| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
|
|
|
|||||||
|
|||||||||
(Received for publication, March 9, 1995; and in revised form, July 26, 1995) From the
The T-cell-specific protooncogene lck, a src-related tyrosine kinase, is under the control of two
promoters that give rise to transcripts differing only in their
5`-untranslated regions. The distal promoter is transcriptionally
active in both peripheral and thymic T-cells, whereas expression of the
proximal promoter is highest in developing thymocytes. The proximal
promoter has also been shown to be selectively activated in a number of
colon carcinoma cell lines. Approximately 570 base pairs of proximal
promoter sequence is required for expression in both T-cells and colon
carcinoma cell lines. Protein binding studies were initiated with an
oligonucleotide homologous to a region that, when deleted, causes an
increase in promoter activity in transgenic animals. Two proteins with
approximate molecular masses of 35 and 75 kDa were found to bind to
this region as determined by UV cross-linking studies. Absence of
specific protein binding is correlated with a high level of proximal
promoter expression. Competitive gel retardation analysis identified a
9-base pair binding site within the proximal lck promoter that
is necessary for repression of transcription in cells that contain
specific binding activity. Mutants of this binding site do not repress
transcription. Repression does not occur in a cell line that expresses lck and lacks this activity. These data support the hypothesis
that activation of lck transcription in colon carcinoma is
due, at least in part, to the loss of a transcriptional repressor.
In T-cells, expression of lck, a src-related
tyrosine kinase, is driven by two promoters located approximately 35
kilobases apart that give rise to transcripts differing only in their
5`-untranslated regions(1) . Transgenes containing lck proximal promoter sequences are actively transcribed in thymocytes
of transgenic animals, whereas in similar studies the distal promoter
can support transcription in both thymocytes and peripheral
T-cells(2, 3) . Therefore, these two apparently
independently acting promoters may lead to both the developmental and
cell type specific regulation of lck. In T-cells lck is physically associated with the CD4 and CD8 components of the
T-cell receptor complex (4, 5) and has been reported
to be associated with the In addition to its expression in T-cells and T-cell
lymphomas, lck is expressed in a subset of colon carcinoma
cell lines derived from metastatic lesions as well as in some small
cell lung carcinomas and B-cell
leukemias(12, 13, 14) . In solid tumor cell
lines, lck expression results from activation of the proximal
promoter, and no obvious rearrangements or amplifications of the gene
have been detected in these cell lines(12) . The proximal lck promoter, like that of other src family
members(15, 16) , is TATA-less and contains multiple
start sites for initiation of transcription. Previously, deletion
analysis has determined minimal promoter sequences required for both in vitro(17) and in vivo(2) expression of this gene. These studies identified a
potentially important region between positions -565 and
-433, which, when deleted, caused an increase in expression of
both a reporter gene and of lck driven by the proximal
promoter in transgenic animals(2) . In order to investigate the
transcriptional regulatory mechanisms involved in the expression of lck in colon cancer we studied this region of the proximal
promoter. We now report that a novel sequence is located at positions
-474 to -466 and specifically binds two proteins of
approximate molecular mass 35 and 75 kDa. This binding activity is
present in a number of cell lines that do not express lck as
well as in a cell line that expresses only small amounts of lck. Specific binding was not detected using extracts from two
cell lines expressing high levels of lck. The 9-bp (
Gel retardation analyses were performed with a
double-stranded oligonucleotide, synthesized by the SKI Microchemistry
Core Facility, representing sequences -560 to -420 of
upstream lck sequence:
AACAGGCACACATTTATCACTTTACTCCTATGGAGTTCTGCTTGATTCATCAGACAAA (19) . Other oligonucleotides used in this study were derived
from this sequence and are described in detail in Fig. 2A. The AP1 consensus oligonucleotide was
purchased from Stratagene, and the nuclear factor of activated T-cells
(NFAT) oligonucleotide was a gift from S. Nimer (Memorial
Sloan-Kettering Cancer Center). Double-stranded oligonucleotides were
prepared by slow annealing and purified on an 18% polyacrylamide gel,
and 25 ng was
Figure 2:
Localization of the binding site by
competition in a gel retardation assay. Panel A shows the
-520 to -460 oligonucleotide used as a probe in the gel
shift assay as well as the competitor oligonucleotides used to map the
binding site. Oligonucleotides 1-7 show the mutations, either C
to T or G to A conversions used as competitors. The deduced binding
site is shown within the -520 to -460 region in boldface letters. Panel B is the gel shift analysis
using HT29 nuclear extract and no competitor (0) or various
competitors at different levels of molar excess, 1000-fold molar excess
of a nonspecific competitor (N), the -520 to -460
oligonucleotide in 10, 100, and 1000-fold molar excess, and the 5`,
middle, 3`, and mutant 1-3 competitor oligonucleotides also in
1000-fold molar excess. Panel C is identical to panel B except that the last four lanes are competitions with
1000-fold molar excess of mutant oligos
4-7.
A search for known transcription
factors that bind the mapped sequence was performed using the
Transcription Factor Data Base from the National Center For
Biotechnology, National Library of Medicine.
Concatamerization of both the binding site and a corresponding
mutant was performed by cloning double-stranded oligonucleotides with
flanking BglII and BamHI sites into a pCAT vector
constructed by H.L. Grimes. By utilizing an EcoRI site within
the pCAT sequence and sequential BamHI/EcoRI and BglII/EcoRI ligations, the binding site was
duplicated and cloned into a TKCAT vector, also provided by H. L.
Grimes. All plasmids were sequenced using Sequenase in a procedure
described by the manufacturer (U.S. Biochemical Corp.).
Proper initiation of transcription of the TKCAT templates
was determined by RNase protection analysis (12) of total RNA
isolated from transfected cells. The Riboprobe was comprised of
sequences between -109 and +52 of the thymidine kinase (TK)
promoter.
Figure 1:
Gel retardation analysis. Panel A shows the result of a gel shift assay using oligonucleotide
complementary to -520 to -460 of the proximal lck promoter and 60 µg of crude nuclear extracts from HT29. The
following competitors were used: 0, no competitor; N,
a nonspecific oligonucleotide in 1000-fold molar excess and 10, 100,
and 1000-fold molar excess of the -520 to -460
oligonucleotide. In panel B, the analysis in panel A was repeated using COLO205 nuclear extracts. On the right of panel B a consensus AP1 oligonucleotide was used in a
gel retardation using COLO205 extracts and 1000-fold molar excess of a
nonspecific oligonucleotide (N) and the AP1 oligonucleotide (1000
Figure 3:
Molecular characterization of proteins
binding the -520 to -460 oligonucleotide. Panel A shows a 10% SDS-polyacrylamide gel electrophoresis gel indicating
the relative migration of the protein-DNA complexes from either HT29 or
SW620 nuclear extracts that bind to a doubly labeled probe
corresponding to -520 to -460 of the proximal promoter
after UV cross-linking. The molecular weight marker is listed at the left. The lane marked 0 is no competitor added; 100
Figure 4:
The effect of a site-directed mutation in
the mapped binding site on the proximal lck promoter.
Comparison in HT29 and SW620 of promoter activity of the wild type and
mutant measured by CAT activity, quantitated by phosphor imaging and
expressed as relative to the luciferase activity obtained by
cotransfection of Rous sarcoma virus-luciferase. Transfections were
done in triplicate in three independent experiments. A representative
experiment is shown.
Since loss of transcriptional repression at this site may not be
sufficient to fully activate this promoter in HT29, the effect of the
site on a minimal promoter was investigated. An oligonucleotide
containing the binding site was cloned in one or two copies just
upstream of the herpes simplex virus TK minimal promoter in a
CAT-containing expression vector (Fig. 5A) and these
constructs were used in transient transfection assays. The results of a
representative experiment for HT29 and SW620 are shown in Fig. 5, B and C, respectively. Comparison of CAT
activity driven either by the TK promoter alone or with one or two
sites just 5` to the TK promoter reveals the ability of this element to
completely abolish transcription from this minimal promoter element in
HT29 (Fig. 5A), and identical results were obtained in
HeLa (data not shown). These experiments were repeated in SW620, and
although complete repression was not documented, this site caused an
8-fold reduction in promoter activity in this cell line. As a control,
a mutant binding site, GGGCATACT, was also cloned upstream of the TK
promoter, and the transient assays were repeated. For both HT29 (Fig. 5B) and SW620 (Fig. 5C) a mutant
binding site that did not compete for protein binding in gel
retardation analysis had no effect on the transcriptional activity of
the TK promoter in either of these cell lines. To insure that the CAT
activity measured was due to accurate transcription initiation in the
TK promoter, RNase protection analysis was performed using a probe
containing the TK promoter. Proper initiation of transcription of the
TKCAT construct was observed (data not shown).
Figure 5:
The binding site functions to repress
transcription of the TKCAT construct. Graphs of transient expression of
TKCAT as compared with expression obtained with either one or two wild
type binding sites as well as mutant binding site (mut) cloned
5` of the TK promoter. All transfections were done in at least
triplicate in three different experiments. Diagrams of the constructs
used in this analysis are shown in panel A. The quantitation
of one experiment is shown in panel B and panel C using either HT29 or SW620, respectively. CAT assays were
quantitated by phosphor imaging and expressed as relative to luciferase
activity measured by luminometry (RLU).
Since this sequence
acts to repress transcription in cells containing specific binding
activity, transfection studies were performed in a cell line lacking
this activity. As shown in Fig. 6, the sequence does not
suppress the TK promoter in COLO205, a cell line that expresses high
levels of the proximal lck transcript. Proper transcript
initiation was also observed in this cell line (data not shown). Thus,
repression of promoter activity seems to require both the intact
binding sequence and the binding activity.
Figure 6:
Promoter activity is not affected by the
binding site in COLO205. Transfections were performed as in Fig. 5using COLO205 as the recipient cell line. CAT assays were
repeated three times in at least triplicate, quantitated by phosphor
imaging, and expressed relative to luciferase activity. A
representative experiment is shown.
In this study we have defined a sequence in the human lck proximal promoter located at positions -474 to -466,
which acts as a strong repressor of transcription. The approximate
molecular masses of proteins that specifically bind this sequence are
35 and 75 kDa. The binding activity was detected in four human tumor
cell lines; three of these do not express lck (HT29, T84, and
HeLa), and the other expresses nominal amounts (SW620). Specific
binding was not detected in two cell lines that express high levels of
proximal lck promoter transcripts. This sequence acted to
repress transcription of a heterologous promoter in cell lines that
contained the binding activity but had no effect on the promoter in a
cell line lacking this activity. These data suggest that activation of
the proximal lck promoter is at least partly due to a loss of
transcriptional repression mediated by the loss of specific protein
binding to this 9-bp sequence. These findings are consistent with
results from transgenic mice experiments, which demonstrated protein
binding to an analogous 50-bp region in the murine proximal promoter
with nuclear extracts from spleen, a tissue in which this promoter is
inactive, and a lack of binding in cells expressing the
transgene(2) . Comparisons between mouse and human have
demonstrated a high degree of sequence conservation in the proximal
promoter element, indicating that this promoter may be similarly
regulated in both species. This conservation also extends to the
binding site mapped to -474 to -466 in this study (7/9-bp).
These data indicate that the murine system may have a functionally
similar transcriptional repressor. Our data, which show measurable
promoter activity using 570 bp of the human proximal promoter sequence,
varies somewhat from previously reported transient assays in which,
when using identical sequence, deletion to -512 was necessary to
show modest promoter activity(17) . In transgenic animals,
however, 584 bp of the murine proximal promoter sequence was sufficient
for promoter activity(2) . In this report CAT activity was
measured rather than primer extension of transient Although the region from
-520 to -460 was shown to contain a repressive element (2) and gel retardation experiments correlated a lack of
binding to this region with a high level of lck expression,
site-directed mutagenesis of the binding site located at -474 to
-466 had little effect on the expression of the intact 570-bp
promoter in transient assays in SW620. However, the binding site does
repress the transcriptional activity of a heterologous promoter in this
cell line. Since the proximal lck promoter is activated in
SW620 and deletion analysis to -433 of the human promoter had
little effect on transcription in SW620(17) , it is possible
that the promotor is activated at another site. However, a reproducible
2-fold increase in promoter activity was observed in HT29. It is likely
that other factors are required for full activation of this promoter. To determine the effect of the binding site on a minimal promoter
the binding site was cloned upstream of a TK promoter containing CAT
vector and used in transient transfection assays. The binding site
acted to completely abolish transcriptional activity of this minimal
promoter in both HeLa and HT29 and reduced transcriptional activity
8-fold in SW620. A mutated site that abolishes protein binding in gel
retardation experiments had no effect on promoter activity, indicating
that repression was sequence-specific. Since the binding site had no
effect of transcription from this promoter in COLO205 it appears that
the specific binding proteins, which were not detected by gel
retardation, are either absent in this cell line or at least not able
to bind to this site. This paper describes a novel binding site in
the proximal lck promoter that acts as a strong repressor of
transcription in cell lines that either do not express proximal lck transcripts (HT29 and HELA) or only express small amounts (SW620).
The correlation of repressor activity, protein binding activity, and lck expression suggests that this repressor does regulate lck transcription. Whether expression of the wild type lck transcript in colon carcinoma regulates aspects of the transformed
phenotype remains to be established. However, the loss of a
transcriptional repressor may have more global regulatory effects in
colon cancer. In addition, the proximal lck promoter is most
active in developing thymocytes; the transcriptional repressor complex
defined in this report may play an important role in the silencing of
this promoter in peripheral T-cells. Purification and cloning of the
binding proteins will allow further characterization of the function of
this repressor.
Volume 270,
Number 46,
Issue of November 17, 1995 pp. 27538-27543
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
-chain of the interleukin-2
receptor(6) . Although the exact functions of lck in
T-cells are not known, it has been shown to be an essential component
of the T-cell receptor signaling pathway (7, 8) and
may also be involved in T-cell maturation in the thymus(9) . lck has been classified as a protooncogene because of its
homology to src and its activation by promoter insertion in
certain retroviral induced murine lymphomas (1, 3) and
by translocation in human T-cell leukemias(10) . Also,
transfection of NIH3T3 cells with an lck mutant that encodes
an activated protein kinase results in malignant transformation (11) . However, the functional significance of overexpression
of wild type lck to the transformed phenotype has yet to be
determined.
)sequence acts to repress a heterologous minimal promoter
in cell lines that contain specific binding activity. Repression does
not occur in a colon carcinoma cell line that expresses high levels of lck and lacks this binding activity. Mutants of the sequence
that do not bind the proteins do not repress transcription. We propose
that activity of the proximal lck promoter is regulated by a
repressor that binds to this sequence and that expression of lck in colon cancer cell lines is, in part, due to loss of this
repression.
Nuclear Extracts and Gel Retardation
Analysis
Nuclear extracts were prepared essentially as described
by Dingam et al.(18) . Protein concentrations were
determined using a Bradford assay (Pierce), and aliquots were stored in
liquid nitrogen.P-end-labeled using T4 DNA kinase (Life
Technologies, Inc.) by standard methods(20) . Gel shifts were
done as described(21) . Gel shift buffer contained 20
mM Hepes, pH7.9, 75 mM NaCl, 0.5 mM EDTA, 1
mM dithiothreitol, 10 mM MgCl
. Each
reaction contained approximately 0.05 ng of oligonucleotide (20,000
cpm), 6 mg of BSA, 4 µg of poly(dI-dC), and 60 µg of crude
extract. These reactions were incubated at 30 °C for 30 min,
electrophoresed on a nondenaturing 6% acrylamide gel, dried, and
subjected to autoradiography.
UV Cross-linking
Probes were generated by
annealing complimentary oligonucleotides (as described above), one 30
bases shorter than the other and labeled by extension with Klenow (Life
Technologies, Inc.) using a synthesis mixture containing 0.25 mM dATP, 25 µM each dCTP and dGTP, 0.5 µM each of [
-P]dCTP and
[
-P]dGTP and 0.25 mM
bromodeoxyuridine (Sigma). Gel retardation reaction mixtures were
generated as described above. For some experiments, the 6% acrylamide
gel was wrapped in plastic and cross-linked on a UV transilluminator
(Fisher) for 30 min on each side. Each complex was excised from the gel
and run on a 10% SDS-polyacrylamide gel, dried, and exposed to x-ray
film. For other experiments, the gel shift reaction mixture was
cross-linked by a transilluminator at a distance of 10 cm for 30 min,
loaded onto a 10% SDS-polyacrylamide gel, dried, and subjected to
autoradiography.
Cloning and Site-directed Mutagenesis
All
subclones used in this study were derived from a 1.9-kilobase BamHI-EcoRI upstream lck fragment, provided
by R. Benarous(22) . A 650-bp PstI-BamHI
fragment was subcloned into Bluescript KS by standard
methods. Site-directed mutagenesis was performed as described (23) . Both wild type and mutant fragments were subcloned into
pCAT Basic (Promega) by standard methods(20) .
Transfections
All cell lines were maintained in
RPMI 1640 supplemented with 5% fetal bovine serum with the exception of
HeLa, which was maintained in Dulbecco's minimal essential/F12,
5% fetal bovine serum. All cells were transfected using Lipofectin
(Life Technologies, Inc.) by procedures described by the manufacturer.
Cells were cotransfected with 0.25 µg of a Rous sarcoma
virus-luciferase vector kindly provided by E. Lai. Each plasmid used
for transfection was titrated to insure that expression was a linear
function of DNA concentration and that no competition between the
promoters occurred. Cells were lysed after 24 h using 75 µl of 1
reporter lysis buffer (Promega) containing 0.2 M phenylmethylsulfonyl fluoride. A portion of the lysate was assayed
for luciferase activity using a Bertold Lumat luminometer. CAT assays
were performed as described (24) with minor modifications.
Briefly, 50 µl of lysate was incubated with a solution containing
25 µCi of [
C]acetyl-coenzyme A, 5 mM acetyl-coenzyme A, and 0.8 mM chloramphenicol for 1 h at
37 °C. This mixture was extracted with 1 ml of ethyl acetate, dried
by lyophilization, resuspended in 30 µl of ethyl acetate, spotted
onto TLC plates (Whatman), and chromatographed in 95% chloroform, 5%
methanol. All CAT assays were quantitated using a Fuji phosphor-imaging
system.
Gel Retardation Analysis of Protein Binding to
-520 to -460 of the Proximal lck Promoter
Deletion
analysis of the proximal lck promoter has allowed the
identification of a region that, when deleted, causes an increase in
transcription of both reporter genes and of lck in transient
assays and in transgenic animals(2, 17) . To
investigate the potential importance of this region to the expression
of lck in colon carcinoma, gel retardation experiments were
performed with an end-labeled 60-bp oligonucleotide representing
sequences from -520 to -460 of the proximal promoter and
nuclear extracts isolated from a variety of cell lines. The results of
one of these experiments are shown in Fig. 1. In panel A nuclear extracts from HT29, a well differentiated primary colon
carcinoma cell line that does not express lck, were analyzed.
A number of complexes are observed in the lane marked 0 (no competitor). To assess the specificity of the complexes,
competition analysis was performed using the unlabeled -520 to
-460 oligonucleotide in 10, 100, and 1000-fold molar excess (lanes 3-5) as well as a 1000-fold molar excess of a
nonspecific oligonucleotide (lane N). 1000-fold molar excess
of the specific oligonucleotide reduces the level of two of the
complexes (arrows). The upper complex is occasionally resolved
into two closely migrating complexes that show the same competition
pattern (see below). In panel B, the experiment was repeated
with nuclear extracts isolated from COLO205, an undifferentiated human
colon carcinoma cell line that expresses high levels of lck.
As shown in the left side of panel B, COLO205 nuclear
extracts do not specifically shift this oligonucleotide. COLO205
extracts do specifically shift an oligonucleotide containing a
consensus AP1 site as shown in the right portion of panel
B. A summary of the results of the gel retardation experiments
performed in several cell lines is shown in Table 1. Protein
binding is tabulated as a function of lck expression, as
determined by RNase protection analysis (24, 31) and
quantitated by phosphor imaging. The two cell lines that express high
levels of lck (CEM, a human T-cell leukemia cell line, which
expresses high levels of lck from both the proximal and distal
promoters(24, 31) , and COLO205) do not show specific
binding to the -520 to -460 oligonucleotide. Three cell
lines that do not express lck (HT29, HeLa, a well
differentiated cervical carcinoma cell line, and T84, another well
differentiated colon carcinoma cell line) show specific binding to the
-520 to -460 oligonucleotide. SW620, a human colon
carcinoma cell line derived from a lymph node metastasis expresses
small amounts of lck and also specifically binds this
oligonucleotide. Thus, in the two cell lines tested that express high
levels of lck, specific protein binding to the -520 to
-460 oligonucleotide is not detected.
).
Mapping of the Protein Binding Site in HT29 and
SW620
A competitive gel retardation analysis was used to map the
binding site of this protein(s). A series of wild type and mutant
oligonucleotides representing different regions of the -520 to
-460 oligonucleotide (Fig. 2A) were added in 1000-fold
molar excess as competitors in the gel retardation assay. The first
five lanes of Fig. 2B demonstrate the specific
binding to the original -520 to -460 oligonucleotide.
Neither the most 5` 30-bp oligonucleotide, nor the middle 30-bp
oligonucleotide competed for binding of the protein. However, the most
3` 30-bp oligonucleotide competed with the original oligonucleotide,
localizing the binding site to this region. The 3` oligonucleotides
containing 6 bp changes (Fig. 2A) were then analyzed
similarly. As shown in Fig. 2B, oligonucleotides 2 and
3 did not compete, further narrowing the binding region.
Oligonucleotides, 4, 5, 6, and 7, with 3 bp changes were used as
competitors in this analysis (Fig. 2, A and C). Of these only oligonucleotides 5 and 6 did not compete,
thus mapping the binding site to the sequence TTTCATCAG, represented in boldface letters within the original -520 to -460
oligonucleotide in Fig. 2A. Identical results were
obtained using nuclear extracts isolated from both HT29 and SW620. As
described above, the upper complex shown in Fig. 2B is
resolved into two complexes as seen in Fig. 2C; the
significance of this is, at this time, unknown. Therefore, by
competitive gel retardation the binding site was mapped to positions
-474 to -466 of the lck proximal promoter.UV Cross-linking Defines Two Proteins of Different
Molecular Weight
To determine the approximate molecular weight
of proteins that bind to the oligonucleotide, a -520 to
-460 probe was used in UV cross-linking studies. HT29 nuclear
extracts were incubated with a labeled probe, exposed to a UV
transilluminator, and immediately subjected to SDS-polyacrylamide gel
electrophoresis. The results of this analysis are shown in Fig. 3A. Three protein-DNA complexes migrating at 35, 65,
and 75 kDa are visible in the lane containing no competitor (lane
0). Upon competition with either 100- or 1000-fold molar excess of
the unlabeled -520 to -460 oligonucleotide, two proteins
were shown to bind specifically and are indicated by the arrows at the right of Fig. 3A. Since covalently
bound oligonucleotides have a limited effect on the migration of the
cross-linked proteins in SDS-polyacrylamide gel electrophoresis
gels(4) , the approximate molecular weight of the proteins that
bind this oligonucleotide are 35 and 75 kDa. To determine whether
similarly sized proteins were present in both the complexes observed in
the gel retardation assays, a similar gel was cross-linked in situ on a UV transilluminator, and both the upper and lower complexes
described in Fig. 1and Fig. 2were excised and run on an
SDS-polyacrylamide gel electrophoresis gel. The result of this
experiment is shown in Fig. 3B. These experiments
demonstrated that both proteins detected by in the solution UV
cross-linking studies were present in each complex.
and 1000 indicate where either 100- or 1000-fold molar
excess of specific competitor was used. Panel B shows the
migration patterns of both the upper and lower protein-DNA complexes
excised from gel retardations using either HT29 or SW620 nuclear
extracts.
The Binding Site Is Required for Transcriptional
Repression
To begin to determine the functional significance of
the binding site in the lck proximal promoter, a 650-bp PstI-BamHI fragment containing 570 bp of promoter
sequence was cloned into a Basic CAT vector and cotransfected with a
Rous sarcoma virus-luciferase reporter gene into SW620, HT29, HeLa, and
COLO205 cells. Resultant CAT activity for SW620 and HT29 is shown in Fig. 4. These experiments demonstrated that the fragment
containing 570 bp of lck promoter sequence was sufficient for
expression of CAT activity in SW620 and COLO205 but not in HT29 or
HeLa, in which it was only slightly active. Transient assays were
performed using the wild type proximal lck promoter and a
proximal promoter carrying a mutation in the binding site (GGGCATCAG),
which abolished protein binding in gel retardation experiments. The
results of a representative experiment are shown in Fig. 4.
SW620 expresses high levels of CAT activity from the wild type lck promoter, while in HT29 this promoter is only slightly active.
These data suggest that the proximal lck promoter is activated in trans in SW620. The mutation in the lck promoter
has no detectable effect on transcription in SW620 and shows a 2-fold
increase in transcription over the wild type promoter in HT29 cells.
-globin mRNA,
possibly allowing for the detection of lower amounts of promoter
activity. The binding site located within the -520 to -460
oligonucleotide was mapped to the sequence TTTCATCAG at positions
-474 to -466 by competitive gel retardation assays. A
computer search of the Transcription Factor Data Base revealed no
strong homology to known transcription factor binding sites. However,
we noted some homology to the 3` portion of the composite binding site
for NFAT within the interleukin-2 promoter, i.e. TTTCATACAG,
the portion thought to bind Fos or
Jun(25, 26, 27) . The proteins detected in
this study are unlikely to be identical to those in the T-cell NFAT
complex, as neither an oligonucleotide containing an NFAT motif nor one
containing an AP-1 motif competes in 1000-fold molar excess in a gel
retardation assay (data not shown).
)
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  J D Ceci, C P Patriotis, C Tsatsanis, A M Makris, R Kovatch, D A Swing, N A Jenkins, P N Tsichlis, and N G Copeland Tpl-2 is an oncogenic kinase that is activated by carboxy-terminal truncation. Genes & Dev., March 15, 1997; 11(6): 688 - 700. [Abstract] [PDF]
|
|
|
|
 |
|
 A. Yamada, S. Takaki, F. Hayashi, K. Georgopoulos, R. M. Perlmutter, and K. Takatsu Identification and Characterization of a Transcriptional Regulator for the lck Proximal Promoter J. Biol. Chem., May 18, 2001; 276(21): 18082 - 18089. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |
ABSTRACT
