|
Volume 270,
Number 45,
Issue of November 10, 1995 pp. 26940-26949
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Methylation-associated
Transcriptional Silencing of the Major Histocompatibility
Complex-linked hsp70 Genes in Mouse Cell Lines (*)
(Received for publication, May 12, 1995; and in revised form, August 25, 1995)
Jacek J.
Gorzowski (§),
,
Carrie A.
Eckerley (¶),
,
Robert G.
Halgren
,
Allison
B.
Mangurten
,
Benette
Phillips (**)
From the Departments of Obstetrics and Gynecology and Cell,
Molecular, and Structural Biology, Northwestern University Medical
School, Chicago, Illinois 60611
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The MHC-linked hsp70 locus consists of duplicated genes, hsp70.1
and hsp70.3, which in primary mouse embryo cells are highly heat
shock-inducible. Several mouse cell lines in which hsp70 expression is
not activated by heat shock have been described previously, but the
basis for the deficiency has not been identified. In this study,
genomic footprinting analysis has identified a common basis for the
deficient response of the hsp70.1 gene to heat shock in four such cell
lines, viz., the promoter is inaccessible to transcription
factors, including heat shock transcription factor. Southern blot
analyses reveal extensive CpG methylation of a 1.2-kilobase region
spanning the hsp70.1 transcription start site and hypermethylation of
the adjacent hsp70.3 gene, which is presumably also inaccessible to
regulatory factors. Of four additional, randomly chosen mouse cell
lines, three show no or minimal hsp70.3 heat shock responsiveness and
CpG methylation of both hsp70 genes, and two of the three lines exhibit
a suboptimal hsp70.1 response to heat shock as well. In all three
lines, the accessibility of the hsp70.1 promoter to transcription
factors is detectable but clearly diminished (relative to that in
primary mouse cells). Our results suggest that the tandem hsp70 genes
are concomitantly methylated and transcriptionally repressed with high
frequency in cultured mouse cells.
INTRODUCTION
The heat shock response, the increased transcription of a set of
genes in response to heat or other environmental stresses, is a highly
conserved biological response, occurring in all organisms so far
examined. In eukaryotes, the response is mediated by heat shock
transcription factor (HSF), ( )which is present in a
monomeric, non-DNA binding form in unstressed cells (except in certain
yeast(1) ) and is activated by stress to an oligomeric species
which can bind to promoters of heat shock genes (2, 3, 4, 5, 6) . The
target sequence for activated HSF, the heat shock element (HSE),
consists of inverted repeats of the pentanucleotide sequence
NGAAN(7, 8) . In mouse, where two distinct HSF genes
have been cloned, antisera specific for HSF1 and HSF2 were used to show
that the response to stress was mediated solely by
HSF1(9, 10) . Of the heat shock genes, hsp70 is the
most highly stress-inducible. It was therefore quite surprising to find
several rodent cell lines where this gene exhibited minimal, if any,
activation in response to stress. This finding was initially reported
in mouse erythroleukemia (MEL) cells(11) , a mouse plasmacytoma
line (MPC-11, (12) ), and two mouse embryonal carcinoma (EC)
lines (PCC4-AzaRI, PCC7-S-1009, (13) ). More recently, the same
deficiency was found in a glucocorticoid-resistant rat hepatoma clone (14) and in the murine lymphoma line CH1, where, interestingly,
hsp70 heat shock responsiveness was restored when the cells were grown
as a tumor and heated in situ(15) . Based on results
of gel shift analyses and/or transfection studies, a trans-acting defect, possibly in HSF, was proposed as the
cause for the lack of hsp70 responsiveness in the MEL, MPC-11, PCC4,
and PCC7 mouse lines(11, 12, 13) . In the
case of the rat hepatoma clone, a defect specific to the hsp70 gene
itself was one of the possibilities considered(14) , and, in
the case of CH1 cells, a requirement for additional regulatory factors
to activate hsp70 expression was suggested(15) . None of the
previous studies has identified the exact nature of the defect,
however. In mouse (as well as in human), duplicated genes comprise
the hsp70 locus, which is located in the MHC class III
region(16, 17) . The murine hsp70.1 and hsp70.3 genes
are highly homologous, although the nucleotide sequences completely
diverge in the 3`-untranslated regions (UTR), encode identical
proteins, and are both expressed only in response to
stress(18, 19) . The genes are in the same
transcriptional orientation and are approximately 7 kb apart in
mouse(20) . Methodology used in some of the previous studies of
mouse lines lacking an hsp70 heat shock response would have detected
expression of either gene; one can therefore surmise that in these
lines, both hsp70 genes are completely unresponsive to heat shock.
Using probes which distinguish transcription from each of the hsp70
genes, we formally demonstrate that in MEL, MPC-11, and PCC4 cells,
neither hsp70 gene responds to heat shock. Furthermore, examination of
additional, randomly selected mouse lines reveals that transcriptional
repression of one or both hsp70 genes is very widespread. The deficit
appears to reside in the hsp70 locus itself, as we find that HSF1 is
activated normally by heat shock in all lines deficient for activation
of one or both hsp70 genes and that another heat shock gene, hsp86,
exhibits normal heat shock induction. In the case of the hsp70.1
gene, we have used genomic footprinting and Southern blot analyses to
demonstrate that unresponsiveness to heat shock is consistently
associated with a complete loss of promoter accessibility and extensive
CpG methylation; these alterations apparently constitute the common
basis for the nonresponsive phenotype. We also find detectable but
reduced (relative to primary mouse cells) hsp70.1 promoter
accessibility and partial hsp70.1 gene methylation in three additional
mouse cell lines. Two of these three cell lines show a clearly
attenuated hsp70.1 transcriptional response to heat shock. In every
cell line which exhibits hsp70.1 methylation, the adjacent hsp70.3 gene
is also methylated and shows no or a very weak response to heat shock.
The tandem hsp70 genes are thus concomitantly methylated and
transcriptionally repressed with high frequency in cultured murine
cells.
MATERIALS AND METHODS
Cell Culture, Generation of Primary Mouse Embryo Cells,
Heat ShockMouse F9 and PCC4.aza.R1 embryonal carcinoma (EC)
cells were grown on gelatinized dishes in DME supplemented with 10%
FBS; NIH3T3 fibroblasts were grown in the same medium. Mouse
erythroleukemia (MEL) cells were grown in DME supplemented with 15%
heat-inactivated FBS. CH27 (mouse B-cell lymphoma) and LK35.2 (mouse
B-cell hybridoma) cells were kindly provided by S. Pierce (Northwestern
University) and grown in DME supplemented with 15% heat-inactivated FBS
and 50 µM 2-mercaptoethanol; L1210 (mouse lymphocytic
leukemia) and MPC-11 (mouse plasmacytoma) cells were obtained from ATCC
and grown in Fischer's medium supplemented with 10% horse serum
and DME supplemented with 20% heat-inactivated horse serum,
respectively. Primary mouse embryo fibroblasts (MEF) were derived by
disaggregation of minced 13-day-old C57BL/6J SJL/J embryos
overnight at 4 °C in 0.25% trypsin, 0.1% glucose. The dissociated
cells were expanded over several days in DME supplemented with 10% FBS,
and the cells were pooled and cryopreserved. For heat shock, plates
were sealed with parafilm and immersed in a 43 °C water bath for 40
min.
