Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gill, S. S.
Right arrow Articles by Francis, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gill, S. S.
Right arrow Articles by Francis, V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 45, Issue of November 10, 1995 pp. 27277-27282
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Identification, Isolation, and Cloning of a Bacillus thuringiensis CryIAc Toxin-binding Protein from the Midgut of the Lepidopteran Insect Heliothis virescens(*)

(Received for publication, June 27, 1995; and in revised form, September 7, 1995)

Sarjeet S. Gill (1) (2) Elizabeth A. Cowles (1)(§) Vidyasagar Francis (1)(¶)

From the  (1)Department of Entomology and the (2)Environmental Toxicology Graduate Program, University of California, Riverside, California 92521

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Bacillus thuringiensis toxins are insecticidal to a variety of insect species. The selectivity of the toxins produced by these bacteria is dependent on both the toxin structure and the receptor sites that are present in different insect species. One of these toxins, CryIAc, is highly insecticidal to the noctuid pest Heliothis virescens. Using toxin overlay assay, a 120-kDa glycoprotein was identified as a toxin-binding protein. This protein was partially purified, its N-terminal sequence was determined, and the full-length cDNA encoding this protein was isolated from a H. virescens midgut library. The B. thuringiensis toxin-binding protein, BTBP(1), has high homology to aminopeptidase N from eukaryotes and prokaryotes.


INTRODUCTION

Bacillus thuringiensis, a Gram-positive bacterium, produces insecticidal parasporal inclusions during sporulation(1) . This insecticidal activity is dependent on a unique set of inclusion proteins or -endotoxins produced by these B. thuringiensis strains(2) . Most of these insecticidal proteins are usually produced as large protoxins, about 130 kDa, although smaller naturally truncated proteins are also observed. When ingested by susceptible insect larvae, the parasporal inclusions dissolve in the alkaline environment of insect midgut giving rise to soluble protoxins that are activated by midgut proteases(2, 3) . For example, the 130-kDa CryIAc protoxin is activated to a 65-kDa toxin in the midgut of lepidopteran Heliothis virescens and Manduca sexta larvae and is toxic to these insects.

These activated toxins then interact with the apical membranes of insect midgut columnar cells(4, 5) . Using preparations of columnar cell brush-border membrane vesicles (BBMV) (^1)previous studies have demonstrated that in susceptible insects, high affinity toxin binding sites are correlated with the insecticidal activity of B. thuringiensis toxins(6, 7) . Changes in toxin structure, even minor, that are associated with decreased toxin binding result in decreased insecticidal activity(8, 9, 10) .

To identify the precise toxin binding targets in insects, midgut cell membranes have been electrophoretically separated and probed with radiolabeled toxins in toxin overlay assays. Several CryIAc binding proteins ranging from 150 to 50 kDa were observed in H. virescens(11, 12, 13, 14) . We have identified the proteins involved in CryIAc toxicity to H. virescens using toxin overlay assays (15) . A 120-kDa B. thuringiensis toxin-binding protein, BTBP(1), from the midgut brush-border membrane that binds the CryIAc toxin was partially purified, and its N-terminal sequence was determined. A cDNA clone encoding this protein was isolated and characterized. The deduced amino acid sequence shows that the BTBP(1) belongs to the aminopeptidase N family of proteins.


MATERIALS AND METHODS

Toxin Isolation and Radiolabeling

Parasporal inclusions from B. thuringiensis sp. kurstaki strain HD-73 were isolated, the protoxin proteolytically was activated, and the 65-kDa activated toxin was purified on a fast protein liquid chromatography Superose 12 column (Pharmacia Biotech Inc.) as described previously(15) . Radioiodination was performed as described previously (15) giving specific activities of 100-200 Ci/mmol. The biological activity of the radiolabeled CryIAc toxin was comparable with that of the unlabeled toxin(15) .

Partial Purification of the CryIAc Binding Proteins

Freshly prepared H. virescens BBMV (15) were solubilized in 2% CHAPS (Boehringer Mannheim Biochemicals) in solubilization buffer (20 mM Tris, pH 7.5, 1 mM EDTA, 1 mM Mg(2)SO(4), 0.01% NaN(3), and 10% glycerol) containing protease inhibitors (1 mM phenylmethylsulfonyl fluoride, 1 µM aprotinin, 0.7 µM leupeptin, and 1 µM pepstatin). Following 1-h incubation at 4 °C, the mixture was centrifuged for 1 h at 100,000 times g. The supernatant was applied to a 1-ml fast protein liquid chromatography MonoQ column (Pharmacia). After washing with solubilization buffer the proteins were eluted with a 0 to 500 mM KCl linear gradient in solubilization buffer with 1% CHAPS. Fractions were assayed for toxin binding ability using a solid-phase binding assay(15) . Fractions eluting at 250 mM KCl that bound the CryIAc toxin were pooled and are called the Pool II fraction.

This Pool II toxin binding fraction was then applied to a Ricinis communis agglutinin (RCA) agarose column in 20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM MgSO(4), 1% CHAPS (w/v) containing protease inhibitors at 4 °C overnight, with gentle mixing. The preparation was then poured into a column, washed extensively, and eluted with 200 mM lactose in the appropriate buffer, and the eluted material was concentrated in a stirred cell using PM10 filters (Amicon).

Protein Determination and Enzyme Assays

Protein concentrations were determined using the detergent compatible protein assay kit (Bio-Rad) with bovine serum albumin as a standard. Alkaline phosphatase (16) and aminopeptidase activities were assayed as described previously(17) .

