When exposed to changes in environmental osmolarity, Escherichia coli responds by altering the expression of OmpF and OmpC, two porin proteins present in the outer membrane (for review, see Csonka and Hanson(1991)). OmpF and OmpC each exist as homotrimeric proteins that span the outer membrane and serve as channels for the passive diffusion of small molecules between the external media and the periplasmic space (Nikaido and Vaara, 1987). Under low osmolarity conditions, OmpF is present in the outer membrane at significantly higher levels than OmpC. Upon a shift to high osmolarity, OmpF is no longer expressed, while the level of OmpC is increased (Kawaji et al., 1979).

Expression of the ompF and ompC genes is dependent upon two proteins, EnvZ and OmpR (Sarma and Reeves, 1977; Hall and Silhavy, 1981a, 1981b; Mizuno and Mizushima, 1987; Slauch et al., 1988; Slauch and Silhavy, 1989). These proteins belong to the family of highly conserved histidine kinase/response-regulator proteins that make up the two-component systems prevalent in prokaryotes (Nixon et al.(1986), Parkinson and Kofoid(1992), and for review, see Stock et al.(1989)). Such two-component systems have recently been identified in eukaryotes as well (Ota and Varshavsky, 1993; Chang et al., 1993). In each case, the histidine kinase is phosphorylated on a conserved histidine residue, using free ATP as the substrate. The response regulator then catalyzes the transfer of the phosphoryl group to a completely conserved aspartic acid residue, which accepts the phosphate from the histidine kinase. In many cases, the response regulator is a transcription factor with a DNA-binding domain.

EnvZ is phosphorylated at the histidine 243 residue to function as the substrate for OmpR phosphorylation (Kanamaru et al., 1990; Aiba et al., 1989a; Forst et al., 1989a; Igo and Silhavy, 1988). OmpR is phosphorylated at Asp (Delgado et al., 1993; Kanamaru et al., 1990). EnvZ also acts as an OmpR-phosphate phosphatase (Igo et al., 1989; Aiba et al., 1989a). The level of phosphorylated OmpR present in the cell appears to be controlled through the regulation of EnvZ phosphatase activity (Yang and Inouye, 1991; Russo and Silhavy, 1991; Yang and Inouye, 1993; Jin and Inouye, 1993). At low osmolarity, EnvZ phosphatase activity maintains a low concentration of phosphorylated OmpR in the cytoplasm. Upon a shift to high osmolarity, the phosphatase activity of EnvZ is decreased, allowing an increase in the level of phosphorylated OmpR. Phosphorylation of OmpR enhances DNA-binding activity (Aiba et al., 1989b; Aiba and Mizuno, 1990).

OmpR binds to sequences upstream of the ompF and ompC promoters to regulate the transcription of these genes. In vivo and in vitro footprinting has demonstrated that OmpR binds to the -100 to -80 and -74 to -40 sequences of ompC (Maeda and Mizuno, 1990), and to the -100 to -40 (Maeda and Mizuno, 1988; Maeda et al., 1988; Mizuno and Mizushima, 1986; Mizuno et al., 1988; Tsung et al., 1989) and -380 to -360 sequences of ompF (Rampersaud et al., 1994; Huang et al., 1994). Phosphorylated OmpR binds to the upstream regulatory region of ompC to activate ompC expression. However, in the case of ompF, OmpR acts as both an activator (during low osmolarity conditions) and repressor (during high osmolarity conditions) of transcription (Slauch and Silhavy, 1989; Forst et al., 1989b). Since low osmolarity conditions are correlated with low levels of phosphorylated OmpR, it would be expected that under these conditions, only high affinity sites are bound by OmpR. In contrast, under high osmolarity conditions when there is a higher level of phosphorylated OmpR in the cell, OmpR will bind to both high and low affinity sites. It is of interest to understand how OmpR carries out this dual function. Identifying high and low affinity sites will aid in identification of activator and repressor sites.

In the studies presented here, an OmpR fusion protein was designed and used for mobility shift assays to determine the exact number of OmpR molecules that bind to sequences upstream of the ompF promoter. Subsequently we were able to identify individual OmpR binding sites and use a random sequence selection/PCR ()amplification method to identify critical base pairs within the OmpR binding site. Finally, mobility shift assays were used to demonstrate that cooperative interactions between OmpR proteins bound to the DNA increase the ability of OmpR to bind to low affinity sites. In this paper, we demonstrate that six OmpR molecules cooperatively bind to the -100 to -39 sequence of ompF. Taken with previously published data regarding the distal -380 to -361 binding site, a total of eight OmpR molecules are involved in the positive and negative regulation of ompF expression.

EXPERIMENTAL PROCEDURES

Plasmids and Oligonucleotides

The construct pCF001 contains the upstream regulatory regions of both the ompC and ompF genes, cloned into pGEM3Zf(+) (Promega). The ompF upstream regulatory sequence was obtained from the plasmid pAR094 (Rampersaud et al., 1994). The ompC regulatory sequence was obtained from the plasmid pGR241 (Norioka et al., 1986). The fused sequence was created by a two-step PCR reaction. To amplify the ompC sequence, a 5`-PCR primer (AGGAATTCATTTCGCCATTCC) was annealed to the -199 to -187 sequence of ompC and also created an EcoRI site. The 3`-PCR primer (AACTGGATCCAATCCAACACGAATATGA) was annealed to the -44 to -27 sequence of the ompC gene and created a BamHI site. To amplify the ompF sequence, a 5`-PCR primer (GATTGGATCCAGTTCCTTAAATTTTACT) was annealed to the -112 to -95 sequence of ompF and created a BamHI site. The corresponding 3`-PCR primer (TCAAGCTTGCATGC) was annealed to the -2 to +12 sequence of ompF in pAR094, where a HindIII site is present. The two PCR products that encoded the ompF and ompC upstream regulatory sequences were then used in a second PCR reaction such that the sequences at the 3`-end of ompC sequence annealed to the 5`-end of the ompF sequence during the PCR reaction to fuse the two sequences. Thus, the final product contained the ompC -199 to -27 sequence upstream of the -112 to +1 sequence of ompF. A BamHI site is present between the two sequences, an EcoRI site is at the 5`-end, and a HindIII site is at the 3`-end. The correct sequence was confirmed by DNA sequencing.