Measurement of Transcription RatesNuclei were
isolated as described previously(21) . Briefly, unstressed and
heat-shocked cells were lysed in hypotonic buffer (10 mM Tris,
pH 7.4, 5 mM MgCl , 0.4% Nonidet P-40, 0.5 mM dithiothreitol, 0.3 M sucrose), and nuclei were pelleted
through a cushion of the same buffer containing 0.88 M
sucrose. Transcription run-on analysis was done as described previously (22) using 5 10 to 1 10 nuclei per analysis. The amount of radioactivity incorporated
into nascent transcripts was quantitated by trichloroacetic acid
precipitation and liquid scintillation counting. A probe to
specifically measure transcription from the hsp70.1 gene was prepared
by subcloning a StuI-BglII fragment of
pM9.5(18) , containing sequences from the 3`-UTR of the hsp70.1
gene, into the StuI and BamHI sites of
pGem-7Zf(+) (Promega). A probe to specifically measure
transcription of the hsp70.3 gene was prepared by subcloning the ScaI-SstI fragment of pMHS213(23) ,
containing sequences from the 3`-UTR of the hsp70.3 gene into the SmaI and SstI sites of pUC18. These plasmids, as well
as pUC801 (human hsp89 (24) ) and GAPDH (rat
glyceraldehyde-3-phosphate dehydrogenase(25) ) were immobilized
on filters and hybridized to equivalent amounts of labeled transcripts
from each cell line. Results were quantitated with a Fuji
PhosphorImager.
Gel Retardation AssaysWhole cell extracts were
prepared and gel retardation assays were performed as described
previously(22) . Briefly, extracts containing 10 µg of
protein were incubated with a P-labeled oligonucleotide at
room temperature for 20 min. To measure Sp1 levels, binding reactions
were carried out using a double-stranded oligonucleotide
5`GAGAGTGGGCGGGGCCGGTGAA3` and its complement. To measure levels of HSE
binding activity, a double-stranded oligonucleotide
5`ACGCGAAACTGCTGGAAGATTCCTGGCCCCA3` and its complement were used. These
oligonucleotides corresponded to the proximal Sp1 site and HSE,
respectively, of the mouse hsp70.1 promoter (18) . The
oligonucleotide-binding protein complexes were analyzed on 4%
nondenaturing polyacrylamide gels. Antibody perturbation experiments
were performed exactly as described previously; dilutions (1 µl) of
rabbit antiserum specific for HSF1 or HSF2 were preincubated with whole
cell extracts for 20 min at room temperature prior to initiating the
binding reactions(10) .
Genomic FootprintingUnstressed and heat-shocked
cells (approximately 2 10 cells) were exposed to
dimethyl sulfate (DMS), 0.2% final concentration in culture medium, for
3 min at room temperature. For adherent cells, spent medium was
removed, DMS was resuspended in 10 ml of this medium by vortexing, and
the mixture was added back to the cells. Suspension cells were pelleted
and resuspended in 3 ml of spent medium containing DMS. Duplicate
samples were exposed to DMS, and replicate experiments were performed
with each cell line to ensure reproducibility of results. Genomic DNA
was isolated(26) , digested with EcoRI, cleaved with
piperidine, and used for footprinting. Footprinting was also carried
out on DNA which was isolated from NIH3T3 cells, deproteinized (naked
DNA), and treated with DMS in vitro. Genomic footprinting
analysis was performed using a ligation-mediated polymerase chain
reaction method(27) . Primers for footprinting of the coding
strand of the hsp70.1 gene were derived from noncoding strand sequences
located just downstream of the TATA element(18) . The sequence
of primer 1 was 5`CTTCGCTTGTCTCTGGATGG3`; the sequence of primer 2 was
5`AGTAGCTGTCAGCGTCTGGTGCCCT3`. Primer 3, used for end labeling, had the
same sequence as primer 2 but included four additional bases at the 3`
end: 5`GCTC3`.The hsp70.3 sequence corresponding to primer 2 is
5`AGTAGCTGTCAGCGTCTGGTGACCGT3`(19) ; it thus contains both a
base change and a base insertion near the 3` end and should not be
recognized by footprinting primer 2 in the amplification step of the
ligation-mediated polymerase chain reaction procedure, which is carried
out at 2 °C above the T of the primers. We
detected labeled product of the expected size when mouse DNA, the
hsp70.1 footprinting primer 2 and an opposite strand hsp70.1-specific
primer of equivalent T (derived from sequences
upstream of the distal HSE) were subjected to the same amplification
conditions used in the genomic footprinting analysis and then labeled
using genomic footprinting primer 3, but we did not detect any labeled
product when an opposite strand hsp70.3-specific primer of equivalent T was used instead, thus verifying that, under
these conditions, the hsp70.1 footprinting primer 2 does not recognize
the hsp70.3 gene.
Amplification, Cloning, and Sequencing of the hsp70.1
Promoter RegionGenomic DNA (100 µg) isolated from MEL,
CH27, and MPC-11 cells was amplified with the primer
5`GCTCGCTCTGCTTCTCTTGTCTTCGC3`, which overlaps footprinting primer 1,
and 5`CTCCCCCTCAGGAATCCGTACTCTCT3`, derived from sequences upstream of
the distal HSE of the hsp70.1 promoter. Polymerase chain reaction
conditions were 40 cycles of 94 °C, 1 min, 64 °C, 1 min, and 72
°C, 1 min. Each of the DNAs yielded the expected 310-bp amplimer,
which was cloned into the pCRII vector (Invitrogen). Several clones
derived from each of the cell lines were subjected to dideoxy
sequencing.
Southern Blot AnalysisOne hundred µg of
genomic DNA, isolated as for genomic footprinting, was incubated with 5
units/µg of BglII (BRL) for at least 4 h, followed by a
second incubation with an additional 2-5 units/µg of enzyme.
To specifically analyze hsp70.1 gene methylation, the digests were
electrophoresed on 0.8% Seaplaque (FMC) agarose gels, and DNA fragments
which comigrated with an 1135-bp molecular size marker (from AatII-digested -DNA) were recovered by melting, phenol
extraction, and ethanol precipitation. This DNA was then subjected to
further digestion with MspI (New England Biolabs), its
methylation-sensitive isoschizomer HpaII (BRL), or HhaI (New England Biolabs), again utilizing two applications
of restriction endonuclease to ensure complete digestion. In some
experiments, completeness of digestion was checked further by adding 2
ng of the 2.25-kb BamHI fragment of pMSGCAT (Pharmacia Biotech
Inc.) to an aliquot of the digestion mixture and using Southern blot
analysis to determine that this plasmid fragment was digested to
completion. Following electrophoresis of the digested genomic DNA on
1.2% agarose gels, DNA was transferred to Zeta-Probe GT membranes
(Bio-Rad) and hybridized with a P-labeled probe prepared
by random-primed labeling (Life Technologies, Inc.) of a 1.2-kb
fragment of the hsp70.1 gene, using protocols recommended by the
manufacturers. Bands were visualized by autoradiography.
Transfection and CAT AssayThe plasmids RSVCAT or
pHBCAT (28) were introduced into MEL cells by
liposome-mediated transfection using Lipofectin (Life Technologies,
Inc.). The DNA-liposome complex was incubated with 2.5 10 cells overnight in Opti-Mem (Life Technologies, Inc.), and the
transfection was stopped by addition of an equal volume of DME, 30%
FBS. Eight hours later, cells were pelleted, resuspended in DME, 15%
FBS, and aliquoted into two dishes. The next morning, one dish was
heat-shocked for 30 min at 42 °C, and, 8 h later, unstressed and
heat-shocked cells were harvested for CAT assays. CAT assays were
performed as described previously(29) , and results were
quantitated with a Fuji PhosphorImager.