Gel Electrophoresis, Electroblotting, and Toxin Overlay Assay

Discontinuous buffer SDS-PAGE was performed in 10% polyacrylamide gels(18) . Separated proteins were transferred to Immobilon membranes (Millipore) using a Tris/glycine buffer as suggested by the manufacturer. After transfer, membranes were blocked in phosphate-buffered saline containing 3% bovine serum albumin. The membranes were then incubated in binding buffer (20 mM HEPES, pH 7.5, 150 mM NaCl, 0.1% bovine serum albumin, 0.1% Tween-20, and 0.01% NaN(3)) containing 1 nMI-CryIAc toxin with or without unlabeled competitor (500-fold) or N-acetylgalactosamine (200 mM) for 1 h at RT as described previously(15) . The blots were washed 4 times with binding buffer, dried, and analyzed by autoradiography.

N-terminal Sequence Analysis

To identify the N-terminal sequences, the 170-, 120-, and 105-kDa Mono Q-purified proteins in Pool II were separated by SDS-PAGE, transferred to an Immobilon membrane in 50 mM CAPS, 20% methanol, and 0.1% EDTA. The membrane was then washed, stained, and destained as described previously(19) . Individual bands were excised and subjected to N-terminal amino acid gas-phase sequencing at the Biotechnology Instrumentation Facility at the University of California, Riverside.

cDNA Library Construction

Size fractionated poly(A) RNA, >3 kilobases, obtained from the midguts of early fifth instar H. virescens larvae was used for the construction of a unidirectional cDNA using the Life Technologies, Inc. SuperScript Plasmid System kit and an oligo(dT) primer in a modified pCDM8 vector(20) . The library consisting of about 10^5 transformants was plated on 15 LB/Amp (100 µg/ml) plates. Plasmid preparations were made from these 15 library pools.

cDNA Library Screening

Briefly, the cDNA library was screened by initially performing PCR using plasmid DNA as template from each of the 15 library pools(21) . The primers used were degenerate primers H. virescens primers: HV1F, GACCCIGCITA(C/T)(A/C)GN(C/T)TNCCNAC, and HV1R, IGAIA(A/G)IGTIGGNA(A/G)NC(G/T)(A/G)TA; M. sexta primer, MS1F, GA(C/T)CCI(A/T)(G/C)NTA(C/T)(A/C)GN(C/T)TNCC; conserved aminopeptidase N primers: AMN1R, TC(A/G)TTIAGCCANA(A/G)(A/G)TC(A/G)TTCCACCA, AMN1F, GACTTCAA(C/T)GCIGGNGCNATGGA(A/G)AA), and AMN2R, CCGAACCA(C/T)TG(A/G)TGIGCNAG(C/T)TC(A/G)TG; vector primers: V1F, CGTG TACGGTGGGAGGTCTATATA, and V2F, TTAACTGGCTTATCGAAATTAATA. DNA from the plasmid pool showing the presence of the expected size product by PCR was then used for electroporation of E. coli DH10B cells. Transformed cells were used for additional screening by PCR as described previously(21) . Successive rounds of this protocol yielded two clones.

Dideoxy double-stranded sequencing of the cDNA insert was performed using Sequenase 2.0 as described by the manufacture (U. S. Biochemical).

In Vitro Transcription and Translation

In vitro transcription was performed with the cDNA clone linearized with NotI using the mMessage mMachine kit (Ambion) catalyzed by T7 polymerase. The cRNA was translated in a rabbit reticulocyte cell-free translation system (Promega, WI) using [S]methionine (Amersham, Corp.). The translated products were immunoprecipitated by the addition of anti-H. virescens BBMV antibody followed by Protein A-Sepharose (Sigma). The precipitates were washed extensively in buffer containing 150 mM NaCl, 10 mM Tris-HCl, pH 7.5, 2 mM EDTA, and 5% Nonidet P-40 followed by 3 washes in a similar buffer but containing 500 mM NaCl. The final pellets were resuspended in SDS-PAGE loading buffer and analyzed on 8% gels SDS-PAGE under reducing conditions and visualized by fluorography (DuPont NEN).


RESULTS

Purification of the CryIAc Binding Protein

We previously (15) identified a number of proteins in H. virescens midgut BBMV and CHAPS-solubilized BBMV that bind iodinated CryIAc toxin. An attempt was made to identify one of these toxin-binding proteins. CHAPS-solubilized BBMV, when separated on Mono Q anion-exchange chromatography, gave rise to three toxin-binding fractions(15) . One of these fractions, Pool II (Fig. 1, lane 4), from this Mono Q separation, eluting at 250 mM KCl, was then further separated using RCA chromatography. Combination of anion-exchange and lectin chromatography resulted in the purification of 120- and 105-kDa proteins (Fig. 1, lane 6). Minor amounts of a 170-kDa protein were also detected (lane 6). Purification using RCA chromatography demonstrates that these three proteins are all glycosylated.


Figure 1: Partial purification of the CryIAc binding protein from H. virescens midgut. Lane 1, BBMV; lane 2, CHAPS-solubilized BBMV; lanes 3 and 4, fractions I and II isolated from Mono Q column; lane 5, flow-through from RCA column; lane 6, RCA-bound fraction eluted with 0.2 M lactose. The gel is stained with Coomassie Blue, and each lane contains 10 µg of protein, except lane 6, which contains 2.5 µg of protein.



Toxin overlay assay (15) showed that the 120- and 105-kDa RCA-purified proteins bound iodinated CryIAc toxin (Fig. 2, lane 2) and that addition of excess unlabeled CryIAc toxin significantly decreased binding (Fig. 2, lane 3). Low level binding was also observed with a 140-kDa protein, but this binding was not as readily displaced with excess unlabeled CryIAc toxin. The 140-kDa protein is not visible in the SDS-polyacrylamide gel (Fig. 1, lane 6). The 170-kDa protein did not bind the CryIAc toxin. Similar results were obtained with Mono Q Pool II fractionated proteins, except the 170-kDa protein also bound the CryIAc toxin(15) .