The 20-base pair OmpR binding sites were synthesized on an Applied Biosystems DNA synthesizer. Complimentary strands were annealed to create double-stranded DNA sequences for mobility shift assays.

Mobility Shift Assays

Binding reactions were carried out in 50 mM Tris-HCl, pH 7.5, 50 mM KCl, 5 mM CaCl, 5% glycerol, 0.0025% Nonidet P-40, and 200 ng of poly(dI-dC). First, OmpR was phosphorylated in vitro using ATP and the purified catalytic cytoplasmic domain of EnvZ (amino acids Arg-Gly), referred to as EnvZ(C) (Delgado et al., 1993). OmpR was incubated with 7 nM EnvZ(C) in the binding buffer with 60 mM ATP at 25 °C for 10 min. Appropriate amounts of purified OmpR or PrS-OmpR were then added and allowed to incubate for another 15 min at 25 °C. Labeled DNA was added to each reaction, and the final reaction volume was 15 µl. Binding reactions were incubated at 4 °C for 30 min and then loaded onto a 5% acrylamide/bisacrylamide (40:1.2) gel. The gel was run at 4 °C in 1 TE buffer (10 mM Tris-HCl, pH 7.5, 1 mM EDTA) and run at 120 V. The dried gel was exposed to autoradiography film overnight at -80 °C.

Expression of the PrS-OmpR Fusion Protein

Random Selection and Amplification of OmpR Binding Sites

RESULTS

Construction of an OmpR Fusion Protein

OmpR was fused to protein S, a protein present on the spore coat of a Gram-negative soil bacterium, Myxococcus xanthus (Inouye et al., 1979, 1981). Protein S has a high -sheet content (90%) and is known to be very stable in solution (Bagby et al., 1994). Two tandem copies of a DNA fragment encoding the amino-terminal 92 amino acid residues of protein S were fused to the 5`-end of the ompR gene to encode a hybrid protein with a molecular mass of 47 kDa, which is 20 kDa larger than OmpR. The purpose of fusing protein S to OmpR was to increase the size of OmpR without affecting OmpR DNA-binding activity. Thus, in a mobility shift assay, the addition of PrS-OmpR to DNA-binding reactions should simply result in the production of slower mobility bands relative to the mobility of the DNA fragment bound by the intact OmpR molecule. The T7 expression system was used to express this hybrid protein, referred to as PrS-OmpR (Fig. 1A).

Figure 1: OmpR and PrS-OmpR bind to the ompF upstream regulatory sequences to form a total of three complexes. A, schematic of the PrS-OmpR fusion protein in which two N-terminal domains of protein S were fused to the wild-type OmpR to create a protein with a molecular mass of 42 kDa. B, increasing concentrations of OmpR, as indicated above the gel, were phosphorylated in vitro with EnvZ(C) and ATP. Labeled DNA containing the ompF -100 to -40 sequence was added to the phosphorylation reactions, and the reactions were incubated on ice for 30 min. Binding reactions were then loaded on a 5% polyacrylamide gel and run at 4 °C in 1 TE buffer. a, b, and c indicate the three OmpR-DNA complexes formed. C, increasing concentrations of PrS2-OmpR were phosphorylated in vitro and incubated with the ompF -100 to -40 DNA as described for OmpR in A. A control reaction using wild-type OmpR is shown in the far right lane as a comparison of the mobilities of the three complexes a, b, and c.

Previous studies have shown that OmpR binds to the -100 to -40 region of ompF. The BamHI-HindIII fragment of pCF001, containing the -100 to -40 region of ompF and referred to as 100/1, was used for mobility shift assays. The gel retardation analysis of this fragment with increasing amounts of phosphorylated OmpR is shown in Fig. 1B. A total of 3 bands, labeled a, b, and c, represent binding by different numbers of OmpR molecules. Band a represents the DNA fragment bound by the minimum number of OmpR molecules under the binding conditions used in the present study. Higher concentrations of OmpR resulted in the binding of all of the DNA with exclusive formation of band c, suggesting that this band represents the DNA fragment bound by the maximum number of OmpR molecules. The existence of three bands indicates that there are three distinct OmpR-binding units in the 100/1 fragment. A similar gel shift pattern consisting of three bands a, b, and c, is observed when this DNA fragment is incubated with increasing concentrations of PrS-OmpR (Fig. 1C). These three bound complexes correspond to the three complexes formed when using intact OmpR (Fig. 1C, far right lane), but the mobility of the DNA bound by PrS-OmpR is slower due to its higher molecular weight. Formation of the complexes required PrS-OmpR concentrations similar to those of intact OmpR, indicating that fusion of protein S to OmpR did not affect OmpR DNA-binding activity. The PrS-OmpR-DNA complexes appear as doublets, possibly due to conformational effects imparted by the protein S domain. In vitro copper phenanthroline footprinting in the presence of PrS-OmpR resulted in a protection pattern identical to that observed in the presence of the intact OmpR (data not shown). This provides further evidence that both OmpR and PrS-OmpR bind to the 100/1 fragment in an identical manner.

Six OmpR Molecules Bind to the -100 to -40 region of ompF

Figure 2: Six OmpR proteins bind to the -100 to -40 sequence of ompF. Varying concentrations of OmpR and PrS-OmpR were mixed, phosphorylated in vitro with EnvZ(C) and ATP, and incubated with the 100/1 fragment, containing the -100 to -40 sequence of ompF (A); the 100/64 fragment, containing the -100 to -64 sequence of ompF (B); and the 100/81 fragment, containing the -100 to -81 sequence of ompF (C). The concentrations of OmpR and PrS-OmpR are indicated for each lane. The binding reactions were incubated on ice for 30 min and loaded onto a 5% acrylamide gel and run at 4 °C in 1 TE buffer. To the right of each gel is a diagrammatic representation of the number of OmpR and PrS-OmpR proteins present in each bound complex. symbolizes PrS-OmpR and symbolizes OmpR.

Footprinting of the ompF upstream regulatory sequences in the presence of the OmpR2 protein, a DNA-binding mutant, results in protection of the -100 to -60 sequence, but no protection of the -60 to -40 sequence (Mizuno et al., 1988; Tsung et al., 1989). Also, binding studies previously done in this laboratory using a synthetic DNA fragment containing the -100 to -64 sequence of ompF, demonstrated that phosphorylated OmpR can bind this DNA (Rampersaud et al., 1989). Mobility shift assays of OmpR and PrS-OmpR with the synthetic DNA fragment containing the -100 to -64 fragment are shown in Fig. 2B. A total of five bands are formed, indicating that four OmpR molecules bind to this fragment. In the presence of increasing concentrations of intact OmpR only (Fig. 2B), two binding events are observed as shown by the presence of two complexes.

Finally, a 20-bp fragment representing the ompF -100 to -81 sequence was used in a mobility shift assay with OmpR and PrS-OmpR. With increasing concentrations of phosphorylated OmpR alone, only a single bound complex is formed (Fig. 2C). The addition of increasing concentrations of PrS-OmpR to OmpR leads to the formation of three complexes (Fig. 2C), indicating that the 20-mer is bound by two OmpR molecules.

The results obtained above indicate that two OmpR molecules bind to each of the three 20-bp sequences in the region downstream of -100 and that a total of six OmpR molecules bind to the region from -100 to -40. The binding of the 100/1 fragment using increasing concentrations of OmpR resulted in the step-wise formation of three distinct complexes. These results suggest that OmpR binds to the DNA ``two-at-a-time'' and that bands a, b, and c in Fig. 1B thus correspond to two, four, and six OmpR molecules binding to the 100/1 fragment. There are not sufficient data at present to indicate that OmpR forms dimers prior to binding DNA. Binding by two OmpR molecules may occur in a highly cooperative manner, such that formation of a complex with an OmpR monomer was not detected by the mobility shift assay. It is evident that there are three OmpR binding units in the -100 to -40 sequence of ompF. Each consists of approximately 20 bp, to which two OmpR molecules bind. These units are assigned F1, F2, and F3 and determined to be from -100 to -81, -80 to -61, and -58 to -39, respectively, on the basis of the results above and a consensus sequence as described below (see Fig. 3).

Figure 3: The -100 to -39 sequence of ompF is composed of three OmpR binding sites, each 20 base pairs long, and designated F1, F2, and F3.

Determination of an OmpR Consensus Sequence

Figure 4: Computer alignment of OmpR binding sites. Five OmpR 20 base pair sites, which are each bound by two OmpR proteins, were aligned using the GCG version 7.2 Pileup program. The sites are as follows: F1 (ompF -100 to -81); F2 (ompF -80 to -61), F3, ompF -58 to -39; F4, ompF -380 to -361; and C1, ompC -58 to -89). Boldface letters indicate residues that are fully conserved, upper case letters indicate highly conserved residues, and lower case letters indicate poorly conserved residues. The numbers above the aligned sequence indicate the positions of the residues within the 20-bp motif as discussed in the text.

Random selection and PCR amplification (Oliphant and Struhl, 1988) was used to determine a consensus sequence for OmpR binding. Initially, an oligonucleotide was designed for OmpR binding in which 20 bp were randomized. After repeated attempts failed, a new PCR template was designed that contained the 5` 11 bp of the F1 sequence. The final PCR template thus used was 46 bp in length, having the following sequence: GACGGATCCTTTTACTTTTGG(N9)CTGTAGGAATTCTCAC. The ompF -100 to -90 sequence (underlined) is followed by nine randomized bases(N9) on the 3`-side. After four cycles of binding and PCR amplification, 5% of the DNA was retarded in the mobility shift gel electrophoresis. Essentially 100% of the DNA was retarded after six cycles of binding and PCR amplification. This shifted DNA was eluted, PCR-amplified in the presence of labeled fragment, and used in a mobility shift assay in the presence of 200 nM OmpR and increasing concentrations of PrS-OmpR. As shown in Fig. 5, the results demonstrate that the selected sequence is bound by two OmpR molecules as judged from the formation of three bands.

Figure 5: The sequence obtained through random selection and PCR amplification is bound by two OmpR molecules. The selected pool of sequences was PCR-amplified using a PCR primer end-labeled with [-P]ATP and incubated with in vitro phosphorylated OmpR and PrS-OmpR. The concentrations of each protein are indicated above the gel.

The PCR products were subcloned and 20 clones were sequenced. The results are shown in Fig. 6. Most striking are the 100% conserved ACA sequence at positions 3, 4, and 5 of the N9 sequence, and the highly conserved TTACA sequence at positions 1-5. It should be noted that the C at position 4 occurs 10 bp downstream of the C in the template, which represents the C at position -96 within the F1 box. Both C residues correspond to the C residues that are fully conserved in all five OmpR binding sequences shown in Fig. 3. Therefore, it is reasonable to assume that the C residue in the N9 sequence was selected by the distance from the C residue in the portion of the sequence held constant. This accurate determination of the distance can be explained by sequential binding of two OmpR molecules to the 20-mer sequence containing N9; an OmpR molecule first recognizes the motif in the 5`-half, TTAC, which governs the position of the second OmpR binding. This results in selection of the TTAC sequence within the N9 region as the most preferred sequence. It should also be noted that the consensus sequence in the N9 region from 20 independent clones was TTACATXTX (Fig. 6), which is identical to the 3`-half of the F1 sequence (TTACATATT; see Fig. 3) except for 2 Xs. Interestingly, the first X in F1 is A, and the PCR reaction selected A or T at this position in 17 out of 20 cases. Similarly, the second X in F1 is T, and the PCR reaction again picked A or T in 15 out of 20 cases. This result indicates that A or T is the highly preferred base at these positions.

Figure 6: A highly conserved TTACATNTN sequence was selected within the random pool of binding templates. The pool of amplified sequences after 6 rounds of selection was subcloned, and 20 clones were sequenced. The residues labeled constant represent the 11 bp in the 5`-half of the F1 site, which were present in the initial template for OmpR binding selection. N9 indicates the randomized portion of the initial binding template. The highly conserved residues that were selected are in boldface, and a consensus sequence is indicated at the bottom.

Two OmpR Proteins Tandemly Bind to the F1 Sequence

Figure 7: Mutating the conserved residues of the 20-base pair OmpR binding motif decreases binding by OmpR. Twenty-base pair oligonucleotides were synthesized and annealed to form double-stranded DNA molecules for OmpR binding assays. The sequences are shown in A. wt is the wild-type F1 sequence. Numbers above this sequence indicate the positions of the residues within the 20-bp sites as discussed in the text. Boldface residues indicate the point mutations within the mutated 20-bp sequences. 90/70(T11G) is the ompF -90 to -71 sequence in which the T at position -80 is changed to a G. The mobility shift assays are shown in B. The 20-mers were labeled with [-P]ATP and T4 kinase and incubated with or without in vitro phosphorylated OmpR (100 nM).

Next we analyzed the role of the two fully conserved C residues by individually substituting them with T. Interestingly, the change of C to T at positions 5 and 15 of the 20-mer caused a decrease in binding to approximately 10% of the wild-type 20-mer sequence (Fig. 7B, lanes C5T and C15T). This result indicates that although two OmpR molecules bind to the F1 sequence at the same time, a single OmpR molecule is unable to individually bind to either the 5`- or 3`-half.

The results described above support the notion that two OmpR molecules bind tandemly to two direct repeats, each of which exists in a 10-bp subunit sequence; one is the 5`-half (which we will call subunit a), and the other is the 3`-half (which we will call subunit b). Examination of all five binding sequences shown in Fig. 4reveals an interesting feature; 33 Ts out of a total of 50 bases (66%) are found within subunit a, while only 15 Ts out of a total of 50 bases (30%) are found within subunit b. To examine the significance of this finding, the order of subunits was reversed by placing subunit b of F1 as the 5`-half and subunit a of F2 as the 3`-half. The 20-mer fragment thus encompasses the ompF upstream sequence from -90 to -71 (90/71 fragment, Fig. 7A). This fragment was not bound by OmpR (data not shown). Since the substitution of G with T in F1 resulted in a substantial reduction of OmpR binding (see Fig. 7B), we examined whether the substitution of the T residue with G at position 11 of the 90/71 fragment recovers OmpR binding ability. The resultant fragment (Fig. 7A, 90/71(T11G)) was poorly bound by OmpR (Fig. 7B). These results indicate that the T-richness in the 5`-half of the OmpR-binding 20-mer fragments plays an important role in the coordinate binding of two OmpR molecules to the fragment.

OmpR Binds Cooperatively to ompF Regulatory Sequences

Figure 8: Cooperative interaction between OmpR molecules bound to F2 and F3 are required for binding to these low affinity sites. Increasing concentrations of in vitro phosphorylated OmpR were incubated with the 100/1 fragment (containing the F1, F2, and F3 sites) and with the 80/1 fragment (containing the F2 and F3 sites). The three complexes a, b, and c were formed with the 100/1 fragment, but only one complex was formed with the 80/1 fragment. Binding assays with PrS-OmpR showed that the single complex with the 80/1 fragment was bound by four OmpR proteins (data not shown).

This cooperative binding can be further supported by mutational analysis of the 100/1 fragment containing either the C T or the C T mutation, which corresponds to C T and C T (C5T and C15T in Fig. 7A), respectively. The C T mutation completely eliminated OmpR binding to the F1 20-mer (Fig. 7B, lane marked C15T). The mutated sequence was bound by six OmpR molecules as determined by gel shift analysis with PrS-OmpR (data not shown). However, unlike the wild-type ompF sequence in which incubation with increasing OmpR concentrations leads to the formation of three bands, incubation of increasing OmpR concentrations with the mutated sequences produced only two complexes, b and c (Fig. 9). Gel shift assays with PrS-OmpR showed that this mutated fragment is bound by six proteins (data not shown). This suggests that although OmpR can bind to the mutated sequence at -96 or -86, this binding requires OmpR binding to the downstream F2-F3 region.

Figure 9: Substitution of C with T resulted in the loss of the a complex bound by two OmpR proteins. Increasing concentrations of in vitro phosphorylated OmpR were incubated with the 100/1 fragment (containing the F1, F2, and F3 sites) and with the 100/1 fragment containing the C T mutation. Only complexes b (bound by four OmpR proteins) and c (bound by six OmpR proteins) were formed with the mutated fragment, as demonstrated by binding assays using PrS-OmpR (data not shown).

DISCUSSION

The present results unambiguously demonstrated that six OmpR molecules bind to the -100 to -39 region of ompF. We determined that this region contains three individual binding sites, 20 base pairs in length, which are each bound by two OmpR proteins. The binding sites were designated F1, F2, and F3, representing the -100 to -81, -80 to -61, and -58 to -39 sequences of ompF, respectively (Fig. 3). Recent data have shown a far upstream OmpR binding site located at the -380 to -361 sequence of ompF (Huang et al., 1994; Rampersaud et al., 1994), which also shares sequence identity with F1, F2, and F3. Based on the results reported in this paper, we defined this distal site as F4. Although the number of OmpR molecules bound to this site was not determined due to poor binding to this sequence by OmpR, it is reasonable to assume that two OmpR proteins bind to this 20-base pair motif. Similarly, the ompC -98 to -79 sequence is another independent binding site bound by two OmpR molecules (data not shown) and assigned C1.

Although two OmpR molecules bind to a 20-base pair sequence, each 20-mer is considered a single site since binding of a single OmpR molecule was never detected. Three complexes observed in mobility shift assays with OmpR and the DNA fragment containing the F1, F2, and F3 sequences (Fig. 1B) were thus formed by binding of two (to F1), four (to F1 and F2), or six OmpR (to F1, F2, and F3) proteins. Currently, there are not sufficient data to suggest that OmpR dimerizes in solution prior to binding DNA. Methods such as gel filtration and light scattering detect only OmpR monomers. ()Co-precipitation of OmpR (not fused to protein S) with PrS-OmpR bound to M. xanthus spores occurred only in the presence of DNA. ()It is likely that significant OmpR-OmpR interactions occur only upon binding to DNA.

The finding that two proteins bind to a 20-base pair site led to the question of whether the proteins bind to two direct repeats or to two inverted repeats. Random selection of an optimal OmpR binding sequence by PCR amplification was done using a synthetic fragment, which contained 11 base pairs from the 5`-half of the F1 site followed by nine random base pairs. The sequence TTACATNTN was selected within the randomized portion. This suggests that the most preferred OmpR binding sequence consists of two direct repeats consisting of TTACATNTN, since sequences similar to TTACATNTN are seen in the 5`-half of F1 and the 5`- and 3`-halves of F2, F3, F4, and C1. Note that T, C, A, and C are invariable in all of the 20-base pair binding motifs. Substitution of the C with T in a 20-bp template resulted in decreased OmpR binding, while substitution of the C to T in a 20-base pair binding template resulted in a complete loss of OmpR binding activity. These data are consistent with the data of Rampersaud et al.(1989) who showed that incubation of phosphorylated OmpR with a fragment containing the -100 to -60 sequence of ompF resulted in the formation of two bands. Introduction of the C T or C T mutation within this fragment resulted in a decrease in affinity of OmpR for this DNA as well as the loss of the faster complex (that bound by only two proteins). Again, the C T mutation was more detrimental to binding than the C T mutation. However, a T A mutation within this fragment increased binding by OmpR, confirming that the ACA sequence obtained through the random selection is a preferred binding sequence in both the 5`- and 3`-half of the 20-base pair motif. The present results clearly indicate that two OmpR proteins bind to direct repeat sequences rather than inverted repeat sequences. Note that in F1 there are not inverted repeat sequences consisting of more than three bases. Furthermore, the existence of two absolutely conserved C residues in the two halves of the 20-base pair motif makes it unlikely that OmpR proteins bind to an inverted repeat structure.

Previously, we had assigned each of the direct repeats in F1 as two binding sites, Fa and Fb, which share the 10-base pair sequence NTTACNTNTN (Tsung et al., 1989). It should be noted that Fa is highly T-rich in comparison with Fb. The T-richness in the 5`-halves of the 20-base pair motifs is common in all sequences as shown in Fig. 4and appears to contribute asymmetry to the 20-base pair motif, since exchanging the position between the two halves resulted in the loss of OmpR binding. Maeda et al.(1991) also proposed an asymmetric consensus motif with the sequence TTTTACTTTTTGTAACATAT. Interestingly, Makino et al.(1989) proposed that the OmpR homologue PhoB binds to an asymmetric 18-base pair sequence, the pho box, which is tandemly repeated upstream of promoters controlled by PhoB (Kimura et al., 1989; Kasahara et al., 1991).

Binding of protein dimers to direct repeats has been reported for AraC (Carra and Schleif, 1993), GABP (Thompson et al., 1991), and Mat2 (Smith and Johnson, 1992). In each case, the authors propose the presence of a flexible linker domain between the dimerization domain and the DNA-binding domain. The flexible linker allows AraC (Carra and Schleif, 1993) and Mat2 (Smith and Johnson, 1992) to bind to the nucleotide sequence repeats in either a direct or inverted orientation, as well as to repeats with variable spacing. In contrast, there appears to be little or no flexibility in the positioning of the two OmpR binding sequences within a 20-base pair motif. One possibility is that the nucleotide sequence of the binding motif confers a strict conformation on the DNA to position the two direct repeats such that two bound OmpR proteins can cooperatively interact for stabilization of the complex. T-rich sequences are known to cause bending of DNA, and bending of the ompF upstream regulatory sequence has been experimentally shown. (Mizuno, 1987; Slauch and Silhavy, 1991).

Note that identification of the fully conserved C residues of an OmpR binding site aided in the more precise identification of the F3 site, which is actually two base pairs removed from the F2 site. This positioning of the F3 site may function to place the bound OmpR proteins on the same face of the DNA helix. Since a full helical turn is 10.5 base pairs in length, the 40 base pairs of the F1 and F2 sites may fall short of four full turns. The location of the F3 site may compensate for this.

Computer alignment of the five OmpR binding sites (Fig. 4) agrees well with the established affinity hierarchy, F1 > C1 > F2 > F3 > F4 (Rampersaud et al., 1994). ()Comparison of these sequences suggests that F3 and F4 have the most mismatches and thus are likely to have the lowest affinity for OmpR. Both F3 and F4 lack the highly conserved G residue at position 11 of the 20-base pair site. F4, which seems to have the lowest affinity for OmpR, also lacks the T-richness in its 5`-half.

Cooperative interactions also affect the ability of OmpR to bind to the sites upstream of the ompF promoter. Rampersaud et al.(1994) showed that binding of the F4 site depended upon prior binding of OmpR to the downstream region. The present data show that cooperative interactions are also important for binding to the lower affinity F2 and F3 sites. Deletion of the F1 site resulted in a decreased affinity of OmpR for the F2 and F3 sites. It was clear that OmpR was not able to bind to the F2 or F3 sites alone. Clearly, binding of these low affinity sites was enhanced by the presence of OmpR-OmpR interactions.

According to the model proposed above, six OmpR proteins bind tandemly to six direct repeats upstream (-100 to -39) of the ompF promoter. In addition to these six OmpR molecules, two other molecules are bound to F4, making a total of eight molecules involved in the regulation of ompF expression. Multiple transcription factor binding sites upstream of a promoter is also known in other systems (for review, see Collado-Vides et al.(1991)). In the case of ompF, this allows more flexibility and fine-tuning in the regulation of transcription, as more OmpR binding shifts the function of OmpR from activation to repression. Binding is clearly regulated by the concentration of phosphorylated OmpR in the cell. An increase in medium osmolarity is accompanied by an increase in the number of phosphorylated OmpR molecules (Forst et al., 1990), leading to binding of additional, lower affinity sites. In addition, the need for cooperative interactions ensures that binding of proteins to high affinity sites precedes binding to adjacent low affinity sites.

FOOTNOTES

*

This work was supported by National Institutes of Health Grant GM19043 (to M. I.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§

To whom correspondence should be addressed.

()

The abbreviations used are: PCR, polymerase chain reaction; bp, base pair(s).

()

Y. Hidaka, unpublished results.

()

L. Bergstrom, unpublished results.

()

S. L. Harlocker, unpublished results.

ACKNOWLEDGEMENTS

REFERENCES

1. Aiba, H., and Mizuno, T. (1990) FEBS Lett. 261, 19-22 [CrossRef][Medline] [Order article via Infotrieve]
2. Aiba, H., Mizuno, T., and Mizushima, S. (1989a) J. Biol. Chem. 264, 8563-8567 [Abstract/Free Full Text]
3. Aiba, H., Nakasai, F., Mizushima, S., and Mizuno, T. (1989b) J. Biochem. 106, 5-7 [Abstract/Free Full Text]
4. Bagby, S., Harvey, T. S., Eagle, S. G., Inouye, S., and Ikura, M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4308-4312 [Abstract/Free Full Text]
5. Carra, J. H., and Schleif, R. F. (1993) EMBO J. 12, 35-44 [Medline] [Order article via Infotrieve]
6. Chang, C., Kwok, S. F., Bleecker, A. B., and Meyerowitz, E. M. (1993) Science 262, 539-544 [Abstract/Free Full Text]
7. Collado-Vides, J., Magasanik, B., and Gralla, J. D. (1991) Microbiol. Rev. 55, 371-394 [Abstract/Free Full Text]
8. Csonka, L. N., and Hanson, A. D. (1991) Annu. Rev. Microbiol. 45, 569-606 [CrossRef][Medline] [Order article via Infotrieve]
9. Delgado, J., Forst, S., Harlocker, S., and Inouye, M. (1993) Molec. Micro. 10, 1037-1047
10. Forst, S., Delgado, J., and Inouye, M. (1989a) Proc. Natl. Acad. Sci. U. S. A. 86, 6052-6056 [Abstract/Free Full Text]
11. Forst, S., Delgado, J., and Inouye, M. (1989b) J. Bacteriol. 171, 2949-2955 [Abstract/Free Full Text]
12. Forst, S., Delgado, J., Rampersaud, A., and Inouye, M. (1990) J. Bacteriol. 172, 3473-3477 [Abstract/Free Full Text]
13. Hall, M. N., and Silhavy, T. J. (1981a) J. Mol. Biol. 151, 1-15 [CrossRef][Medline] [Order article via Infotrieve]
14. Hall, M. N., and Silhavy, T. J. (1981b) J. Mol. Biol. 146, 23-43 [CrossRef][Medline] [Order article via Infotrieve]
15. Huang, K., Schieberl, J. L., and Igo, M. M. (1994) J. Bacteriol. 176, 1309-1315 [Abstract/Free Full Text]
16. Igo, M. M., and Silhavy, T. J. (1988) J. Bacteriol. 170, 5971-5973 [Abstract/Free Full Text]
17. Igo, M. M., Ninfa, A. J., Stock, J. B., and Silhavy, T. J. (1989) Genes & Dev. 3, 1725-1734
18. Inouye, M., Inouye, S., and Zusman, D. R. (1979) Dev. Biol. 68, 579-591 [CrossRef][Medline] [Order article via Infotrieve]
19. Inouye, S., Harada, W., Zusman, D., and Inouye, M. (1981) J. Bacteriol. 148, 678-683 [Abstract/Free Full Text]
20. Jin, T., and Inouye, M. (1993) J. Mol. Biol. 232, 484-492 [CrossRef][Medline] [Order article via Infotrieve]
21. Kanamaru, K., Aiba, H., and Mizuno, T. (1990) J. Biochem. (Tokyo) 108, 483-487 [Abstract/Free Full Text]
22. Kasahara, M., Makina, K., Amemura, M., Nakata, A., and Shinagawa, H. (1991) J. Bacteriol. 173, 549-558 [Abstract/Free Full Text]
23. Kawaji, H., Mizuno, T., and Mizushima, S. (1979) J. Bacteriol. 140, 843-847 [Abstract/Free Full Text]
24. Kimura, S., Makino, K., Shinagawa, H., Amemura, M., and Nakata, A. (1989) Mol. & Gen. Genet. 215, 374-380
25. Maeda, S., and Mizuno, T. (1988) J. Biol. Chem. 263, 14629-14633 [Abstract/Free Full Text]
26. Maeda, S., and Mizuno, T. (1990) J. Bacteriol. 172, 501-503 [Abstract/Free Full Text]
27. Maeda, S., Ozawa, Y., Mizuno, T., and Mizushima, S. (1988) J. Mol. Biol. 202, 433-441 [CrossRef][Medline] [Order article via Infotrieve]
28. Maeda, S., Takayanagi, K., Nishimura, Y., Maruyama, T., Sato, K., and Mizuno, T. (1991) J. Biochem. (Tokyo) 110, 324-327 [Abstract/Free Full Text]
29. Makino, K., Shinagawa, H., Amemura, M., Kimura, S., Nakata, A., and Ishihama, A. (1986) J. Mol. Biol. 203, 85-95
30. Mizuno, T. (1987) Gene (Amst.) 54, 57-64 [CrossRef][Medline] [Order article via Infotrieve]
31. Mizuno, T., and Mizushima, S. (1986) J. Bacteriol. 168, 86-95 [Abstract/Free Full Text]
32. Mizuno, T., and Mizushima, S. (1987) J. Biochem. (Tokyo) 101, 387-396 [Abstract/Free Full Text]
33. Mizuno, T., Kato, M., Jo, Y.-L., and Mizushima, S. (1988) J. Biol. Chem. 263, 1008-1012 [Abstract/Free Full Text]
34. Nikaido, H., and Vaara, M. (1987) in Escherichia coli and Salmonella typhimurium: Cellular and Molecular Biology (Neidhardt, F. C., Ingraham, J. L., Low, K. B., Magasanik, B., Schaechter, M., and Umbarger, H. E., eds) pp. 7-22, American Society of Microbiology, Washington, D. C.
35. Nixon, B. T., Ronson, C. W., and Ausubel, F. M. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 7850-7854 [Abstract/Free Full Text]
36. Norioka, S., Ramakrishnan, G., Ikenaka, K., and Inouye, M. (1986) J. Biol. Chem. 261, 17113-17119 [Abstract/Free Full Text]
37. Oliphant, A. R., and Struhl, K. (1987) Nucleic Acids Res. 16, 7673-7681 [Abstract/Free Full Text]
38. Ota, I. M., and Varshavsky, A. (1993) Science 262, 566-569 [Abstract/Free Full Text]
39. Parkinson, J. S., and Kofoid, E. C. (1992) Annu. Rev. Genet. 26, 71-112 [CrossRef][Medline] [Order article via Infotrieve]
40. Rampersaud, A., Norioka, S., and Inouye, M. (1989) J. Biol. Chem. 264, 18693-18700 [Abstract/Free Full Text]
41. Rampersaud, A., Harlocker, S. L., and Inouye, M. (1994) J. Biol. Chem. 269, 12559-12566 [Abstract/Free Full Text]
42. Russo, F. D., and Silhavy, T. J. (1991) J. Mol. Biol. 222, 567-580 [CrossRef][Medline] [Order article via Infotrieve]
43. Sarma, V., and Reeves, P. (1977) J. Bacteriol. 132, 23-27 [Abstract/Free Full Text]
44. Slauch, J. M., and Silhavy, T. J. (1989) J. Mol. Biol. 210, 281-292 [CrossRef][Medline] [Order article via Infotrieve]
45. Slauch, J. M., and Silhavy, T. J. (1991) J. Bacteriol. 173, 4039-4048 [Abstract/Free Full Text]
46. Slauch, J. M., Garrett, S., Jackson, D. E., and Silhavy, T. J. (1988) J. Bacteriol. 170, 439-441 [Abstract/Free Full Text]
47. Smith, D. L., and Johnson, A. D. (1992) Cell 68, 133-142 [CrossRef][Medline] [Order article via Infotrieve]
48. Stock, J. B., Ninfa, A. J., and Stock, A. M. (1989) Microbiol. Rev. 53, 450-490 [Abstract/Free Full Text]
49. Thompson, C. C., Brown, T. A., and McKnight, S. L. (1991) Science 253, 762-768 [Abstract/Free Full Text]
50. Tsung, K., Brissette, R., and Inouye, M. (1989) J. Biol. Chem. 264, 10104-10109 [Abstract/Free Full Text]
51. Yang, Y., and Inouye, M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 11057-11061 [Abstract/Free Full Text]
52. Yang, Y., and Inouye, M. (1993) J. Mol. Biol. 231, 335-342 [CrossRef][Medline] [Order article via Infotrieve]

CiteULike

Complore

Connotea

Del.icio.us

Digg

Reddit

Technorati

This article has been cited by other articles:

				J. E. Rhee, W. Sheng, L. K. Morgan, R. Nolet, X. Liao, and L. J. Kenney Amino Acids Important for DNA Recognition by the Response Regulator OmpR J. Biol. Chem., March 28, 2008; 283(13): 8664 - 8677. [Abstract] [Full Text] [PDF]

				J. King-Scott, E. Nowak, E. Mylonas, S. Panjikar, M. Roessle, D. I. Svergun, and P. A. Tucker The Structure of a Full-length Response Regulator from Mycobacterium tuberculosis in a Stabilized Three-dimensional Domain-swapped, Activated State J. Biol. Chem., December 28, 2007; 282(52): 37717 - 37729. [Abstract] [Full Text] [PDF]

				R. Kishii, L. Falzon, T. Yoshida, H. Kobayashi, and M. Inouye Structural and Functional Studies of the HAMP Domain of EnvZ, an Osmosensing Transmembrane Histidine Kinase in Escherichia coli J. Biol. Chem., September 7, 2007; 282(36): 26401 - 26408. [Abstract] [Full Text] [PDF]

				P. Bachhawat and A. M. Stock Crystal Structures of the Receiver Domain of the Response Regulator PhoP from Escherichia coli in the Absence and Presence of the Phosphoryl Analog Beryllofluoride J. Bacteriol., August 15, 2007; 189(16): 5987 - 5995. [Abstract] [Full Text] [PDF]

				G. Condemine and A. Ghazi Differential Regulation of Two Oligogalacturonate Outer Membrane Channels, KdgN and KdgM, of Dickeya dadantii (Erwinia chrysanthemi) J. Bacteriol., August 15, 2007; 189(16): 5955 - 5962. [Abstract] [Full Text] [PDF]

				T. Yoshida, L. Qin, L. A. Egger, and M. Inouye Transcription Regulation of ompF and ompC by a Single Transcription Factor, OmpR J. Biol. Chem., June 23, 2006; 281(25): 17114 - 17123. [Abstract] [Full Text] [PDF]

				S. Begic and E. A. Worobec Regulation of Serratia marcescens ompF and ompC porin genes in response to osmotic stress, salicylate, temperature and pH Microbiology, February 1, 2006; 152(2): 485 - 491. [Abstract] [Full Text] [PDF]

				I. C. Koo, D. Walthers, P. S. Hefty, L. J. Kenney, and R. S. Stephens ChxR is a transcriptional activator in Chlamydia PNAS, January 17, 2006; 103(3): 750 - 755. [Abstract] [Full Text] [PDF]

				P. Perron-Savard, G. De Crescenzo, and H. L. Moual Dimerization and DNA binding of the Salmonella enterica PhoP response regulator are phosphorylation independent Microbiology, December 1, 2005; 151(12): 3979 - 3987. [Abstract] [Full Text] [PDF]

				A. J. Standish, U. H. Stroeher, and J. C. Paton The two-component signal transduction system RR06/HK06 regulates expression of cbpA in Streptococcus pneumoniae PNAS, May 24, 2005; 102(21): 7701 - 7706. [Abstract] [Full Text] [PDF]

				H. He and T. C. Zahrt Identification and Characterization of a Regulatory Sequence Recognized by Mycobacterium tuberculosis Persistence Regulator MprA J. Bacteriol., January 1, 2005; 187(1): 202 - 212. [Abstract] [Full Text] [PDF]

				E.-B. Goh, D. F. Siino, and M. M. Igo The Escherichia coli tppB (ydgR) Gene Represents a New Class of OmpR-Regulated Genes J. Bacteriol., June 15, 2004; 186(12): 4019 - 4024. [Abstract] [Full Text] [PDF]

				M. Fernandez-Mora, J. L. Puente, and E. Calva OmpR and LeuO Positively Regulate the Salmonella enterica Serovar Typhi ompS2 Porin Gene J. Bacteriol., May 15, 2004; 186(10): 2909 - 2920. [Abstract] [Full Text] [PDF]

				H. Geng, S. Nakano, and M. M. Nakano Transcriptional Activation by Bacillus subtilis ResD: Tandem Binding to Target Elements and Phosphorylation-Dependent and -Independent Transcriptional Activation J. Bacteriol., April 1, 2004; 186(7): 2028 - 2037. [Abstract] [Full Text] [PDF]

				K. A. Kalivoda, S. M. Steenbergen, E. R. Vimr, and J. Plumbridge Regulation of Sialic Acid Catabolism by the DNA Binding Protein NanR in Escherichia coli J. Bacteriol., August 15, 2003; 185(16): 4806 - 4815. [Abstract] [Full Text] [PDF]

				V. L. Robinson, T. Wu, and A. M. Stock Structural Analysis of the Domain Interface in DrrB, a Response Regulator of the OmpR/PhoB Subfamily J. Bacteriol., July 15, 2003; 185(14): 4186 - 4194. [Abstract] [Full Text] [PDF]

				Y. Chen, C. Birck, J.-P. Samama, and F. M. Hulett Residue R113 Is Essential for PhoP Dimerization and Function: a Residue Buried in the Asymmetric PhoP Dimer Interface Determined in the PhoPN Three-Dimensional Crystal Structure J. Bacteriol., January 1, 2003; 185(1): 262 - 273. [Abstract] [Full Text] [PDF]

				S. J. Cai and M. Inouye EnvZ-OmpR Interaction and Osmoregulation in Escherichia coli J. Biol. Chem., June 28, 2002; 277(27): 24155 - 24161. [Abstract] [Full Text] [PDF]

				I. N. Olekhnovich and R. J. Kadner Mutational Scanning and Affinity Cleavage Analysis of UhpA-Binding Sites in the Escherichia coli uhpT Promoter J. Bacteriol., May 15, 2002; 184(10): 2682 - 2691. [Abstract] [Full Text] [PDF]

				J. C. Comolli, A. J. Carl, C. Hall, and T. Donohue Transcriptional Activation of the Rhodobacter sphaeroides Cytochrome c2 Gene P2 Promoter by the Response Regulator PrrA J. Bacteriol., January 15, 2002; 184(2): 390 - 399. [Abstract] [Full Text] [PDF]

				C. Prigent-Combaret, E. Brombacher, O. Vidal, A. Ambert, P. Lejeune, P. Landini, and C. Dorel Complex Regulatory Network Controls Initial Adhesion and Biofilm Formation in Escherichia coli via Regulation of the csgD Gene J. Bacteriol., December 15, 2001; 183(24): 7213 - 7223. [Abstract] [Full Text] [PDF]

				L. Qin, T. Yoshida, and M. Inouye The critical role of DNA in the equilibrium between OmpR and phosphorylated OmpR mediated by EnvZ in Escherichiacoli PNAS, January 23, 2001; (2001) 31383098. [Abstract] [Full Text]

				A. Aguirre, S. Lejona, E. G. Véscovi, and F. C. Soncini Phosphorylated PmrA Interacts with the Promoter Region of ugd in Salmonella enterica Serovar Typhimurium J. Bacteriol., July 1, 2000; 182(13): 3874 - 3876. [Abstract] [Full Text]

				M. Ansaldi, G. Simon, M. Lepelletier, and V. Méjean The TorR High-Affinity Binding Site Plays a Key Role in Both torR Autoregulation and torCAD Operon Expression in Escherichia coli J. Bacteriol., February 15, 2000; 182(4): 961 - 966. [Abstract] [Full Text]

				J. K. Cheung and J. I. Rood The VirR Response Regulator from Clostridium perfringens Binds Independently to Two Imperfect Direct Repeats Located Upstream of the pfoA Promoter J. Bacteriol., January 1, 2000; 182(1): 57 - 66. [Abstract] [Full Text]

				S. Eder, W. Liu, and F. M. Hulett Mutational Analysis of the phoD Promoter in Bacillus subtilis: Implications for PhoP Binding and Promoter Activation of Pho Regulon Promoters J. Bacteriol., April 1, 1999; 181(7): 2017 - 2025. [Abstract] [Full Text]

				M. K. B. Berlyn Linkage Map of Escherichia coli K-12, Edition 10: The Traditional Map Microbiol. Mol. Biol. Rev., September 1, 1998; 62(3): 814 - 984. [Abstract] [Full Text] [PDF]

				K. C. Quon, B. Yang, I. J. Domian, L. Shapiro, and G. T. Marczynski Negative control of bacterial DNA replication by a cell cycle regulatory protein that binds at the chromosome origin PNAS, January 6, 1998; 95(1): 120 - 125. [Abstract] [Full Text] [PDF]

				K.-J. Huang, C.-Y. Lan, and M. M. Igo Phosphorylation stimulates the cooperative DNA-binding properties of the transcription factor OmpR PNAS, April 1, 1997; 94(7): 2828 - 2832. [Abstract] [Full Text] [PDF]

				J. L. Dahl, B.-Y. Wei, and R. J. Kadner Protein Phosphorylation Affects Binding of the Escherichia coli Transcription Activator UhpA to the uhpT Promoter J. Biol. Chem., January 17, 1997; 272(3): 1910 - 1919. [Abstract] [Full Text] [PDF]

				Q. Lu, H. Park, L. A. Egger, and M. Inouye Nucleoside-diphosphate Kinase-mediated Signal Transduction via Histidyl-Aspartyl Phosphorelay Systems in Escherichia coli J. Biol. Chem., December 20, 1996; 271(51): 32886 - 32893. [Abstract] [Full Text] [PDF]

				K. Jung, K. Hamann, and A. Revermann K+ Stimulates Specifically the Autokinase Activity of Purified and Reconstituted EnvZ of Escherichia coli J. Biol. Chem., October 26, 2001; 276(44): 40896 - 40902. [Abstract] [Full Text] [PDF]

				L. Qin, T. Yoshida, and M. Inouye The critical role of DNA in the equilibrium between OmpR and phosphorylated OmpR mediated by EnvZ in Escherichiacoli PNAS, January 30, 2001; 98(3): 908 - 913. [Abstract] [Full Text] [PDF]

This Article Abstract Full Text (PDF) Submit a Letter to Editor Alert me when this article is cited Alert me when eLetters are posted Alert me if a correction is posted Citation Map Services Email this article to a friend Similar articles in this journal Similar articles in PubMed Alert me to new issues of the journal Download to citation manager Request Permissions Citing Articles Citing Articles via HighWire Citing Articles via Google Scholar Google Scholar Articles by Harlocker, S. L. Articles by Inouye, M. Search for Related Content PubMed PubMed Citation Articles by Harlocker, S. L. Articles by Inouye, M. Social Bookmarking                      What's this?