinase reaction (see ``Materials and Methods''). Bound proteins were eluted with the aid of N-octyl-beta-D-glucopyranoside and analyzed on Westerns, using antibodies to JNK. These antibodies were developed against JNK1 and JNK2, yet apparently they can also identify other JNK isozymes(47) . We demonstrate that Jun-bound JNK in 3T3-4A cells consists of the 46- and 54-kDa proteins which correspond to JNK1 and JNK2 (Fig. 2). Comparison of Jun kinases that bind to pGEX-Jun after treatment with different types of stress reveals a similar subset of JNK isozymes (Fig. 2). When the proteins were analyzed via Western (without prior elution), a similar pattern of JNK isozymes was noticed (not shown). The 54-kDa doublet seen in 143B206 cells that were depleted of mitochondrial DNA may represent two JNK isozymes. Interestingly, it is the lower component of this doublet that is found to be induced after UV irradiation in the ``in-gel'' kinase assay (Fig. 1B), indicating that not all bound JNK isozymes are capable of phosphorylating c-Jun. Among these two forms it is the upper component which is bound to pGEX-Jun in the Cockayne syndrome JC133 cells (Fig. 2). A similar reaction with empty pGEX (pGEX2T) did not reveal any JNK binding (not shown). When the protein extracts from HS- and UV-treated cells were first depleted of JNK (using the supernatant retained after immunoprecipitation with antibodies to JNK and protein A/G beads), there was a significant decrease in the degree of JNK activity (not shown).


Figure 2: JNK isozymes in 3T3-4A cells. Protein extracts were prepared from sham, UV, or HS-treated 143B205 cells (depleted of mitochondrial DNA), 3T3-4A (mouse fibroblasts), and JC133 (Cockayne syndrome derived fibroblasts). These proteins were incubated with pGEX-Jun as in the kinase reaction. After washing, the bound proteins were eluted and analyzed via Western blotting on SDS-PAGE using antibodies to JNK. M(r) markers are indicated on the right panel, and the position of JNK1 and JNK2 is shown by arrows on the left panel.



H(2)O(2)Inhibits HS- but Not UV-mediated JNK Activation

Finding two different cell systems that fail to mediate JNK activation after HS, while exhibiting proper activation by UV (Fig. 1), prompted us to explore which cellular components are involved in the response to each of these stimuli. The approach used in the present study employed modulators of different cellular compartments that are known to play a role in the cellular stress response. These included: (i) changes of cytoplasmic components, such as (a) oxygen radicals, one of the pronounced effects of UV-C (254 nm) irradiation (with the aid of hydrogen peroxide), and (b) their respective scavengers (NAC; glutathione) and (ii) modulation of membrane components via alteration of receptor organization and anchored proteins. In utilizing this approach we have elected to study a cell system that exhibits proper JNK activation by either form of stress, UV or HS. To this end, we have characterized mouse fibroblast 3T3-4A cells that appear to express both the 46- and 54-kDa forms of JNK, representing JNK1 and JNK2, respectively (Fig. 2). When treated with various levels of H(2)O(2) to inflict oxidative damage, no change in the level of JNK activity was noticed (Fig. 3A). In these experiments, cellular proteins were prepared 30 min after exposure, and JNK activity was measured via the phosphorylation of a pGEX-Jun construct which contains the NH(2)-terminal region of c-Jun (amino acids 5-89). Products of this kinase reaction were separated on SDS-PAGE, autoradiographed, and quantified with a radioimaging blot analyzer. H(2)O(2) did not activate JNK, suggesting that not only components induced or modulated by oxidative stress, but additional factors are involved in JNK activation by ultraviolet irradiation. When cells had been treated with low doses of UV irradiation (5-10 J/m^2), H(2)O(2) was capable of further increasing the level of JNK activity (not shown). However, when added to cells treated with higher UV doses (40-80 J/m^2), H(2)O(2) did not affect the overall degree of JNK activation (Fig. 3A). The latter suggests that UV mediates JNK activation via cellular targets that are also affected by H(2)O(2). Interestingly, however, when added to heat shock (42 °C for 60 min) treated cells, H(2)O(2) was a potent inhibitor of JNK activity (Fig. 3B). That H(2)O(2) selectively inhibits JNK activation by HS, but not by UV, substantiates the existence of a variety of cellular components as mediators of JNK activation. HS-mediated JNK activation was also noticed after shorter exposures (30 min; not shown). When cellular proteins of untreated cells were heated in vitro (42 °C 1 h), a noticeable increase in JNK activity was seen (Fig. 3B). The cytotoxicity caused by HS treatment was 30%, whereas the UV irradiation doses had induced 80% toxicity after 24 h.