RESULTS
Transcriptional Silencing of One or Both hsp70 Genes Is
Widespread in Mouse Cell LinesSequences from the 3`-UTRs of the
mouse hsp70.1 and hsp70.3 genes were cloned and used as gene-specific
probes in transcription run-on assays of primary mouse embryo cells,
three cell lines which had previously been shown to exhibit no hsp70
response to heat shock, and five additional, randomly chosen mouse cell
lines present in our laboratory or obtained from colleagues. The eight
cell lines fell into three categories with respect to the
transcriptional response of the hsp70 genes to heat shock. Only F9
cells showed a pronounced heat shock inducibility of both hsp70 genes,
similar to that seen in primary mouse embryo cells ( Fig. 1and Table 1). In all three of the previously studied cell lines, MEL,
MPC-11, and PCC4, and in the B-cell lymphoma line CH27, neither hsp70
gene showed a transcriptional response to heat shock. NIH3T3 cells, the
mouse hybridoma line LK35.2, and the lymphocytic leukemia line L1210
exhibited an intermediate phenotype: the hsp70.3 gene was weakly or not
at all heat shock-responsive, while the hsp70.1 gene consistently
exhibited a heat shock response, although in LK35.2 and especially in
L1210 cells, this response was reproducibly weaker than in mouse embryo
cells ( Fig. 1and Table 1). Transcriptional repression of
one or both hsp70 genes is therefore very widespread in mouse cell
lines.
Figure 1:
Transcriptional
response to heat shock of the hsp70.1 and hsp70.3 genes in mouse cell
lines and primary mouse embryo fibroblasts (MEF). Transcription rates
of the hsp70.1, hsp70.3, hsp86, and glyceraldehyde-3-phosphate
dehydrogenase genes were measured by run-on assays in nuclei isolated
from unstressed (37 °C) and heat-shocked (43 °C, 40 min) cells.
To adjust for differences in overall levels of transcription between
cell lines, equivalent amounts of labeled transcripts from the
unstressed cells were taken for hybridization to the immobilized
probes; within each cell line, transcripts corresponding to equal
numbers of nuclei from unstressed and heat-shocked cells were used.
Hybridization of transcripts to the plasmid pBR322 is indicated in the
row labeled vector.
The Deficit in Heat Shock Responsiveness Resides in the
Endogenous hsp70 GenesWith the exception of L1210 cells,
transcription of another heat shock gene, hsp86, was induced by thermal
stress in all of the cell lines in which one or both hsp70 genes was
heat shock unresponsive (Fig. 1), suggesting that the overall
heat shock pathway is intact in these cells. This premise was further
supported by the results of gel retardation assays for HSF activation.
Using an HSE oligonucleotide derived from the mouse hsp70 promoter, an
HSE HSF complex was detectable after heat shock in all of the cell
lines examined (Fig. 2A). Our laboratory has previously
reported that heat-shocked F9 and PCC4 cells contain equivalent amounts
of HSE DNA binding activity and that this activity consists solely of
HSF1(30) . Antibody perturbation experiments carried out in
this study demonstrated that the HSE binding activity in heat-shocked
MEL, CH27, L1210, and MPC-11 cells also consists solely of HSF1, since
it was recognized by HSF1 antisera but not by HSF2 antisera (Fig. 2B, not shown).
Figure 2:
Analysis of HSE binding activity in mouse
cell lines after heat shock. A, gel retardation assay using an
HSE oligomer derived from the mouse hsp70.1 promoter and whole cell
extracts from unstressed (37 °C) and heat-shocked (43 °C, 40
min) cells. HSF denotes specific HSE HSF complexes; NS denotes a nonspecific complex, i.e. not competed
by excess unlabeled oligonucleotide. B, antibody recognition
of HSF in HSF HSE complexes. Whole cell extracts from heat-shocked
cells were preincubated with the indicated dilutions of antiserum
specific for mouse HSF1 ( HSF1) or mouse HSF2 ( HSF2) prior to gel shift analysis as in A.
While the levels of HSE
binding activity in heat-shocked cells varied considerably among the
cell lines (Fig. 2A), there was no correlation between
these levels and the presence or absence of an hsp70 heat shock
response. For example, MEL cells contain high levels of HSE binding
activity after heat shock yet fail to transcribe either hsp70 gene,
suggesting, as did our previous findings of similar levels of HSF1 DNA
binding activity in heat-shocked PCC4 and F9 cells, that the deficit is
unrelated to HSF1 levels. Furthermore, there were no cell line-specific
differences in the mobilities of the HSE HSF complexes which might
suggest alterations in HSF1 itself or in its oligomeric state. Another prediction of the tenet that the heat shock response
machinery functions normally in cell lines with a deficient hsp70
response is that a transfected heat shock promoter should be
activatable by heat shock in these lines. Previous studies where
HSE-containing promoters were introduced into such cell lines
transiently or permanently have yielded conflicting
results(11, 13, 14, 31) . In the
present study, a CAT reporter gene under the control of the human hsp70
promoter was introduced into MEL cells using liposome-mediated
transfection. Two HSEs are present in this promoter, the most proximal
of which has previously been shown to be required for stress
inducibility(32) . Two days post-transfection, the cells were
heat-shocked and then harvested for CAT assays. The results (Fig. 3) show a clear induction (6-13-fold) of promoter
activity in the heat-shocked cells. This was true at three levels of
introduced plasmid and was not seen when the cells were transfected
with RSVCAT. A similar result was obtained with L1210 cells (not
shown), suggesting that the heat shock response pathway is functional
in this line as well, despite the unresponsiveness to heat shock of the
hsp86 gene. These data, coupled with the results of the gel retardation
assays, suggest that a feature peculiar to the endogenous hsp70 genes,
rather than a deficiency in the overall heat shock response, is
responsible for their lack of heat shock responsiveness.
Figure 3:
CAT assay of MEL cells transfected with an
hsp70 promoter-CAT construct. MEL cells transfected with the indicated
constructs were maintained at 37 °C (control, C) or
heat-shocked (HS) at 42 °C for 40 min and allowed to
recover for 8 h prior to harvesting. Cell extracts were incubated with
[ C]chloramphenicol and acetyl-CoA, and the
acetylated products were separated by TLC.
The Common Basis for the Lack of Heat Shock
Responsiveness Is the Failure of HSF1 to Bind to the hsp70.1
PromoterGenomic footprinting studies of the human hsp70
promoter have shown dramatic changes in the regions corresponding to
the HSEs during heat shock, suggesting interaction of a factor,
presumably HSF1, with this site (33) . This technique, which
detects the binding of regulatory factors to endogenous sequences
because bound factors alter the susceptibility of guanines within these
sequences to methylation by DMS, was used to examine the occupancy of
the HSEs in the murine hsp70.1 promoter during heat shock. A 200-nt
region of the coding strand of the proximal hsp70.1 promoter was
examined; this region contains two consensus HSEs, a proximal HSE
approximately 80 bp upstream of the TATA element and a more distal HSE
located 80 bp further upstream of the proximal HSE (Fig. 4A). Just downstream of each HSE is a GC box
(GGGCGG), a putative binding site for the transcription factor Sp1; the
most proximal of these GC boxes is part of a decanucleotide,
5`TGGGCGGGGC3`, which constitutes an especially good binding site for
Sp1(34) . A CCAAT box is located between the proximal HSE and
Sp1 sites.
Figure 4:
Genomic footprinting of the coding strand
of the mouse hsp70.1 promoter in cell lines and mouse embryo
fibroblasts before and after heat shock. A, schematic
representation of the proximal 200 bp of the mouse hsp70.1 promoter and
the sequence of the region shown in the autoradiogram (this region
starts just upstream of the TATA element). The sequences of the CCAAT,
HSE, and Sp1 sites are boldfaced and underlined. DMS
methylation patterns of the guanine residues in genomic DNA which was
isolated from heat-shocked (43 °C, 40 min) or unstressed (37
°C) MEF and F9 cells (B) or from L1210, CH27, MEL, NIH3T3,
and LK35.2 cells (C). N lanes show the pattern for
protein-free (naked) DNA which was DMS-treated in vitro. The
correspondence between bands and Gs in the proximal Sp1 and HSE sites
is shown adjacent to the autoradiogram in B. For the HSE, arrows indicate guanine residues which are protected from
methylation by DMS in heat-shocked cells as compared to unstressed
cells or naked DNA, and asterisks denote guanines which are
hypersensitive to methylation. For the Sp1 sites, where cell
line-specific differences in occupancy are seen both in the stressed
and unstressed states, the arrows and asterisks depict differences in sensitivities of guanines to DMS in DNA
isolated from either stressed or unstressed cells as compared to naked
DNA. The bracketed regions at the tops of the
autoradiograms correspond to the distal Sp1 and HSE sites, where
differences in methylation patterns can also be
seen.