Figure 2: Analysis of CryIAc toxin binding to RCA isolated fractions. Lane 1 contains 10 µg of RCA isolated fraction stained with Coomassie Blue. Lanes 2 and 3 are autoradiographs; lane 2 is probed with 1 nMI-CryIAc, and lane 3 is probed with 1 nMI-CryIAc and 500 nM cold CryIAc.



Analysis of enzyme activity in the various fractions during purification through the Mono Q anion-exchange chromatography shows that alkaline phosphatase and aminopeptidases are enriched in the BBMV, solubilized BBMV, and in Pool II (Table 1). The alkaline phosphatase activity was enriched about 17times from that found in crude homogenates, while the activities of leucine, lysine, and phenylalanine aminopeptidases were enriched 10, 14 and 9times, respectively. Leucine aminopeptidase, an enzyme used as a marker for insect BBMV(22) , had the highest specific activity in the Mono Q pooled fraction, Pool II.



N-terminal Sequencing and cDNA Isolation

N-terminal sequencing of the 170-, 120-, and 105-kDa proteins from Pool II (Fig. 1, lane 4) was performed. The N termini of the 170- and 120-kDa proteins are DPAYRLPTL and NV(V/A)ASPYRLPT, respectively (Table 2). The N-terminal sequence of the 120-kDa protein purified from the RCA column was identical to that of the 120-kDa protein from the Mono Q column. The N terminus of the 105-kDa protein from the pooled fraction was different. The 170- and 120-kDa protein N-terminal sequences were compared with that of the N-terminal sequence of M. sexta CryIAc toxin 120-kDa binding protein (Table 2) (23) and to known aminopeptidase N(24) , since it has previously been established that the CryIAc binding protein in M. sexta appears to be aminopeptidase N-like(23, 25) .



The sequence YRLPT was conserved in all three insect CryIAc toxin-binding proteins, and the sequence YRLP was conserved in all of the proteins compared (Table 2). Oligonucleotide primers, forward and reverse, were made ensuring the sequence YRLPT was present at the 3` end of the primers. When used in conjunction with a primer to conserved regions of aminopeptidase N (AMN2R) in PCR screening, both the M. sexta (MS1F) and H. virescens (HV1F) primers gave the same size product, 0.85 kilobase. Reamplification of these PCR products with AMN1F and AMN1R gave products of the expected size, 170 bp. Amplification of one of the fractionated libraries, number 3, using the primers V1F and AMN1R, followed by reamplification using V2F and HV1R, showed the presence of prominent bands between 220 and 300 bp, suggesting the presence of cDNA sequence upstream of the N-terminal sequences obtained. Electroporation of fraction 3 plasmid DNA into DH10B cells and successive rounds of PCR screening (21) resulted in the isolation of two clones. Nucleotide sequencing of these two clones showed that one clone contained a sequence that matched that of the 120-kDa protein. This clone had an insert of 3419 bp, with a 3027-bp open reading frame encoding a 1009-amino acid protein (Fig. 3). The putative translation start site at nucleotide 35 contains a consensus Kozak sequence, AAGATGG (26) . A polyadenylation sequence, AATAAA(27) , at nucleotide 3385 precedes the poly(A) tail, which is 337 bp downstream of the termination codon.


Figure 3: Deduced amino acid sequence of the CryIAc binding protein from H. virescens midgut. The oligonucleotide sequence of the entire 3471-bp cDNA was sequenced in both orientations. The hydrophobic N and C termini are underlined. The N terminus of the mature protein that was sequenced is underlined and in boldface. The putative N-glycosylation sites are double underlined. The putative metal binding sites are indicated by bullet, and the putative nucleophile is indicated by circle. The putative GPI-anchor signal sequence is indicated by a dotted underline. Two hydrohobic domains are observed. The first is at the N terminus, amino acids 1-19, and the second is at the C terminus between amino acids 933-1009.



The protein, BTBP(1), has a calculated molecular weight of 113,461 Da and a pI of 5.29. The N-terminal sequence obtained from protein sequencing is between amino acids 53 and 63 and indicates that the mature BTBP(1) isolated from H. virescens BBMV has 52 amino acids cleaved from the N terminus. Both the N and C termini are hydrophobic. Two potential N-glycosylation sites are observed at amino acid residues 581 and 906. A metal binding motif, HEXXH (28, 29) is observed at 374-378.

Role of Glycosylation in Toxin Binding and Immunoprecipitation with Antibodies

The CryIAc toxin has been shown to bind to carbohydrate moieties(11, 12, 13, 14) . Fig. 4shows CryIAc binding to RCA purified proteins (lane 1) and its displacement by the presence of 200 mMN-acetylgalactosamine (lane 2) confirming the role of carbohydrate moieties in toxin binding.


Figure 4: Autoradiograph of inhibition of CryIAc binding to RCA purified fraction by N-acetylgalactosamine. Lane 1, 10 µg of RCA-isolated fractions are probed with 1 nMI-CryIAc, and lane 2 is probed with 1 nMI-CryIAc in the presence of 200 mM GalNAC.