Figure 3: H(2)O(2) inhibits HS- but not UV-mediated JNK activation. A, mouse fibroblasts were exposed to the indicated doses of H(2)O(2), UV-C (20 J/m^2), or sham treatment, either alone or in combination as indicated. Proteins were then used for JNK assays as detailed under ``Materials and Methods.'' After their incubation with the pGEX-Jun in the presence of kinase buffer and [-P]ATP, beads were washed and separated on SDS-PAGE which was autoradiographed. The bands shown reflect the 35-kDa fusion protein Gst-Jun (NH(2)-terminal region). B, mouse fibroblasts were exposed to heat shock (HS) (60 min at 42 °C), H(2)O(2), sodium vanadate (SV), or sham treatment, either alone or in the indicated combinations. JNK assays were performed as described in the text. HS in vitro indicates the increase in level of active JNK after exposure of proteins from control (untreated cells) to HS in vitro. C, the actual gels were scanned with a radioimaging blot analyzer and values obtained were normalized per JNK activity in sham-treated cells. Values are shown as n-fold increase in JNK activity.



To quantify the degree of JNK activation noticed after HS and UV exposure, we have scanned the respective gels by a radioimaging blot analyzer. The counts/min obtained under each of these experimental conditions were normalized per counts measured in control (untreated) extracts, resulting in values that represent an n-fold increase in JNK activation (Fig. 3C).

While the role of tyrosine phosphorylation in JNK activation was shown previously(48, 49) , we have determined the influence of tyrosine phosphorylation on JNK activities in mouse fibroblast 3T3-4A cells. One of the potent modulators of tyrosine kinases is sodium vanadate. When added to cultures of 3T3-4A cells, sodium vanadate (1 mM) itself caused a significant increase in JNK activities (Fig. 3B), suggesting that the degree of JNK phosphorylation directly contributes to its activity. Although UV is already a potent inducer of JNK activities, an enhanced effect is noted when UV is combined with sodium vanadate. Similar to the UV effect, heat shock treatment of 3T3-4A cells leads to a strong activation of JNK, which is further enhanced by sodium vanadate (not shown). Additional support for the role of tyrosine kinases in JNK activities comes from the use of genistein, a potent inhibitor of tyrosine kinase. When genistein was added to 3T3-4A cells, we have noticed a dose-dependent decrease in JNK activation after UV irradiation (not shown).

NAC Inhibits UV-mediated but Not HS-mediated JNK Activation

To further explore mechanisms involved in JNK activation by HS and UV, respectively, and in light of the ability of hydrogen peroxide to inhibit HS, but not UV-mediated JNK activation, we have used NAC, a potent scavenger of free radicals(6) . As shown in Fig. 4A, NAC itself had no significant effects on JNK activity, yet, it strongly inhibited UV-mediated JNK activation. This inhibition was reversible; in fact, adding H(2)O(2) to the cells restored UV-mediated JNK activation in a dose-dependent manner (Fig. 4A). This emphasizes the role of oxidative damage in JNK activation by UV irradiation. In contrast, when NAC was added to HS-treated cells, no significant changes in the levels of JNK activation were noticed (Fig. 4B). However, NAC was capable of restoring H(2)O(2)-mediated inhibition of JNK activation after HS. Similar observations were also made when lower doses of NAC (20 mM) were used (not shown). Thus, while oxidative stress is contributing to JNK activation by UV, it is an inhibitory component of HS-mediated JNK activation.


Figure 4: NAC inhibits UV- but not HS-mediated JNK activation. A, 3T3-4A cells were exposed to NAC (40 mM), UV-C (20 J/m^2), or H(2)O(2) (10-100 µM) as indicated. Proteins (10 µg) were used as source of JNK which was added to the pGEX-Jun coupled to GST beads. Analysis of JNK activity was performed as outlined. B, quantitative JNK assays were performed on 3T3-4A cell proteins prepared from cells treated with UV (20 J/m^2), HS (60` 42 °C), NAC (40 mM), or H(2)O(2) (100 µM), alone or combined as indicated.



Since NAC acts as a potent scavenger of free oxygen radicals, we have tested how glutathione in its oxidized and reduced forms contributes to JNK activation. When tested by itself, neither form induced JNK activation. Yet, when added to UV-treated cells, the oxidized form of glutathione had an additive effect on JNK activity. The reduced form of glutathione had an inhibitory effect on UV-mediated JNK activation. When added to HS-treated cells, the oxidized form of glutathione was a potent inhibitor of JNK, whereas the reduced form increased JNK activation (not shown). These observations further support our former experiments and suggest that HS utilizes a different cellular component than UV in mediating JNK activation.