For primary mouse embryo cells and for each cell line,
the methylation pattern in DNA isolated from heat-shocked cells was
compared to that in DNA isolated from unstressed cells as well as to
the pattern in protein-free (naked) genomic DNA which had been
methylated in vitro. Similar to their assignment with regard
to hsp70 heat shock responsiveness, primary mouse cells and the eight
cell lines could be grouped into the same three categories with respect
to their methylation patterns (Table 1). Only DNA from F9 cells
showed patterns similar to those in DNA isolated from primary mouse
cells (Fig. 4B). As has been previously reported for F9
cells(30) , the band patterns in regions corresponding to the
proximal and distal HSEs were identical in naked DNA and in DNA
isolated from unstressed cells, suggesting that no factor is bound to
these sequences in unstressed cells; however, the HSE band patterns in
DNA isolated from heat-shocked F9 and mouse embryo cells were
considerably different. In the proximal HSE, six guanine residues
protected from methylation during heat shock were flanked by two
guanines which were hypersensitive to methylation, while in the distal
HSE, protected and hypersensitive guanines were interspersed (Fig. 4B). The changes in the methylation pattern of
the mouse hsp70.1 promoter HSEs after heat shock in F9 and mouse embryo
cells were strikingly similar to those previously seen in the proximal
and distal HSEs of the human hsp70 promoter(33, 35) .
Such changes suggest the binding of a factor, presumably HSF1, to the
HSEs during heat shock. By contrast, the band patterns in these regions
were absolutely identical in naked DNA and in DNA isolated from both
unstressed and heat-shocked CH27 and MEL cells (Fig. 4C), suggesting that the HSEs are not occupied by
factors either prior to or during heat shock. The same result was
obtained with DNA isolated from unstressed and heat-shocked MPC-11 and
PCC4 cells (not shown). These results suggest a common basis for the
lack of heat shock responsiveness of the hsp70.1 gene in these four
cell lines, viz. HSF1, although activated, does not bind to
the hsp70.1 promoter during heat shock. In DNA isolated from L1210
cells, where the hsp70.1 gene shows a low level of heat shock
responsiveness, there were only subtle differences in the HSE
methylation pattern following heat shock (Fig. 4C). The
guanine residues at both boundaries of the proximal HSE were
hypersensitive to methylation after heat shock, although not nearly to
the extent seen in F9 and mouse embryo cells, and, of the intervening
guanines, only the most distal one showed any protection from
methylation. Similarly, in the distal HSE, the only definitive change
in the L1210 methylation pattern following heat shock was a minor
hypersensitivity in the middle NGAAN binding site (which in the distal
HSE is NGAGN). Thus, consistent with the weak transcriptional response
of the hsp70.1 gene in L1210 cells relative to F9 and mouse embryo
cells, occupancy of the HSEs during heat shock was much less apparent. Similar differences in methylation patterns were also seen in DNA
isolated from unstressed and heat-shocked NIH3T3 and LK35.2 cells,
which, like L1210 cells, show a defective transcriptional response of
one or both hsp70 genes (Table 1). Following heat shock, a
hypersensitive guanine at the upstream boundary of the proximal HSE was
readily apparent in both lines, although in both lines, the guanine at
the downstream boundary of the proximal HSE was only slightly
hypersensitive (Fig. 4C). Several intervening guanines
were protected after heat shock in NIH3T3 DNA, while in LK35.2 DNA,
only slight protection of the most distal guanine could be seen. The
minor hypersensitivity in the distal HSE which is seen in heat-shocked
L1210 cells is also seen in heat-shocked NIH3T3 and LK35.2 cells. Thus,
as in L1210 cells, the differences in the NIH3T3 and LK35.2 methylation
patterns before and after heat shock were considerably more subtle than
those seen in F9 and mouse embryo cells, but they were seen at the same
guanine residues and in replicate experiments, validating their
authenticity. Although stronger than in L1210 cells, the hsp70.1
transcriptional response to heat shock in LK35.2 cells is reproducibly
lower than in F9 and mouse embryo cells (Table 1), consistent
with the observed reduction in HSE occupancy. However, NIH3T3 cells
consistently show a very robust hsp70.1 response to heat shock. It is
thus quite surprising that occupancy of the HSEs of the hsp70.1
promoter in this cell line is clearly (and reproducibly) submaximal.
One possibility is that NIH3T3 cells have a higher hsp70.1 gene copy
number than the other cell lines, which would counterbalance the
reduced HSF1 binding and allow retention of a robust transcriptional
response; this and other possible explanations are detailed further
under ``Discussion.''
Occupancy of Sp1 Sites in the hsp70.1 Promoter prior to
or during Heat Shock Correlates with HSF1 Occupancy during Heat
ShockSignificantly, mouse embryo cells and the eight murine
cell lines could be grouped into the same three categories with regard
to occupancy of the Sp1 sites in the hsp70.1 promoter (Table 1).
In unstressed F9 and mouse embryo cells, one guanine in the proximal
Sp1 site was extremely hypersensitive to methylation (compared to the
same residue in naked DNA), while five flanking guanines were strongly
protected from methylation (Fig. 4B). (Heat shock did
not affect Sp1 occupancy, in agreement with previous footprinting data
from the human hsp70 promoter(33) .) A hypersensitive guanine
in the proximal Sp1 site could also be seen in DNA isolated from L1210,
NIH3T3, and LK35.2 cells, although the hypersensitivity was not nearly
as striking as in F9 cells (Fig. 4C). Of the five
guanines which were clearly protected from DMS in F9 cells and MEFs,
only the most distal was protected in NIH3T3 cells, and no protected
guanines in the proximal Sp1 site were visible in the L1210 and LK35.2
DNA. The band pattern in the proximal Sp1 site in DNA from CH27 and MEL
cells was identical with that in naked DNA, however, suggesting that
this site was unoccupied in these cells (Fig. 4C).
Likewise, no occupancy of the proximal Sp1 site of the hsp70.1 promoter
was seen in MPC-11 or PCC4 cells, the other two lines in which no
occupancy of the HSEs was seen after heat shock (not shown). The same
cell line-specific differences in occupancy were seen at the distal
GGGCGG hexanucleotide. One of the downstream guanines was very
hypersensitive to methylation in mouse embryo and F9 cells, less so in
L1210, LK35.2, and NIH3T3 cells, and not at all in CH27, MPC-11, MEL,
and PCC4 cells (Fig. 4, B and C, not shown).
Thus, in those lines where HSF1 does not bind or binds submaximally to
the hsp70 promoter during heat shock, the binding of at least one
additional transcription factor, Sp1, is similarly diminished; this is
apparent both prior to and during heat shock. Gel retardation assays
using an oligomer corresponding to the proximal Sp1 site revealed no
significant differences in the levels of Sp1 binding activity in the
various cell lines (not shown), eliminating this as a possible reason
for the differences in Sp1 site occupancy. Our results thus suggest
that the differences among cell lines in HSF1 binding to the hsp70.1
promoter during heat shock reflect differences in overall promoter
accessibility. (It is also noteworthy that these differences in
promoter accessibility do not affect basal hsp70.1 transcription, which
is undetectable in primary mouse embryo cells (not shown) and in all of
the cell lines.)
Sequencing of the Proximal Region of the hsp70.1
PromoterAlthough genomic footprinting of the hsp70.1 promoter
in all of the cell lines showed the expected G ladder, the possibility
remained that other bases in this region were mutated in the cell lines
which contained heat shock unresponsive hsp70.1 genes and that such
mutations might account for the diminished binding of factors to the
promoter. To rule this out, PCR was used to amplify a region of 310 bp
from MEL, CH27, and MPC-11 genomic DNA; the resulting amplimers were
cloned and several clones derived from each cell line were sequenced.
These amplimers included the entire region of the hsp70.1 promoter
examined by genomic footprinting. Within this region, no deviations
from the published sequence were seen in any of the clones (not shown),
thus ruling out mutations in the proximal promoter as the reason for
the lack of factor binding.
Methylation of CpG Sites in the hsp70.1 Promoter
Correlates with Reduced Accessibility to Transcription
FactorsOur results indicate that in seven of the eight mouse
lines we examined, the hsp70.1 promoter has undergone a loss of
accessibility. CpG methylation is commonly associated with promoter
inaccessibility; studies of both X-linked and autosomal genes
in cultured cells have demonstrated that the promoters are free of CpG
methylation when the gene is transcriptionally active, while assembly
into an inaccessible conformation and transcriptional silencing is
accompanied by promoter
methylation(36, 37, 38) . To determine the
methylation status of the hsp70.1 promoter region in the cells analyzed
by genomic footprinting, a 1.16-kb (hereafter referred to as 1.2 kb) BglII fragment which encompasses 0.57 kb of promoter sequences
and 0.59 kb of transcribed sequences was analyzed, using the
methylation-sensitive restriction enzymes HpaII and HhaI and the methylation-insensitive isoschizomer of HpaII, MspI. There are 15 HpaII/MspI and HhaI sites in this BglII fragment (Fig. 5A), which is CpG-rich,
especially the transcribed sequences, and meets the established
criteria for a CpG island(39) .
Figure 5:
Methylation status of MspI/HpaII and HhaI sites in the region
flanking the transcription start site of the hsp70.1 gene. A,
map of the 1.2-kb region, flanked by BglII sites, examined by
Southern blot analysis. The hatched region of the box
corresponds to the 5`-UTR. Locations of HhaI and MspI/HpaII sites are indicated. B, genomic
DNA from each of the cell lines was digested with BglII, and
DNA comigrating with a 1.2-kb molecular weight marker was isolated from
gel slices. The recovered DNA was digested with MspI (B), HpaII (C), or HhaI (D) and subjected to Southern blot analysis. A random-primed P-labeled 1.2-kb BglII fragment was used as a
probe. The cloned 1.2-kb fragment (p70/1.2), intact or digested as
indicated, was run along with the genomic DNAs to indicate fragments
expected from completely unmethylated DNA. HinfI-digested SV40
DNA was used as size markers.
When genomic DNA was cut
with BglII alone and analyzed by Southern blotting, the
expected 1.2-kb band was seen in all of the DNAs; an additional,
strongly hybridizing 3.0-kb band, corresponding to the hsp70.3 gene,
was also seen. To specifically examine methylation of the hsp70.1 gene,
we size-fractionated the BglII-cut DNA on an agarose gel,
isolated the DNA fragments which were approximately 1.2 kb in size, and
confirmed recovery of the hsp70.1 BglII fragment by Southern
blotting. This DNA was then further digested with HpaII, MspI, or HhaI. A cloned hsp70.1 BglII 1.2-kb
fragment, free of CpG methylation, was also digested with the same
three enzymes. When cut with the methylation-insensitive restriction
enzyme MspI, all of the DNAs except NIH3T3 yielded the
expected fragments, 220, 380, and 500 bp in size, which comigrated with
the products of digestion of the cloned BglII fragment (Fig. 5B). In the case of NIH3T3 DNA, only the 500-bp
fragment and one additional, slightly larger fragment were seen; this
pattern suggests that in NIH3T3 cells, the MspI/HpaII
site in the 5`-UTR of the hsp70.1 gene (Fig. 5A) is not
present. When digested with HpaII, the
methylation-sensitive isoschizomer of MspI, F9 and MEF DNA
yielded products identical with those obtained from MspI
digestion (Fig. 5C), suggesting that the MspI/HpaII sites are completely unmethylated,
although this cannot be determined with certainty for the two closely
spaced sites just 10 and 20 bp upstream of the BglII site in
the coding region. F9 and mouse embryo cells showed the greatest
accessibility of the hsp70.1 promoter to Sp1 and HSF1. In contrast, the
hsp70.1 BglII fragment was almost completely refractory to HpaII digestion in DNA from all four cell lines which showed a
total lack of accessibility to factors by footprinting analysis (Fig. 5C). This suggests that all five MspI/HpaII sites are methylated, with the same caveat
as above. Finally, partial digestion by HpaII of the hsp70.1 BglII fragment was evident in DNA from LK35.2 and L1210 cells,
two lines where the footprinting analysis showed some, but not full,
promoter accessibility. Neither the 380- nor the 220-bp fragments was
detected in these digests, suggesting that neither of these cell lines
contains an allele where the MspI/HpaII sites are
completely unmethylated. The retention of the intact 1.2-kb fragment in
the LK35.2 and L1210 digests indicates that each of these two cell
lines contains one allele with methylation at all five sites. The
NIH3T3 HpaII digest pattern was identical with that obtained
with MspI, however, suggesting no methylation of the four MspI/HpaII sites in the proximal promoter in this
cell line. Conclusions regarding methylation status were generally
supported by Southern blot analyses using HhaI, except for
NIH3T3 cells, where the HhaI digestion pattern suggested
partial methylation. There are many closely spaced HhaI sites
in the 1.2-kb region of the hsp70.1 gene, and, when the cloned BglII fragment is digested with HhaI, only three
bands, representing 480-, 175-, and 145-bp fragments, are detected (Fig. 5D). This same set of fragments is seen in HhaI digests of DNA from F9 and MEF cells, suggesting a
complete absence of CpG methylation at HhaI sites in this
1.2-kb region. In the lanes representing DNA from MEL, CH27, and PCC4
cells, no digestion of the 1.2-kb fragment by HhaI is
apparent, suggesting methylation of all of the HhaI sites,
while in the MPC-11 lane, roughly equivalent amounts of the undigested
1.2-kb fragment and a slightly smaller fragment are seen, suggesting
that in one hsp70.1 allele in this line, a single HhaI site
near one of the fragment ends may not be methylated. The 480-bp
fragment is seen in the NIH3T3, LK35.2, and L1210 digests; however, the
smaller fragments are not, and a fragment slightly larger than 480 bp
is also present in the NIH3T3 and LK35.2 lanes. The intact, undigested
1.2-kb BglII fragment is present in the LK35.2 and L1210 lanes
but not in the NIH3T3 lane, while the slightly smaller fragment which
was produced by HhaI digestion of MPC-11 DNA appears to be
present in both the NIH3T3 and LK35.2 lanes. These data suggest that in
LK35.2 and L1210 cells, one hsp70 allele is fully methylated at CpG
sites in this region and one is methylated at some sites, while there
is methylation at some HhaI sites in both alleles in NIH3T3
cells. The 1.2-kb region flanking the transcription start site of the
hsp70.1 gene is therefore hypermethylated in every cell line in which
promoter accessibility is diminished (Table 1). For all of the
cell lines, only a small set of predominant bands is seen after HpaII and HhaI digestion, suggesting that the cell
populations we examined are largely homogeneous with respect to hsp70
methylation patterns. Data supporting this suggestion were obtained for
the NIH3T3 population, where Southern blot analyses of DNA isolated
from six clonal isolates yielded fragment patterns identical with those
seen in DNA isolated from the parental population (not shown).
The hsp70.3 Gene Is Methylated in All Cell Lines
Exhibiting hsp70.1 Gene MethylationThe failure of the hsp70.3
gene to respond to heat shock in all cells except MEF and F9 suggested
that it too had undergone methylation. To examine this possibility,
unfractionated BglII digested DNA from each of the cell lines
was further digested with MspI or HpaII. When
digested with BglII, the hsp70.3 gene generates a fragment
approximately 3 kb in length (the two hsp70 sequences diverge upstream
of the distal HSE) which hybridizes with the hsp70.1 probe (Fig. 6A). Both the 1.2-kb and 3-kb fragments were
detected in a Southern blot of BglII cleaved DNA from all of
the cell lines (Fig. 6B). When digested further with MspI, both the 1.2- and 3-kb fragments disappear and are
replaced by a set of three bands identical in size with those generated
by digestion of the isolated 1.2-kb hsp70.1 fragment (Fig. 6C). This is the expected result: all of the
hsp70.1 MspI sites shown in Fig. 5A are
identically located in the hsp70.3 gene, and there is an MspI
site in hsp70.3 which is located upstream of the point of sequence
divergence, generating a 360-bp fragment which comigrates with the
hsp70.1-derived 380-bp fragment (Fig. 6A). When BglII-digested DNA is further digested with HpaII,
the same set of three bands is seen only in DNA from F9 and MEF cells,
and complete disappearance of the 1.2- and 3-kb fragments is seen only
in DNA from these cells. This result indicates that the hsp70.3 gene is
methylated, apparently quite extensively, in all of the remaining cell
lines.
Figure 6:
Methylation status of Msp/HpaII
sites in the region flanking the transcription start site of the
hsp70.3 gene. A, comparative maps of the hsp70.1 and hsp70.3
genes. Symbol usage is the same as in Fig. 5A. The
sequences of the two genes start to diverge upstream of the distal HSE,
and this is indicated by the dashed line in the hsp70.3 map.
The hsp70.3 gene lacks the BglII site which is 570 nucleotides
upstream of the start site in the hsp70.1 gene, although it retains the BglII site 590 nucleotides downstream of the transcription
start site. Southern blot analysis of genomic DNA from each cell line
digested with BglII only (B), with BglII and MspI (C), or with BglII and HpaII (D), using the probe described in Fig. 5. Size markers
are from AatII-digested -DNA. In C and D, BglII cut MEF DNA which had not been digested
further (MEF Bgl2) and the cloned 1.2-kb fragment (p70/1.2), digested
as indicated, were included. Degradation of the HpaII-cleaved
p70/1.2 was apparent in the blot shown in D. Size markers in C and D are SV40/HinfI
fragments.
DISCUSSION
Our results reveal a common basis for the lack of heat shock
responsiveness of the hsp70.1 gene in CH27, MEL, MPC-11, and PCC4
cells, viz. the promoter is inaccessible to HSF1 as well as to
other transcription factors. This lack of accessibility is associated
with extensive methylation of a 1.2-kb region surrounding the
transcription start site. While its exact role in gene silencing is not
clear, CpG hypermethylation is a hallmark of mammalian genes which have
assumed an inaccessible and transcriptionally inert state. First shown
for X-linked genes(40) , this as well as previous
studies (36) document the association of methylation and
promoter inaccessibility for autosomal genes as well. We detect no
deficits in the overall heat shock pathway in these four mouse cell
lines: HSF1 is activated normally by heat shock and is able to
stimulate the transcription of another heat shock gene, hsp86.
Furthermore, an HSE-containing promoter introduced by transfection into
MEL cells is heat shock-responsive. Previous studies of Drosophila heat shock genes have established that, despite
being present in a highly condensed region of the chromosome, the
regulatory regions of these genes are maintained in a
nuclease-sensitive, accessible conformation prior to heat shock, such
that the TATA element is occupied and RNA polymerase is already bound (41, 42, 43) . In Drosophila, the
binding of the GAGA factor plays a major role in establishing and
maintaining this open conformation(44) . One could speculate
that the transcription factor Sp1 serves a role in mammalian heat shock
genes analogous to the GAGA factor in Drosophila heat shock
genes, since, as exemplified by the murine hsp70 promoter, Sp1 sites
are commonly found in proximity to HSEs in mammalian heat shock genes.
Methylation of the CpG dinucleotide in the Sp1 binding site could
therefore potentially prevent Sp1 binding and the establishment of an
accessible state. However, at least in vitro, Sp1 binding to
its recognition site is not appreciably affected by CpG
methylation(45, 46) . Although we do not know what
changes in chromatin structure have rendered the murine hsp70.1
promoter inaccessible to transcription factors, it is quite possible
that changes in nucleosomal packaging or positioning have occurred.
Relevant to this possibility, there are two previous in vitro studies demonstrating that HSF is unable to bind to an
HSE-containing template after it has been packaged into
nucleosomes(47, 48) . On the other hand, Sp1 was
demonstrated to bind in vitro (although with greatly reduced
affinity) to GC boxes which had been reconstituted into nucleosome
cores(49) , and, at least in yeast, HSF was shown to bind in vivo to a plasmid in which an HSE is packaged into
nucleosomes(50) . Based on this set of results, it is hard to
predict the extent to which the inclusion into nucleosomes of their
recognition sites would hinder the binding of Sp1 and/or HSF1 to the
hsp70.1 promoter. Furthermore, packaging into nucleosomes is considered
to represent only the first step in chromatin condensation; in cell
lines where hsp70 fails to respond to heat shock, the hsp70 gene may be
present in a highly condensed heterochromatin-like structure. Ours
is only the second reported study in which the methylation status and
accessibility to transcription factors of a particular gene have been
evaluated in a set of cell lines which show differential expression of
that gene. As in the previous study, which focused on the human
6-O-methylguanine DNA methyltransferase gene(51) , the
relationship between gene expression and accessibility as determined by
genomic footprinting was good but not perfect. In the previous study,
no transcription factor binding to the 6-O-methylguanine DNA
methyltransferase promoter could be detected in cells where the gene
was silent, but this was also true for a cell line with reduced but
detectable 6-O-methylguanine DNA methyltransferase expression.
Three of the lines which we examined in our study exhibited a
submaximal and roughly equivalent state of accessibility to
transcription factors, yet the transcriptional response to heat shock
ranged from quite robust (NIH3T3) to very weak (L1210). There are at
least two possible explanations for the disparity. In genomic
footprinting analysis, one is visualizing an average of the
interactions which are occurring at both, or in the case of gene
amplification or polyploidy, all of the alleles in the cell. NIH3T3
cells, for example, may contain one allele which, despite some CpG
methylation, is fully accessible to HSF1 and can generate a full
transcriptional response. A second consideration is that the mechanism
by which HSF1, once bound to the promoter, is able to stimulate
transcription of heat shock genes is still unknown; the range of
transcriptional responses in the three cell lines may reflect differing
levels or activities of a coactivator through which HSF1, although
weakly bound in all three cases, contacts the basal transcription
complex. Although methylation-associated transcriptional repression
of genes in cultured cells is a frequent and well-documented
phenomenon(52) , this is the first reported case involving the
hsp70 genes, and the first reported instance of concomitant methylation
of duplicated genes. The observation that methylation commonly or
perhaps, invariably, affects both of the tandem hsp70 genes assumes
greater significance in view of the location of these genes in the
class III region of the MHC. This region is very gene dense and (C
+ G)-rich, with an estimated 40 expressed genes occupying
approximately 1000 kb. Although the function of most of these genes is
not known, many of these genes contain CpG islands(53) . Such
islands are also found in the MHC class I H-2D/L genes, which encode
proteins vital for the presentation of non-self-antigens to cytotoxic T
lymphocytes and which lie just telomeric to the class III
region(54) . These class I genes have also been shown to be
susceptible to methylation-associated transcriptional
repression(55, 56) . The high density of CpG
island-containing genes in the MHC region, and the demonstration in
this and previous reports that genes in this region are susceptible to
methylation, raises the possibility that the MHC region constitutes a
``hot spot'' for aberrant hypermethylation. In light of
previous studies demonstrating that inactive chromatin can spread from
an initial focus of methylation (57, 58) , it is also
possible that a block of DNA encompassing many MHC region genes may
become incorporated into an inaccessible structure as a unit. Interestingly, although dimunition or loss of hsp70 heat shock
responsiveness has been observed frequently in mouse cell lines, there
is only one report so far of a similar phenomenon in human cell lines, viz., the Y79 retinoblastoma line, where the loss of stress
responsiveness was also associated with a lack of promoter occupancy (59) . Unlike rodent cell lines, there is at least some, and
frequently robust, basal expression of the hsp70 gene(s) in most human
cell lines, and loss of this basal expression may be disadvantageous
for human cells. The mechanism and kinetics of the process by which
endogenous genes or a region encompassing several genes acquire a new
methylation pattern are not understood, nor is the relationship between
this altered methylation pattern and losses in accessibility to
regulatory proteins, which result in transcriptional repression.
Because they are intronless, facilitating analyses of their methylation
patterns, duplicated, allowing changes in methylation status and
consequent effects on promoter accessibility to be tracked on adjacent
and highly homologous genes, and are located in a very well
characterized region of the genome, the hsp70 genes may be well-suited
to further studies of these issues. The clinical relevance of such
studies is underscored by several recent reports implicating
methylation-associated silencing of specific genes in the genesis and
progression of tumors(60, 61, 62) .
FOOTNOTES
- *
- This study was supported by Grants 93-23 and 94-19
from the Illinois Division of the American Cancer Society. The costs of
publication of this article were defrayed in part by the payment of
page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- Present address: Diagnostics Division, Abbott
Laboratories, Abbott Park, IL 60064.
- ¶
- Present
address: Dept. of Pediatric Infectious Disease, Loyola University
Medical Center, Maywood, IL 60153.
- **
- To whom
correspondence should be addressed: Dept. of Obstetrics &
Gynecology, Northwestern University Medical School, Tarry 4-755, 303 E.
Chicago Ave., Chicago, IL 60611. Tel.: 312-503-7883; Fax: 312-908-8773.
- (
) - The abbreviations used are: HSF, heat shock
transcription factor; HSE, heat shock element; MHC, major
histocompatibility complex; UTR, untranslated region; kb, kilobase(s);
bp, base pair(s); DME, Dulbecco's modified Eagle's medium;
FBS, fetal bovine serum; DMS, dimethyl sulfate; CAT, chloramphenicol
acetyltransferase.
ACKNOWLEDGEMENTS
We thank Klara Abravaya, Paul Kroeger, Robin Anderson,
and Sean Davidson for critical reviews of the manuscript.
REFERENCES
- Jakobsen, B. K., and Pelham, H. R. B. (1988) Mol. Cell. Biol. 8, 5040-5042
[Abstract/Free Full Text]
- Baler, R., Dahl, G., and Voellmy, R. (1993) Mol. Cell. Biol. 13, 2486-2496
[Abstract/Free Full Text]
- Kingston, R. E., Schuetz, T. J., and Larin, Z. (1987) Mol. Cell. Biol. 7, 1530-1534
[Abstract/Free Full Text]
- Morimoto, R. I. (1993) Science 259, 1409-1410
[Free Full Text]
- Morimoto, R. I., Sarge, K. D., and Abravaya, K. (1992) J. Biol. Chem. 267, 21987-21990
[Abstract/Free Full Text]
- Westwood, J. T., Clos, J., and Wu, C. (1991) Nature 353, 822-827
[CrossRef][Medline]
[Order article via Infotrieve]
- Amin, J., Ananthan, J., and Voellmy, R. (1988) Mol. Cell. Biol. 8, 3761-3769
[Abstract/Free Full Text]
- Xiao, H., and Lis, J. T. (1988) Science 239, 1139-1142
[Abstract/Free Full Text]
- Sarge, K. D., Zimarino, V., Holm, K., Wu, C., and Morimoto, R. I. (1991) Genes & Dev. 5, 1902-1911
- Sarge, K. D., Murphy, S. P., and Morimoto, R. I. (1993) Mol. Cell. Biol. 13, 1392-1407
[Abstract/Free Full Text]
- Aujame, L. (1987) Biochem. Cell Biol. 66, 691-701
- Aujame, L., and Morgan, C. (1985) Mol. Cell. Biol. 5, 1780-1783
[Abstract/Free Full Text]
- Mezger, V., Bensaude, O., and Morange, M. (1987) Dev. Biol. 124, 544-550
[CrossRef][Medline]
[Order article via Infotrieve]
- Pirity, M., Nguyen, V. T., Dubois, M. F., Bensaude, O., and Hever-Szabo, A. (1993) Eur. J. Biochem. 210, 793-800
[Medline]
[Order article via Infotrieve]
- Davidson, S., Høj, P., Gabriele, T., and Anderson, R. L. (1995) Mol. Cell. Biol. 15, 1071-1078
[Abstract]
- Milner, C. M., and Campbell, R. D. (1990) Immunogenetics 32, 242-251
[Medline]
[Order article via Infotrieve]
- Sargent, C. A., Dunham, I., Trowsdale, J., and Campbell, R. D. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 1968-1972
[Abstract/Free Full Text]
- Hunt, C., and Calderwood, S. (1990) Gene (Amst.) 87, 199-204
[CrossRef][Medline]
[Order article via Infotrieve]
- Perry, M. D., Aujame, L., Shtang, S., and Moran, L. A. (1994) Gene (Amst.) 146, 273-278
[CrossRef][Medline]
[Order article via Infotrieve]
- Snoek, M., Janssen, M., Olavesen, M. G., Duncan Campbell, R., Teuscher, C., and van Vugt, H. (1993) Genomics 15, 350-356
[CrossRef][Medline]
[Order article via Infotrieve]
- Murphy, S. P., Garbern, J., Odenwald, W., Lazzarini, R., and Linney, E. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 5587-5591
[Abstract/Free Full Text]
- Mosser, D. D., Theodorakis, N. G., and Morimoto, R. I. (1988) Mol. Cell. Biol. 8, 4736-4744
[Abstract/Free Full Text]
- Lowe, D. G., and Moran, R. L. (1986) J. Biol. Chem. 261, 2102-2112
[Abstract/Free Full Text]
- Hickey, E., Brandon, S. E., Smale, G., Lloyd, D., and Weber, L. A. (1989) Mol. Cell. Biol. 9, 2615-2626
[Abstract/Free Full Text]
- Fort, P., Marty, L., Piechaczyk, M., El Sabrouty, S., Dani, C., Jeanteur, P., and Blanchard, J. M. (1985) Nucleic Acids Res. 13, 1431-1442
[Abstract/Free Full Text]
- Becker, P. B., and Schutz, G. (1988) Genomic Footprinting , pp. 1-19, Plenum Press, New York
- Mueller, P. R., and Wold, B. (1989) Science 246, 780-785
[Abstract/Free Full Text]
- Wu, B., Hunt, C., and Morimoto, R. (1985) Mol. Cell. Biol. 5, 330-341
[Abstract/Free Full Text]
- Gorman, C., Moffat, L. F., and Howard, B. H. (1982) Mol. Cell. Biol. 2, 1044-1051
[Abstract/Free Full Text]
- Murphy, S. P., Gorzowski, J. J., Sarge, K. D., and Phillips, B. (1994) Mol. Cell. Biol. 14, 5309-5317
[Abstract/Free Full Text]
- Hensold, J. O., Hunt, C. R., Calderwood, S. K., Housman, D. E., and Kingston, R. E. (1990) Mol. Cell. Biol. 10, 1600-1608
[Abstract/Free Full Text]
- Wu, B. J., Kingston, R. E., and Morimoto, R. I. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 629-633
[Abstract/Free Full Text]
- Abravaya, K., Phillips, B., and Morimoto, R. I. (1991) Mol. Cell. Biol. 11, 586-592
[Abstract/Free Full Text]
- Kadonaga, J. T., Jones, K. A., and Tjian, R. (1986) Trends Biochem. Sci. 11, 20-23
- Sistonen, L., Sarge, K. D., Phillips, B., Abravaya, K., and Morimoto, R. I. (1992) Mol. Cell. Biol. 12, 4104-4111
[Abstract/Free Full Text]
- Costello, J. F., Futscher, B. W., Kroes, R. A., and Pieper, R. O. (1994) Mol. Cell. Biol. 14, 6515-6521
[Abstract/Free Full Text]
- Hornstra, I. K., and Yang, T. P. (1994) Mol. Cell. Biol. 14, 1419-1430
[Abstract/Free Full Text]
- Pfeifer, G. P., Tanguay, R. L., Steigerwald, S. D., and Riggs, A. D. (1990) Genes & Dev. 4, 1277-1287
- Gardiner-Garden, M., and Frommer, M. (1987) J. Mol. Biol. 196, 261-282
[CrossRef][Medline]
[Order article via Infotrieve]
- Hansen, R. S., Ellis, N. A., and Gartler, S. M. (1988) Mol. Cell. Biol. 8, 4692-4699
[Abstract/Free Full Text]
- Rougvie, A. E., and Lis, J. T. (1988) Cell 54, 795-804
[CrossRef][Medline]
[Order article via Infotrieve]
- Wu, C. (1980) Nature 286, 854-860
[CrossRef][Medline]
[Order article via Infotrieve]
- Wu, C. (1984) Nature 309, 229-234
[CrossRef][Medline]
[Order article via Infotrieve]
- Lu, Q., Wallrath, L. L., Granok, H., and Elgin, S. C. R. (1993) Mol. Cell. Biol. 13, 2802-2814
[Abstract/Free Full Text]
- Harrington, M. A., Jones, P. A., Imagawa, M., and Karin, M. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 2066-2070
[Abstract/Free Full Text]
- Höller, M., Westin, G., Jiricny, J., and Schaffner, W. (1988) Genes & Dev. 2, 1127-1135
- Becker, P. B., Rabindran, S. K., and Wu, C. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 4109-4113
[Abstract/Free Full Text]
- Taylor, I. C. A., Workman, J. L., Schuetz, T. J., and Kingston, R. E. (1991) Genes & Dev. 5, 1285-1298
- Li, B., Adams, C. C., and Workman, J. L. (1994) J. Biol. Chem. 269, 7756-7763
[Abstract/Free Full Text]
- Pederson, D. S., and Fidrych, T. (1994) Mol. Cell. Biol. 14, 189-199
[Abstract/Free Full Text]
- Costello, J. F., Futscher, B. W., Tano, K., Graunke, D. M., and Pieper, R. O. (1994) J. Biol. Chem. 269, 17228-17237
[Abstract/Free Full Text]
- Antequera, F., Boyes, J., and Bird, A. (1990) Cell 62, 503-514
[CrossRef][Medline]
[Order article via Infotrieve]
- Sargent, C. A., Dunham, I., and Campbell, R. D. (1989) EMBO J. 8, 2305-2312
[Medline]
[Order article via Infotrieve]
- Tykocinski, M. L., and Max, E. E. (1984) Nucleic Acids Res. 12, 4385-4395
[Abstract/Free Full Text]
- Bonal, F. J., Pareja, E., Martin, J., Romero, C., and Garrido, F. (1986) J. Immunogenet. 13, 179-186
[Medline]
[Order article via Infotrieve]
- Meruelo, D., Kornreich, R., Rossomando, A., Pampeno, C., Boral, A., Silver, J. L., Buxbaum, J., Weiss, E. H., Devlin, J. J., Mellor, A. L., Flavell, R. A., and Pellicer, A. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 4504-4508
[Abstract/Free Full Text]
- Kass, S. U., Goddard, J. P., and Adams, R. L. P. (1993) Mol. Cell. Biol. 13, 7372-7379
[Abstract/Free Full Text]
- Toth, M., Lichtenbery, U., and Doerfler, W. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 3728-3732
[Abstract/Free Full Text]
- Mathur, S. K., Sistonen, L., Brown, I. R., Murphy, S. P., Sarge, K. D., and Morimoto, R. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 8695-8699
[Abstract/Free Full Text]
- Herman, J. G., Latif, F., Weng, F., Lerman, M. I., Zbar, B., Liu, S., Samid, D., Duan, D. S. R., Gnarra, J. R., Linehan, W. M., and Baylin, S. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 9700-9704
[Abstract/Free Full Text]
- Lee, W.-H., Morton, R. A., Epstein, J. I., Brooks, J. D., Campbell, P. A., Bova, G. S., Hsieh, S., Isaacs, W. B., and Nelson, W. G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 11733-11737
[Abstract/Free Full Text]
- Zion, M., Ben-Yehuda, D., Avraham, A., Cohen, O., Wetzler, M., Melloul, D., and Ben-Neriah, Y. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 10722-10726
[Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
F. Sun, Q. Xie, J. Ma, S. Yang, Q. Chen, and A. Hong
Nuclear Factor Y Is Required for Basal Activation and Chromatin Accessibility of Fibroblast Growth Factor Receptor 2 Promoter in Osteoblast-like Cells
J. Biol. Chem.,
January 30, 2009;
284(5):
3136 - 3147.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-Y. Shen, J.-C. He, Y. Wang, Q.-Y. Huang, and J.-F. Chen
Geldanamycin Induces Heat Shock Protein 70 and Protects against MPTP-induced Dopaminergic Neurotoxicity in Mice
J. Biol. Chem.,
December 2, 2005;
280(48):
39962 - 39969.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. Yang, S. Liu, Y. Tian, C. Hasan, D. Kersey, H. R. Salwen, A. Chlenski, E. J. Perlman, and S. L. Cohn
Methylation-Associated Silencing of the Heat Shock Protein 47 Gene in Human Neuroblastoma
Cancer Res.,
July 1, 2004;
64(13):
4531 - 4538.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
R. Holtz, J. C. Choi, M. G. Petroff, J. F. Piskurich, and S. P. Murphy
Class II Transactivator (CIITA) Promoter Methylation Does Not Correlate with Silencing of CIITA Transcription in Trophoblasts
Biol Reprod,
September 1, 2003;
69(3):
915 - 924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Minuzzo, S. Marchini, M. Broggini, G. Faircloth, M. D'Incalci, and R. Mantovani
Interference of transcriptional activation by the antineoplastic drug ecteinascidin-743
PNAS,
June 6, 2000;
97(12):
6780 - 6784.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Nueda, F. Hudson, N. F. Mivechi, and W. S. Dynan
DNA-dependent Protein Kinase Protects against Heat-induced Apoptosis
J. Biol. Chem.,
May 21, 1999;
274(21):
14988 - 14996.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. H. Bednarek, B. J. Lee, S. Gandhi, E. Lee, and B. Phillips
Novel Binding Sites for Regulatory Factors in the Human Papillomavirus Type 18 Enhancer and Promoter Identified by In Vivo Footprinting
J. Virol.,
January 1, 1998;
72(1):
708 - 716.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Imbriano, F. Bolognese, A. Gurtner, G. Piaggio, and R. Mantovani
HSP-CBF Is an NF-Y-dependent Coactivator of the Heat Shock Promoters CCAAT Boxes
J. Biol. Chem.,
July 6, 2001;
276(28):
26332 - 26339.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Leppa, R. Kajanne, L. Arminen, and L. Sistonen
Differential Induction of Hsp70-encoding Genes in Human Hematopoietic Cells
J. Biol. Chem.,
August 17, 2001;
276(34):
31713 - 31719.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|