In vitro transcription and translation of BTBP(1) cDNA gives a protein of about 113 kDa (Fig. 5, lane 3). This size, as predicted from the deduced amino acid sequence, lends support to the putative start site. The in vitro translated CryIAc binding protein was immunoprecipitable with anti-H. virescens BBMV antibodies (Fig. 5, lane 4), but not with preimmune antibodies (lane 5). The smaller and weakly labeled products (lane 3) are derived either from incomplete transcription and translation or are proteolytically cleaved BTBP(1), since these products all are immunoprecipitable only by anti-BBMV antibodies (lane 4) and not by preimmune antibodies (lane 5). No products were obtained when only the vector was used for in vitro transcription and translation (Fig. 5, lanes 1 and 2). Immunolocalization studies show these antibodies react with the midgut brush-border membrane of H. virescens (data not shown), demonstrating that the cloned BTBP(1) is apparently localized to the brush-border membrane of H. virescens midgut. The in vitro translated BTBP(1) protein does not bind CryIAc toxin (data not shown) consistent with previous data showing the CryIAc toxin binding to carbohydrate moieties of this 120-kDa protein.


Figure 5: Autoradiograph of in vitro transcribed and translated CryIAc binding protein binding to antibodies to BBMV. The total or the products immunoprecipitated by rabbit anti-H. virescens BBMV antibodies were separated by SDS-PAGE and then subjected to autoradiography. Lane 1, in vitro transcribed and translated products of the plasmid vector minus the BTBP(1) cDNA labeled with [S]methionine. Lane 2, the product in lane 1 was immunoprecipitated with anti-BBMV antibodies. Lane 3, in vitro transcribed and translated products of the BTBP(1) cDNA labeled with [S]methionine. Lane 4, the product in lane 3 was immunoprecipitated with anti-BBMV antibodies. Lane 5, the product in lane 3 was immunoprecipitated with preimmune rabbit serum.




DISCUSSION

Protein purification, N-terminal sequencing, and characterization of the cDNA isolated identify the CryIAc toxin-binding protein from the midgut of H. virescens as an aminopeptidase N-like protein (Fig. 6). An aminopeptidase N from M. sexta, that also binds the CryIAc toxin, has recently been reported(30) . The H. virescens BTBP(1) has 42 and 62% identity and similarity, respectively, to the M. sexta protein. Comparison of these two sequences suggests the M. sexta CryIAc binding protein probably has an additional 10-25 amino acids upstream of the reported N-terminal sequence(30) . Similar levels of identity, although slightly lower, are observed with other eukaryote aminopeptidases N, zinc-dependent metalloproteases(28, 29) . For example, H. virescens BTBP(1) has 32 and 52% identity and similarity, respectively, to human aminopeptidase N.


Figure 6: Comparison of H. virescens BTBP(1) with known aminopeptidases. BTBP(1) sequence was compared with nucleotide sequences (Genbank, release 88.0) and with protein sequences (Swiss Protein, release 31.0). The greatest similarity is observed with zinc-dependent metalloproteases, which includes aminopeptidases N. Only some sequences are used for comparison and include human(24) , Caenorhabditis elegans(54) , mouse(51) , Saccharomyces(55) , and Lactobacilli(56) . The M. sexta sequence used was as published recently(30) .



The BTBP(1) N terminus is quite divergent from that of other aminopeptidases. The first 15 amino acids are highly hydrophobic (2.6) and probably contain an appropriate signal sequence that facilitates membrane targeting(31, 32) . However, unlike mammalian aminopeptidases, where the mature protein undergoes limited truncation at the N terminus(33) , the first 52 amino acid residues of H. virescens BTBP(1) are cleaved. This can be explained, in part, by the different membrane anchors used by H. virescens BTBP(1), and those used by aminopeptidase N in mammals. In the latter, aminopeptidase N is membrane-bound apparently by a hydrophobic N terminus(33) , and trypsin treatment results in cleavage of the membrane anchor, with the resulting soluble protein beginning at amino acid residue 40(33) . In insects, aminopeptidase N is apparently membrane bound at the C terminus. The soluble form of the insect leucine aminopeptidase is obtained by treatment with phosphatidylinositol-specific phospholipase C(34, 35) . Immunoprecipitation of BTBP(1) by BBMV-specific antibodies suggests that this protein is localized to the midgut cell brush border of H. virescens. Leucine aminopeptidase activity is often used as a marker for insect midgut columnar cell brush border(22, 36) .

Unlike the other aminopeptidases, the H. virescens BTBP(1) has a long hydrophobic C terminus. In two insect species, Bombyx mori and M. sexta, the midgut aminopeptidase N activity is membrane-linked via a glycosylphosphatidylinositol (GPI) anchor(34, 35) . The presence of a long hydrophobic C terminus preceded by hydrophilic residues suggests that the BTBP(1) is similarly linked by a GPI anchor. A putative sequence signaling the addition of GPI anchors(37) , DSA, is observed. The aspartic acid at 987 is a likely site for attachment of the GPI anchor, with cleavage of the hydrophobic tail between Asp and Ser. The presence of a GPI anchor in H. virescens, however, needs to be established, and alternative mechanisms of BTBP(1) membrane anchoring, however, cannot be excluded. N- and C-terminal proteolytic cleavage will result in a 105-kDa protein containing 935 amino acid residues. The BTBP(1) isolated from H. virescens midgut, however, is of 120 kDa, consequently the difference in the molecular masses of these two proteins results from carbohydrate or other posttranslational modifications. The M. sexta CryIAc binding protein similarly has a putative GPI signal sequence, a hydrophobic N terminus, and identical molecular masses for the processed and isolated proteins(30) .

The hydrophobic tail and the GPI-linked anchor could play a crucial role in insects resistant to B. thuringiensis toxins. Elevation of endogenous phosphatidylinositol-specific phospholipase C, or B. thuringiensis phosphatidylinositol-specific phospholipase C could result in decreased levels of membrane-bound BTBP(1) or aminopeptidase N causing increased tolerance and/or resistance to the CryIAc toxin. Alternatively down-regulation of BTBP(1) expression in insect midgut will result in the loss of toxin binding sites, and decreased CryIAc toxicity. However, H. virescens resistance to the CryIAc toxin does not appear to be correlated with decreased toxin binding(38) , and consequently alternative mechanisms of toxin resistance are likely. On the other hand, in Plutella xylostella and Plodia interpunctella, resistance to the CryIAb toxins is correlated with the availability of toxin binding sites(39, 40, 41) .