Triton X-100 as Selective Inhibitor of UV-mediated JNK Activation

To further explore mechanisms that may be involved in UV- and HS-mediated JNK activation, we have tested the effect of non-ionic detergent which, at low concentrations, alters membrane components and reorganizes its associated proteins, including receptors (50, 51, 52) and p21 protein(53) . To this end we have pretreated 3T3-4A cells with various concentrations of Triton X-100 for 5 min, before applying either UV or HS treatment. Proteins were then prepared from the cells and tested for JNK activation. While JNK activation by HS was not affected by pretreatment of the cells with Triton X-100 (Fig. 5A), the JNK-activating capacity of UV was inhibited in a dose-dependent manner (Fig. 5B). A dose of 0.032% Triton X-100 caused a 60% inhibition, whereas a dose of 0.004% Triton yielded 10% inhibition of the JNK activation by UV irradiation (Fig. 5C). Interestingly, the effect of Triton on JNK activation by UV was seen only in cells that were pretreated with the detergent in culture. When Triton was added to the cells after UV or HS treatment, only minor changes in JNK activity were noticed (Fig. 5D). When protein extracts prepared from either UV- or HS-treated cells were incubated with Triton X-100 in vitro, prior to the JNK assay, no change in JNK activation was seen (not shown). To examine possible changes in membrane that may have caused leakage upon Triton X-100 exposure we have measured uptake of [alpha-P]dCTP (1 µCi/assay) into 3T3-4A cells (3 times 10^6) after either 5- or 10-min incubation. Under normal growth conditions the amount of radioactive material that was incorporated into the cells was similar to that measured in cells that were preincubated with 0.04% Triton X-100 (which causes about 50% inhibition of JNK activity after UV). A significantly higher incorporation (100-fold) was observed when cells were pretreated with 0.25% of Triton X-100 (not shown). These experiments suggest that the concentration proven effective in inhibiting UV-mediated JNK activities do not allow penetration of nucleotides and therefore is not expected to cause any leakage/changes in cellular ATP content either. Triton X-100, at the concentration of up to 0.04%, may affect phospholipids or other membrane associated components which are required to mediate UV, but not heat shock, response. Similarly, Nonidet P-40 was as potent as Triton X-100 in the selective inhibition of UV-mediated JNK activation, whereas SDS was significantly less effective (not shown). Further support for changes in membrane-associated components came from the finding that Triton X-100 inhibits the ability of sodium vanadate to activate JNK (Fig. 5D). The kinase-activating ability of sodium vanadate had previously been attributed to changes at the membrane receptor level(54) . Sodium vanadate-mediated JNK activation was inhibited to a greater degree than UV-mediated JNK activation (Fig. 5D). The latter suggests that UV can mediate JNK activation via other components while sodium vanadate effects are entirely dependent on alteration of membrane components by Triton X-100. This is supported by the finding that a combination of UV and sodium vanadate exerts an additive effect on JNK activity (not shown).


Figure 5: Effect of Triton X-100 on UV- and HS-mediated JNK activation. A, cells were exposed to the indicated concentrations of Triton X-100 for 5 min before their exposure to HS (60 min at 42 °C). The control lane represents the basal level of JNK activity. B, cells were exposed to the indicated concentrations of Triton X-100 for 5 min before irradiation with UV (20 J/m^2). Proteins were prepared 30 min after treatment and analyzed as indicated. C, quantitative data with the gel shown in B were obtained through the use of a radioimaging blot analyzer. Counts/min values of UV-mediated JNK activation were considered as 100%, and those obtained after pretreatment with Triton X-100 were normalized to reflect percent inhibition of JNK activity after UV irradiation. D, 3T3-4A cells were incubated for 5 min with Triton X-100 (0.008%) 30 min after UV (40 J/m^2, UV + T) or after sodium vanadate (SV, 1 mM; SV + T) treatment. Protein extracts were prepared and assayed for JNK activity as indicated. Lanes T + UV and T + SV represent JNK assays performed with proteins prepared from cells growing in culture that were incubated with Triton X-100 at the same concentration for 5` before they were treated with UV or sodium vanadate.



Effects of UV, HS, and H(2)O(2)Treatments on c-Jun Phosphorylation in Vivo and on DNA Binding Activity

The next set of experiments was designed to evaluate whether JNK phosphorylation contributes to c-Jun activities. Since previous studies had documented the effects of different forms of stress on the level of c-Jun transcripts, we have measured the level of these transcripts as a control for the efficiency of the treatments administered in the present study. Northern blot analysis with RNA prepared 1 h after treatments revealed a noticeable increase in the level of c-Jun transcripts after UV and H(2)O(2), but not after HS, treatment (not shown).

