|
|
|
|||||||
|
|||||||||
(Received for publication, June 27,
1995; and in revised form, September 7, 1995) From the
Bacillus thuringiensis toxins are insecticidal to a
variety of insect species. The selectivity of the toxins produced by
these bacteria is dependent on both the toxin structure and the
receptor sites that are present in different insect species. One of
these toxins, CryIAc, is highly insecticidal to the noctuid pest Heliothis virescens. Using toxin overlay assay, a 120-kDa
glycoprotein was identified as a toxin-binding protein. This protein
was partially purified, its N-terminal sequence was determined, and the
full-length cDNA encoding this protein was isolated from a H.
virescens midgut library. The B. thuringiensis toxin-binding protein, BTBP
Bacillus thuringiensis, a Gram-positive bacterium,
produces insecticidal parasporal inclusions during
sporulation(1) . This insecticidal activity is dependent on a
unique set of inclusion proteins or These activated toxins then interact with
the apical membranes of insect midgut columnar
cells(4, 5) . Using preparations of columnar cell
brush-border membrane vesicles (BBMV) ( To identify the
precise toxin binding targets in insects, midgut cell membranes have
been electrophoretically separated and probed with radiolabeled toxins
in toxin overlay assays. Several CryIAc binding proteins ranging from
150 to 50 kDa were observed in H.
virescens(11, 12, 13, 14) . We
have identified the proteins involved in CryIAc toxicity to H.
virescens using toxin overlay assays (15) . A 120-kDa B. thuringiensis toxin-binding protein, BTBP
This Pool II toxin binding fraction was then
applied to a Ricinis communis agglutinin (RCA) agarose column
in 20 mM Tris, pH 7.5, 150 mM NaCl, 1 mM EDTA, 1 mM MgSO
Dideoxy double-stranded sequencing of the cDNA
insert was performed using Sequenase 2.0 as described by the
manufacture (U. S. Biochemical).
Figure 1:
Partial purification of the CryIAc
binding protein from H. virescens midgut. Lane 1,
BBMV; lane 2, CHAPS-solubilized BBMV; lanes 3 and 4, fractions I and II isolated from Mono Q column; lane
5, flow-through from RCA column; lane 6, RCA-bound
fraction eluted with 0.2 M lactose. The gel is stained with
Coomassie Blue, and each lane contains 10 µg of protein, except lane 6, which contains 2.5 µg of
protein.
Toxin overlay assay (15) showed that the 120- and 105-kDa RCA-purified proteins
bound iodinated CryIAc toxin (Fig. 2, lane 2) and that
addition of excess unlabeled CryIAc toxin significantly decreased
binding (Fig. 2, lane 3). Low level binding was also
observed with a 140-kDa protein, but this binding was not as readily
displaced with excess unlabeled CryIAc toxin. The 140-kDa protein is
not visible in the SDS-polyacrylamide gel (Fig. 1, lane
6). The 170-kDa protein did not bind the CryIAc toxin. Similar
results were obtained with Mono Q Pool II fractionated proteins, except
the 170-kDa protein also bound the CryIAc toxin(15) .
Figure 2:
Analysis of CryIAc toxin binding to RCA
isolated fractions. Lane 1 contains 10 µg of RCA isolated
fraction stained with Coomassie Blue. Lanes 2 and 3 are autoradiographs; lane 2 is probed with 1 nM
Analysis of enzyme activity in the various fractions during
purification through the Mono Q anion-exchange chromatography shows
that alkaline phosphatase and aminopeptidases are enriched in the BBMV,
solubilized BBMV, and in Pool II (Table 1). The alkaline
phosphatase activity was enriched about 17
The sequence YRLPT
was conserved in all three insect CryIAc toxin-binding proteins, and
the sequence YRLP was conserved in all of the proteins compared (Table 2). Oligonucleotide primers, forward and reverse, were
made ensuring the sequence YRLPT was present at the 3` end of the
primers. When used in conjunction with a primer to conserved regions of
aminopeptidase N (AMN2R) in PCR screening, both the M. sexta (MS1F) and H. virescens (HV1F) primers gave the same size
product, 0.85 kilobase. Reamplification of these PCR products with
AMN1F and AMN1R gave products of the expected size, 170 bp.