A CryIAb toxin-binding protein has recently been cloned and shown to be a cadherin-like 210-kDa membrane glycoprotein(42) . Unlike the CryIAb-binding protein, which apparently has an intracellular component, BTBP(1) is entirely extracellular and is probably GPI-anchored. Hence it is unlikely to directly participate in any intracellular changes that have been observed with B. thuringiensis intoxication(43) , although it could affect external mediators of signal transduction.

The precise mechanism of B. thuringiensis toxicity is not known. The generally accepted model is that following toxin binding to a receptor protein or macromolecule, the toxin undergoes a conformational change that facilitates toxin insertion into the apical cell membrane of insect midgut columnar cells. This initial binding is then followed by oligomerization of the bound toxin(3, 44, 45) . The cation ion selective pore formed by this oligomer causes a disruption of osmotic balance in the midgut epithelial layer(46, 47, 48) . This disruption of midgut function ultimately leads to the insect's death (3) . Potentially the 120-kDa toxin-binding proteins isolated here and that in M. sexta(23, 25) , since they have an ability to bind the CryIAc toxin, function to localize the toxin to the columnar cell membrane in insect midguts. Indeed phospholipid vesicles containing a 120-kDa aminopeptidase N from M. sexta enhanced Rb permeability when challenged with the CryIAc toxin(25) . The CryIAc binding in M. sexta, like that in H. virescens, is partially blocked by N-acetylgalactosamine, suggesting that the binding occurs on the carbohydrate moieties of this protein. Two putative N-glycosylation sites are observed in the H. virescens BTBP(1) protein. Both sites occur in predicted turns in protein structure (49) and are likely glycosylated. Moreover, just as in M. sexta(30) , the H. virescens BTBP(1) protein sequence preceding the GPI signal sequence is rich in Ser/Thr residues, which could also provide O-linked glycosylated residues required for CryIAc binding. Furthermore, the addition of a GPI anchor provides additional carbohydrate moieties for toxin interaction. The nature of these carbohydrate moieties, at the N- and O-glycosylation sites, and at the GPI anchor, is not known. Their characterization should provide a better understanding of the selectivity of B. thuringiensis toxins.

If B. thuringiensis CryIAc toxin activity is mediated predominantly by the carbohydrate moieties, it is likely that the differing responses observed between insects is due to heterogeneity in glycosylation. This heterogeneity in glycosylation could in part explain the rapid recovery of susceptibility from previously resistant insects(41) . A variety of glycoproteins could function as toxin-binding proteins, hence facilitating toxin interaction with the midgut epithelium.

Aminopeptidases N are not only widely distributed in a number of mammalian cell types, but they also appear to play various roles in these cell types(50) . In mice they are involved in hematopoeisis (51) and in the degradation of extracellular matrix and tumor cell invasion (52) . In intestinal epithelia, aminopeptidase N is involved in peptidyl bond cleavage releasing amino acids that are transported across the brush-border membrane(50) . Their high level expression in a variety of cell types facilitates the entry of certain coronaviruses in humans (53) . Hence the interaction observed here with the CryIAc toxin similarly enables B. thuringiensis to be insecticidal.


FOOTNOTES

*
This work was supported in part by research Grant 89-372590-4521 from the United States Department of Agriculture Cooperative State Research Service and NIH Grant ES03298. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) U35096[GenBank].

To whom correspondence should be addressed: 5419 Boyce Hall, Environmental Toxicology Graduate Program, University of California, Riverside, CA 92521. Tel.: 909-787-4621; Fax: 909-787-3087; Gill@ucrac1.ucr.edu.

§
Present address: Dept. of Orthopaedics, MC 1110, University of Connecticut Health Center, Farmington, CT 06030.

(^1)
The abbreviations used are: BBMV, brush-border membrane vesicles; CHAPS, 3-[(3-cholamidopropyl)dimethylammmonio]-1-propane sulfonate; RCA, Ricinis communis agglutinin; Mono Q, quaternary amino ethyl; PAGE, polyacrylamide gel electrophoresis; CAPS, 3-(cyclohexylamino)propanesulfonic acid; PCR, polymerase chain reaction; bp, base pair(s); GPI, glycosylphosphatidylinositol.


ACKNOWLEDGEMENTS

We thank P. Pietrantonio and A. K. Pullikuth for critically reading the manuscript and Daniela I. Oltean for technical assistance.


REFERENCES

  1. Bulla, L. A., Jr., Bechtel, D. B., Kramer, K. J., Shethna, Y. I., Aronson, A. I., and Fitz-James, P. C. (1980) Crit. Rev. Microbiol. 8, 147-204 [Medline] [Order article via Infotrieve]
  2. Hofte, H., and Whiteley, H. R. (1989) Microbiol. Rev. 53, 242-255 [Abstract/Free Full Text]
  3. Gill, S. S., Cowles, E. A., and Pietrantonio, P. V. (1992) Annu. Rev. Entomol. 37, 615-636 [CrossRef][Medline] [Order article via Infotrieve]
  4. Percy, J., and Fast, P. G. (1983) J. Invertebr. Pathol. 41, 86-98 [CrossRef]
  5. Singh, G. J. P., Schouest, L. P., Jr., and Gill, S. S. (1986) Pestic. Biochem. Physiol. 26, 36-46 [CrossRef]
  6. Hofmann, C., Vanderbruggen, H., Höfte, H., Van Rie, J., Jansens, S., and Van Mellaert, H. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7844-7848 [Abstract/Free Full Text]
  7. Van Rie, J., Jansens, S., Höfte, H., Degheele, D., and Van Mellaert, H. (1989) Eur. J. Biochem. 186, 239-247 [Medline] [Order article via Infotrieve]
  8. Ge, A. Z., Shivarova, N. I., and Dean, D. H. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 4037-4041 [Abstract/Free Full Text]
  9. Wu, D., and Aronson, A. I. (1992) J. Biol. Chem. 267, 2311-2317 [Abstract/Free Full Text]
  10. Chen, X. J., Lee, M. K., and Dean, D. H. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 9041-9045 [Abstract/Free Full Text]
  11. Oddou, P., Hartmann, H., and Geiser, M. (1991) Eur. J. Biochem. 202, 673-680 [Medline] [Order article via Infotrieve]
  12. Oddou, P., Hartmann, H., Radecke, F., and Geiser, M. (1993) Eur. J. Biochem. 212, 145-150 [Medline] [Order article via Infotrieve]
  13. Garczynski, S. F., Crim, J. W., and Adang, M. J. (1991) Appl. Environ. Microbiol. 57, 2816-2820 [Abstract/Free Full Text]
  14. Knowles, B. H., Knight, P. J. K., and Ellar, D. J. (1991) Proc. R. Soc. Lond. B 245, 31-35 [Medline] [Order article via Infotrieve]
  15. Cowles, E. A., Yunovitz, H., Charles, J.-F., and Gill, S. S. (1995) Appl. Environ. Microbiol. 61, 2738-2744 [Abstract]
  16. Lowry, O. H., Roberts, N. R., Wu, M.-L., Hixon, W. S., and Crawford, E. J. (1954) J. Biol. Chem. 207, 19-37 [Free Full Text]
  17. Tuppy, H., Weisbauer, U., and Wintersberger, E. (1962) Hoppe-Seyler's Z. Physiol. Chem. 329, 278-288
  18. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  19. Hunkapiller, M. W., Lujan, E., Ostrander, F., and Hood, L. E. (1983) Methods Enzymol. 91, 227-237 [Medline] [Order article via Infotrieve]
  20. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell 65, 1255-1266 [CrossRef][Medline] [Order article via Infotrieve]
  21. Mbungu, D., Ross, L. S., and Gill, S. S. (1995) Arch. Biochem. Biophys. 318, 489-497 [CrossRef][Medline] [Order article via Infotrieve]
  22. Wolfersberger, M. G., Luethy, P., Maurer, A., Parenti, P., Sacchi, F. V., Giordana, B., and Hanozet, G. M. (1987) Comp. Biochem. Physiol. 86, 301-308 [CrossRef]
  23. Knight, P. J. K., Crickmore, N., and Ellar, D. J. (1993) Mol. Microbiol. 11, 429-436 [CrossRef]
  24. Olsen, J., Cowell, G. M., Konigshofer, E., Danielsen, E. M., Moller, J., Laustsen, L., Hansen, O. C., Welinder, K. G., Engberg, J., Hunzinker, W., Spiess, M., Sjöström, H., and Norén, O. (1988) FEBS Lett. 238, 307-314 [CrossRef][Medline] [Order article via Infotrieve]
  25. Sangadala, S., Walters, F. S., English, L. H., and Adang, M. J. (1994) J. Biol. Chem. 269, 10088-10092 [Abstract/Free Full Text]
  26. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8132 [Abstract/Free Full Text]
  27. Manley, J. L., Yu, H., and Ryner, L. (1985) Mol. Cell. Biol. 5, 373-379 [Abstract/Free Full Text]
  28. Murphy, G. J., Murphy, G., and Reynolds, J. J. (1991) FEBS Lett. 289, 4-7 [CrossRef][Medline] [Order article via Infotrieve]
  29. Jongeneel, C. V., Bouvier, J., and Bairoch, A. (1989) FEBS Lett. 242, 211-214 [CrossRef][Medline] [Order article via Infotrieve]
  30. Knight, P. J. K., Knowles, B. H., and Ellar, D. J. (1995) J. Biol. Chem. 270, 17765-17770 [Abstract/Free Full Text]
  31. Kyte, J., and Doolittle, R. F. (1982) J. Mol. Biol. 157, 105-132 [CrossRef][Medline] [Order article via Infotrieve]
  32. Gierasch, L. M. (1989) Biochemistry 28, 923-930 [CrossRef][Medline] [Order article via Infotrieve]
  33. Watt, V. M., and Yip, C. C. (1989) J. Biol. Chem. 264, 5480-5487 [Abstract/Free Full Text]
  34. Garczynski, S. F., and Adang, M. J. (1995) Insect Biochem. Mol. Biol. 25, 409-415
  35. Tomita, M., Obara, H., Takesue, Y., Tamura, H.-O., Miyajima, S., Taguchi, R., and Ikezawa, H. (1994) Int. J. Biochem. 26, 977-986 [CrossRef]
  36. Cioffi, M., and Wolfersberger, M. G. (1983) Tissue & Cell 15, 781-803
  37. Englund, P. T. (1993) Annu. Rev. Biochem. 62, 121-138 [CrossRef][Medline] [Order article via Infotrieve]
  38. Gould, F., Martinez-Ramirez, A., Anderson, A., Ferre, J., Silva, F. J., and Moar, W. J. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7986-7990 [Abstract/Free Full Text]
  39. Van Rie, J., McGaughey, W. H., Johnson, D. E., Barnett, B. D., and Van Mellaert, H. (1990) Science 247, 72-74 [Abstract/Free Full Text]
  40. Ferre, J., Real, M. D., Van Rie, J., Jansens, S., and Peferoen, M. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 5119-5123 [Abstract/Free Full Text]
  41. Tabashnik, B. E., Finson, N., Groeters, F. R., Moar, W. J., Johnson, M. W., Luo, K., and Adang, M. J. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4120-4124 [Abstract/Free Full Text]
  42. Vadlamudi, R. K., Weber, E., Ji, I., Ji, T. H., and Bulla, L. A., Jr. (1995) J. Biol. Chem. 270, 5490-5494 [Abstract/Free Full Text]
  43. Schwartz, J.-L., Garneau, L., Masson, L., and Brousseau, R. (1991) Biochim. Biophys. Acta 1065, 250-260 [Medline] [Order article via Infotrieve]
  44. Chow, E., Singh, G. J. P., and Gill, S. S. (1989) Appl. Environ. Microbiol. 55, 2779-2788 [Abstract/Free Full Text]
  45. Walters, F. S., Kulesza, C. A., Philips, A. T., and English, L. H. (1994) Insect Biochem. Mol. Biol. 24, 963-968 [CrossRef]
  46. Knowles, B. H., Blatt, M. R., Tester, M., Horsnell, J. M., Carroll, J., Menestrina, G., and Ellar, D. J. (1989) FEBS Lett. 244, 259-262 [CrossRef][Medline] [Order article via Infotrieve]
  47. Knowles, B. H., and Ellar, D. J. (1987) Biochim. Biophys. Acta 924, 509-518
  48. Slatin, S. L., Abrams, C. K., and English, L. H. (1990) Biochem. Biophys. Res. Commun. 169, 765-772 [CrossRef][Medline] [Order article via Infotrieve]
  49. Garnier, J., Osguthorpe, D. J., and Robson, B. (1978) J. Mol. Biol. 120, 97-120 [CrossRef][Medline] [Order article via Infotrieve]
  50. Semenza, G. (1986) Annu. Rev. Cell Biol. 2, 255-313 [CrossRef]
  51. Wu, Q., Lahti, J. M., Air, G. M., Burrows, P. D., and Cooper, M. D. (1990) Proc. Natl. Acad. Sci. U. S. A. 87, 993-997 [Abstract/Free Full Text]
  52. Saiki, I., Fujii, H., Yoneda, J., Abe, F., Nakajima, M., Tsuruo, T., and Azuma, I. (1993) Int. J. Cancer 54, 137-143 [Medline] [Order article via Infotrieve]
  53. Yeager, C. L., Ashmun, R. A., Williams, R. K., Cardellichio, C. B., Shapiro, L. H., Look, A. T., and Holmes, K. V. (1992) Nature 357, 420-422 [CrossRef][Medline] [Order article via Infotrieve]
  54. Wilson, R., Ainscough, R., Anderson, K., Baynes, C., Berks, M., Bonfield, J., Burton, J., Connell, M., Copsey, T., Cooper, J., and et al. (1994) Nature 368, 32-38 [CrossRef][Medline] [Order article via Infotrieve]
  55. Garcia-Alvarez, N., Cueva, R., and Suarez-Rendueles, P. (1991) Eur. J. Biochem. 202, 993-1002 [Medline] [Order article via Infotrieve]
  56. Christensen, J. E., Lin, D. L., Palva, A., and Steele, J. L. (1995) Gene (Amst.) 155, 89-93 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Microbiol. Mol. Biol. Rev.Home page
C. R. Pigott and D. J. Ellar
Role of Receptors in Bacillus thuringiensis Crystal Toxin Activity
Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 255 - 281.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
Y. Shitomi, T. Hayakawa, D. M. Hossain, M. Higuchi, K. Miyamoto, K. Nakanishi, R. Sato, and H. Hori
A Novel 96-kDa Aminopeptidase Localized on Epithelial Cell Membranes of Bombyx mori Midgut, Which Binds to Cry1Ac Toxin of Bacillus thuringiensis
J. Biochem., February 1, 2006; 139(2): 223 - 233.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
D. Avisar, M. Segal, B. Sneh, and A. Zilberstein
Cell-cycle-dependent resistance to Bacillus thuringiensis Cry1C toxin in Sf9 cells
J. Cell Sci., July 15, 2005; 118(14): 3163 - 3171.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
S. Atsumi, E. Mizuno, H. Hara, K. Nakanishi, M. Kitami, N. Miura, H. Tabunoki, A. Watanabe, and R. Sato
Location of the Bombyx mori Aminopeptidase N Type 1 Binding Site on Bacillus thuringiensis Cry1Aa Toxin
Appl. Envir. Microbiol., July 1, 2005; 71(7): 3966 - 3977.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Mehlo, D. Gahakwa, P. T. Nghia, N. T. Loc, T. Capell, J. A. Gatehouse, A. M. R. Gatehouse, and P. Christou
An alternative strategy for sustainable pest resistance in genetically enhanced crops
PNAS, May 31, 2005; 102(22): 7812 - 7816.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
R. Xie, M. Zhuang, L. S. Ross, I. Gomez, D. I. Oltean, A. Bravo, M. Soberon, and S. S. Gill
Single Amino Acid Mutations in the Cadherin Receptor from Heliothis virescens Affect Its Toxin Binding Ability to Cry1A Toxins
J. Biol. Chem., March 4, 2005; 280(9): 8416 - 8425.
[Abstract] [Full Text] [PDF]