To determine whether c-Jun phosphorylation in vivo reflects the patterns noticed in the JNK assays, we have incubated 3T3-4A cells in [P]orthophosphate for 60 min after their exposure to UV, HS, or H(2)O(2). Following extensive washing, proteins were prepared and the c-Jun protein was then immunoprecipitated with the aid of antibodies to c-Jun and with protein A/G beads. Immunoprecipitated material was separated on SDS-PAGE and autoradiographed. As shown in Fig. 6A, clear differences were noticed in the overall level of phosphorylated jun after these treatments. Both UV and HS were potent inducers of c-Jun phosphorylation in vivo, whereas H(2)O(2) was not. The degree of phosphorylated c-Jun is even lower after H(2)O(2) treatment when compared with that precipitated from control proteins. The doublet seen in c-Jun after H(2)O(2) treatment indicates a phosphorylated form, although the overall level of phosphorylation was substantially lower than that found after UV or HS treatment, as seen in shorter exposures (not shown). The pattern seen here is in agreement with that observed in vitro after using pGEX-Jun (NH(2)-terminal region) as a substrate ( Fig. 3and Fig. 4). Longer incubation periods did not affect the overall level of phosphorylation (Fig. 6A), suggesting that the immediate response of JNK is the key determinant in c-Jun phosphorylation. The position of c-Jun was confirmed by both the molecular mass of 39 kDa and by the use of in vitro translated c-Jun which was subjected to phosphorylation by JNK in vitro and separated in parallel on SDS-PAGE (Fig. 6A).


Figure 6: A, changes in jun phosphorylation in vivo after HS, H(2)O(2), or UV treatment. [P]Orthophosphate was added to 3T3-4A cells that were grown in 150-mm dishes in phosphate-free medium. After 60-min incubation (unless otherwise indicated) proteins were prepared, immunoprecipitated with antibodies to c-Jun, and separated on SDS-PAGE, which was then subjected to autoradiography. The molecular mass of the band shown was calculated to be 39 kDa. On the same gel (a few lanes apart that were spliced out) in vitro translated, and immunoprecipitated c-Jun was also separated as an internal control. B, binding to AP1 target sequence after HS, H(2)O(2), or UV treatment. Proteins prepared from mouse fibroblast 3T3-4A cells 1 h after exposure to HS, H(2)O(2), or UV irradiation were incubated (5 µg) with a P-labeled AP1 target sequence in the presence of nonspecific DNA and DNA binding buffer (lane marked with -). Competition experiments were performed using a 50-fold excess of the respective nonlabeled target sequence and using AP1 or NFkappaB as indicated in the second and third lanes of each panel. Upon their separation on a 5% PAGE, protein complexes were visualized via autoradiography. The first three lanes from the left represent free probes; the arrow points to the position of the major complex.



As a measure for transcriptional activities that are mediated by proteins which interact with the AP1 target sequence, we have performed EMSA. In these assays we have compared the binding of proteins prepared after HS, UV, or H(2)O(2) treatments. As demonstrated in Fig. 6B, whereas binding activities have increased after each of these treatments, proteins derived after HS and H(2)O(2) treatments were more potent than those obtained after UV exposure. The specificity of this reaction was demonstrated through the use of AP1 and NFkappaB as specific and nonspecific competitors, respectively (Fig. 6B). While AP1 was capable of inhibiting binding to the AP1 target sequence, NFkappaB had no effects. A similar pattern was observed when the NFkappaB target sequence was used (not shown).


DISCUSSION

The present study provides direct evidence for the existence of alternate pathways in JNK activation by different forms of stress, as shown for UV and HS. The distinction of these alternate pathways lies in the requirement for membrane-associated components for UV-mediated, but not for HS-mediated, JNK activation. This can be concluded on the basis of the ability of Triton X-100 to block JNK activation by both vanadate and UV, when these are administered before, but not after, UV irradiation. As vanadate has been shown to mediate its effects via cell membrane receptors(54) , changes in such receptors are expected to abolish its activities as was observed in our experiments (Fig. 5). Moreover, it has been previously demonstrated that Triton X-100 alters membrane organization and modulates the ability of p21 to mediate mitogen-activated protein kinase activation(53) . Similar detergents were shown to alter the ability of the epidermal growth factor receptor to dimerize and autophosphorylate(50, 51, 52) . It is likely, therefore, that due to the effect of Triton X-100 on receptor organization, the receptor can no longer dimerize to trans-phosphorylate and thus fails to activate downstream protein kinases. Furthermore, we have recently shown the association between p21 and JNK(55) . We, therefore, cannot exclude the possibility that membrane-anchored components, such as p21 were also altered, so that they could not associate/activate JNK. Accordingly, HS-mediated JNK activation may utilize ras-independent pathways which were previously documented (25, 56) . We conclude, therefore, that UV requires cellular membrane signaling, whereas HS does not. It is, therefore, surmised that different kinases are involved in JNK activation in response to alternate forms of stress as shown here for UV and HS.

UV-mediated JNK activation also involves oxidative damage, as demonstrated by the inhibition of this response through the radical scavenger NAC. In contrast, oxidative damage by H(2)O(2) inhibits HS-mediated JNK activation, and we have shown that NAC is unable to inhibit HS-mediated JNK activation. That oxygen radicals, such as H(2)O(2), inhibit the HS-mediated pathway suggests that cellular components other than catalase, superoxide dismutase, or glutathione peroxidase (which are involved in the response to UV and its oxidative damage) are playing an important role in the regulation of JNK activation. That there are different cellular sensors for UV and HS damage can also be deduced from the observation that in vitro HS treatment of cellular extracts can induce JNK (Fig. 3B), whereas UV-mediated JNK activation requires a complete and precise in vivo setting of membrane components as demonstrated in the Triton X-100 experiments. The different responses to HS and UV are not mediated by different JNK isozymes, as both the 46-kDa and the 54-kDa proteins representing JNK1 and JNK2, respectively, were equally capable of binding to the NH(2)-terminal region of Jun.

Both UV and HS were potent inducers of JNK activation leading to increased c-Jun phosphorylation in vivo and to a corresponding increase in binding to the AP1 target sequence. The degree of JNK activity and, in turn, c-Jun phosphorylation is expected to be tightly regulated by specific protein phosphatases, which are also induced by external stress, as shown for HS. For example, protein phosphatase 2C is induced by HS in Schizosaccharomyces pombe(57) . Similarly, PAC1, a mitogen-induced nuclear protein with tyrosine phosphatase activities, is also induced by HS(58) .

Interestingly, in the cell system studied here, H(2)O(2) was neither capable of activating JNK, nor was it able to increase in vivo labeling of c-Jun; however, it was as potent as UV or HS in forming complexes with AP1 target sequence DNA. It is thus possible that although complexes of similar size were formed in all cases, the binding observed in our EMSA may have been mediated not only by c-Jun proteins, but by other members of the AP1 or ATF families that can interact with the AP1 target sequence and have a M(r) similar to that of c-Jun. However, the overall transcriptional signal is expected to be different in the case of H(2)O(2) than in that of UV or HS.

A possible clue as to the nature of the different cellular components involved in JNK activation evolved from the reactions with different cell lines. We have shown this for CS cells which mediate selective activation of JNK2 by UV but not by HS. A similar observation was made in cells that lack mitochondrial DNA and exhibit JNK activation after UV exposure but not after HS treatment (Fig. 1B and (2) ). These observations suggest that HS activation of JNK requires mitochondria-related components, which are not available upon deregulation of the mitochondria. Impaired mitochondrial function has been widely documented for aged cells(41) . The latter coincides with our observations that higher levels of oxidative stress inhibit HS-mediated JNK activities and that aged cells abrogate heat shock response(59, 60, 61) .

Overall, that alternate pathways mediate JNK activation by different forms of stress indicates the existence of multiple cellular sensors which are triggered by the respective stimuli. UV-induced JNK activation is dependent on membrane-associated components and free oxygen radicals (our present study) and DNA damage per se(47) , whereas mitochondria-related components appear to be involved in the HS response.


FOOTNOTES

*
This work was supported by Grants CA-51995 and CA-59908 from the National Cancer Institute. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed.

(^1)
The abbreviations used are: HS, heat shock; EMSA, electrophoretic mobility shift assay; PAGE, polyacrylamide gel electrophoresis; JNK, c-Jun amino-terminal protein kinase; GST, glutathione S-transferase; CS, Cockayne syndrome.

(^2)
V. Adler, L. Dolan, V. Dhar, and Z. Ronai, unpublished observations.


ACKNOWLEDGEMENTS

We thank C. Basilico of New York University for providing us with the 3T3-4A cells, A. Lehman of Medical Research Council Univ. Sussex UK, London for the JC133 cells, M. King of Columbia University for 143B206 cells, A. Kraft of Univ. Alabama Birmingham, and M. Karin of the University of California San Diego for GST-Jun constructs. We are grateful to C. Monell of PharMingen, San Diego, for antibodies to JNK and to K. Yokoyama of RIKEN Japan for mouse c-Jun cDNA. We also acknowledge the assistance of I. Hoffmann and R. Alexander in the preparation of this manuscript.


REFERENCES

  1. Kastan, M. B., Onyekwere, O., Sidransky, D., Vogelstein, B. & Craig, R. W. (1991) Cancer Res. 51, 6304-6311 [Medline] [Order article via Infotrieve]
  2. Fornace, A. J., Jr. (1992) Annu. Rev. Genet. 26, 507-526 [Medline] [Order article via Infotrieve]
  3. Smith, M. L., Chen, I. T., Zhan, Q., Bae, I., Chen, C.-Y., Gilmer, T. M., Kastan, M. B., O'Connor, P. M. & Fornace, A. J., Jr. (1994) Science 266, 1376-1379 [Abstract/Free Full Text]
  4. El-Deiry, W. S., Tokino, T., Velculescu, V. E., Levy, D. B., Parsons, R., Trent, J. M., Lin, D., Mercer, W. E., Kinzler, K. W. & Vogelstein, B. W. (1993) Cell 75, 817-825 [CrossRef][Medline] [Order article via Infotrieve]
  5. Leonardo, A. D., Linke, S. P., Clarkin, K. & Wahl, G. M. (1994) Genes & Dev. 8, 2540-2551
  6. Devary, Y., Rosette, C., DiDonato, J. A. & Karin, M. (1993) Science 261, 1442-1445 [Abstract/Free Full Text]
  7. Stein, B., Rahmsdorf, H. J., Steffen, A., Litfin, M. & Herrlich, P. (1989) Mol. Cell. Biol. 9, 5169-5181 [Abstract/Free Full Text]
  8. Herrlich, P. & Rahmsdorf, H. J. (1994) Curr. Opin. Cell Biol. 6, 425-431 [CrossRef][Medline] [Order article via Infotrieve]
  9. Radler-Pohl, A., Sachsenmaier, C., Gebel, S., Auer, H. P., Bruder, J. T., Rapp, U., Angel, P., Rahmsdorf, H. J. & Herrlich, P. (1993) EMBO J. 12, 1005-1012 [Medline] [Order article via Infotrieve]
  10. Ronai, Z., Rutberg, S. & Yang, Y. M. (1994) Environ. Mol. Mutagen. 23, 157-163 [Medline] [Order article via Infotrieve]
  11. Wu, X. & Levine, A. J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 602-606
  12. Li, R., Waga, S., Hannon, G. J., Beach, D. & Stillman, B. (1994) Nature 371, 534-537 [CrossRef][Medline] [Order article via Infotrieve]
  13. Kuerbitz, S. J., Plunkett, B. S., Walsh, W. V. & Kastan, M. B. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7491-7495 [Abstract/Free Full Text]
  14. Zhan, Q., Lord, K. A., Alamo, I., Jr., Hollander, M. C., Carrier, F., Ron, D., Kohn, K. W., Hoffman, B., Liebermann, D. A. & Fornace, A. J., Jr. (1994) Mol. Cell. Biol. 14, 2361-2371 [Abstract/Free Full Text]
  15. Engelberg, D., Klein, C., Martinetto, H., Struhl, K. & Karin, M. (1994) Cell 77, 381-390 [CrossRef][Medline] [Order article via Infotrieve]
  16. Rahmsdorf, H. J., Gebel, S., Kramer, M., Konig, H., Lucke-Huhle, C., Radler-Pohl, A., Sachsenmaier, C., Stein, B., Auer, H.-P., Vanetti, M. & Herrlich, P. (1992) in Induced Effects of Genotoxic Agents in Eukaryotic Cells (Rossman, T. G., ed) pp. 141-161, Hemisphere Publishing Corp., London
  17. Derijard, B., Raingeaud, J., Barret, T., Wu, I-H., Han, J., Ulevitch, R. J. & Davis, R. J. (1995) Science 267, 682-685 [Abstract/Free Full Text]
  18. Devary, Y., Gottlieb, R. A., Smeal, T. & Karin, M. (1992) Cell 71, 1081-1091 [CrossRef][Medline] [Order article via Infotrieve]
  19. Davis, R. J. (1994) Trends Biochem. Sci. 19, 470-473 [CrossRef][Medline] [Order article via Infotrieve]
  20. Derijard, B., Hibi, M., Wu, I. H., Barrett, T., Su, B., Deng, T., Karin, M. & Davis, R. J. (1994) Cell 76, 1025-1037 [CrossRef][Medline] [Order article via Infotrieve]
  21. Choi, H. S., Li, B., Lin, Z., Huang, E. & Liu, A. Y. (1991) J. Biol. Chem. 266, 11858-65 [Abstract/Free Full Text]
  22. Sachsenmaier, C., Radler-Pohl, A., Zinck, R., Nordheim, A., Herrlich, P. & Rahmsdorf, H. J. (1994) Cell 78, 963-972 [CrossRef][Medline] [Order article via Infotrieve]
  23. Sanchez, I., Hughes, R. T., Mayer, B. J., Yee, K., Woodgett, J. R., Avruch, J., Kyriakis, J. M. & Zon, L. I. (1994) Nature 372, 794-798 [Medline] [Order article via Infotrieve]
  24. Galcheva-Gargova, Z., Derijard, B., Wu, I-H. & Davis, R. J. (1994) Science 265, 806-808 [Abstract/Free Full Text]
  25. Lin, A., Minden, A., Martinetto, H., Claret, F.-X., Lange-Carter, C., Mercurio, F., Johnson, G. L. & Karin, M. (1995) Science 268, 286-290 [Abstract/Free Full Text]
  26. Rouse, J., Cohen, P., Trigon, S., Morange, M., Alonso-Llamazares, A., Zamanillo, D., Hunt, T. & Nebreda, A. R. (1994) Cell 78, 1027-1037 [CrossRef][Medline] [Order article via Infotrieve]
  27. Pulverer, B. J., Kyriakis, J. M., Avruch, J., Nikolakaki, E. & Woodgett, J. R. (1991) Nature 353, 670-674 [CrossRef][Medline] [Order article via Infotrieve]
  28. Morgan, I. M., Asano, M., Havarstein, L. S., Ishikawa, H., Hiiragi, T., Ito, Y. & Vogt, P. K. (1993) Oncogene 8, 1135-1140 [Medline] [Order article via Infotrieve]
  29. Smeal, T., Binetruy, B., Mercola, D. A., Birrer, M. & Karin, M. (1991) Nature 354, 494-496 [CrossRef][Medline] [Order article via Infotrieve]
  30. Adler, V., Franklin, C. C. & Kraft, A. S. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5341-5345 [Abstract/Free Full Text]
  31. Angel, P., Smeal, T., Meek, J. & Karin, M. (1989) New Biol. 1, 35-43 [Medline] [Order article via Infotrieve]
  32. Baichwal, V. R. & Tjian, R. (1990) Cell 63, 815-825 [CrossRef][Medline] [Order article via Infotrieve]
  33. Datta, R., Taneja, N., Sukhatme, V. P., Qureshi, S. A., Weichselbaum, R. & Kufe, D. W. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2419-2422 [Abstract/Free Full Text]
  34. Nose, K., Shibanuma, M., Kikuchi, K., Kageyama, H., Sakiyama, S. & Kuroki, T. (1991) Eur. J. Biochem. 201, 99-106 [Medline] [Order article via Infotrieve]
  35. Devary, Y., Gottlieb, R., Lau, L. F. & Karin, M. (1991) Mol. Cell. Biol. 11, 2804-2811 [Abstract/Free Full Text]
  36. Meyer, M., Schreck, R. & Baeuerle, P. A. (1993) EMBO J. 12, 2005-2015 [Medline] [Order article via Infotrieve]
  37. Heinecke, J. W., Meier, K., Lorenzen, J. A. & Shapiro, B. M. (1990) J. Biol. Chem. 265, 7717-7720 [Abstract/Free Full Text]
  38. Schieven, G. L., Kirihara, J. M., Myers, D. E., Ledbetter, J. A. & Uckun, F. M. (1993) Blood 82, 1212-1220 [Abstract/Free Full Text]
  39. Cerutti, P., Shah, G., Peskin, A. & Amstad, P. (1992) Ann. N. Y. Acad. Sci. 663, 158-166 [Abstract]
  40. Hockenbery, D. M., Oltvai, Z. N., Yin, X. M., Milliman, C. L. & Korsmeyer, S. J. (1993) Cell 75, 241-251 [CrossRef][Medline] [Order article via Infotrieve]
  41. Ames, B. N., Shigenaga, M. K. & Hagen, T. M. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 7915-7922 [Abstract/Free Full Text]
  42. Shimizu, S., Eguchi, Y., Kosaka, H., Kamiiki, W., Matsuda, H. & Tsujimoto, Y. (1995) Nature 374, 811-814 [CrossRef][Medline] [Order article via Infotrieve]
  43. Liboi, E. & Basilico, C. (1984) Virology 135, 440-451 [CrossRef][Medline] [Order article via Infotrieve]
  44. Yang, Y. M., Rutberg, S. E., Luo, F. C., Spratt, T. E., Halaban, R., Ferrone, S. & Ronai, Z. (1991) Cell Growth & Differ. 4, 595-602
  45. Rutberg, S. E., Yang, Y. M. & Ronai, Z. (1992) Nucleic Acids Res. 20, 4305-4310 [Abstract/Free Full Text]
  46. Adler, V., Unlap, T. & Kraft, A. S. (1994) J. Biol. Chem. 269, 11186-11191 [Abstract/Free Full Text]
  47. Adler, V., Fuchs, S., Kim, J., Kraft, A., King, M. & Ronai, Z. (1995) Cell Growth & Differ. , in press
  48. Hibi, M., Lin, A., Smeal, T., Miden, A. & Karin, M. (1993) Genes & Dev. 7, 2135-2148
  49. Kallunki, T., Su, B., Tsigelny, I., Sluss, H. K., Derijard, B., Moore, G., Davis, R. & Karin, M. (1994) Genes & Dev. 8, 2996-3007
  50. Carlin, C., Phillips, P. D., Brooks-Frederich, K., Knowles, B. B. & Cristofalo, V. J. (1994) J. Cell. Physiol. 160, 427-434 [CrossRef][Medline] [Order article via Infotrieve]
  51. Gates, R. E. & King, L. E., Jr. (1993) J. Recept. Res. 13, 829-847 [Medline] [Order article via Infotrieve]
  52. Spaargaren, M., Defize, L. H., Boonstra, J. & de Laat, S. W. (1991) J. Biol. Chem. 266, 1733-1739 [Abstract/Free Full Text]
  53. Dent, P., Wu, J., Romero, G., Vincent, L. A., Castle, D. & Sturgill, T. W. (1993) Mol. Biol. Cell 4, 483-493 [Abstract]
  54. Secvist, J. P., Burns, L. A., Karnitz, L., Kovetzky, G. A. & Abraham, R. T. (1993) J. Biol. Chem. 268, 5886-5893 [Abstract/Free Full Text]
  55. Adler, V., Pincus, M. T., Brandt-Rauf, P. & Ronai, Z. (1995) Proc. Natl. Acad. Sci. U. S. A. , in press
  56. Yan, M., Dai, T., Deak, J. C., Kyriakis, J. M., Zon, L. I., Woodgett, J. R. & Templeton, D. J. (1994) Nature 372, 798-800 [Medline] [Order article via Infotrieve]
  57. Shiozaki, K., Akhavan-Niaki, H., McGowan, C. H. & Russell, P. (1994) Mol. Cell. Biol. 14, 3742-3751 [Abstract/Free Full Text]
  58. Rohan, P. J., Davis, P., Moskaluk, C. A., Kearns, M., Krutzsch, H., Siebenlist, U. & Kelly, K. (1993) Science 259, 1763-1766 [Abstract/Free Full Text]
  59. Choi, H. S., Lin, Z., Li, B. & Liu, A. Y. (1990) J. Biol. Chem. 265, 18005-18011 [Abstract/Free Full Text]
  60. Heydari, A. R., Wu, B., Takahashi, R., Strong, R. & Richardson, A. (1993) Mol. Cell. Biol. 13, 2909-2918 [Abstract/Free Full Text]
  61. Liu, A. Y., Choi, H. S., Lee, Y. K. & Chen, K. Y. (1991) J. Cell. Physiol. 149, 560-566 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Exp. Biol.Home page
C. Gaitanaki, M. Mastri, I.-K. S. Aggeli, and I. Beis
Differential roles of p38-MAPK and JNKs in mediating early protection or apoptosis in the hyperthermic perfused amphibian heart
J. Exp. Biol., August 1, 2008; 211(15): 2524 - 2532.
[Abstract] [Full Text] [PDF]


Home page
Toxicol SciHome page
S.-H. Chen, J.-K. Lin, S.-H. Liu, Y.-C. Liang, and S.-Y. Lin-Shiau
Apoptosis of Cultured Astrocytes Induced by the Copper and Neocuproine Complex through Oxidative Stress and JNK Activation
Toxicol. Sci., March 1, 2008; 102(1): 138 - 149.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Physiol. Lung Cell. Mol. Physiol.Home page
S. Chu and T. J. Ferro
Identification of a hydrogen peroxide-induced PP1-JNK1-Sp1 signaling pathway for gene regulation
Am J Physiol Lung Cell Mol Physiol, November 1, 2006; 291(5): L983 - L992.
[Abstract] [Full Text] [PDF]


Home page
Molecular Cancer TherapeuticsHome page
R. P. Singh, S. Dhanalakshmi, S. Mohan, C. Agarwal, and R. Agarwal
Silibinin inhibits UVB- and epidermal growth factor-induced mitogenic and cell survival signaling involving activator protein-1 and nuclear factor-{kappa}B in mouse epidermal JB6 cells
Mol. Cancer Ther., May 1, 2006; 5(5): 1145 - 1153.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
T. Tanos, M. J. Marinissen, F. C. Leskow, D. Hochbaum, H. Martinetto, J. S. Gutkind, and O. A. Coso
Phosphorylation of c-Fos by Members of the p38 MAPK Family: ROLE IN THE AP-1 RESPONSE TO UV LIGHT
J. Biol. Chem., May 13, 2005; 280(19): 18842 - 18852.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.