Amplification of one of the fractionated libraries, number 3, using the
primers V1F and AMN1R, followed by reamplification using V2F and HV1R,
showed the presence of prominent bands between 220 and 300 bp,
suggesting the presence of cDNA sequence upstream of the N-terminal
sequences obtained. Electroporation of fraction 3 plasmid DNA into
DH10B cells and successive rounds of PCR screening (21) resulted in the isolation of two clones. Nucleotide
sequencing of these two clones showed that one clone contained a
sequence that matched that of the 120-kDa protein. This clone had an
insert of 3419 bp, with a 3027-bp open reading frame encoding a
1009-amino acid protein (Fig. 3). The putative translation start
site at nucleotide 35 contains a consensus Kozak sequence, AAGATGG (26) . A polyadenylation sequence, AATAAA(27) , at
nucleotide 3385 precedes the poly(A) tail, which is 337 bp downstream
of the termination codon.
Figure 3:
Deduced amino acid sequence of the CryIAc
binding protein from H. virescens midgut. The oligonucleotide
sequence of the entire 3471-bp cDNA was sequenced in both orientations.
The hydrophobic N and C termini are underlined. The N terminus
of the mature protein that was sequenced is underlined and in boldface. The putative N-glycosylation sites are double underlined. The putative metal binding sites are
indicated by
The protein, BTBP
Figure 4:
Autoradiograph of inhibition of CryIAc
binding to RCA purified fraction by N-acetylgalactosamine. Lane 1, 10 µg of RCA-isolated fractions are probed with 1
nM
In vitro transcription and translation of BTBP
Figure 5:
Autoradiograph of in vitro transcribed and translated CryIAc binding protein binding to
antibodies to BBMV. The total or the products immunoprecipitated by
rabbit anti-H. virescens BBMV antibodies were separated by
SDS-PAGE and then subjected to autoradiography. Lane 1, in
vitro transcribed and translated products of the plasmid vector
minus the BTBP
Protein purification, N-terminal sequencing, and
characterization of the cDNA isolated identify the CryIAc toxin-binding
protein from the midgut of H. virescens as an aminopeptidase
N-like protein (Fig. 6). An aminopeptidase N from M. sexta, that also binds the CryIAc toxin, has recently been
reported(30) . The H. virescens BTBP
Figure 6:
Comparison of H. virescens BTBP
The BTBP Unlike the
other aminopeptidases, the H. virescens BTBP The hydrophobic tail and the GPI-linked
anchor could play a crucial role in insects resistant to B.
thuringiensis toxins. Elevation of endogenous
phosphatidylinositol-specific phospholipase C, or B. thuringiensis phosphatidylinositol-specific phospholipase C could result in
decreased levels of membrane-bound BTBP A CryIAb toxin-binding
protein has recently been cloned and shown to be a cadherin-like
210-kDa membrane glycoprotein(42) . Unlike the CryIAb-binding
protein, which apparently has an intracellular component, BTBP The precise mechanism of B.
thuringiensis toxicity is not known. The generally accepted model
is that following toxin binding to a receptor protein or macromolecule,
the toxin undergoes a conformational change that facilitates toxin
insertion into the apical cell membrane of insect midgut columnar
cells. This initial binding is then followed by oligomerization of the
bound toxin(3, 44, 45) . The cation ion
selective pore formed by this oligomer causes a disruption of osmotic
balance in the midgut epithelial
layer(46, 47, 48) . This disruption of midgut
function ultimately leads to the insect's death (3) .
Potentially the 120-kDa toxin-binding proteins isolated here and that
in M. sexta(23, 25) , since they have an
ability to bind the CryIAc toxin, function to localize the toxin to the
columnar cell membrane in insect midguts. Indeed phospholipid vesicles
containing a 120-kDa aminopeptidase N from M. sexta enhanced
Rb If B. thuringiensis CryIAc toxin
activity is mediated predominantly by the carbohydrate moieties, it is
likely that the differing responses observed between insects is due to
heterogeneity in glycosylation. This heterogeneity in glycosylation
could in part explain the rapid recovery of susceptibility from
previously resistant insects(41) . A variety of glycoproteins
could function as toxin-binding proteins, hence facilitating toxin
interaction with the midgut epithelium. Aminopeptidases N are not
only widely distributed in a number of mammalian cell types, but they
also appear to play various roles in these cell types(50) . In
mice they are involved in hematopoeisis (51) and in the
degradation of extracellular matrix and tumor cell invasion (52) . In intestinal epithelia, aminopeptidase N is involved in
peptidyl bond cleavage releasing amino acids that are transported
across the brush-border membrane(50) . Their high level
expression in a variety of cell types facilitates the entry of certain
coronaviruses in humans (53) . Hence the interaction observed
here with the CryIAc toxin similarly enables B. thuringiensis to be insecticidal.
The
nucleotide sequence(s) reported in this paper has been submitted to the
GenBank(TM)/EMBL Data Bank with accession number(s)
U35096[GenBank].
Volume 270,
Number 45,
Issue of November 10, 1995 pp. 27277-27282
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
, has high homology to
aminopeptidase N from eukaryotes and prokaryotes.
-endotoxins produced by these B. thuringiensis strains(2) . Most of these
insecticidal proteins are usually produced as large protoxins, about
130 kDa, although smaller naturally truncated proteins are also
observed. When ingested by susceptible insect larvae, the parasporal
inclusions dissolve in the alkaline environment of insect midgut giving
rise to soluble protoxins that are activated by midgut
proteases(2, 3) . For example, the 130-kDa CryIAc
protoxin is activated to a 65-kDa toxin in the midgut of lepidopteran Heliothis virescens and Manduca sexta larvae and is
toxic to these insects.
)previous studies
have demonstrated that in susceptible insects, high affinity toxin
binding sites are correlated with the insecticidal activity of B.
thuringiensis toxins(6, 7) . Changes in toxin
structure, even minor, that are associated with decreased toxin binding
result in decreased insecticidal
activity(8, 9, 10) ., from
the midgut brush-border membrane that binds the CryIAc toxin was
partially purified, and its N-terminal sequence was determined. A cDNA
clone encoding this protein was isolated and characterized. The deduced
amino acid sequence shows that the BTBP belongs to the
aminopeptidase N family of proteins.
Toxin Isolation and Radiolabeling
Parasporal
inclusions from B. thuringiensis sp. kurstaki strain
HD-73 were isolated, the protoxin proteolytically was activated, and
the 65-kDa activated toxin was purified on a fast protein liquid
chromatography Superose 12 column (Pharmacia Biotech Inc.) as described
previously(15) . Radioiodination was performed as described
previously (15) giving specific activities of 100-200
Ci/mmol. The biological activity of the radiolabeled CryIAc toxin was
comparable with that of the unlabeled toxin(15) .Partial Purification of the CryIAc Binding
Proteins
Freshly prepared H. virescens BBMV (15) were solubilized in 2% CHAPS (Boehringer Mannheim
Biochemicals) in solubilization buffer (20 mM Tris, pH 7.5, 1
mM EDTA, 1 mM Mg
SO
, 0.01%
NaN
, and 10% glycerol) containing protease inhibitors (1
mM phenylmethylsulfonyl fluoride, 1 µM aprotinin,
0.7 µM leupeptin, and 1 µM pepstatin).
Following 1-h incubation at 4 °C, the mixture was centrifuged for 1
h at 100,000 
g. The supernatant was applied to a 1-ml
fast protein liquid chromatography MonoQ column (Pharmacia). After
washing with solubilization buffer the proteins were eluted with a 0 to
500 mM KCl linear gradient in solubilization buffer with 1%
CHAPS. Fractions were assayed for toxin binding ability using a
solid-phase binding assay(15) . Fractions eluting at 250 mM KCl that bound the CryIAc toxin were pooled and are called the
Pool II fraction., 1% CHAPS (w/v) containing
protease inhibitors at 4 °C overnight, with gentle mixing. The
preparation was then poured into a column, washed extensively, and
eluted with 200 mM lactose in the appropriate buffer, and the
eluted material was concentrated in a stirred cell using PM10 filters
(Amicon).Protein Determination and Enzyme Assays
Protein
concentrations were determined using the detergent compatible protein
assay kit (Bio-Rad) with bovine serum albumin as a standard. Alkaline
phosphatase (16) and aminopeptidase activities were assayed as
described previously(17) .Gel Electrophoresis, Electroblotting, and Toxin Overlay
Assay
Discontinuous buffer SDS-PAGE was performed in 10%
polyacrylamide gels(18) . Separated proteins were transferred
to Immobilon membranes (Millipore) using a Tris/glycine buffer as
suggested by the manufacturer. After transfer, membranes were blocked
in phosphate-buffered saline containing 3% bovine serum albumin. The
membranes were then incubated in binding buffer (20 mM HEPES,
pH 7.5, 150 mM NaCl, 0.1% bovine serum albumin, 0.1% Tween-20,
and 0.01% NaN) containing 1 nMI-CryIAc toxin with or without unlabeled competitor
(500-fold) or N-acetylgalactosamine (200 mM) for 1 h
at RT as described previously(15) . The blots were washed 4
times with binding buffer, dried, and analyzed by autoradiography.
N-terminal Sequence Analysis
To identify the
N-terminal sequences, the 170-, 120-, and 105-kDa Mono Q-purified
proteins in Pool II were separated by SDS-PAGE, transferred to an
Immobilon membrane in 50 mM CAPS, 20% methanol, and 0.1% EDTA.
The membrane was then washed, stained, and destained as described
previously(19) . Individual bands were excised and subjected to
N-terminal amino acid gas-phase sequencing at the Biotechnology
Instrumentation Facility at the University of California, Riverside.cDNA Library Construction
Size fractionated
poly(A) RNA, >3 kilobases, obtained from the
midguts of early fifth instar H. virescens larvae was used for
the construction of a unidirectional cDNA using the Life Technologies,
Inc. SuperScript Plasmid System kit and an oligo(dT) primer in a
modified pCDM8 vector(20) . The library consisting of about
10
transformants was plated on 15 LB/Amp (100 µg/ml)
plates. Plasmid preparations were made from these 15 library pools.cDNA Library Screening
Briefly, the cDNA library
was screened by initially performing PCR using plasmid DNA as template
from each of the 15 library pools(21) . The primers used were
degenerate primers H. virescens primers: HV1F,
GACCCIGCITA(C/T)(A/C)GN(C/T)TNCCNAC, and HV1R,
IGAIA(A/G)IGTIGGNA(A/G)NC(G/T)(A/G)TA; M. sexta primer, MS1F,
GA(C/T)CCI(A/T)(G/C)NTA(C/T)(A/C)GN(C/T)TNCC; conserved aminopeptidase
N primers: AMN1R, TC(A/G)TTIAGCCANA(A/G)(A/G)TC(A/G)TTCCACCA, AMN1F,
GACTTCAA(C/T)GCIGGNGCNATGGA(A/G)AA), and AMN2R,
CCGAACCA(C/T)TG(A/G)TGIGCNAG(C/T)TC(A/G)TG; vector primers: V1F, CGTG
TACGGTGGGAGGTCTATATA, and V2F, TTAACTGGCTTATCGAAATTAATA. DNA from the
plasmid pool showing the presence of the expected size product by PCR
was then used for electroporation of E. coli DH10B cells.
Transformed cells were used for additional screening by PCR as
described previously(21) . Successive rounds of this protocol
yielded two clones.In Vitro Transcription and Translation
In
vitro transcription was performed with the cDNA clone linearized
with NotI using the mMessage mMachine kit (Ambion) catalyzed
by T7 polymerase. The cRNA was translated in a rabbit reticulocyte
cell-free translation system (Promega, WI) using
[S]methionine (Amersham, Corp.). The translated
products were immunoprecipitated by the addition of anti-H.
virescens BBMV antibody followed by Protein A-Sepharose (Sigma).
The precipitates were washed extensively in buffer containing 150
mM NaCl, 10 mM Tris-HCl, pH 7.5, 2 mM EDTA,
and 5% Nonidet P-40 followed by 3 washes in a similar buffer but
containing 500 mM NaCl. The final pellets were resuspended in
SDS-PAGE loading buffer and analyzed on 8% gels SDS-PAGE under reducing
conditions and visualized by fluorography (DuPont NEN).
Purification of the CryIAc Binding Protein
We
previously (15) identified a number of proteins in H.
virescens midgut BBMV and CHAPS-solubilized BBMV that bind
iodinated CryIAc toxin. An attempt was made to identify one of these
toxin-binding proteins. CHAPS-solubilized BBMV, when separated on Mono
Q anion-exchange chromatography, gave rise to three toxin-binding
fractions(15) . One of these fractions, Pool II (Fig. 1, lane 4), from this Mono Q separation, eluting at 250 mM KCl, was then further separated using RCA chromatography.
Combination of anion-exchange and lectin chromatography resulted in the
purification of 120- and 105-kDa proteins (Fig. 1, lane
6). Minor amounts of a 170-kDa protein were also detected (lane 6). Purification using RCA chromatography demonstrates
that these three proteins are all glycosylated.
I-CryIAc, and lane 3 is probed with 1
nM
I-CryIAc and 500 nM cold
CryIAc.
from that found in
crude homogenates, while the activities of leucine, lysine, and
phenylalanine aminopeptidases were enriched 10, 14 and 9,
respectively. Leucine aminopeptidase, an enzyme used as a marker for
insect BBMV(22) , had the highest specific activity in the Mono
Q pooled fraction, Pool II.
N-terminal Sequencing and cDNA
Isolation
N-terminal sequencing of the 170-, 120-, and 105-kDa
proteins from Pool II (Fig. 1, lane 4) was performed.
The N termini of the 170- and 120-kDa proteins are DPAYRLPTL and
NV(V/A)ASPYRLPT, respectively (Table 2). The N-terminal sequence
of the 120-kDa protein purified from the RCA column was identical to
that of the 120-kDa protein from the Mono Q column. The N terminus of
the 105-kDa protein from the pooled fraction was different. The 170-
and 120-kDa protein N-terminal sequences were compared with that of the
N-terminal sequence of M. sexta CryIAc toxin 120-kDa binding
protein (Table 2) (23) and to known aminopeptidase
N(24) , since it has previously been established that the
CryIAc binding protein in M. sexta appears to be
aminopeptidase N-like(23, 25) .
, and the putative nucleophile is indicated by
. The putative GPI-anchor signal sequence is indicated by a dotted underline. Two hydrohobic domains are observed. The
first is at the N terminus, amino acids 1-19, and the second is
at the C terminus between amino acids
933-1009.
, has a
calculated molecular weight of 113,461 Da and a pI of 5.29. The
N-terminal sequence obtained from protein sequencing is between amino
acids 53 and 63 and indicates that the mature BTBP isolated
from H. virescens BBMV has 52 amino acids cleaved from the N
terminus. Both the N and C termini are hydrophobic. Two potential N-glycosylation sites are observed at amino acid residues 581
and 906. A metal binding motif, HEXXH (28, 29) is observed at 374-378.Role of Glycosylation in Toxin Binding and
Immunoprecipitation with Antibodies
The CryIAc toxin has been
shown to bind to carbohydrate
moieties(11, 12, 13, 14) . Fig. 4shows CryIAc binding to RCA purified proteins (lane
1) and its displacement by the presence of 200 mMN-acetylgalactosamine (lane 2) confirming the role of
carbohydrate moieties in toxin binding.
I-CryIAc, and lane 2 is probed with
1 nM
I-CryIAc in the presence of 200 mM GalNAC.
cDNA gives a
protein of about 113 kDa (Fig. 5, lane 3). This size,
as predicted from the deduced amino acid sequence, lends support to the
putative start site. The in vitro translated CryIAc binding
protein was immunoprecipitable with anti-H. virescens BBMV
antibodies (Fig. 5, lane 4), but not with preimmune
antibodies (lane 5). The smaller and weakly labeled products (lane 3) are derived either from incomplete transcription and
translation or are proteolytically cleaved BTBP, since
these products all are immunoprecipitable only by anti-BBMV antibodies (lane 4) and not by preimmune antibodies (lane 5). No
products were obtained when only the vector was used for in vitro transcription and translation (Fig. 5, lanes 1 and 2). Immunolocalization studies show these antibodies react
with the midgut brush-border membrane of H. virescens (data
not shown), demonstrating that the cloned BTBP is
apparently localized to the brush-border membrane of H. virescens midgut. The in vitro translated BTBP protein
does not bind CryIAc toxin (data not shown) consistent with previous
data showing the CryIAc toxin binding to carbohydrate moieties of this
120-kDa protein.
cDNA labeled with
[S]methionine. Lane 2, the product in lane 1 was immunoprecipitated with anti-BBMV antibodies. Lane 3, in vitro transcribed and translated products
of the BTBP
cDNA labeled with
[S]methionine. Lane 4, the product in lane 3 was immunoprecipitated with anti-BBMV antibodies. Lane 5, the product in lane 3 was immunoprecipitated
with preimmune rabbit serum.
has
42 and 62% identity and similarity, respectively, to the M. sexta protein. Comparison of these two sequences suggests the M.
sexta CryIAc binding protein probably has an additional
10-25 amino acids upstream of the reported N-terminal
sequence(30) . Similar levels of identity, although slightly
lower, are observed with other eukaryote aminopeptidases N,
zinc-dependent metalloproteases(28, 29) . For example, H. virescens BTBP has 32 and 52% identity and
similarity, respectively, to human aminopeptidase N.
with known aminopeptidases. BTBP sequence was compared with nucleotide sequences (Genbank, release
88.0) and with protein sequences (Swiss Protein, release 31.0). The
greatest similarity is observed with zinc-dependent metalloproteases,
which includes aminopeptidases N. Only some sequences are used for
comparison and include human(24) , Caenorhabditis
elegans(54) , mouse(51) , Saccharomyces(55) , and Lactobacilli(56) . The M. sexta sequence used
was as published recently(30) .
N terminus is quite divergent from that of other aminopeptidases.
The first 15 amino acids are highly hydrophobic (2.6) and probably
contain an appropriate signal sequence that facilitates membrane
targeting(31, 32) . However, unlike mammalian
aminopeptidases, where the mature protein undergoes limited truncation
at the N terminus(33) , the first 52 amino acid residues of H. virescens BTBP are cleaved. This can be
explained, in part, by the different membrane anchors used by H.
virescens BTBP, and those used by aminopeptidase N in
mammals. In the latter, aminopeptidase N is membrane-bound apparently
by a hydrophobic N terminus(33) , and trypsin treatment results
in cleavage of the membrane anchor, with the resulting soluble protein
beginning at amino acid residue 40(33) . In insects,
aminopeptidase N is apparently membrane bound at the C terminus. The
soluble form of the insect leucine aminopeptidase is obtained by
treatment with phosphatidylinositol-specific phospholipase
C(34, 35) . Immunoprecipitation of BTBP by
BBMV-specific antibodies suggests that this protein is localized to the
midgut cell brush border of H. virescens. Leucine
aminopeptidase activity is often used as a marker for insect midgut
columnar cell brush border(22, 36) . has a
long hydrophobic C terminus. In two insect species, Bombyx mori and M. sexta, the midgut aminopeptidase N activity is
membrane-linked via a glycosylphosphatidylinositol (GPI)
anchor(34, 35) . The presence of a long hydrophobic C
terminus preceded by hydrophilic residues suggests that the BTBP is similarly linked by a GPI anchor. A putative sequence
signaling the addition of GPI anchors(37) , DSA, is observed.
The aspartic acid at 987 is a likely site for attachment of the GPI
anchor, with cleavage of the hydrophobic tail between Asp and Ser
. The presence of a GPI anchor in H.
virescens, however, needs to be established, and alternative
mechanisms of BTBP
membrane anchoring, however, cannot be
excluded. N- and C-terminal proteolytic cleavage will result in a
105-kDa protein containing 935 amino acid residues. The BTBP isolated from H. virescens midgut, however, is of 120
kDa, consequently the difference in the molecular masses of these two
proteins results from carbohydrate or other posttranslational
modifications. The M. sexta CryIAc binding protein similarly
has a putative GPI signal sequence, a hydrophobic N terminus, and
identical molecular masses for the processed and isolated
proteins(30) . or aminopeptidase N
causing increased tolerance and/or resistance to the CryIAc toxin.
Alternatively down-regulation of BTBP expression in insect
midgut will result in the loss of toxin binding sites, and decreased
CryIAc toxicity. However, H. virescens resistance to the
CryIAc toxin does not appear to be correlated with decreased toxin
binding(38) , and consequently alternative mechanisms of toxin
resistance are likely. On the other hand, in Plutella xylostella and Plodia interpunctella, resistance to the CryIAb
toxins is correlated with the availability of toxin binding
sites(39, 40, 41) . is entirely extracellular and is probably GPI-anchored. Hence it
is unlikely to directly participate in any intracellular changes that
have been observed with B. thuringiensis intoxication(43) , although it could affect external
mediators of signal transduction. permeability when challenged with the CryIAc
toxin(25) . The CryIAc binding in M. sexta, like that
in H. virescens, is partially blocked by N-acetylgalactosamine, suggesting that the binding occurs on
the carbohydrate moieties of this protein. Two putative N-glycosylation sites are observed in the H. virescens BTBP
protein. Both sites occur in predicted turns in
protein structure (49) and are likely glycosylated. Moreover,
just as in M. sexta(30) , the H. virescens BTBP protein sequence preceding the GPI signal
sequence is rich in Ser/Thr residues, which could also provide O-linked glycosylated residues required for CryIAc binding.
Furthermore, the addition of a GPI anchor provides additional
carbohydrate moieties for toxin interaction. The nature of these
carbohydrate moieties, at the N- and O-glycosylation
sites, and at the GPI anchor, is not known. Their characterization
should provide a better understanding of the selectivity of B.
thuringiensis toxins.
)
We thank P. Pietrantonio and A. K. Pullikuth for
critically reading the manuscript and Daniela I. Oltean for technical
assistance.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  C. R. Pigott and D. J. Ellar Role of Receptors in Bacillus thuringiensis Crystal Toxin Activity Microbiol. Mol. Biol. Rev., June 1, 2007; 71(2): 255 - 281. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Shitomi, T. Hayakawa, D. M. Hossain, M. Higuchi, K. Miyamoto, K. Nakanishi, R. Sato, and H. Hori A Novel 96-kDa Aminopeptidase Localized on Epithelial Cell Membranes of Bombyx mori Midgut, Which Binds to Cry1Ac Toxin of Bacillus thuringiensis J. Biochem., February 1, 2006; 139(2): 223 - 233. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Avisar, M. Segal, B. Sneh, and A. Zilberstein Cell-cycle-dependent resistance to Bacillus thuringiensis Cry1C toxin in Sf9 cells J. Cell Sci., July 15, 2005; 118(14): 3163 - 3171. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Atsumi, E. Mizuno, H. Hara, K. Nakanishi, M. Kitami, N. Miura, H. Tabunoki, A. Watanabe, and R. Sato Location of the Bombyx mori Aminopeptidase N Type 1 Binding Site on Bacillus thuringiensis Cry1Aa Toxin Appl. Envir. Microbiol., July 1, 2005; 71(7): 3966 - 3977. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. Mehlo, D. Gahakwa, P. T. Nghia, N. T. Loc, T. Capell, J. A. Gatehouse, A. M. R. Gatehouse, and P. Christou An alternative strategy for sustainable pest resistance in genetically enhanced crops PNAS, May 31, 2005; 102(22): 7812 - 7816. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 R. Xie, M. Zhuang, L. S. Ross, I. Gomez, D. I. Oltean, A. Bravo, M. Soberon, and S. S. Gill Single Amino Acid Mutations in the Cadherin Receptor from Heliothis virescens Affect Its Toxin Binding Ability to Cry1A Toxins J. Biol. Chem., March 4, 2005; 280(9): 8416 - 8425. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
H. Katayama, H. Yokota, T. Akao, O. Nakamura, M. Ohba, E. Mekada, and E. Mizuki Parasporin-1, a Novel Cytotoxic Protein to Human Cells from Non-Insecticidal Parasporal Inclusions of Bacillus thuringiensis J. Biochem., January 1, 2005; 137(1): 17 - 25. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. M. Hossain, Y. Shitomi, K. Moriyama, M. Higuchi, T. Hayakawa, T. Mitsui, R. Sato, and H. Hori Characterization of a Novel Plasma Membrane Protein, Expressed in the Midgut Epithelia of Bombyx mori, That Binds to Cry1A Toxins Appl. Envir. Microbiol., August 1, 2004; 70(8): 4604 - 4612. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. L. Jurat-Fuentes, F. L. Gould, and M. J. Adang Altered Glycosylation of 63- and 68-Kilodalton Microvillar Proteins in Heliothis virescens Correlates with Reduced Cry1 Toxin Binding, Decreased Pore Formation, and Increased Resistance to Bacillus thuringiensis Cry1 Toxins Appl. Envir. Microbiol., November 1, 2002; 68(11): 5711 - 5717. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Agrawal, P. Malhotra, and R. K. Bhatnagar Interaction of Gene-Cloned and Insect Cell-Expressed Aminopeptidase N of Spodoptera litura with Insecticidal Crystal Protein Cry1C Appl. Envir. Microbiol., September 1, 2002; 68(9): 4583 - 4592. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Gomez, J. Miranda-Rios, E. Rudino-Pinera, D. I. Oltean, S. S. Gill, A. Bravo, and M. Soberon Hydropathic Complementarity Determines Interaction of Epitope 869HITDTNNK876 in Manduca sexta Bt-R1 Receptor with Loop 2 of Domain II of Bacillus thuringiensis Cry1A Toxins J. Biol. Chem., August 9, 2002; 277(33): 30137 - 30143. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Darboux, Y. Pauchet, C. Castella, M. H. Silva-Filha, C. Nielsen-LeRoux, J.-F. Charles, and D. Pauron Loss of the membrane anchor of the target receptor is a mechanism of bioinsecticide resistance PNAS, April 30, 2002; 99(9): 5830 - 5835. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Zhuang, D. I. Oltean, I. Gomez, A. K. Pullikuth, M. Soberon, A. Bravo, and S. S. Gill Heliothis virescens and Manduca sexta Lipid Rafts Are Involved in Cry1A Toxin Binding to the Midgut Epithelium and Subsequent Pore Formation J. Biol. Chem., April 12, 2002; 277(16): 13863 - 13872. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 L. J. Gahan, F. Gould, and D. G. Heckel Identification of a Gene Associated with Bt Resistance in Heliothis virescens Science, August 3, 2001; 293(5531): 857 - 860. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Hua, L. Masson, J. L. Jurat-Fuentes, G. Schwab, and M. J. Adang Binding Analyses of Bacillus thuringiensis Cry {delta}-Endotoxins Using Brush Border Membrane Vesicles of Ostrinia nubilalis Appl. Envir. Microbiol., February 1, 2001; 67(2): 872 - 879. [Abstract] [Full Text]
|
|
|
|
|
|
J. L. Jurat-Fuentes and M. J. Adang Importance of Cry1 {delta}-Endotoxin Domain II Loops for Binding Specificity in Heliothis virescens (L.) Appl. Envir. Microbiol., January 1, 2001; 67(1): 323 - 329. [Abstract] [Full Text]
|
|
|
|
|
|
D. I. Oltean, A. K. Pullikuth, H.-K. Lee, and S. S. Gill Partial Purification and Characterization of Bacillus thuringiensis Cry1A Toxin Receptor A from Heliothis virescens and Cloning of the Corresponding cDNA Appl. Envir. Microbiol., November 1, 1999; 65(11): 4760 - 4766. [Abstract] [Full Text]
|
|
|
|
|
|
M. K. Lee, T. H. You, F. L. Gould, and D. H. Dean Identification of Residues in Domain III of Bacillus thuringiensis Cry1Ac Toxin That Affect Binding and Toxicity Appl. Envir. Microbiol., October 1, 1999; 65(10): 4513 - 4520. [Abstract] [Full Text]
|
|
|
|
|
|
T. P. Keeton, B. R. Francis, W. S. A. Maaty, and L. A. Bulla Jr. Effects of Midgut-Protein-Preparative and Ligand Binding Procedures on the Toxin Binding Characteristics of BT-R1, a Common High-Affinity Receptor in Manduca sexta for Cry1A Bacillus thuringiensis Toxins Appl. Envir. Microbiol., June 1, 1998; 64(6): 2158 - 2165. [Abstract] [Full Text]
|
|
|
|
|
|
F. Rajamohan, O. Alzate, J. A. Cotrill, A. Curtiss, and D. H. Dean Protein engineering of Bacillus thuringiensis delta -endotoxin: Mutations at domain II of CryIAb enhance receptor affinity and toxicity toward gypsy moth larvae PNAS, December 10, 1996; 93(25): 14338 - 14343. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Gomez, D. I. Oltean, S. S. Gill, A. Bravo, and M. Soberon Mapping the Epitope in Cadherin-like Receptors Involved in Bacillus thuringiensis Cry1A Toxin Interaction Using Phage Display J. Biol. Chem., July 27, 2001; 276(31): 28906 - 28912. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |