Volume 270,
Number 44,
Issue of November 3, 1995 pp. 26511-26522
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A Novel FK506
Binding Protein Can Mediate the Immunosuppressive Effects of FK506 and
Is Associated with the Cardiac Ryanodine Receptor (*)
(Received for publication, May 16, 1995; and in revised form, August 11, 1995)
Elsa
Lam
(1),
Mary
M.
Martin
(1),
Anthony P.
Timerman
(5),
Candace
Sabers
(4),
Sidney
Fleischer
(5),
Thomas
Lukas
(6),
Robert
T.
Abraham
(4), (3),
Stephen
J.
O'Keefe
(2),
Edward A.
O'Neill
(2),
Gregory J.
Wiederrecht
(1)(§)From the
(1)Departments of Immunology Research and
(2)Molecular Immunology, Merck Research
Laboratories, Rahway, New Jersey 07065, the Departments of
(3)Immunology and
(4)Pharmacology, Mayo Clinic, Rochester, Minnesota
55905, and the Departments of
(5)Molecular Biology,
(6)Cell Physiology, and
(7)Biophysics, Vanderbilt University, Nashville,
Tennessee 37235
ABSTRACT
- INTRODUCTION
- MATERIALS AND METHODS
- RESULTS
- DISCUSSION
- FOOTNOTES
- REFERENCES
ABSTRACT 
FK506, an immunosuppressant that prolongs allograft survival, is
a co-drug with its intracellular receptor, FKBP12. The
FKBP12
FK506 complex inhibits calcineurin, a critical signaling
molecule during T-cell activation. FKBP12 was, until recently, the sole
FKBP known to mediate calcineurin inhibition at clinically relevant
FK506 concentrations. The best characterized cellular function of
FKBP12 is the modulation of ryanodine receptor isoform-1, a component
of the calcium release channel of skeletal muscle sarcoplasmic
reticulum.
Recently, a novel protein, FKBP12.6, was found to inhibit
calcineurin at clinically relevant FK506 concentrations. We have cloned
the cDNA encoding human FKBP12.6 and characterized the protein. In
transfected Jurkat cells, FKBP12.6 is equivalent to FKBP12 at mediating
the inhibitory effects of FK506. Upon binding rapamycin, FKBP12.6
complexes with the 288-kDa mammalian target of rapamycin. In contrast
to FKBP12, FKBP12.6 is not associated with ryanodine receptor isoform-1
but with the distinct ryanodine receptor isoform-2 in cardiac muscle
sarcoplasmic reticulum. Our results suggest that FKBP12.6 has both a
unique physiological role in excitation-contraction coupling in cardiac
muscle and the potential to contribute to the immunosuppressive and
toxic effects of FK506 and rapamycin.
INTRODUCTION
FK506 (tacrolimus) is a powerful immunosuppressive drug for
treating graft rejection and autoimmune disorders. Rapamycin (RAP, (
)sirolimus) is an immunosuppressant structurally-related to
FK506 but with a distinct mechanism of action. Both drugs bind to a
family of intracellular receptors, the FK506 binding proteins (FKBPs),
whose members include FKBPs 12, 12.6, 13, 25, 51, and 52 (for review,
see (1) ). All FKBPs are peptidyl-prolyl isomerases, catalyzing
the cis-trans isomerization of peptidyl-prolyl bonds in
peptides and proteins, an activity inhibited by both FK506 and RAP.
Peptidyl-prolyl isomerase inhibition is unrelated to
immunosuppression. FK506 and RAP gain function upon binding FKBP12. The
FKBP12FK506 and FKBP12RAP complexes are the actual
immunosuppressive species whose targets are calcineurin (CaN) and the
mammalian target of RAP (mTOR), respectively (for review, see (1) and (2) ). CaN is a Ca
-dependent,
serine-threonine phosphatase required during the commitment phase
(G
G) of T-cell activation(3) .
Inhibition of CaN blocks the nuclear translocation of transcription
factors such as nuclear factor of activated T-cells and NF-
B,
controlling the expression of cytokine genes whose products are
required for immune response coordination (for review, see (2) ). RAP, unlike FK506, does not block lymphokine production
but inhibits the T-cell proliferative response to cytokines by blocking
G S-phase progression. The function of mTOR, a
288-kDa protein related to phosphatidylinositol kinases, is unknown.
CaN is a ubiquitous protein, and its inhibition at unwanted sites is
most responsible for the toxicity associated with FK506
therapy(4) . That immunosuppression and toxicity are
mechanistically linked through inhibition of CaN has been documented
using the nonimmunosuppressive and nontoxic FK506 analog, L-685,818
(`818; see Fig. 1). The observations that `818 binds tightly to
FKBP12, that the human FKBP12`818 complex has little affinity for
CaN, and that `818 reverses FK506 toxicity have demonstrated that CaN
inhibition, not FKBP binding, is responsible for the toxicity profile
of FK506(4, 5) .
Figure 1:
Structures of the
FKBP12.6 and FKBP12 ligands.
The cellular and pharmacologic
functions of FKBP12 are unrelated. Physiologically, FKBP12 regulates
the ryanodine receptor (RyR-1), an intracellular
Ca-release channel (CRC) required for
excitation-contraction coupling in skeletal muscle. The native CRC,
isolated from the terminal cisternae (TC) of skeletal muscle
sarcoplasmic reticulum (SR), is composed of four 565-kDa RyR-1
protomers and four FKBP12 molecules(6) . FKBP-stripped CRC
differs functionally from normal channels. It is activated by lower
concentrations of caffeine (6, 7) or
Ca(8, 9) , higher Mg concentrations are required for inactivation(9) , and it
has a greater open probability and displays longer mean open times in
the full conductance state(8) . These effects, reversed upon
rebinding FKBP12, indicate that FKBP12 stabilizes a closed conformation
of the channel. Cloned RyR-1, expressed in insect cells, also exhibits
channel properties functionally different from those of the native
CRC(7) . Without FKBP12, the channel flickers among
subconductance states, while co-expression of FKBP12 and RyR-1
generates channels opening to the full-conductance state(7) ,
suggesting that FKBP12 insures cooperativity among RyR-1 protomers.
FKBP12 may asymmetrically regulate ion flow through the channel,
promoting the flow of Ca unidirectionally from the
lumen of the SR to the cytoplasm during channel
activation(10) .
Until recently, FKBP12 was the sole FKBP
believed to be relevant to FK506-mediated immunosuppression or
toxicity. It had been the only FKBP known to be a potent mediator of
FK506's inhibition of CaN in vitro(11) and
signal transduction in Jurkat cells(12) . Recently, a novel
FKBP, FKBP12.6, was purified, sequenced, and characterized
biochemically(13) . Closely related to FKBP12, it has the same
number of amino acids and 18 mostly conservative amino acid
substitutions (13) . The most striking substitution is that of
a phenylalanine for a highly conserved tryptophan (13) forming
the base of the drug-binding cavity. FKBP12.6 and FKBP12 have equal
affinities for FK506 and are equipotent mediators of CaN inhibition by
FK506(13) . Thus, FKBP12.6 has the potential to mediate the
immunosuppression or toxicity associated with FK506 therapy.
We have
cloned and expressed the cDNA encoding human FKBP12.6. The
characterization of human FKBP12.6 in the presence and absence of its
drug ligands is the subject of this report.
MATERIALS AND METHODS
Isolation of the cDNA Encoding Human
FKBP12.6
Using the bovine amino acid sequence, nested polymerase
chain reaction (PCR) was used to isolate a cDNA fragment encoding human
FKBP12.6. The primary sense primers corresponding to the amino-terminal
six amino acids, MGVEIE, were ATGGGNGTNGARATAGA, ATGGGNGTNGARATCGA, and
ATGGGNGTNGARATTGA. The primary antisense primers, corresponding to
amino acids 81-86, VAYGAT, were GTNGCNCCRTANGCGAC,
GTNGCNCCRTANGCAAC, GTNGCNCCRTANGCTAC, and GTNGCNCCRTANGCCAC. Using Taq Ultima polymerase (Perkin-Elmer), the primers were used in
all 12 possible combinations in reactions performed according to the
manufacturer's instructions.The secondary sense primers,
corresponding to amino acids 14-19, RTFPKK, were
(A/C)GNACNTTYCCNAAGAA and (A/C)GNACNTTYCCNAAAAA. The secondary
antisense primers, corresponding to amino acids 60-65, FEEGAA,
were GCNGCNCCYTCYTCGA and GCNGCNCCYTCYTCAA. One µl of a 1:10
dilution of each primary PCR reaction mixture was used in each of the
four possible secondary PCR reactions (48 reactions total). The
combination of the (A/C)GNACNTTYCCNAAGAA and GCNGCNCCYTCYTCAA primers
gave the greatest amount of 156-base pair product. These two primers,
resynthesized with EcoRI linkers attached, were used to
generate a product that was digested with EcoRI, subcloned
into the EcoRI site of pUC19, and sequenced to confirm that it
encoded a fragment of hFKBP12.6.
The remainder of the cDNA encoding
hFKBP12.6 was cloned using the rapid amplification of cDNA ends) (RACE)
technique. To obtain the 3` end of the cDNA, a sense primer,
RCCTTTCAAGTTCAGAA, corresponding to a specific sequence obtained from
the partial hFKBP12.6 cDNA clone obtained above, was used. The first
antisense primer, GACTCGAGTCGACATCGATTTTTTTTTTTTTTTTT, anneals to
poly(A) tracts. The PCR reactions were performed as described
previously (14) , and 1 µl of the 10-fold diluted product
was used in a secondary PCR reaction. In the second PCR reaction, the
sense primer (corresponding to a specific nucleotide sequence in the
original partial cDNA) was AAACAGGAAGTCATCAA, and the antisense primer
was GACTCGAGTCGACATCG. The PCR reactions were performed as described
for the primary amplification; the products were purified by agarose
gel electrophoresis, and the major 800-base pair product was
reamplified with the same set of secondary primers except that the
sense primer contained an EcoRI linker. The product was cloned
between the EcoRI and SalI sites of pUC19.
To
obtain the 5` end of the gene, human brain 5`-RACE-Ready cDNA
(Clontech) was used as the template. A 5` anchor primer was supplied by
the manufacturer. The first antisense primer (corresponding to a
nucleotide sequence in the original partial cDNA) used was
TTGATGACTTCCTGTTTGCCAATTC. The PCR conditions were as described for the
3` RACE reactions. The products of the first reaction were diluted
10-fold, and those used in a second PCR reaction with the
manufacturer's anchor primer and a second antisense primer,
GAAAGGYTTGTTTCTGTCTCTGGAT. The product of the secondary reaction was
reamplified using an EcoRI-linkered antisense primer, and the
product was subcloned into the EcoRI site of pUC19 (the
Race-Ready cDNA contains an EcoRI site at the 5` end) and
sequenced. Alignment of the 5` RACE product, the original PCR fragment,
and the 3` RACE product generated a contiguous DNA sequence. To ensure
that the product of the alignment represented one contiguous cDNA, EcoRI- linkered primers corresponding to the extreme 5` and 3`
ends of the sequence were used to PCR the cDNA in one piece from human
brain cDNA. The PCR product was subcloned into the EcoRI site
of pUC19 and sequenced.
Bacterial Expression and Purification of
hFKBP12.6
The open reading frame (ORF) of the hFKBP12.6 cDNA was
subcloned from the complete cDNA by PCR using
GAATTCCCATGGGCGTGGAGATCGAG as the sense primer and
TTGGATCCTCACTCTAAGTTGAGCAG as the antisense primer. The PCR product was
digested with NcoI and BamHI and subcloned between
the NcoI and BamHI sites of the bacterial expression
vector pET3d (Novagen), and the plasmid was transformed into BL21(DE3)
cells. Expression of FKBP12.6 and production of the bacterial lysate
were as described for FKBP12(15) . The lysate was dialyzed
overnight against CM (5 mM sodium phosphate (pH 6.8), 1 mM EDTA, and 5 mM 
-mercaptoethanol)
buffer(13) . The dialyzed protein was purified on a TosoHaas
CM-3SW HPLC column (21.5 mm 
15 cm) as described
previously(13) . Up to 75 mg of pure hFKBP12.6 were obtained
per liter of Escherichia coli. Purified hFKBP12.6 may be
stored at -70 or at 4 °C.
Construction and Expression of a GST-hFKBP12.6 Fusion
Gene
Sense (AAGCTTGGATCCGGCGTGGAGATCGAGACC) and antisense
(AAGCTTTTGGATCCTCACTCTAAGTTGAGCAG) oligonucleotides were used in a PCR
reaction to generate, from the hFKBP12.6 cDNA, a BamHI-linkered DNA fragment containing the ORF of hFKBP12.6.
This fragment was digested with BamHI and subcloned into
pGEX2T (Pharmacia Biotech) at the BamHI site. The plasmid was
transformed into BL21(DE3) cells, and the GST-hFKBP12.6 fusion protein
was expressed as described previously (16) with two
modifications. First, induction with
isopropyl-1-thio--D-galactopyranoside proceeded
overnight. Second, after elution from the glutathione-agarose affinity
column, the protein-containing fractions were applied at a flow rate of
6 ml/min to a TosoHaas DEAE 3SW HPLC column (21.5 mm 15 cm)
equilibrated in buffer containing 5 mM Tris (pH 7.8). The
GST-FKBP12.6 fusion protein was eluted with a linear gradient of
0-500 mM NaCl in 5 mM Tris (pH 7.8) buffer over
a period of 1 h at a flow rate of 6 ml/min. Fractions (6 ml) were
collected, and one protein peak was eluted at about 200 mM NaCl. About 250 mg of GST-hFKBP12.6 were obtained per liter of E. coli. The homogeneous fusion protein can be stored at 4
°C or at -70 °C.
Expression and Purification of hFKBP12, yFKBP12,
hFKBP13-His6, hFKBP25, hFKBP52-His6, and hCyPA
Recombinant
hFKBP12 was expressed and purified as described
previously(15) . The ORFs encoding yeast FKBP12 (yFKBP12) and
human FKBP25 (hFKBP25) were generated by PCR, cloned into pET3d between
the NcoI and BamHI sites, and transformed into
BL21(DE3) cells. Both FKBPs were expressed as described for
hFKBP12(15) . Whereas, yFKBP12 localizes to the periplasm and
was purified as described for hFKBP12(15) , hFKBP25 localizes
to the cytosol. The cell pellet from 1 liter of cells expressing
hFKBP25 was resuspended in 10 ml of CM buffer and frozen in liquid
nitrogen. After thawing, 1% (v/v) of Triton X-100, 2 mM phenylmethylsulfonyl fluoride, and 2 µg/ml each of aprotinin,
leupeptin, pepstatin, and trypsin inhibitor were added to the
suspension. Cells were lysed in an ice bath using a Kontes
microultrasonic cell disrupter (4 15 s; maximum power) and
debris was removed by centrifugation (35,000 g for 30
min). The extract was applied to a TosoHaas CM-3SW HPLC column (21.5 mm
15 cm) and equilibrated in CM buffer at a 6 ml/min flow rate.
hFKBP25 was eluted from the column with a linear gradient of
0-300 mM NaCl in CM buffer over a period of 1 h at a
flow rate of 6 ml/min. hFKBP25 elutes between 100 and 150 mM NaCl and is homogeneous. The purified material was fully active as
determined by its complete binding to RAP-Sepharose and by its
peptidyl-prolyl isomerase activity, which agreed with published values
(for review, see (17) ). Purified hFKBP25 was stored at
-70 °C.The ORF encoding the processed form of human
FKBP13 (hFKBP13) fused to 10 histidine residues was generated by PCR
using the sense oligonucleotide
AGATATACCATGGGCCATCATCATCATCATCATCATCATCATCACAGCAGCGGCCATATCGACGACGACGACAAGACGGGGGCCGAGGGCAAAAGG
and the antisense oligonucleotide AACCTTGGATCCTTACAGCTCAGTTCGTCGCTC.
The PCR product was digested with NcoI and BamHI and
cloned between the NcoI and BamHI sites of pET3d, and
the resulting plasmid was transformed into BL21(DE3) cells. Protein
expression and cell lysis was as described for hFKBP25. hFKBP13 was
applied to a nickel nitrilotriacetic acid (Qiagen) affinity column (1
cm 5 cm) and washed, and the pure protein was eluted with 250
mM imidazole (pH 7.0) according to the manufacturer's
instructions. The ORF encoding human FKBP52 (hFKBP52) was generated by
PCR using the sense oligonucleotide
AATTGTCGACCATATGACAGCCGAGGAGATGAAGGCG and the antisense oligonucleotide
AATTCTCGAGCTATGCTTCTGTCTCCACCTGAGA. The product was digested with NdeI and XhoI and cloned into pET15b (Novagen), a
polyhistidine fusion vector. hFKBP52 was expressed and purified as
described for hFKBP13 above. That recombinant hFKBP13 and hFKBP52 are
fully active was confirmed by their complete binding to FK506-Sepharose
and by their peptidyl-prolyl isomerase activities, which were in accord
with published values (for review, see (17) ). hCyPA was
expressed and purified to homogeneity as described
previously(18) . hFKBP13 and hFKBP52 were stored at -70
°C, and hCyPA was stored at 4 °C.
Protein Determinations
Protein determinations were
performed according to the method of Bradford (19) using bovine
plasma albumin (Bio-Rad) as the standard. The protein reagent
concentrate was purchased from Bio-Rad.
FK506 Binding, CaN Phosphatase, and Peptidyl-prolyl
Isomerase Assays
The LH-20 binding assay was performed as
described previously (20) with the modifications
noted(21) . The CaN phosphatase assay has been described
previously(22) . When immunophilins were titrated, reaction
mixtures (60 µl) contained 40 mM Tris (pH 8), 100
mM NaCl, 6 mM Mg(OAc)
, 0.1 mM CaCl, 0.1 mg/ml bovine serum albumin, 0.5 mM dithiothreitol, 190 nM bovine brain calmodulin (Sigma), 3
nM bovine brain CaN (Sigma), 50 µM drug (FK506,
CsA, or `818), and 40 µM [
P]RII
peptide (Peptides International; 600 cpm/pmol). When drugs were
titrated, the reaction mixtures were identical except that 50
µM immunophilin was substituted for 50 µM drug. The RII peptide, DLDVPIPGRFDRRVSVAAE, was phosphorylated at
the serine residue as described previously(22) . The CaN
phosphatase reaction mixtures were incubated for 30 min at 30 °C,
and dephosphorylation was initiated by peptide addition and allowed to
proceed for 10 min at 30 °C. Termination of the reaction and
separation of free phosphate from phosphorylated peptide were performed
as described previously(22) . The peptidyl-prolyl isomerase
assay was performed as described previously (13) on peptide
substrates obtained from Bachem.
Construction of Expression and Reporter
Constructs
The vector pcDL-SR
296 (23) (SR) was
used for protein expression in Jurkat cells. A consensus ribosome
binding site, CCACC(24) , was inserted adjacent to the
initiating codon of all ORFs. ORFs encoding the following immunophilins
(referenced by GenBank accession number) were generated using the sense
and antisense oligonucleotides, respectively, shown in parentheses:
hFKBP12, M34539 (GAATTCCTGCAGCCACCATGGGAGTGCAGGTGGAAACCATC and
CATCATGAATTCTCATTCCAGTTTTAGAAGCTCCAC); yFKBP12, M57967
(AAGCTTGAATTCCCACCATGTCTGAAGTAATTGAAGGTAAC and
AAGCTTGAATTCTTAGTTGACCTTCAACAATTCGAC); hFKBP12.6, L37086
(GAATTCCTGCAGCCACCATGGGCGTGGAGATCGAGACCATC and
CATCATGAATTCTCACTCTAAGTTGAGCAGCTCCAC); hFKBP13, M65128
(AAGCTTGAATTCCCACCATGAGGCTGAGCTGGTTCCGGGTC and
AAGCTTGAATTCTTACAGCTCAGTTCGTCGCTCTAT); hFKBP25, M90820
(AAGCTTGAATTCCCACCATGGCGGCGGCCGTTCCACAGCGG and
CATCATGGATCCGAATTCTCAATCAATATCCACTAATTCCAC); hFKBP52, M88279
(GTCGACGGTACCCCACCATGACAGCCGAGGAGATGAAGGCG and
GTCGACGGTACCCTATGCTTCTGTCTCCACCTGAGA); and hCyPA, Y00052
(AAGCTTCTGCAGGCCACCATGGTCAACCCCACCGTGTTCTTC and
AAGCTTGAATTCTTATTCGAGTTGTCCACAGTCAGC). PCR products encoding hFKBP12,
hFKBP13, and yFKBP12 were digested with EcoRI and cloned into
the EcoRI site of SR. PCR products encoding hFKBP12.6 and
hCyPA were digested with PstI and EcoRI and cloned
between the PstI and EcoRI sites of SR. The PCR
product encoding hFKBP52 was digested with KpnI and cloned
into the KpnI site of SR. The construction of
pSRCaN(25) , encoding the regulatory subunit of
murine CaN(26) , and pSRCN4(3) , encoding the
catalytic subunit of murine CaN(27) , have been described. The
reporter plasmid directing synthesis of -galactosidase from the
IL-2 promoter (base pairs -448 to +43), pIL2.Gal, has been
described(3) . The transfection procedure has been described
previously(25) .
Expression of Transfected Plasmids
To confirm that
transfected DNAs were expressed, 20 µl of the supernatant from
mock-transfected cells and from transfected cells were subjected to
SDS-PAGE on a 16% denaturing gel (Novex) in parallel with concentration
standards. Proteins were transferred to a membrane and analyzed by
Western blotting as described previously(13) . To detect
hFKBP12, hFKBP12.6, or yFKBP12, the membrane was probed with a 1:10,000
dilution of an antipeptide antibody (R2565) directed against the
sequence DVELLKLE. To detect hFKBP13 or hFKBP25, the membrane was
probed with a 1:10,000 dilution of an antibody (R2816 or R2819,
respectively) derived from injection of rabbits with the recombinantly
produced purified protein. To detect CaN, the membrane was probed
with a 1:10,000 dilution of an antipeptide antibody (R2930) specific
for the sequence LSNSSNIQ. Peptide synthesis, chemistry for coupling
peptides to thyroglobulin, and antiserum production have been described
previously(13) . Antibodies to detect hCyPA and hFKBP52
(Affinity Bioreagents) were used at a dilution of 1:1,000.
Preparation of Cardiac and Skeletal Muscle Sarcoplasmic
Reticulum and Terminal Cisternae
The TC of skeletal muscle SR
were isolated from dog or rabbit skeletal muscle as described
previously(28) . Cardiac microsomes were isolated from heart as
described previously (29) . Cardiac junctional SR was isolated
from cardiac microsomes by sucrose density gradient centrifugation
following Ca-phosphate loading as described
previously (30) .
[
H]Dihydro-FK506 and
[H]Ryanodine Binding Isotherms to
Cardiac and Skeletal Muscle Sarcoplasmic Reticulum
The
concentration of [H]dihydro-FK506 binding sites
in cardiac and skeletal muscle SR fractions was determined by Scatchard
analysis of [H]dihydro-FK506 binding isotherms.
[H]Dihydro-FK506 binding was performed in
CHAPS-solublized SR by the LH-20 column method (20) using the
modifications described previously(6) . Samples (3 µl) of
the solublized vesicles were incubated for 30 min at 37 °C in
binding mixture (volume, 60 µl) containing between 1.0 and 30.0
nM [H]dihydro-FK506 (55,000 cpm/pmol).
Nonspecific binding was determined by the addition of 1 µM unlabeled L-683,590 (`590, Fig. 1), a potent FK506
analog(4) . Following the incubation, 50 µl of the sample
(containing 5 µg of cardiac SR or 1.0 µg of skeletal muscle TC)
were applied to a 2-ml Sephadex LH-20 column equilibrated in LH-20
column buffer (binding mixture without bovine serum albumin present) to
separate free from bound ligand.The high affinity
[H]ryanodine binding site density in cardiac and
skeletal muscle SR was determined by Scatchard analysis of
[H]ryanodine binding isotherms as described
previously(6) . Because the native CRC contains one high
affinity binding site for ryanodine, the B
value
is proportional to the concentration of CRC present in SR. The
stoichiometry of FKBP per CRC was calculated directly from the ratio of B values for
[H]dihydro-FK506 and
[H]ryanodine binding as described previously (6) .
Western Blot Analysis of Sarcoplasmic Reticulum
Fractions
Muscle SR fractions were loaded onto SDS-PAGE gels
separately or co-loaded with 30 ng of human recombinant FKBP12 or
FKBP12.6. Proteins were separated by electrophoresis on a 12.5%
polyacrylamide gel (12.5% acrylamide containing 2.6% cross-linker
polymerized with 0.25% TEMED and 0.05% ammonium persulfate) at 90 V for
2 h. Western blotting with a 1:1,000 dilution of a rabbit antipeptide
antiserum to amino acids 3-16 of human FKBP12 (31) (recognizing FKBP12 and FKBP12.6) was performed as
described previously (32) .
Purification of FKBP12.6 from Cardiac RyR
The
cardiac RyR (RyR-2) was purified as described previously(33) .
FKBP12.6 was isolated from RyR-2 by dissociation of the FKBPdrug
complex from the RyR essentially as described for isolation of FKBP12
from the skeletal muscle RyR(32) . Briefly, 100 µg of RyR-2
were incubated in Superose 6B column buffer (20 mM Tris-Cl (pH
7.4), 0.5 M KCl, 0.5% CHAPS, 2 mM dithiothreitol, and
1 µg/ml leupeptin) containing 12 µM `590 (volume, 650
µl) for 1 h at room temperature. The RyR was then adsorbed to
hydroxyapatite (0.1 ml) by incubation at 4 °C for 1 h. The
supernatant, containing the dissociated FKBP12.6`590 complex, was
obtained by low speed sedimentation of the hydroxyapatite resin in a
1.5-ml microcentrifuge tube.
Sequencing of the FKBP Associated with the Cardiac
RyR
The FKBP associated with the cardiac RyR was subjected to
automated Edman degradation to determine the amino-terminal amino acid
sequence. 250 µl of a 0.66 µg/ml solution of the purified
protein with FK506 bound in 0.5% CHAPS, 0.5 M KCl, 2 mM dithiothreitol, and 2 µg/ml leupeptin were concentrated to 80
µl in a Speed Vac concentrator. 70 µl of the concentrated
protein were applied to a treated 13-mm ``peptide'' glass
fiber filter membrane (Porton Instruments, 19101) in three equal
aliquots. The filter was allowed to dry between each protein
application. After the last application, the filter was rinsed briefly
in methanol to remove excess detergent. The filter was then installed
in an Applied Biosystems 475A pulsed liquid protein sequencer and
subjected to 14 cycles of automated degradation following the
manufacturer's recommended program for use of the
``peptide'' support on the instrument. Automated analysis of
phenylthiohydantoin-derivatives was performed with an on-line Applied
Biosystems 120A narrow bore high performance liquid chromatography, and
data were collected and analyzed on an Applied Biosystems 900A data
station as described previously(34) . Amino acid sequence data
was obtained in 10 of the first 11 cycles. The calculated initial yield
was 43%, based upon the amount of protein present in the original
solution. Approximately 50 pmol of FKBP12 from skeletal muscle RyR were
sequenced separately as a control and gave the expected amino acid
sequence for 14 cycles of automated Edman degradation. Analysis of the
data indicated an initial yield of 100% and a repetitive yield of 93%.
Affinity Purification of mTOR and CaN From Rat
Brain
Preparation of rat brain extracts and affinity
purification of CaN and mTOR with the GST-hFKBP12FK506 and the
GST-hFKBP12RAP complexes, respectively, have been described
previously(16) . In some experiments, a GST-FKBP12.6 fusion
protein was substituted for the GST-FKBP12 fusion protein with no other
changes to the procedure. To detect mTOR by Western blotting, a rabbit
antiserum developed against the yeast TOR2 peptide HDLELAVPG (amino
acids 2074-2082) was prepared by methods described
previously(13) . This antiserum recognizes the corresponding
sequence, RDLELAVPG (amino acids 2134-2142), in rat mTOR. Western
blots were performed as described previously(13) , and the blot
was probed with a 1:7500 dilution of the anti-mTOR peptide antiserum.
To detect CaN, rabbit antisera were developed against the human
CaN gene 1 peptide SNSSNIQ (amino acids 515-521), the human
CaN gene 2 peptide TGNHTAQ (amino acids 518-524), and the
human CaN gene 3 peptide QGKKAHS (amino acids 496-502).
These sequences are well conserved in the corresponding rat CaNs. The
antibodies were diluted 1:10,000 and used to probe Western blots.
RESULTS
Cloning of Human FKBP12.6
Reasoning that bovine
and human FKBP12.6 (hFKBP12.6) would be highly conserved, PCR primers
based upon the bovine sequence (13) were used to isolate an
880-base pair human brain cDNA (Fig. 2) encoding a 108-amino
acid protein identical in sequence to that of the bovine
protein(13) . After we had obtained the clone, the same cDNA,
obtained by random sequencing, was reported(35) . Northern
blotting of oligo(dT)-purified RNA from a variety of human tissues
shows that steady-state hFKBP12.6 mRNA levels are highest in brain and
thymus (Fig. 3, panels A and B). Because FK506
has significant adverse neurologic side effects(36) , the
steady-state hFKBP12 and hFKBP12.6 mRNA levels in anatomically distinct
regions of the brain were compared (Fig. 3, panels E and F). Relative to hFKBP12 message levels, hFKBP12.6
message levels in the brain are lower overall (note the different
exposure times). However, the steady-state levels of the hFKBP12 and
hFKBP12.6 mRNAs in each section of the brain parallel one another, with
the highest levels of both transcripts located in the caudate nucleus
and the lowest levels located in the corpus callosum and substantia
nigra.
Figure 2:
Amino acid and nucleotide sequence of
human FKBP12.6. The nucleotide sequence of the cDNA encoding human
FKBP12.6 and the translated open reading frame are shown. The amino
acid sequence is identical to that of bovine FKBP12.6(13) .
Nucleotide numbering is with respect to the first base of the initiator
methionine. Where two numbers are present, the lower number is the
amino acid position, and the upper number is the nucleotide position.
This sequence has been deposited in the Genome Sequence Data Base, the
EMBL Data Library, the DNA Data Bank of Japan, and the NCBI under the
accession number L37086.
Figure 3:
Steady-state hFKBP12.6 and hFKBP12 mRNA
levels in various human tissues and regions of the human brain.
Northern blots (Clontech) containing, per lane, 2 µg of
poly(A)
RNA from various tissues or anatomically
distinct regions of the human brain were probed with the 
P-labeled, randomly primed cDNAs encoding hFKBP12.6 (panels A, B, and E), hFKBP12 (panel
F), or -actin (panels C, D, and G). Panels C and D are the actin controls
for panels A and B, respectively. Panel G is
the actin control for panels E and F, the same blot
probed with hFKBP12.6 and FKBP12, respectively. Arrows show
the locations of molecular weight markers in kilobase (kb)
pairs. Hybridizations were performed under high stringency conditions
and were washed according to the manufacturer's conditions. The
mRNA sources are as follows: lane 1, heart; lane 2,
brain; lane 3, placenta; lane 4, lung; lane
5, liver; lane 6, skeletal muscle; lane 7,
kidney; lane 8, pancreas; lane 9, spleen; lane
10, thymus; lane 11, prostate; lane 12, testis; lane 13, ovary; lane 14, intestine; lane 15,
colon; lane 16, peripheral blood lymphocyte; lane 17,
amygdala; lane 18, caudate nucleus; lane 19, corpus
collosum; lane 20, hippocampus; lane 21,
hypothalamus; lane 22, substantia nigra; lane 23,
subthalamic nucleus; and lane 24, thalamus. The exposure times
were as follows: panels A, B, and E, 4 days; panel F, 12 h; and panels C, D, and G, 2 h.
Characteristics of Recombinant Human FKBP12.6
The
cDNA encoding hFKBP12.6 was expressed in E. coli. The protein
localizes to the periplasm and is purified to homogeneity (Fig. 4) in one chromatography step on a CM column. Recombinant
hFKBP12.6 binds FK506 with the same affinity (K
= 0.5 nM) as both purified bovine brain FKBP12.6 (13) and recombinant hFKBP12 (data not shown). The specific
binding activities, measured using a modified LH-20 assay, of
recombinant yFKBP12, hFKBP12, and hFKBP12.6 are approximately 30 ng of
[H]dihydro-FK506/µg of protein, a value in
good agreement with that measured for FKBP12(21) . Because the
Bradford assay used to measure protein concentration is known to
overestimate FKBP concentration by 2.5-fold(21) , the binding
activities are close to the theoretical maximum expected for a 1:1
molar complex between FKBP and FK506. Despite a calculated molecular
weight slightly less than that of hFKBP12, recombinant hFKBP12.6, like
purified bovine brain FKBP12.6(13) , migrates more slowly on
denaturing gels than hFKBP12 (Fig. 4).
Figure 4:
Purity of recombinant hFKBP12 and
hFKBP12.6. Five µg of purified bacterially-expressed hFKBP12 (lane 2) and hFKBP12.6 (lane 3) were subjected to
SDS-PAGE on a 16% gel (Novex). The following proteins (and their
molecular weights) were used as standards (lane 1):
phosphorylase b, 106,000; bovine serum albumin, 80,000; ovalbumin,
49,500; carbonic anhydrase, 32,500; soybean trypsin inhibitor, 27,500;
and lysozyme, 18,500.
The catalytic
efficiency (k
/K
) of hFKBP12
toward peptidyl-prolyl substrates correlates strongly with the
hydrophobicity of the amino acid immediately preceding the proline (37) . This contrasts with the promiscuous peptidyl-prolyl
isomerase substrate specificity observed with CyPA, the binding protein
for the structurally unrelated immunosuppressive drug, CsA. We compared
the abilities of purified recombinant hFKBP12.6 and hFKBP12 to catalyze
the isomerization to the trans form of tetrapeptides of the
general structure N-succinyl-Ala-Xaa-cis-Pro-Phe-p-nitroanilide
where Xaa is any one of 12 amino acids (Table 1). hFKBP12.6
exhibits substrate preferences similar, but not identical, to those
observed for hFKBP12. As with hFKBP12, substrates in which a
hydrophobic amino acid precedes proline are greatly preferred by
hFKBP12.6. For both FKBPs, the most reactive substrates have Leu, Ile,
Phe, or Nle at the Xaa position, while the least reactive substrate has
Gly at the Xaa position. With most of the tetrapeptide substrates
tested, the catalytic efficiency of hFKBP12.6 is roughly 2-fold lower
than that observed with hFKBP12. When Xaa is Val or Nle, the catalytic
efficiencies of hFKBP12 and hFKBP12.6 are about equal. Only with the
His-Pro substrate does hFKBP12.6 exhibit more reactivity than hFKBP12.
Heart Muscle RyR Is Associated with FKBP12.6
It is
well-established that FKBP12 is associated with the skeletal muscle RyR
(RyR-1)(6, 31, 38) , stabilizing calcium flux
through the CRC(6, 7, 8) . RyR-2 in heart
muscle is an isoform distinct from RyR-1 in skeletal muscle and
associates with a novel, uncharacterized FKBP, termed FKBP-Cardiac
(FKBP-C)(32) . Like both bovine (13) and human FKBP12.6 (Fig. 4), FKBP-C migrates slightly slower than hFKBP12 on SDS
gels (32) , suggesting that FKBP-C and FKBP12.6 are the same
protein. To confirm their identity, TC preparations from canine
skeletal and heart muscle SR fractions were analyzed by Western
blotting using an antibody that recognizes both FKBPs (Fig. 5).
That the immunoreactive bands in the skeletal and cardiac muscle
fractions are FKBP12 and FKBP12.6, respectively, is confirmed by
co-loading the fractions with recombinant hFKBP12 or hFKBP12.6. In
skeletal muscle TC, the immunoreactive band (lane 1) has the
same mobility as the FKBP12 standard (lane 7). When co-loaded
in the same well with either hFKBP12 (lane 2) or hFKBP12.6 (lane 3), the skeletal muscle band co-migrates with hFKBP12,
whereas hFKBP12.6 is well separated. Therefore, as observed with the
rabbit skeletal muscle RyR(6, 31) , the canine
skeletal muscle RyR is associated with FKBP12. In contrast, in cardiac
SR fractions (lane 4), the antibody detects a band with
somewhat slower mobility. Because the cardiac SR fractions were
isolated in the presence of 0.6 M KCl, the immunoreactive
bands have broadened (lanes 4-6) and have
slightly reduced mobilities relative to the standards (lanes 7 and 8). Nevertheless, when co-loaded in the same well
with either hFKBP12 (lane 5) or hFKBP12.6 (lane 6),
it is apparent that the immunoreactive band in cardiac SR migrates with
hFKBP12.6, whereas hFKBP12 is well separated. These results indicate
that the FKBP associated with the canine heart RyR, previously called
FKBP-C, is FKBP12.6.
Figure 5:
FKBP12.6 is associated with the RyR of
canine heart SR. Samples of canine skeletal muscle terminal cisternae
of SR (lanes 1-3) or cardiac SR (lanes
4-6) were analyzed by Western blot analysis. Samples were
loaded in the absence(-) or presence (+) of either 30 ng of
hFKBP12 (lanes 2 and 5) or 30 ng of hFKBP12.6 (lanes 3 and 6). Lanes 7 and 8 were
loaded with 30 ng of hFKBP12 and 30 ng of FKBP12.6, respectively. The
position of molecular weight standards, the bromphenol blue dye front (D) and the top of the resolving gel (T) are
indicated to the left of the figure. The positions of bands
corresponding to hFKBP12 and hFKBP12.6 are indicated at right.
All other immunoreactive bands in lanes 1-6 are
nonspecific because they are also observed in the absence of primary
antibody. Cardiac SR was isolated in the presence of 0.6 M KCl, which is responsible for the band broadening (toward the bottom of the gel) and for the slightly slower
mobility of both hFKBP12 and hFKBP12.6 in lanes
4-6.
Confirmation that FKBP12.6 is associated with
the cardiac muscle RyR was obtained by amino-terminal sequencing of
FKBP-C obtained from purified canine cardiac RyR preparations. FKBP-C
was stripped from purified cardiac RyR with FK506 and separated from
the RyR by hydroxyapatite chromatography. Amino-terminal sequencing of
the purified protein gave the eleven amino acid sequence
GVEIETISXGD, identical to the amino-terminal sequence of both
bovine and human FKBP12.6 and different in two amino acids from the 11
amino-terminal amino acids of both bovine and human FKBP12,
GVQVETISPGD. The observations that the RyR purified from canine heart
is associated with a protein that co-migrates with FKBP12.6 on
denaturing gels and has the same amino-terminal sequence as both bovine
and human FKBP12.6 indicates that FKBP12.6 is specifically associated
with the canine heart RyR. In the cytosol of dog heart and in canine
skeletal muscle TC, only FKBP12 has been detected(32) ,
indicating that the interaction between FKBP12.6 and the heart RyR is
specific and not due to the absence of FKBP12 in heart muscle.
There Are Four FKBP12.6 Molecules per Heart Muscle
RyR
The binding isotherm of
[H]dihydro-FK506 to canine cardiac muscle TC is a
simple hyperbola with Scatchard analysis yielding a straight line
indicative of a single class of FK506 binding site (data not shown).
The binding parameters, obtained from five different TC preparations,
give a dissociation constant (K) of 13.2 ±
4.8 nM and a B of 25.1 ± 5.5
pmol/mg of protein (Table 2). The affinity of the interaction
between FKBP12 and FK506 is lower than reported (21) (0.4-0.8 nM) due to the presence of 0.5%
CHAPS in the assay(6) . The CRC contains a single high affinity
ryanodine binding site/homotetramer(33, 39) .
Therefore, the ratio of [H]dihydro-FK506 binding
to ryanodine binding is a measure of the FKBP12.6:RyR-2 protomer
stoichiometry. Table 2compares the number of
[H]dihydro-FK506 binding sites to ryanodine
binding sites in several SR and TC preparations from rabbit and dog.
The stoichiometry is approximately 4 mol of FKBP12.6/mol of canine
cardiac muscle RyR homotetramer. This ratio is equivalent to the
FKBP12:RyR-1 ratio observed in skeletal muscle (Table 2)(6) . Thus, the structure of the native CRC in
canine heart muscle SR can be represented as
(FKBP12.6)
(RyR-2 protomer).
The observation
that FKBP12.6 associates specifically with the cardiac CRC makes it
likely that FKBP12.6 modulates channel gating of the cardiac isoform in
a manner similar to that observed for modulation of the skeletal muscle
RyR-1 by FKBP12. Thus, the few amino acid differences between FKBP12
and FKBP12.6 have important consequences for channel binding
specificity. We have expanded our characterization of hFKBP12.6 and
have performed a pharmacological comparison of hFKBP12.6 and hFKBP12
both in vitro and in Jurkat cells in an effort to uncover
differences between the two molecules that might help to explain their
apparently different physiological roles.
The hFKBP12.6FK506 Complex is a Potent CaN
Inhibitor In Vitro
We have compared the abilities of all known
human FKBPs (hFKBPs), yeast FKBP12 (yFKBP12), and human CyPA (hCyPA) to
mediate inhibition of CaN phosphatase activity by FK506 in
vitro. All FKBPs and hCyPA were expressed in E. coli and
purified to homogeneity. hFKBP13 and hFKBP52 were histidine-tagged to
aid in their purification while all other FKBPs, as well as hCyPA,
contained only native sequences.The phosphatase assays were
designed to measure CaN inhibition by the various immunophilin-drug
complexes and to minimize any effect made by the equilibrium between
the complex and the free immunophilin and drug molecules. Therefore,
immunophilin-drug complex formation at a particular immunophilin or
drug concentration was maximized by having an excess of one component.
In one set of assays (Fig. 6A), drugs (FK506 or CsA)
were titrated in the presence of a constant high concentration (50
µM) of immunophilin to insure that most of the added drug
would be bound. In a second set of assays (Fig. 6B) the
immunophilins were titrated in the presence of a high concentration (50
µM) of drug to insure saturation of added binding protein.
As expected, both types of assays gave similar results. Irrespective of
which component is titrated, the IC
values (legend to Fig. 6) obtained for CaN inhibition by a particular
immunophilin-drug complex are similar to one another. Both the drug and
immunophilin titrations (Fig. 6, A and B,
respectively) demonstrate that the FK506 complexes with hFKBP12.6 and
hFKBP12 are equipotent to one another and to the yFKBP12FK506
complex as CaN inhibitors. As a control, and to further validate the
assay, the ability of the hCyPACsA complex to inhibit CaN was
measured. In agreement with observations that, by several criteria, CsA
is 10-100-fold less potent than FK506 (for review, see (40) ), the hCyPACsA complex was about 15-fold less
active than the hFKBP12FK506 complex as a CaN inhibitor (Fig. 6, A and B). The remaining
hFKBPFK506 complexes are very poor CaN inhibitors. hFKBP25 is
unable to inhibit CaN at even the highest drug and immunophilin
concentrations tested. The hFKBP13FK506 and hFKBP52FK506
complexes are very weak inhibitors of CaN activity. Phosphatase
inhibition by the latter two complexes is observed at immunophilin-drug
concentrations unlikely to be attained within most cells. Thus, the
hFKBP13FK506 and hFKBP52FK506 complexes may not make
significant contributions to CaN-dependent immunosuppression or
toxicity.
Figure 6:
hFKBP12.6 and hFKBP12 are equipotent
mediators of calcineurin inhibition by both FK506 and `818. The FK506
and `818 complexes with the known human FKBPs, with yFKBP12, and with
hCyPA were tested for their ability to inhibit CaN phosphatase
activity. Incubation and assay conditions are described under
``Materials and Methods.'' Results are plotted as the
percentage of the uninhibited control where no drug was present and in
which 3 nM CaN dephosphorylates 14.3 pmol of RII
phosphopeptide/min. Each data point represents an average of two
experiments. Panel A, increasing concentrations of FK506 (or
CsA, when CyPA was the immunophilin were added to CaN, CaM,
MgCl, CaCl, and 50 µM immunophilin. The IC values (in parentheses) of FK506
(or CsA when hCyPA was the immunophilin) complexed with the indicated
immunophilin are as follows: , hFKBP12 (14.3 nM);
, hFKBP12.6 (10.6 nM); 
, yFKBP12 (7.4
nM); 
, hFKBP13 (partial inhibition); 
, hFKBP25 (no
inhibition); 
, hFKBP52 (partial inhibition); 
, hCyPA (301
nM). Panel B, increasing concentrations of
immunophilin were added to CaN, CaM, MgCl,
CaCl, and 50 µM FK506 (or 50 µM CsA, when hCyPA was the immunophilin). The IC values
(in parentheses) of the indicated immunophilin (symbols are as in panel A) complexed with FK506 (or CsA in the case of hCyPA)
are as follows: hFKBP12 (7.6 nM); hFKBP12.6 (8.6 nM);
yFKBP12 (10.4 nM); hFKBP13 (partial inhibition); hFKBP25 (no
inhibition); hFKBP52 (partial inhibition); hCyPA (125 nM). Panel C, as described in panel A except that `818 was
titrated. The IC values (in parentheses) of `818 complexed
with the indicated FKBP (symbols are as in panel A) are as
follows: hFKBP12 (2.9 µM); hFKBP12.6 (3.1
µM); yFKBP12 (94 nM); hFKBP13 (no inhibition);
hFKBP25 (no inhibition); hFKBP52 (no inhibition). Panel D,
immunophilins were titrated as described in panel B except in
the presence of 50 µM `818. The IC values (in
parentheses) of the indicated FKBP (symbols are as in panel A)
complexed with `818 are as follows: hFKBP12 (3.4 µM);
hFKBP12.6 (2.6 µM); yFKBP12 (176 nM); all other
FKBPs (no inhibition).
The FKBP12.6`818 Complex Is a Weak CaN Inhibitor in
Vitro
Despite having only minor differences from FK506 at two
positions, C-18 and C-21 (Fig. 1), `818 is a powerful in
vivo antagonist of the immunosuppressive and toxic side effects of
FK506(4) . The C-18 hydroxyl group is responsible for the
antagonism exerted by `818 since `590 (Fig. 1), identical to
`818 except for the C-18 hydroxyl group, is almost equivalent to FK506
with respect to immunosuppressive potency and toxicity(4) .
`818 binds tightly to hFKBP12, displacing FK506 (K values are 0.7 and 0.4 nM for `818 and FK506,
respectively), but the resulting hFKBP12`818 complex is a poor
CaN inhibitor(4, 5) . These observations suggest that
the C-18 position of FK506, on the solvent-exposed face of the
FKBP12drug complex(41) , contacts CaN, since the added
hydroxyl group in `818 abolishes CaN binding, either by forcing the
hydrophilic hydroxyl group into an unfavorable hydrophobic environment
or through steric hindrance.In noteworthy contrast to hFKBP12, the
yFKBP12 complex with `818 is a potent CaN inhibitor(5) .
Surrounding FK506 on the solvent-exposed surface of the complex are
approximately 26 amino acids that are likely to be close to CaN.
Throughout these 26 residues, there are 10 differences between yeast
and human FKBP12. Because the three-dimensional structures of the yeast
and human FKBP12`818 complexes are almost identical, among the 10
changes in yFKBP12 there must be amino acids that directly interact
with CaN, thereby compensating for `818(42) . These amino acids
in yFKBP12 in some way neutralize the effects of the hydroxyl group at
C-18(5) . In the absence of a crystal structure for the
FKBP12FK506CaN complex, `818 is a useful pharmacological
probe for helping to identify FKBP residues that might interact with
CaN.
Of the 18 amino acid differences between hFKBP12.6 and hFKBP12,
two residue changes in hFKBP12.6 (Arg
and Val
in Fig. 2), are among those 26 surface residues that
surround the drug on the face of the complex. Because `818 uncovered
differences between yeast and human FKBP12 not observed with FK506, we
believed it might also uncover differences between hFKBP12 and
hFKBP12.6. Therefore, the FKBP12.6`818 complex as well as the
`818 complexes with all other hFKBPs and yFKBP12 were tested for CaN
inhibition. As before, two versions of the assay, titrating drug (Fig. 6C) and titrating immunophilin (Fig. 6D), were performed with both assays giving
similar IC values (legend to Fig. 6). As described
previously, yFKBP12 is a surprisingly potent CaN inhibitor when
complexed with `818(5) , albeit 24-fold less potent than when
complexed with FK506 (Fig. 6). When sufficiently high
concentrations (µM) of immunophilin are present, we find
that the hFKBP12`818 complex can inhibit CaN, in contrast to
results from previous assays (4, 5) where the
submicromolar hFKBP12 concentrations used were insufficient to bind the
micromolar amounts of `818 required for detectable inhibitory activity.
The `818 complex with hFKBP12.6 is equipotent to the hFKBP12`818
complex as a CaN inhibitor. However, both complexes are
200-400-fold poorer CaN inhibitors than the FK506 versions of the
complexes. Therefore, unlike yFKBP12, none of the amino acid
differences in hFKBP12.6 relative to hFKBP12 are able to compensate for
the hydroxyl group of `818. In the presence of `818, none of the other
FKBPs can inhibit CaN, corroborating the observations made with FK506.
FKBP12.6 Can Mediate FK506-Sensitivity in a T-Cell
Line
CaN inhibition in vitro does not always correspond
to inhibition of CaN-dependent signaling pathways in vivo. For
example, although the cyclophilin CCsA complex inhibits CaN in vitro, cyclophilin C does not mediate CsA-sensitivity in
Jurkat cells(12) . The ability of hFKBP12.6 to mediate
FK506-sensitivity in T-cells was therefore examined. Previously, the
effects of overexpressing hFKBP12, hFKBP13, hFKBP25, and three of the
human cyclophilins on the IC of FK506 and CsA were
measured(12) . Overexpression of an immunophilin will result,
at equilibrium, in a greater concentration of the immunophilin
drugCaN complex at a particular drug concentration. The previous
experiments showed that overexpression of hFKBP12 rendered Jurkat cells
2-3-fold more sensitive to FK506, whereas overexpression of
hFKBP13 and of hFKBP25 had no effect(12) . This indicated that,
among the three FKBPs tested, only hFKBP12 can mediate the inhibitory
effects of FK506 in cells.We performed an assay similar to the one
described(12) , but to increase sensitivity, we incorporated an
important modification. Overexpression of the catalytic subunit of CaN
(CaN) is known to render activated Jurkat cells 4-5-fold
less sensitive to the effects of FK506 and
CsA(3, 43) . Our modification was to overexpress the
cDNAs encoding both the catalytic (CaN) and regulatory (CaN)
subunits of CaN by transient transfection in Jurkat cells using the
mammalian expression vector pcDL-SR296 (SR)(23) .
Protein overexpression was confirmed by Western blot analysis comparing
extracts from transfected and nontransfected cells (Fig. 7), and
drug sensitivity was quantitated by measuring -galactosidase
production from a co-transfected reporter plasmid, pIL2.Gal, containing
the IL-2 promoter fused to the -galactosidase reporter gene.
Overexpression of both CaN and CaN rendered the cells
insensitive to the effects of up to 10 nM FK506, almost 1000
times the normal IC, 0.012 nM (Fig. 8A). There are two possible explanations for the
drug insensitivity generated by CaN overexpression. Either the CaN is
ectopically expressed in a subcellular compartment, separating it from
the hFKBP12FK506 complex, or the CaN levels have exceeded the
FKBP12 levels such that, even at the highest drug concentrations, there
is sufficient free CaN available to participate in the signaling
pathway. If the second explanation is correct, then co-expression of
hFKBP12 will revert the cells to drug sensitivity and we will have
generated an assay with a greatly amplified readout relative to the
2-3-fold shift in IC observed in the previous
assay(12) . To test between these alternatives, Jurkat cells
overexpressing CaN and CaN were co-transfected with
expression constructs encoding the FKBPs tested in the previous assay
(hFKBP12, hFKBP13, and hFKBP25) (12) . Overexpression of
hFKBP12, confirmed by Western blotting (Fig. 7), reestablishes
the FK506-sensitivity of the cells (Fig. 8A).
Reflecting the greatly increased amount of CaN that must be inhibited,
the IC (0.26 nM) has shifted 20-fold relative to
nontransfected cells (0.012 nM). This result indicates that
CaN-overexpression is cytosolic and that hFKBP12 mediates
FK506-sensitivity in a T-cell line, thereby validating our assay. In
contrast, sensitivity to FK506 is not recovered upon hFKBP25
overexpression (Fig. 8A), confirming the results of
Bram et al.(12) and our result that the
hFKBP25FK506 complex cannot inhibit CaN in vitro. We
find that hFKBP13 has some ability to mediate the inhibitory effects of
FK506, consistent with our observation (see Fig. 6) and with the
observations of others(44, 45) that the
hFKBP13FK506 complex can inhibit, albeit weakly, CaN phosphatase
activity.
Figure 7:
Western blot analysis of immunophilin and
calcineurin expression in transfected Jurkat cells. Cytosolic extracts
from nontransfected (lane 1) and transfected (lane 2)
Jurkat cells are compared with standards consisting of 1 ng (lane
3), 3 ng (lane 4), 10 ng (lane 5), 30 ng (lane 6), 300 ng (lane 7), and 1 µg (lane
8) of the corresponding bacterially produced, purified proteins: A, hFKBP12; B, hFKBP12.6; C, hFKBP13; D, hFKBP25; E, hFKBP52; F, murine CaN; G, hCyPA; and H, yFKBP12. The amount of hFKBP13 in
the cytosolic extract (shown here) of the transfected cells is probably
an underestimate of the amount actually produced because it can
associate with membranes. For experimental details and for details of
the antibodies used, see ``Materials and
Methods.''
Figure 8:
hFKBP12.6 is equipotent to hFKBP12 at
mediating the FK506-sensitivity of the IL-2 promoter in transfected
Jurkat cells. Activities are plotted as the percent of
-galactosidase activity in lysates of activated cells that were
not treated with drug. The amount of -galactosidase produced in
the absence of drug (No-Drug Controls) varied by less than 15%
among the various transfectants, thereby demonstrating that
transfection efficiencies were equivalent and uniform. Each data point
represents the mean of three experiments with a standard error of less
than 10%. Panel A, FK506-insensitivity caused by
overexpression of the catalytic (CaN) and regulatory (CaN)
subunits of CaN is reversed by overexpression of hFKBP12. Jurkat cells
transfected with pIL2.Gal were mock-transfected or co-transfected with
the SR expression vector containing the indicated cDNAs and
activated in the presence of FK506, the amount of -galactosidase
was measured, and the IC values (in parentheses) of FK506
were determined: ⊞, mock transfection (0.012 nM);
, SR vector only (0.012 nM); 
, CaN and
CaN (no inhibition); , hFKBP12, CaN, and CaN (0.26
nM); , hFKBP13, CaN, and CaN (partial
inhibition); , hFKBP25, CaN, and CaN (no inhibition). Panel B, FK506-insensitivity caused by CaN overexpression is
reversed by overexpression of hFKBP12.6. The expressed proteins and the
IC values (in parentheses) for FK506 are as follows:
, SR vector only (replotted from panel A; 0.012
nM); , CaN and CaN (replotted from panel
A; no inhibition); , hFKBP12.6, CaN, and CaN
(0.18 nM); , hFKBP52, CaN, and CaN (partial
inhibition); , yFKBP12, CaN and CaN (0.37
nM). Panel C, effect of FKBP overexpression on the
IC of `818. Jurkat cells transfected with pIL2.Gal were
mock-transfected or co-transfected with the SR expression vector
containing the indicated cDNAs and activated in the presence of `818,
the amount of -galactosidase was measured, and the IC values (in parentheses) of `818 were determined. ⊞, mock
transfection (no inhibition); , yFKBP12 (0.27 nM);
, hFKBP12 (2.7 nM); , hFKBP12.6 (2.3
nM); , hFKBP13 (no inhibition); , hFKBP25 (no
inhibition); , hFKBP52 (no inhibition). Panel D, CsA
insensitivity caused by CaN-overexpression is reversed by
overexpression of hCyPA. Jurkat cells transfected with pIL2.Gal were
mock-transfected or co-transfected with the SR expression vector
containing the indicated cDNAs and activated in the presence of CsA,
the amount of -galactosidase was measured, and the IC (in parentheses) of CsA determined. ⊞, mock transfection
(0.57 nM); , SR vector only (0.45 nM);
, CaN and CaN (27.5 nM); , hFKBP12,
CaN, and CaN (24.2 nM); , hFKBP12.6,
CaN, and CaN (19.5 nM); , hFKBP13, CaN,
and CaN (24.3 nM); , hFKBP25, CaN, and CaN
(24.1 nM); , hFKBP52, CaN, and CaN (25.9
nM); , hCyPA, CaN, and CaN (3.0
nM).
Finally, the ability of hFKBP12.6 to restore FK506
sensitivity in CaN-overexpressing Jurkat cells was examined. We also
tested hFKBP52 and yFKBP12 since the FK506 complexes with these FKBPs
have been characterized for CaN inhibition, in
vitro(5, 46) , but have not been tested in Jurkat
cells. Transfection of the CaN-overexpressing Jurkat cells with the
cDNA encoding hFKBP12.6 restored FK506-sensitivity (Fig. 8B). The IC of FK506 in the cells
overexpressing hFKBP12.6 is 0.18 nM, demonstrating that
hFKBP12.6 is equipotent to hFKBP12 at mediating the inhibitory effects
of FK506 upon CaN-dependent signaling events in Jurkat cells and
corroborating our result that the hFKBP12.6 and hFKBP12 complexes with
FK506 are equipotent CaN inhibitors in vitro. Also in
agreement with the CaN phosphatase assay, yFKBP12 is equipotent to both
hFKBP12 and hFKBP12.6 at mediating the inhibitory effects of FK506 in
Jurkat cells (Fig. 8B). In contrast, the FK506 complex
with hFKBP52 is only a weak inhibitor of signaling since, even at 10
µM drug concentrations, it is unable to completely block
IL-2 promoter activation (Fig. 8B).
T-Cells Can Be Made Sensitive to `818 by Overexpression
of hFKBP12.6
To confirm the efficacy of the various FKBPs at
mediating the inhibitory effects of FK506, we used the antagonist and
close FK506 relative, `818, which cannot block IL-2 promoter
stimulation in activated Jurkat cells containing wild-type levels of
CaN (Fig. 8C). We have previously demonstrated (Fig. 6, C and D) that, at high hFKBP12 or
hFKBP12.6 concentrations, `818 can inhibit CaN in vitro.
Therefore, we reasoned that by overexpressing FKBPs relevant to the
inhibitory effects of FK506, the IL-2 promoter could be made sensitive
to `818, thereby converting it from an antagonist to an agonist.
Because `818 is such a weak agonist, its use in this assay provides a
more stringent test of the abilities of the various FKBPs to mediate
inhibition of FK506-sensitive signaling pathways in the cell. Moreover,
it allows distinctions to be made between FKBPs, such as between
yFKBP12 and hFKBP12, that cannot observed when FK506 is used.
Therefore, expression plasmids encoding each of the known human FKBPs
(as well as yFKBP12) were co-transfected into Jurkat cells with the
pIL2.Gal reporter plasmid activated in the presence of `818 and the
amount of -galactosidase produced measured.Overexpression of
hFKBP12.6 renders activated Jurkat cells sensitive to `818 (Fig. 8C). Moreover, hFKBP12.6 and hFKBP12 are
equipotent in this assay, in agreement with their equal abilities to
mediate FK506-sensitivity in vivo and in accord with their
abilities, when complexed with `818, to inhibit CaN in vitro.
Further validation of these transfection experiments as an accurate
measure of the ability of FKBPs to mediate drug sensitivity was
obtained when the yFKBP12 expression plasmid was transfected into
Jurkat cells. IL-2 promoter activity in activated cells is strikingly
sensitive to the yFKBP12`818 complex (Fig. 8C),
again correlating with the results obtained in the CaN phosphatase
assay. Overexpression of hFKBPs 13, 25, or 52 had no effect on the `818
sensitivity of the IL-2 promoter, confirming that these FKBP complexes
with FK506-like drugs are ineffective inhibitors of the signaling
pathway to IL-2 gene transcription.
The CsA sensitivity of the IL-2
promoter in activated Jurkat cells was measured as a control.
Transfections with the cDNAs encoding the CaN and CaN
subunits rendered the promoter less sensitive but not insensitive to
CsA (Fig. 8D), which differs from the results obtained
with FK506. The inability to make the cells insensitive to CsA upon CaN
overexpression is due to naturally high CyPA levels in Jurkat cells (Fig. 7, row G). Scanning densitometry (data not shown)
of the bands in Fig. 7shows that the molar concentration of
endogenous CyPA in Jurkat cells is still 7-fold greater than CaN,
even when the latter protein is overexpressed (Fig. 7, compare lanes F and G). Thus, in CaN-overexpressing cells,
the molarity of CaN does not exceed the natural molarity of hCyPA,
explaining why the cells cannot be rendered completely insensitive to
CsA. Nevertheless, the CaN-overexpressing cells are less sensitive to
CsA because there is more CaN to inhibit (Fig. 8D). The
decreased sensitivity to CsA is reversed 9-fold in the
CaN-overexpressing cells by co-transfection with the cDNA encoding
hCyPA (Fig. 8D) thereby confirming previous results (12) that hCyPA can mediate the inhibitory effects of CsA. The
FKBPs are specific for mediating the inhibitory effects of FK506 and
not of CsA because FKBP overexpression does not alter the
CsA-sensitivity of the IL-2 promoter (Fig. 8D).
The hFKBP12.6RAP Complex Binds mTOR
The
hFKBP12 RAP complex binds to a 288-kDa protein, mTOR, that has
been isolated from rat brain(16, 47) , bovine
thymus(48) , and a human T-leukemic cell line(49) . To
determine if the hFKBP12.6RAP complex also binds mTOR, purified
GST-hFKBP12.6 or GST-hFKBP12 fusion protein was incubated with a rat
brain extract in the absence or presence of 10 µM RAP, and
protein complexes were precipitated with glutathione-agarose beads.
After washing the beads to remove proteins binding nonspecifically,
proteins were eluted from the beads with reducing SDS-sample
buffer(16) , subjected to electrophoresis on denaturing gels,
and analyzed by Western blotting using antipeptide antibodies that
recognize mTOR or CaN. The RAP complex with hFKBP12.6, as
described previously for hFKBP12, binds specifically to a high
molecular weight protein previously identified as mTOR (Fig. 9, lanes 5 and 8). This experiment, repeated 4 times,
reproducibly shows that the RAP complex with GST-FKBP12.6 precipitates
less mTOR than the GST-FKBP12 complex. As observed with FKBP12,
FKBP12.6 binding to mTOR is dependent upon RAP and is not observed in
the presence of FK506. In the presence of FK506, the GST-FKBP
complexes, as expected, precipitate CaN (Fig. 9, lanes 6 and 9).
Figure 9:
hFKBP12.6RAP binds to mTOR. Rat
brain extracts were incubated with GST, GST-hFKBP12.6, or GST-hFKBP12
coupled to GSHagarose beads. Precipitations were performed
without drug(-) or in the presence of 10 µM RAP or
10 µM FK506 (FK). Precipitated proteins were
eluted, resolved by SDS-PAGE through a 8.75% gel, and subjected to
Western blotting. The blot was probed first with the anti-mTOR
antibody. The blot was stripped and reprobed with anti-CaN antibodies
that recognize all three CaN isoforms. Panel A shows that
portion of the blot with bands immunoreactive with the anti-mTOR
antibody. Panel B shows that portion of the blot having bands
immunoreactive with the anti-CaN antibodies. The molecular masses
(kDa) of the calibration standards are indicated at the left and lane numbers are indicated at the bottom. The arrow labeled mTOR indicates the protein that binds
to the GST-hFKBP12.6RAP and GST-hFKBP12RAP complexes. The arrow labeled CaN shows the location of the 57-
and 61-kDa isoforms of the catalytic CaN
subunit.
DISCUSSION
We have cloned the cDNA encoding human FKBP12.6 and have
characterized the expressed protein pharmacologically and
physiologically. Physiologically, FKBP12.6 has a role distinct from
that of FKBP12. FKBP12 is associated with RyR-1 of skeletal muscle SR,
whereas FKBP12.6 is specifically associated with RyR-2 of cardiac
muscle SR. Pharmacologically, FKBP12.6 is almost indistinguishable from
FKBP12. FKBP12.6 is the only other FKBP family member equipotent to
FKBP12 at inhibiting CaN in vitro and at mediating the
FK506-sensitivity of a CaN-dependent signal transduction pathway.
Moreover, when complexed with RAP, FKBP12.6, like FKBP12, binds mTOR.
The cardiac CRC (RyR-2) is a 565-kDa protomer 64% identical to RyR-1 (50, 51) . The hydropathy profiles and predicted
secondary structures of the cardiac and skeletal isoforms are virtually
identical(51) . Both are activated by Ca,
ATP, and caffeine; both are inactivated by Mg and
ruthenium red; and both contain one high affinity and several low
affinity ryanodine binding sites(52) . Although morphologically
and functionally similar, the channels are not identical(52) .
We have shown that FKBP-C(32) , isolated from the canine
cardiac RyR, co-migrates with hFKBP12.6 on SDS-PAGE gels and has the
same 11-amino acid amino-terminal sequence as both bovine and human
FKBP12.6. Our finding that there are four FK506 binding sites per high
affinity ryanodine binding site in cardiac SR suggests that the
structure of the cardiac CRC can be represented as
(RyR-2)(FKBP12.6), analogous to the structure
of the skeletal muscle CRC, (RyR-1)(FKBP12).
Thus, the native CRC isoforms in heart and skeletal muscle SR are
further distinguished from one another in that different FKBP isoforms
comprise a portion of their structures. The structural and functional
similarities between FKBP12.6 and FKBP12 and between the cardiac and
skeletal muscle RyR isoforms, suggests that the role of FKBP12.6 in the
native cardiac CRC is similar to the role of FKBP12 in the skeletal
muscle CRC.
The stoichiometry of four molecules of FKBP12.6 per
native tetrameric CRC obtained by
[H]dihydro-FK506 binding isotherms relies on the
assumption that the ryanodine receptor is the predominant or only SR
protein that binds FKBP12.6. Recent studies confirm that this is the
case. Endogenous FKBP of cardiac SR was exchanged with the GST-FKBP12.6
fusion protein using exchange methodology developed for the skeletal
muscle RyR(9) . The TC was then solublized with CHAPS, and
protein complexes with the GST-FKBP12.6 fusion protein were affinity
purified on a GST-Sepharose affinity column. RyR-2 was the predominant
protein in the SR that was tightly bound to GST-FKBP12.6. ()
In the presence of drug, the abilities of several human
FKBPs to inhibit CaN in vitro and a CaN-dependent signaling
pathway in cells have been compared. The abilities of the
immunophilin-drug complexes to inhibit CaN and their abilities to block
IL-2 transcription correlate precisely. The FK506 complexes with FKBP13
and FKBP52, weak CaN inhibitors in vitro, are weak inhibitors
of IL-2 promoter activity when the proteins are overexpressed in Jurkat
cells. This correlation extends to the yFKBP12`818 complex, a
more potent CaN inhibitor and a more potent inhibitor of IL-2 promoter
stimulation than the `818 complexes with hFKBP12 or hFKBP12.6. Thus,
our results support the proposed mechanism of action of FK506 in which
CaN inhibition blocks IL-2 transcription, thereby preventing T-cell
activation(54) . The RAP complexes with hFKBP12.6 and hFKBP12
exhibit similar but not identical properties. Qualitatively, the
hFKBP12RAP complex binds more mTOR than the hFKBP12.6RAP
complex, suggesting that hFKBP12 plays a greater role in mediating
RAP's antiproliferative effects in human cells.
The adverse
side effects of FK506 immunotherapy include nephrotoxicity,
diabetogenicity, the development of lymphoproliferative disorders,
expressive aphasia, seizures, coma, drowsiness, lethargy, tremors, and
aggressiveness(36, 55) . Toxicities associated with
RAP treatment in non-rodent mammals include vomiting, diarrhea,
thrombocytopenia, and gastrointestinal ulceration(56) . Because
inhibition of IL-2 promoter activity in T-cells is a convenient measure
of the in vivo potentials of FKBPFK506 complexes to
inhibit a CaN-dependent signaling pathway, our data reflect the impact
that the various FKBPFK506 complexes can have upon a
physiological process involving CaN. The response of any single cell to
FK506 or RAP will depend upon several factors including 1) the
expression levels of the immunophilins mediating drug action; 2) the
abilities of the immunophilin-drug complexes to interact with their
immediate targets; 3) the concentration of FK506 or RAP that gets into
the cell; 4) the concentration of CaN or mTOR in the cell; and 5) the
function of the downstream substrates of CaN or mTOR and their
importance to the cell. Thus, the therapeutic and toxic side effects of
FK506 and RAP are likely due to the formation of multiple
FKBPdrug complexes with varying affinities for their
pharmacologic target proteins, CaN and mTOR. Although nothing is known
about mTOR substrates, CaN substrates that are candidate proteins
responsible for the deleterious effects of FK506 at recognized sites of
toxicity include the Na,K-ATPase in
the brain and kidney (57) and nitric oxide synthase in the
brain (58) . There have been no reports of FK506 toxicity that
would implicate the CRC. Because only a portion of the cellular FKBP
pool is bound by FK506 at immunosuppressive doses, the cytosolic FKBP
in cardiac and skeletal muscle may act as a buffer shielding the CRC
from the effects of the drug.
The design of one of our assays (Fig. 8), reversing the effects of CaN-overexpression,
underscores the importance of the cellular FKBP:CaN ratio in
establishing FK506-sensitivity. FKBP12 is both ubiquitous and abundant (59) and a survey of 15 different rat tissues documented
FKBP/CaN ratios ranging from 13 to 343(60) . The lowest
FKBP/CaN ratios were found in seven anatomically distinct regions of
the brain, a reflection of the great abundance (61) and
probable importance, of CaN there. FKBP/CaN ratios in the thymus and
spleen are among the highest, approximately 200 and 100,
respectively(60) . If the FKBP/CaN ratios in spleen and thymus
reflect ratios to be found in lymphocytes, then the Law of Mass Action
dictates that, in the presence of FK506, a greater proportion of CaN
will be inhibited in lymphocytes than in brain cells (even assuming
that the drug is distributed equally to the brain, which it is not). In
both Jurkat and murine T-cells, the intracellular concentration of FKBP
is 6-7 µM with only 3-5% of the FKBP pool
bound by FK506 at the IC for inhibition of cellular
activation(53) . To decrease neurotoxic effects associated with
FK506 therapy, one strategy would be to design FK506 analogs with
decreased affinity for FKBP, thereby allowing equilibrium to relieve
toxicity. With decreased affinity for FKBP, less FKBPdrug complex
would be formed to inhibit the high levels of CaN in brain. In lymphoid
cells, the high FKBP/CaN ratio would compensate for the lower affinity
of the novel analog for FKBP, thereby maintaining the immunosuppressive
efficacy of the drug. Similar considerations apply to the toxic effects
associated with RAP therapy.
The substrate preferences exhibited by
FKBP12.6 and FKBP12 in the peptidyl-prolyl isomerase assay overlap
almost completely. Therefore, our observation that FKBP12.6 and FKBP12
are physiologically associated with distinct RyR isoforms may be
unrelated to peptidyl-prolyl isomerase activity. Both in the presence
and absence of drug, the biochemical and cellular read-outs used in our
st