Home page
J BiochemHome page
H. Katayama, H. Yokota, T. Akao, O. Nakamura, M. Ohba, E. Mekada, and E. Mizuki
Parasporin-1, a Novel Cytotoxic Protein to Human Cells from Non-Insecticidal Parasporal Inclusions of Bacillus thuringiensis
J. Biochem., January 1, 2005; 137(1): 17 - 25.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
D. M. Hossain, Y. Shitomi, K. Moriyama, M. Higuchi, T. Hayakawa, T. Mitsui, R. Sato, and H. Hori
Characterization of a Novel Plasma Membrane Protein, Expressed in the Midgut Epithelia of Bombyx mori, That Binds to Cry1A Toxins
Appl. Envir. Microbiol., August 1, 2004; 70(8): 4604 - 4612.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
J. L. Jurat-Fuentes, F. L. Gould, and M. J. Adang
Altered Glycosylation of 63- and 68-Kilodalton Microvillar Proteins in Heliothis virescens Correlates with Reduced Cry1 Toxin Binding, Decreased Pore Formation, and Increased Resistance to Bacillus thuringiensis Cry1 Toxins
Appl. Envir. Microbiol., November 1, 2002; 68(11): 5711 - 5717.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
N. Agrawal, P. Malhotra, and R. K. Bhatnagar
Interaction of Gene-Cloned and Insect Cell-Expressed Aminopeptidase N of Spodoptera litura with Insecticidal Crystal Protein Cry1C
Appl. Envir. Microbiol., September 1, 2002; 68(9): 4583 - 4592.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Gomez, J. Miranda-Rios, E. Rudino-Pinera, D. I. Oltean, S. S. Gill, A. Bravo, and M. Soberon
Hydropathic Complementarity Determines Interaction of Epitope 869HITDTNNK876 in Manduca sexta Bt-R1 Receptor with Loop 2 of Domain II of Bacillus thuringiensis Cry1A Toxins
J. Biol. Chem., August 9, 2002; 277(33): 30137 - 30143.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
I. Darboux, Y. Pauchet, C. Castella, M. H. Silva-Filha, C. Nielsen-LeRoux, J.-F. Charles, and D. Pauron
Loss of the membrane anchor of the target receptor is a mechanism of bioinsecticide resistance
PNAS, April 30, 2002; 99(9): 5830 - 5835.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M. Zhuang, D. I. Oltean, I. Gomez, A. K. Pullikuth, M. Soberon, A. Bravo, and S. S. Gill
Heliothis virescens and Manduca sexta Lipid Rafts Are Involved in Cry1A Toxin Binding to the Midgut Epithelium and Subsequent Pore Formation
J. Biol. Chem., April 12, 2002; 277(16): 13863 - 13872.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
L. J. Gahan, F. Gould, and D. G. Heckel
Identification of a Gene Associated with Bt Resistance in Heliothis virescens
Science, August 3, 2001; 293(5531): 857 - 860.
[Abstract] [Full Text] [PDF]


Home page
Appl. Environ. Microbiol.Home page
G. Hua, L. Masson, J. L. Jurat-Fuentes, G. Schwab, and M. J. Adang
Binding Analyses of Bacillus thuringiensis Cry {delta}-Endotoxins Using Brush Border Membrane Vesicles of Ostrinia nubilalis
Appl. Envir. Microbiol., February 1, 2001; 67(2): 872 - 879.
[Abstract] [Full Text]


Home page
Appl. Environ. Microbiol.Home page
J. L. Jurat-Fuentes and M. J. Adang
Importance of Cry1 {delta}-Endotoxin Domain II Loops for Binding Specificity in Heliothis virescens (L.)
Appl. Envir. Microbiol., January 1, 2001; 67(1): 323 - 329.
[Abstract] [Full Text]


Home page
Appl. Environ. Microbiol.Home page
D. I. Oltean, A. K. Pullikuth, H.-K. Lee, and S. S. Gill
Partial Purification and Characterization of Bacillus thuringiensis Cry1A Toxin Receptor A from Heliothis virescens and Cloning of the Corresponding cDNA
Appl. Envir. Microbiol., November 1, 1999; 65(11): 4760 - 4766.
[Abstract] [Full Text]


Home page
Appl. Environ. Microbiol.Home page
M. K. Lee, T. H. You, F. L. Gould, and D. H. Dean
Identification of Residues in Domain III of Bacillus thuringiensis Cry1Ac Toxin That Affect Binding and Toxicity
Appl. Envir. Microbiol., October 1, 1999; 65(10): 4513 - 4520.
[Abstract] [Full Text]


Home page
Appl. Environ. Microbiol.Home page
T. P. Keeton, B. R. Francis, W. S. A. Maaty, and L. A. Bulla Jr.
Effects of Midgut-Protein-Preparative and Ligand Binding Procedures on the Toxin Binding Characteristics of BT-R1, a Common High-Affinity Receptor in Manduca sexta for Cry1A Bacillus thuringiensis Toxins
Appl. Envir. Microbiol., June 1, 1998; 64(6): 2158 - 2165.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
F. Rajamohan, O. Alzate, J. A. Cotrill, A. Curtiss, and D. H. Dean
Protein engineering of Bacillus thuringiensis delta -endotoxin: Mutations at domain II of CryIAb enhance receptor affinity and toxicity toward gypsy moth larvae
PNAS, December 10, 1996; 93(25): 14338 - 14343.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
I. Gomez, D. I. Oltean, S. S. Gill, A. Bravo, and M. Soberon
Mapping the Epitope in Cadherin-like Receptors Involved in Bacillus thuringiensis Cry1A Toxin Interaction Using Phage Display
J. Biol. Chem., July 27, 2001; 276(31): 28906 - 28912.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Gill, S. S.
Right arrow Articles by Francis, V.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Gill, S. S.
Right arrow Articles by Francis, V.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement