|
Volume 270,
Number 48,
Issue of December 1, 1995 pp. 28668-28675
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The Involvement
of Threonine 160 of Cytochrome b of Rhodobacter
sphaeroides Cytochrome bc Complex in Quinone
Binding and Interaction with Subunit IV (*)
(Received for publication, July 20,
1995; and in revised form, September 20, 1995)
Michael W.
Mather (§),
,
Linda
Yu
,
Chang-An
Yu (§)
From the Department of Biochemistry and Molecular Biology,
Oklahoma State University, Stillwater, Oklahoma 74078
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
The cytochrome b subunit (subunit I) of the
ubiquinol-cytochrome c reductase (bc complex) is thought to participate in the formation of two
quinone/quinol reaction centers, an oxidizing center (Q )
and a reducing center, in accordance with the quinone cycle mechanism.
Threonine 160 is a highly conserved residue in a segment of subunit I
that was shown to bind quinone and is placed near the putative Q site in current models of the bc complex. Rhodobacter sphaeroides cells expressing bc complexes with Ser or Tyr substituted for Thr grow
photosynthetically at a reduced rate, and cells expressing the mutated
complexes produce an ``elevated'' level of the bc complex. The Ser substitution also affects the
interaction of subunit IV with subunit I. Replacement of Thr by Ser results in about a 70% loss of the activity in the
purified complex, whereas substitution by Tyr lowers the activity by
more than 80%. Both replacements lower the apparent K for ubiquinol. Electron paramagnetic
resonance (EPR) spectroscopy shows that in the Ser substituted complex,
the environments of the Rieske iron-sulfur cluster in subunit III and
the high potential cytochrome b (b ) in
subunit I have been modified. The spectra of the Ser and
Tyr iron-sulfur clusters have become redox-insensitive,
with a line shape resembling that of the native complex in the fully
reduced state. The EPR signal of b in the
Ser complex is shifted from g = 3.50 to g = 3.52, but otherwise the line shape is very similar
to the spectrum of the native complex. Most of these results are
consistent with current ideas regarding the structure and function of
Q in the bc complex, except for the
alteration of the b EPR feature, because this
heme is not thought to be located in proximity to Q .
Immunoblotting analysis showed that the Ser or Tyr substituted complex
contained significantly less than a stoichiometric amount of subunit
IV. The enzymatic activity of mutated bc complex
was found to be activable by the addition of purified subunit IV. These
results indicate that Thr plays an important role in the
structure and/or function of the bc complex.
INTRODUCTION
The ubiquinol-cytochrome c reductase (or the bc complex) is a key component of the
energy-conserving electron transfer chains of mitochondria and many
respiratory and photosynthetic bacteria. It catalyzes the oxidation of
ubiquinol by cytochrome c and the coupled vectorial
translocation of protons to generate a transmembrane pH gradient.
Although many aspects of the structure and function of this enzyme
complex have been
elucidated(1, 2, 3, 4, 5, 6, 7) ,
the nature of the protein structures involved in the binding and
reactions of ubiquinone and ubiquinol remain an active area of inquiry,
and the identification of the residues involved in subunit interaction
is in the initial stages. The cytochrome bc complex from the purple photosynthetic bacterium Rhodobacter
sphaeroides has been purified and characterized in several
laboratories(8, 9, 10, 11, 12, 13) .
The purified complex contains four protein subunits with five redox
cofactors: two b-type cytochromes (b and b ), one c-type cytochrome
(cytochrome c ), one high potential iron-sulfur
cluster (the Rieske [2Fe-2S]), and at least one ubiquinone
(Q). ( )This bc complex is functionally
analogous to mitochondrial ubiquinol-cytochrome c reductase,
and the three largest subunits are homologous to their mammalian
counterparts (14) . The degree of sequence similarity is
particularly striking among the cytochrome b polypeptides from
a wide range of species (2) . The cytochrome b polypeptide contains the two b hemes and participates in
the ubiquinol oxidation and ubiquinone reduction reactions of the Q
cycle(6) . He et al.(15) have identified two
regions of the bovine cytochrome b subunit that may
participate in quinone binding using specific labeling with
photoreactive quinone analogs. We have created a number of relatively
conservative amino acid replacements in the region of the R.
sphaeroides protein that corresponds to the first of these
putative quinone-binding regions in the bovine cytochrome b.
While screening the chromatophore membranes isolated from
photosynthetically grown R. sphaeroides cells expressing the
various mutated forms of cytochrome b, we noted that the
substitution of a serine for threonine at position 160 resulted in the
loss of about two-thirds of the ubiquinol-cytochrome c reductase activity in the membranes relative to membranes from
control cells. Combined with the fact that this threonine residue is
one of the most conserved amino acids in the primary structure of
cytochrome b, this result may indicate that Thr is an important residue involved in the structure and function of
the bc complex. Here we report the purification
and further characterization of the complexes containing conservative
substitutions at position 160 of cytochrome b, which affect
the activity of the enzyme and the properties of redox centers residing
in separate subunits. In general, the results are consistent with
current models, placing this region of cytochrome b at or near
the quinol-oxidizing center and the intersubunit interface with the
iron-sulfur subunit. However, the substitution of serine for threonine
160 also has an effect on cytochrome b , which is
not generally thought to interact directly with the quinol-oxidizing
center. Thr may also play a role in the proper
interaction of subunit IV and cytochrome b.
EXPERIMENTAL PROCEDURES
MaterialsDodecyl maltoside was
purchased from Anatrace. All other chemicals were of reagent grade or
of the highest quality commercially available. Plasmids pUC4K (16) and pSL1180 (17) were obtained from Pharmacia
Biotech Inc. Restriction endonucleases and DNA modifying enzymes were
purchased from Promega, Life Technologies, New England Biolabs, U. S.
Biochemical Corp., Perkin-Elmer, and Pharmacia. Escherichia coli strains were purchased from BRL Life Technologies (DH5 ),
Invitrogen (INV F`), and Promega (BMH-71-18 mutS). E.
coli S17-1(20) , R. sphaeroides BC17(21) , and the plasmid pRK415 (18) were
generously provided by Dr. R. B. Gennis (University of Illinois).
pSup5Tp (19) was a gift from Dr. T. Donahue (University of
Wisconsin). Wild-type R. sphaeroides NCIB8253 was generously
provided by Dr. R. Niederman (Rutgers University).
Growth of BacteriaE. coli were
grown at 37 °C on LB medium. Extra rich media, e.g. TYP(22) , were used in procedures for the rescue of
single-stranded DNA or the purification of low copy number
plasmids(23) . Plasmid-bearing R. sphaeroides BC17
cells were grown at 30 °C on an enriched Sistrom's medium (24) containing 5 mM glutamate and 0.2% casamino
acids. The pH of the medium was adjusted to 7.1 with a solution of 6 M NaOH and 2 M KOH to increase the sodium ion content
of the medium to a more optimal level(24) . Photosynthetic
cultures of R. sphaeroides were grown essentially as
described(25) . Cells harboring mutated fbc genes on
the pRK415-derived plasmids described below were grown
photosynthetically for one or two serial passages only to minimize any
pressure for reversion. The inoculation volume used for photosynthetic
cultures was always at least 5% of the total volume. Antibiotics were
added at the following concentrations: ampicillin, 100-125
mg/liter; tetracyline, 10-15 mg/liter for E. coli and
0.75-1.0 mg/liter for R. sphaeroides; kanamycin sulfate,
30-50 mg/liter for E. coli and 20-25 mg/liter for R. sphaeroides; trimethoprim, 85-100 mg/liter for E.
coli and 25-30 mg/liter for R. sphaeroides.
Construction of Mutation(s)Mutations
were constructed by site-directed mutagenesis using the Altered-Sites
system from Promega, and oligonucleotides were synthesized at the OSU
Recombinant DNA/Protein Core Facility. The successfully employed
oligonucleotides were CTGGGGCGCCAGCGTGATCAC for the Thr Ser mutation and CCTTCTGGGGCGCCTACGTGATCACCGGCCT for the
Thr Tyr mutation. The template DNA fragment for
mutagenesis was obtained from a previously cloned 6.7-kilobase pair BamHI fragment, which was isolated from R. sphaeroides NCIB 8253 ( )and contains the fbcFBC operon
encoding the three largest subunits of the cytochrome bc complex. The 3.5-kilobase pair NcoI-BstXI
DNA fragment containing the fbcFBC operon was subcloned from
the BamHI clone into pALTER-1 (Promega; previously designated
pSELECT-1). In order to facilitate sequence verification and transfer
into the expression vector following mutagenesis, the template was
modified to reduce the size of the DNA fragment containing the target
sites for mutagenesis. For this purpose we introduced a silent mutation
creating a PinAI site (at position 579 in the fbcB
gene) and eliminated a BstEII site present outside of the
coding regions in the cloned R. sphaeroides DNA fragment, so
that the target region for mutagenesis is contained in a 200-base
pair fragment flanked by unique BstEII and PinAI
sites (Fig. 1). We also introduced a unique XbaI site
between the fbcB and fbcC genes. The nucleotide
sequence from just upstream of the BstEII site through the PinAI site was determined and found to be identical to the
published sequence of the fbcB gene from R. sphaeroides Ga(21) , except for the single base changed in creating
the PinAI site. This engineered fbc operon was
subcloned into the expression vector (see below), conjugated into R. sphaeroides BC17 (a strain from which most of the fbcFBC operon has been deleted(21) ), and found to
support the same rate of photosynthetic growth as the original
3.5-kilobase pair fbc clone.
Figure 1:
Plasmids
constructed for mutagenesis, transfer, and expression of the R.
sphaeroides fbc operons containing mutated fbcB genes
encoding altered cytochromes b. A, pSELNB3503 was
derived from pALTER-1 (pSELECT-1) by insertion of a 3.5-kilobase pair R. sphaeroides DNA fragment containing the fbc operon
(see ``Experimental Procedures''). fbcF, fbcB, and fbcC denote the genes encoding the
iron-sulfur subunit, the cytochrome b subunit, and the
cytochrome c subunits, respectively. The
restriction sites marked by asterisks were engineered in
vitro to facilitate verification and transfer of the segment of
the fbcB gene containing the mutations (see text). Only
selected restriction sites are shown. B and C,
broad-host-range plasmids pRKDNB3503, containing the engineered
wild-type fbcFBC operon, and pRKDNB35KmBP were constructed to
facilitate subcloning, conjugal transfer to R. sphaeroides,
and expression of cytochrome bc complexes
containing altered cytochromes b.
Construction of Vectors for the Expression of Mutated
Complexes in R. sphaeroidesThe gene encoding a
trimethoprim-resistant dihydrofolate reductase from R388 (26) (excised from pSup5Tp) and the engineered fbc-containing insert from pSELNB3503 were combined into the
multiple cloning site polylinker of pSL1180 by a series of in vitro manipulations. The resulting 4400-base pair fragment containing
the dihydrofolate reductase gene and the R. sphaeroides fbc operon were subcloned together into the HindIII and EcoRI sites of the broad host range vector pRK415, producing
pRKDNB3503 (Fig. 1B). For the purpose of subcloning the
200-base pair BstEII-PinAI fragments from
pSELNB3503 following mutagenesis, pRKDNB35KmBP (Fig. 1C) was constructed by inserting the kanamycin
resistance cassette from pUC4K between the BstEII and PinAI sites of pRKDNB3503. Using pRKDNB35KmBP to receive the
mutated BstEII-PinAI fragments eliminates the
possibility of retaining or recloning the wild-type fragment when
attempting to subclone the mutated fragments into the expression vector (27) . Loss of kanamycin resistance was then used to screen for
recombinant plasmids. pRKDNB3503 derivatives were conjugated into R. sphaeroides BC17 (21) from E. coli S17-1 (20) using a plate mating procedure
essentially as described(28, 29) .
Other Recombinant DNA TechniquesGeneral
molecular genetic methods were performed essentially as described in
Sambrook et al.(30) . DNA plasmids and restriction
fragments were recovered from preparative agarose gels according to
Qian and Wilkinson (31) after staining with methylene blue
(this avoids exposure to ultraviolet light). Nucleoside sequencing was
performed with an Applied Biosystems model 373 automatic DNA sequencer.
Sequencing of mutagenized DNA templates was conducted by amplification
of a DNA segment including the entire BstEII to PinAI
sequence using polymerase chain reaction followed by conversion to
single-stranded form by treatment with T7 gene 6 exonuclease as
described(32) . The presence of engineered mutations and the
absence of other changes in the template region was reconfirmed once
for each mutant clone following transfer to and expression in R.
sphaeroides BC17 by purifying the expression plasmid from an
aliquot of a photosynthetic culture and determining the nucleotide
sequence as described above.
Isolation of Chromatophores and Purification of bc1
ComplexesChromatophores were prepared from frozen cell
paste of photosynthetically grown R. sphaeroides BC17
complement and mutant strains by proportionally scaling down the
previously described procedure (33) with minor modifications.
To prepare chromatophores for preliminary characterization in
situ, the initial clarification step by low speed centrifugation
was modified by increasing the speed to 38,000 g and
the duration to 45 min (34) in order to reduce the light
scattering of the chromatophore suspensions.The cytochrome bc complexes were purified from chromatophores by
a modification of the procedure of McCurley et
al.(11) . Dodecyl maltoside was used to solubilize the bc complexes and 20% glycerol was included during
the solubilization and loading of the first column (after Andrews et al.(12) ) to help stabilize mutated bc complexes in case they prove to be less stable
to the extraction conditions. Chromatophore suspensions were adjusted
to about 18 µM cytochrome b by addition of 50
mM Tris-HCl (pH 8.0 at 0 °C) containing 20% glycerol, 1
mM MgSO , and 1 mM phenylmethylsulfonyl
fluoride. Dodecyl maltoside (10% solution in 50 mM Tris-HCl
(pH 8.0 at 0 °C) containing 20% glycerol and 1 mM MgSO ) was added to the chromatophore suspension to
0.525 mg/nmol cytochrome b, and the mixture was stirred for 30
min at 0 °C and then centrifuged at 27,000 g for
30 min. The hard precipitates at the bottom of the centrifuge tubes
were discarded, and the loose pellets and supernatants were collected.
4 M NaCl was added to a final concentration of 0.1 M,
and the suspension was stirred for 1 h at 0 °C. The mixture was
centrifuged at 200,000 g for 90 min. The supernatants
were collected and applied to a DEAE-Biogel A column equilibrated with
50 mM Tris-HCl (pH 8.0 at 0 °C) containing 20% glycerol,
100 mM NaCl, 1 mM MgSO , 5 mM NaN , and 0.01% dodecyl maltoside (TMGD buffer
containing 100 mM NaCl). The column was washed with, in
sequence, 3.33 volumes of TMGD buffer containing 100 mM NaCl,
2 volumes of TMD buffer (TMGD buffer without glycerol) containing 150
mM NaCl, and 2 volumes of TMD buffer containing 200 mM NaCl. The crude cytochrome bc complex was
eluted from the column with TMD buffer containing 300 mM NaCl.
The collected bc complex was diluted with one-half
volume of TMD containing 40% glycerol and applied to a DEAE-Sepharose
CL-6B column equilibrated with TMD buffer containing 100 mM NaCl. The column was washed with 2 column volumes each of TMD
buffer containing 150 mM NaCl, 200 mM NaCl, and 250
mM NaCl. The nearly pure cytochrome bc complex was eluted with TMD buffer containing 375 mM NaCl and concentrated using a Centriprep-10 concentrator to a
final concentration of 100 µM cytochrome b or
greater. Glycerol was added to about 20%, and the purified complex was
stored at -80 °C. The purity of the bc
preparations estimated by SDS-PAGE was 90-95%.
Biochemical and Spectroscopic
MethodsUbiquinol-cytochrome c reductase activity
was measured at 23 °C by following the reduction of cytochrome c at 550 nm in a Shimadzu UV2101PC spectrophotometer. A
millimolar extinction coefficient of 18.5 was used in calculating the
reduced cytochrome c concentration. The nonenzymatic reduction
of cytochrome c by ubiquinol was determined under the same
conditions in the absence of enzyme. Chromatophore preparations were
diluted to a concentration of 1.25-7.5 µM cytochrome b, depending on the expected specific activity of the sample,
with a solution of 50 mM Tris-HCl (pH 8.0 at 0 °C), 1
mM MgCl ; bc preparations were
diluted with 50 mM Tris-HCl (pH 8.0 at 0 °C), 250 mM NaCl, 1 mM MgCl , 10% glycerol, and 0.005%
dodecyl maltoside. Chromatophores and bc
preparations were assayed by addition of 2-5 µl of suitably
diluted samples to a 1.0-ml assay mixture containing 100 mM sodium/potassium phosphate buffer (pH 7.4), 0.3 mM EDTA,
50 µM cytochrome c, and 10 µM
2,3-dimethoxy-5-methyl-6-(10-bromodecyl)-1,4-benzoquinol; 30 µM potassium cyanide was added to assays of chromatophores to inhibit
oxidase activity. Protein was determined by the Lowry method (35) with the inclusion of 1% sodium dodecyl sulfate in the
samples and standards. For accurate measurement of the protein content
of chromatophores, interfering pigments were removed by
acetone/methanol extraction as described(36) . Cytochrome b(37) , cytochrome c (38) ,
ubiquinone(39, 40) , and bacteriochlorophyll (41) were determined according to published methods. SDS-PAGE was performed according to Laemmli (42) and to
Schägger and von Jagow (43) using a Bio-Rad
Mini-Protean dual slab vertical cell. Disaggregation of the sample and
resolution was best obtained using a freshly prepared solubilization
buffer containing 5% SDS, 10 mM EDTA (pH 8.0), 5%
2-mercaptoethanol, 1 mM phenylmethylsulfonyl fluoride, and 10%
glycerol, followed by separation on a 16.5% polyacrylamide gel as
described(43) . Samples were incubated for 1-2 h at
30-37 °C immediately prior to loading onto the gel.
Chromatophores were extracted with acetone/methanol (36) before
solubilization. Western blotting was carried out as described (44) using rabbit antibody raised against purified subunit IV (33) or against purified subunit II (cytochrome c )(45) . The polypeptides separated in the
SDS-PAGE gel were transferred to a 0.2-µm polyvinylidene difluoride
membrane for immunoblotting. Goat anti-rabbit IgG conjugated to
alkaline phosphatase or protein A conjugated to horseradish peroxidase
was used as the second antibody. Low temperature EPR spectra were
obtained with a Bruker ER 200D spectrometer equipped with an Air
Products flow cryostat. Some spectra were recorded at 77 °K using a
liquid N Dewar. Instrument setting details are provided in
the legends of the relevant figures.
RESULTS
Expression and Purification of Cytochrome
bc Complexes Containing Altered Cytochrome
bExpression of cytochrome b with the conservative
substitution Thr Ser (T160S) as part of an fbc operon contained on a low copy number plasmid in R.
sphaeroides BC17 yields cells capable of photosynthetic growth at
a retarded rate (maximal doubling rate about 50-60% of that
obtained with the complement strain).The properties of chromatophore
membranes isolated from these cells are summarized in Table 1together with the properties of membranes from complement
cells expressing the wild-type cytochrome b also encoded by a
plasmid-borne gene. The specific ubiquinol-cytochrome c reductase activity of membranes from the mutant cells is
significantly reduced (25-40% of the activity found in complement
membranes). On the other hand, these membranes also contain an
apparently elevated level of the complex, as indicated by the elevated
level of cytochrome b, relative to that found in membranes
prepared from complement cells (membranes from complement cells already
possess two to three times the amount of cytochrome b found in
wild-type R. sphaeroides, presumably due to a gene dosage
effect; data not shown, but see (21) ). This enhanced level of
cytochrome b was found in the membranes of each of three
independently isolated mutants containing the T160S alteration.
The
mutation Thr Tyr (T160Y) was also subsequently
prepared. R. sphaeroides cells expressing this variant of
cytochrome b are also able to grow photosynthetically at a
reduced rate. The cytochrome b content of membranes from these
cells is also elevated relative to membranes from complement cells (Table 1) but to a slightly lesser extent than membranes
containing the T160S complex. The specific ubiquinol-cytochrome
reductase activity of these membranes was even lower than that of
membranes containing the T160S complex, only 10-20% of that found
in complement membranes. The bc complexes were
extracted with dodecyl maltoside and purified by a modification of
described methods (see ``Experimental Procedures'') from
chromatophore membranes of Rs BC17 cells expressing the
Thr Ser or Tyr mutations and from membranes of
BC17 expressing the cloned wild-type complex (complement cells). The
T160S complex is spectrally identical to the complement complex (Fig. 2) but retains the lower activity seen in the
chromatophores. The absorbance spectrum of T160Y bc is also similar to that of the complement bc , but the ratio of b to c is lower for T160Y. The biochemical properties
of the purified enzymes are summarized in Table 2. SDS-PAGE (Fig. 3) shows that the T160S and T160Y complexes contain the
same four subunits as the wild-type and complement enzymes, but the
T160S complex has a reduced level of subunit IV (estimated by
densitometry to be about one half the level present in the complement bc complex). Indeed, addition of purified,
recombinant subunit IV to the enzyme caused a 70% increase in the
activity of the T160S bc complex (Fig. 4).
Addition of subunit IV to the complement bc complex also produced some stimulation of the activity. By
comparison, addition of exogenous subunit IV to purified three-subunit
complex (completely lacking subunit IV(46) ) resulted in a
5-fold stimulation of the basal specific activity under the conditions
used (Fig. 4). Apparently not all of the recombinant subunit IV
preparation used was in an active conformation for interaction with
depleted bc complexes, because full stimulation of
the three-subunit bc required more than three
molecules of subunit IV per bc complex.
Examination of additional preparations of wild-type, complement, and
mutant bc complexes by SDS-PAGE (not shown)
indicated that the relative amount of subunit IV present varies
somewhat for each preparation, but purified T160S bc had a consistently lower ratio of IV relative to subunits I-III
than complement or wild-type complexes.
Figure 2:
Reduced minus oxidized optical absorption
spectra of purified bc complexes.
Ferricyanide-oxidized and dithionite-reduced spectra of bc complexes diluted to 2.5 µM cytochrome b were recorded at room temperature in 50
mM Tris-HCl (pH 7.5), 100 mM NaCl, 1 mM
MgCl , 0.01% dodecyl maltoside, and 20% glycerol, and the
difference spectra were calculated.
Figure 3:
SDS-PAGE of purified bc complexes and Western analysis for subunit IV. Aliquots of
mutated, complement, and wild-type bc complexes
containing approximately 75 pmol cytochrome b were analyzed on
duplicate gels by SDS-PAGE using the tricine buffer system (A). One gel was transferred to a polyvinylidene difluoride
membrane and probed with antibody raised against R. sphaeroides subunit IV (B). Lanes 1, bc
from wild-type R. sphaeroides; lanes 2, bc from R. sphaeroides BC17 complement
strain; lanes 3, prestained molecular mass standards; lanes 4, bc from R. sphaeroides BC17 expressing the T160Y mutation; lanes 5, bc from R. sphaeroides BC17 expressing
T160S mutation. The concentration of the sample in lane 1 was
overestimated prior to loading on the gel.
Figure 4:
Activation of T160S and three-subunit bc complexes by addition of exogenous, recombinant
subunit IV. Cytochrome bc complexes of T160S
( ) and the three-subunit core complex ( ) diluted to 2.5
µM cytochrome b were mixed with varying amounts
subunit IV in a total volume of 30-50 µl of 50 mM Tris-HCl (pH 8.0 at 0 °C), 250 mM NaCl, 1 mM
MgCl , 0.01% dodecyl maltoside, and 10% glycerol and
incubated on ice for 1-2 h. 3-µl aliquots were withdrawn for
assay of ubiquinol-cytochrome c reductase activity. The amount
of subunit IV added was based on determination of the protein content
by the method of Lowry(35) . The concentration of bc complex present was redetermined after dilution
by optical difference spectroscopy and was based on the cytochrome c content.
In order to examine the
relative amount of subunit IV initially present in the membranes of the
mutant and complement cells, mutant and complement cells were grown
side by side, and chromatophore membranes were prepared at the same
time. Examination of these chromatophores by SDS-PAGE and subsequent
Western blots developed with antibodies raised against subunit IV
indicates that the membranes from the cells expressing T160S cytochrome b contain a significantly lower ratio of subunit IV to
cytochrome b when compared with the complement membranes. It
was estimated to be about 40% of the ratio found in the complement
cells by densitometry corrected for the apparent relative transfer
efficiency (see Fig. 5). T160Y membranes contain a modestly
lower ratio of subunit IV to cytochrome b (estimated to be
80% of the complement level). Complement membranes, in turn,
appear to contain a lower ratio of subunit IV than membranes from
wild-type R. sphaeroides (not shown). It thus appears that R. sphaeroides cells overproducing the fbc genes due
to the presence of multiple copies of the operon on a plasmid and/or
other factors either do not induce a concomitant increase in the levels
of subunit IV or have a more rapid turnover of that subunit. This
effect is most pronounced in the case of the T160S substitution.
Figure 5:
Western analysis of chromatophore
membranes from mutated and complement bc complexes. Membrane samples containing 75 pmol (lanes
1-4) or 150 pmol (lanes 6-9) cytochrome b were extracted with acetone/methanol to remove pigments,
redissolved in loading buffer containing SDS and 2-mercaptoethanol, and
subjected to tricine SDS-PAGE on duplicate gels. One gel was
transferred electrophoretically to a polyvinylidene difluoride
membrane. The membrane was cut into two pieces so that the upper part
contained proteins with a molecular mass greater than about 23 kDa, and
the bottom section contained the low molecular mass proteins. The top
section of the membrane was probed with antibodies to R.
sphaeroides subunit II (cytochrome c ) and
developed with a horseradish peroxidase system, whereas the bottom
section was probed with antibodies to subunit IV and developed with an
alkaline phosphatase system. Only the Western analysis of the membrane
is shown. Lane 1, chromatophores (75 pmol b) from R. sphaeroides BC17 expressing the T160S mutation; lane
2, chromatophores (75 pmol b) from BC17 expressing the
T160Y mutation; lane 3, chromatophores (75 pmol b)
from BC17 complement; lane 4, chromatophores (75 pmol b) from Q strain (46) lacking subunit IV; lane 5, prestained molecular mass standards; lane 6,
chromatophores (150 pmol b) from BC17 expressing the T160S
mutation; lane 7, chromatophores (150 pmol b) from
BC17 expressing the T160Y mutation; lane 8, chromatophores
(150 pmol b) from BC17 complement; lane 9, chromatophores (150 pmol b) from Q strain (46) lacking subunit IV.
Effect of Mutation on the Antimycin-sensitive Radical
Associated with the Quinone-reducing SiteThe purified bc complexes from complement and T160S-expressing
cells were poised in a partially reduced state and examined by EPR
spectroscopy to compare the features of the antimycin-sensitive
ubisemiquinone radical. Both the mutated and the complement complexes
were found to contain a ubisemiquinone radical 7.5 Gauss in width at g = 2.004 (Fig. 6), as previously reported for
the wild-type complex(11) . The power saturation behavior of
the mutated and complement complexes were examined and found to be
virtually identical (Fig. 6, inset). These results
indicate that both the complement and mutated bc complexes have an intact quinone reducing center that stabilizes
an anionic ubisemiquinone radical.
Figure 6:
EPR spectra of the antimycin-sensitive
ubisemiquinone radical in the T160S cytochrome bc complex. Oxidized complement and T160S cytochrome bc complexes containing about 300 µM cytochrome b in 50 mM Tris-HCl (pH 8.0), 300
mM NaCl, 1 mM MgCl , 0.01% dodecyl
maltoside, and 20% glycerol were mixed with a fumarate/succinate
mixture (40:1) such that the final concentration of succinate was
3 mM and a catalytic amount of bovine
succinate-ubiquinone reductase. After recording the spectra over a
range of microwave powers, the samples were thawed and a 2-fold excess
of antimycin A was added. The EPR spectra of the T160S complex at 0.2
milliwatts in the absence (1) and presence (2) of
antimycin are shown together with their difference (1-2;
the antimycin-sensitive radical) spectrum. The inset shows the
uncorrected power saturation curves of the samples. EPR instrument
parameters were a microwave frequency of 9.32 GHz, a modulation
amplitude of 4 G, a time constant of 0.05 s, a scan rate of 2.5 G/s,
and a temperature of 140 K.
Effect of Mutation on the Rieske Iron-Sulfur
ClusterThe EPR parameters of the Rieske [2Fe-2S]
cluster are thought to be sensitive to the redox state of the Q pool
and the quinone(s) bound at the quinol-oxidizing center
(Q )(11, 12, 47, 48, 49, 50, 51, 52) .
EPR spectra of the T160S and complement bc complexes were recorded under several conditions, some of which
are shown in Fig. 7. When cytochrome c and
the [2Fe-2S] cluster are reduced by a small excess of
ascorbate, the complement bc complex has a
spectrum that is essentially the same as that previously reported for
the complex from wild-type R. sphaeroides, with resonances at g = 2.02, g =
1.89, and g =
1.81(11, 12) . In contrast, the spectrum of the
mutated complex shows a broadened signature with g shifted to 1.76; this change is apparently not due to the partial
depletion of subunit IV found in the T160S complex, because
three-subunit bc purified from a strain having no
subunit IV (46) has an EPR spectrum very similar to that of the
wild-type complex with g = 1.81. ( )Upon partial oxidation of the samples by titration with
ferricyanide to an apparent potential of about 210 mV (with cytochrome c (E = 240 mV)
one-fourth oxidized), no changes were found in the spectrum of either
the mutant or the complement bc complex (not
shown). Upon complete reduction by addition of dithionite, the spectrum
of the bc complement complex is broadened, with g shifting to 1.76, as previously reported for the
wild-type bc complex under fully reduced
conditions(11, 12) , whereas the spectrum of the T160S
complex remains unchanged with g = 1.76.
The altered complex thus has a spectrum closely resembling the
``reduced state'' spectrum of the complement, regardless of
the redox state of the ubiquinone pool. The EPR spectra of the T160Y
[2Fe-2S] cluster are very similar to those of T160S (not
shown).
Figure 7:
EPR spectra of the iron-sulfur cluster in
T160S and complement bc complexes. A,
cytochrome bc complexes (300 µM cytochrome b) were partially reduced by the addition of
sodium ascorbate to 1 mM. The samples were incubated on ice
for about 20 min and frozen in liquid nitrogen. EPR spectra were
recorded at 8 K. The instrument settings were: microwave frequency,
9.27 G; microwave power, 2 milliwatts; modulation amplitude, 6.3 G;
time constant, 0.1 s; scan rate, 20 G/s. B, the samples used
in A were thawed on ice and reduced by the addition of a small
excess of sodium dithionite from a buffered solution. The samples were
refrozen, and the EPR spectra were recorded at 10 K. Instrument
settings were the same as in A.
Effect of Mutation on the b CytochromesFig. 8shows the EPR spectra of the b cytochromes from the T160S bc complex and
from the complement complex, taken after the samples were reduced with
sodium ascorbate to eliminate the overlapping signal from cytochrome c . The complement bc has
features at g = 3.50 and g = 3.75
previously assigned to cytochrome b and b , respectively, in the wild-type bc complex (11) . The g =
4.3 signal is thought to be due to nonspecifically bound iron(III).
Similar EPR spectra were also previously reported for the mitochondrial bc complex(53, 54, 55) .
In contrast, the cytochrome b signal of the
T160S bc complex is shifted to 3.52, whereas the
position of the cytochrome b feature is
unchanged. The degree of broadness of the signals appears to be
virtually unchanged by the mutation, with the g = 3.75 signal
being the sharper of the two. As in the case of the [2Fe-2S]
spectra, the change observed in the spectrum of the T160S complex is
apparently not due to depletion of subunit IV because the three-subunit bc complex showed identical EPR characteristics as
those of the wild-type complex.
Figure 8:
EPR spectra of b cytochromes in
T160S and complement bc complexes. The
ascorbate-reduced bc complexes were prepared as
described in the legend to Fig. 7. The EPR spectra were recorded
at 15 K with the following instrument settings: microwave frequency,
9.20 GHz; microwave power, 20 milliwatts; modulation amplitude, 20 G;
time constant, 0.1 s; scan rate, 5 G/s.
DISCUSSION
Threonine 160 is a highly conserved residue in the primary
sequence of cytochrome b, present in all known mitochondrial
and eubacterial cytochromes b, except those from nematodes (2) . Its position in the primary sequence is near residues
that are altered in mutations conferring resistance to Q
center inhibitors (Gly , Ile , and
Thr ), and it is contained within a segment of the
cytochrome b polypeptide that corresponds to a peptide
specifically labeled by azido-quinone in the bc complex from beef heart(15) . Current interpretations of
experimental data and modeling efforts place this region in an
amphipathic helix, designated as helix-cd, located on the positive side
of the membrane and forming part of the Q center of the
complex. This region should also be close to cytochrome b , which is reduced by semiquinone in the Q center. Indeed, a mutation at the position corresponding to
Ile in Rhodobacter exhibits an altered circular
dichroism spectrum for cytochrome b of
yeast(56) . Furthermore, the Rieske [2Fe-2S] cluster
should also be located nearby, although it is bound to a different
subunit of the complex, because it is reduced by quinol in the Q center and binds certain Q center inhibitors. As a
conserved residue in a perhaps pivotal region of the complex,
Thr proves to be a good candidate for investigation using
the method of site-directed mutagenesis combined with biochemical and
biophysical characterization. Expression of the T160S mutation in
cytochrome b results in a bc complex
having a significant loss of activity partially compensated by a small
decrease in the apparent K . Interestingly, cells
expressing this mutated cytochrome b during photosynthetic
growth appear to induce an increased level of the three largest
subunits of the bc complex. This induction could
be a regulatory response of cells expressing the mutated complexes to
lowered electron transfer activity or an elevated ``redox
poise.'' Alternatively, the effect could be caused by a
spontaneous second-site mutation that leads to enhanced expression and
is positively selected by photosynthetic growth. The latter possibility
is unlikely, however, because three T160S clones independently isolated
following mutagenesis all displayed elevated levels of the bc complex during the first round of
photosynthetic growth following initial amplification by aerobic growth
in the dark. The purified T160S complex contains a significantly
reduced amount of subunit IV, relative to the bc complex purified from complemented cells. Addition of recombinant
subunit IV to the partially depleted preparations results in an
increase in activity; however, the final activity of reconstituted
T160S bc complex still remains lower than that of
the complement bc complex. Given the apparent low
content of subunit IV in the T160S bc
preparations, the less than 2-fold activity increase seen upon
incubation with added exogenous subunit IV is surprising. One possible
explanation is that a large fraction of the purified T160S bc complex is in a conformation that no longer
interacts with subunit IV, perhaps due to aggregation or partial
denaturation. Another possibility is that the low level of subunit IV
found in the T160S membranes in the first place, as well as any
conformational changes, in some measure results from a decreased
affinity of subunit IV for the modified cytochrome b. The
possibility that Thr in cytochrome b is directly
or indirectly involved in the binding of subunit IV to the bc complex is currently under investigation. In
contrast to the expression levels observed with T160S, membranes
isolated from T160Y contain levels of subunit IV more comparable with
the complement chromatophores. Possibly this more hydrophobic
substitution has an effect on the interaction of subunit IV with
cytochrome b different from that of the T160S change. The
EPR spectra of the T160S complex display altered signatures for both
the Rieske iron-sulfur center and cytochrome b .
Interestingly, the broad g = 3.50 signal attributed to b is shifted to lower field, whereas the g = 3.75 signal due to b appears to be
essentially unchanged in the spectra of the mutated complex. This is
somewhat surprising, because it is b that is
thought to be located near the quinol-oxidizing center and the positive
side of the membrane, whereas b resides in the
central portion of the membrane or closer to the negative side and the
quinone-reducing center of the
complex(3, 5, 6) . Thus, the effect of the
T160S substitution on the b spectrum would
appear to be indicative of a long range interaction between the
oxidizing center and b or of a geometry placing
the two in closer proximity than current models. It is noted that
long-range effects of mutations at other positions in cytochrome b have been previously reported, e.g. the redox midpoint
potentials of cytochrome c were affected by
substitutions in cytochrome b(27) . The
substitutions at T160 in cytochrome b also affected the EPR
signature of the Rieske [2Fe-2S] center, which is located in
a separate subunit of the complex. The iron-sulfur subunit is thought
to bind in the general vicinity of b on the
positive side of the membrane to form part of the quinol-oxidizing
center, because the cluster is a primary electron acceptor from the
quinol. The particular line shape observed for the [2Fe-2S]
cluster is thought to be mediated by the oxidation state of the
ubiquinone present in the Q center(11, 12, 50, 51, 52, 53, 57) .
When oxidized quinone is present, the EPR signal is sharper than when
quinol is present. The change is most apparent in the case of the g resonance, which in the bc from R. sphaeroides is found at g = 1.81
when oxidized ubiquinone is present but shifts to 1.76 and becomes much
broader when ubiquinol is present. The substitutions at Thr resulted in a broadened [2Fe-2S] EPR signature with g =1.76, which is unaltered by accessible
changes in the redox state of the samples. There was no detectable
difference between the EPR spectra of the mutated complexes and the
``reduced state'' spectrum of the complement or wild-type bc complex. The effect of the mutations on the
iron-sulfur cluster spectrum suggests that the Thr residue of cytochrome b interacts with the
quinol-oxidizing center and/or the [2Fe-2S] cluster. This
idea is consistent with current models of the structure and function of
this part of the complex. The effect of the T160 substitutions on
the iron-sulfur cluster is also reminiscent of the change observed for
the substitution of Leu for Phe (F144L) in the cytochrome b from R. capsulatus(58) . The F144L bc complex in R. capsulatus chromatophores was reported to have a very low turnover rate and a
dysfunctional Q center (having less than 10% of the
wild-type activity for the ubiquinol to cytochrome b reduction step). The EPR spectrum of F144L was broadened and
insensitive to redox state with g assigned a value
of 1.765. It was suggested that these properties of the F144L complex
resulted from a reduced affinity for quinone and quinol exhibited by
the Q center of the mutated complex. In a subsequent study
of the effect of the extraction of ubiquinone from chromatophore
membranes on the iron-sulfur cluster, Ding et al.(52) found that the g signal became
very broad and was located at approximately 1.765 upon depletion of
ubiquinone from R. capsulatus chromatophore membranes. These
workers were able to distinguish the ``depleted state''
spectrum having g 1.765 from the
``reduced state'' spectrum with g = 1.777 and found that the line shape of the
quinone-depleted state was broadened considerably beyond that seen in
the presence of either ubiquinone or ubiquinol. With our EPR
instrumentation we cannot assign g values with such a high
degree of precision given the broadness of the g feature in the reduced and the putative quinone-depleted states.
However, there was no significant difference in the width or depth of
the g = 1.76 signals of the R.
sphaeroides T160S and T160Y bc complexes
relative to the spectrum of the complement bc in
the reduced state. Thus, the changes in the iron-sulfur cluster EPR
spectra resulting from the T160 substitutions in the R. sphaeroides system do not exhibit the extremely broad line shape reported for
the quinone-depleted state and are probably not due to a complete
absence of quinone and quinol binding to the Q center. The
nature of these interactions will be the subject of future
investigations. One possibility, which would account for the reduced
turnover of the mutant complexes and their ``reduced state''
EPR spectra, is that ubiquinol binds more tightly to the
quinol-oxidizing center of the mutated complexes than ubiquinone,
raising its effective redox potential beyond the optimal range for
transfer to the [2Fe-2S] cluster. Destabilization of the
transient ubisemiquinone state required at the Q center
would also inhibit turnover.
FOOTNOTES
- *
- This work was
supported in part by the Oklahoma Center for the Advancement of Science
and Technology Grant HN3-008 (to M. W. M.) and National Institutes of
Health Grant GM 30721 (to C.-A. Y.). The costs of publication of this
article were defrayed in part by the payment of page charges. This
article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
Dept. of Biochemistry and Molecular Biology, 246B Noble Research
Center, OAES, Oklahoma State University, Stillwater, OK 74078. Tel.:
405-744-9336; Fax: 405-744-7799; mmather@bmb-fs1.biochem.okstate.edu.
- (
) - The abbreviations used are: Q, ubiquinone; EPR,
electron paramagnetic resonance; Q
, ubiquinol-oxidizing
center; PAGE, polyacrylamide gel electrophoresis. - (
) - S. Usui and L. Yu, unpublished results.
- (
) - Y. R. Chen, D. Tolkatchev, and C.-A. Yu,
unpublished results.
ACKNOWLEDGEMENTS
We express our thanks to Dr. Yeong-Renn Chen and Tian
Hua for providing protein and chromatophore samples and valuable
assistance in the analysis thereof. We also thank Dr. Dmitri Tolkachev
for help in operation of the EPR spectrometer and interpretation of the
EPR data. We are also grateful to Lisa McReynolds for excellent
technical assistance and to Dr. Roger Koeppe for critical review of the
manuscript.
REFERENCES
- Colson, A.-M. (1993) J. Bioenerg. Biomembr. 25, 211-220
[CrossRef][Medline]
[Order article via Infotrieve]
- degli Esposti, M., de Vries, S., Crimi, M., Ghelli, A., Patarnello, T., and Meyer, A. (1993) Biochim. Biophys. Acta 1143, 243-271
[Medline]
[Order article via Infotrieve]
- Gennis, R., Barquera, B., Hacker, B., van Doren, S. R., Arnaud, S., Crofts, A. R., Davidson, E., Gray, K. A., and Daldal, F. (1993) J. Bioenerg. Biomembr. 25, 195-209
[CrossRef][Medline]
[Order article via Infotrieve]
- Link, T. A., Haase, U., and von Jagow, G. (1993) J. Bioenerg. Biomembr. 25, 221-232
[CrossRef][Medline]
[Order article via Infotrieve]
- Trumpower, B. L. (1990) Microbiol. Rev. 54, 101-129
[Abstract/Free Full Text]
- Trumpower, B. L. (1990) J. Biol. Chem. 265, 11409-11412
[Free Full Text]
- Yu, C.-A., and Yu, L. (1993) J. Bioenerg. Biomembr. 23, 259-273
- Ljungdahl, P. O., Pennoyer, J. D., Robertson, D. E., and Trumpower, B. L. (1987) Biochim. Biophys. Acta 891, 227-241
[Medline]
[Order article via Infotrieve]
- Gabellini, N., Bowyer, J. R., Hurt, E., Melandri, B. A., and Hauska, G. (1982) Eur. J. Biochem 126, 105-111
[Medline]
[Order article via Infotrieve]
- Yu, L., Mei, Q.-C., and Yu, C.-A. (1984) J. Biol. Chem. 259, 5752-5760
[Abstract/Free Full Text]
- McCurley, J. P., Miki, T., Yu, L., and Yu, C.-A. (1990) Biochim. Biophys. Acta 1020, 176-186
[Medline]
[Order article via Infotrieve]
- Andrews, K. M., Crofts, A. R., and Gennis, R. B. (1990) Biochemistry 29, 2645-2651
[CrossRef][Medline]
[Order article via Infotrieve]
- Purvis, D. J., Theiler, R., and Niederman, R. A. (1990) J. Biol. Chem. 265, 1208-1215
[Abstract/Free Full Text]
- Hauska, G., Nitschke, W., and Herrmann, R. G. (1988) J. Bioenerg. Biomembr. 20, 211-228
[CrossRef][Medline]
[Order article via Infotrieve]
- He, D.-Y., Yu, L., and Yu, C.-A. (1994) J. Biol. Chem. 269, 2292-2298
[Abstract/Free Full Text]
- Vieira, J., and Messing, J. (1983) Gene (Amst.) 19, 254-268
- Brosius, J. (1989) DNA (N. Y.) 8, 759-777
[Medline]
[Order article via Infotrieve]
- Keen, N. T., Tamaki, S., Kobayashi, D., and Trollinger, D. (1988) Gene (Amst.) 70, 191-197
[CrossRef][Medline]
[Order article via Infotrieve]
- Rott, M. A., Witthuhn, V. C., Schilke, B. A., Soranno, M., Ali, A., and Donohue, T. J. (1993) J. Bacteriol. 175, 358-366
[Abstract/Free Full Text]
- Simon, R., Priefer, U., and Pühler, A. (1983) Bio/Technology 1, 784-791
[CrossRef]
- Yun, C.-H., Beci, R., Crofts, A. R., Kaplan, S., and Gennis, R. B. (1990) Eur. J. Biochem 194, 399-411
[Medline]
[Order article via Infotrieve]
- Titus, D. E. (ed) (1991) Promega Protocols and Applications Guide , 2nd Ed., p. 105, Promega Corporation, Madison, WI
- Khosravi, M., Ryan, W., Webster, D. A., and Stark, B. C. (1990) Plasmid 23, 138-143
[CrossRef][Medline]
[Order article via Infotrieve]
- Sistrom, W. R. (1960) J. Gen. Microbiol. 22, 778-785
[Abstract/Free Full Text]
- Feher, G., and Okamura, M. Y. (1978) in The Photosynthetic Bacteria (Clayton, R. T., and Sistrom, W. R., eds) pp. 349-386, Plenum Publishing Corp., New York
- Ward, J. M., and Grinstead, J. (1982) Plasmid 7, 239-250
[CrossRef][Medline]
[Order article via Infotrieve]
- Hacker, B., Barquera, B., Crofts, A. R., and Gennis, R. B. (1993) Biochemistry 32, 4403-4410
[CrossRef][Medline]
[Order article via Infotrieve]
- Pemberton, J. M., and Bowen, A. R. S. G. (1981) J. Bacteriol. 147, 110-117
[Abstract/Free Full Text]
- Nano, F. E., and Kaplan, S. (1984) J. Bacteriol. 158, 1094-1103
[Abstract/Free Full Text]
- Sambrook, J., Fritsch, E. F., and Maniatis, T. (1989) Molecular Cloning: A Laboratory Manual , 2nd Ed., Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
- Qian, L., and Wilkinson, M. (1991) BioTechniques 10, 736-738
[Medline]
[Order article via Infotrieve]
- Du, Z., Hood, L., and Wilson, R. K. (1993) Methods Enzymol. 218, 104-121
[Medline]
[Order article via Infotrieve]
- Yu, L., and Yu, C.-A. (1991) Biochemistry 30, 4934-4939
[CrossRef][Medline]
[Order article via Infotrieve]
- Atta-Asafo-Adjei, E., and Daldal, F. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 492-496
[Abstract/Free Full Text]
- Lowry, O. H., Rosebrough, N. J., Farr, A. L., and Randall, R. J. (1951) J. Biol. Chem. 193, 265-275
[Free Full Text]
- Cohen-Bazire, G., Sistrom, W. R., and Stanier, R. Y. (1957) J. Cell. Comp. Physiol. 49, 25-68
- Berden, J. A., and Slater, E. C. (1970) Biochim. Biophys. Acta 216, 237-249
[Medline]
[Order article via Infotrieve]
- Yu, L., Dong, J.-H., and Yu, C.-A. (1986) Biochim. Biophys. Acta 852, 203-211
[Medline]
[Order article via Infotrieve]
- Redfern, E. R. (1967) Methods Enzymol. 10, 381-384
[CrossRef]
- Kröger, A. (1978) Methods Enzymol. 53, 579-591
[Medline]
[Order article via Infotrieve]
- Clayton, R. K. (1973) Biochim. Biophys. Acta 75, 312-323
[CrossRef]
- Laemmli, U. K. (1970) Nature 227, 680-685
[CrossRef][Medline]
[Order article via Infotrieve]
- Schägger, H., and von Jagow, G. (1987) Anal. Biochem. 166, 368-379
[CrossRef][Medline]
[Order article via Infotrieve]
- Twobin, H., Staehelin, T., and Gordon, J. (1979) Proc. Natl. Acad. Sci. U. S. A. 76, 4350-4354
[Abstract/Free Full Text]
- Haley, P. E., Yu, L., Dong, J.-H., Keyser, G. C., Sanborn, M. R., and Yu, C.-A. (1986) J. Biol. Chem. 261, 14593-14599
[Abstract/Free Full Text]
- Chen, Y.-R., Usui, S., Yu, C.-A., and Yu, L. (1994) Biochemistry 33, 10207-10214
[CrossRef][Medline]
[Order article via Infotrieve]
- Matsuura, K., Bowyer, J. R., Ohnishi, T., and Dutton, P. L. (1983) J. Biol. Chem. 258, 1571-1579
[Abstract/Free Full Text]
- Bowyer, J. R., Edwards, C. A., Ohnishi, T., and Trumpower, B. L. (1982) J. Biol. Chem. 257, 8321-8330
[Abstract/Free Full Text]
- de Vries, S., Albracht, S. P. J., Berden, J. A., and Slater, E. C. (1982) Biochim. Biophys. Acta 681, 41-45
[Medline]
[Order article via Infotrieve]
- Seidow, J., Power, S., de la Rosa, F. F., and Palmer, G. (1978) J. Biol. Chem. 253, 2392-2399
[Abstract/Free Full Text]
- Meinhardt, S. W., Yang, X., Trumpower, B. L., and Ohnishi, T. (1987) J. Biol. Chem. 262, 8702-8706
[Abstract/Free Full Text]
- Ding, H., Robertson, D. E., Daldal, F., and Dutton, P. L. (1992) Biochemistry 31, 3144-3158
[CrossRef][Medline]
[Order article via Infotrieve]
- de Vries, S., Albracht, S. P. J., and Leeuwerik, F. J. (1979) Biochim. Biophys. Acta 546, 316-333
[Medline]
[Order article via Infotrieve]
- Orme-Johnson, N. R., Hansen, R. E., and Beinert, H. (1974) Biochem. Biophys. Res. Commun. 45, 871-878
- Salerno, J. C. (1984) J. Biol. Chem. 259, 2331-2336
[Abstract/Free Full Text]
- Tron, T., Crimi, M., Colson, A.-M., and Degli Esposti, M. (1991) Eur. J. Biochem. 199, 753-760
[Medline]
[Order article via Infotrieve]
- Yang, X., and Trumpower, B. L. (1986) J. Biol. Chem. 261, 12282-12289
[Abstract/Free Full Text]
- Robertson, D. E., Daldal, F., and Dutton, P. L. (1990) Biochem. 29, 11249-11260
[CrossRef][Medline]
[Order article via Infotrieve]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
S. Yang, H.-W. Ma, L. Yu, and C.-A. Yu
On the Mechanism of Quinol Oxidation at the QP Site in the Cytochrome bc1 Complex: STUDIED USING MUTANTS LACKING CYTOCHROME bL OR bH
J. Biol. Chem.,
October 17, 2008;
283(42):
28767 - 28776.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Esser, X. Gong, S. Yang, L. Yu, C.-A. Yu, and D. Xia
Surface-modulated motion switch: Capture and release of iron-sulfur protein in the cytochrome bc1 complex
PNAS,
August 29, 2006;
103(35):
13045 - 13050.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Gurung, L. Yu, D. Xia, and C.-A. Yu
The Iron-Sulfur Cluster of the Rieske Iron-Sulfur Protein Functions as a Proton-exiting Gate in the Cytochrome bc1 Complex
J. Biol. Chem.,
July 1, 2005;
280(26):
24895 - 24902.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Gong, L. Yu, D. Xia, and C.-A. Yu
Evidence for Electron Equilibrium between the Two Hemes bL in the Dimeric Cytochrome bc1 Complex
J. Biol. Chem.,
March 11, 2005;
280(10):
9251 - 9257.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X. Liu, C.-A. Yu, and L. Yu
The Role of Extra Fragment at the C-terminal of Cytochrome b (Residues 421-445) in the Cytochrome bc1 Complex from Rhodobacter sphaeroides
J. Biol. Chem.,
November 5, 2004;
279(45):
47363 - 47371.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Brasseur, D. Lemesle-Meunier, F. Reinaud, and B. Meunier
QO Site Deficiency Can Be Compensated by Extragenic Mutations in the Hinge Region of the Iron-Sulfur Protein in the bc1 Complex of Saccharomyces cerevisiae
J. Biol. Chem.,
June 4, 2004;
279(23):
24203 - 24211.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Xiao, G. Engstrom, S. Rajagukguk, C.-A. Yu, L. Yu, B. Durham, and F. Millett
Effect of Famoxadone on Photoinduced Electron Transfer between the Iron-Sulfur Center and Cytochrome c1 in the Cytochrome bc1 Complex
J. Biol. Chem.,
March 21, 2003;
278(13):
11419 - 11426.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
G. Engstrom, K. Xiao, C.-A. Yu, L. Yu, B. Durham, and F. Millett
Photoinduced Electron Transfer between the Rieske Iron-Sulfur Protein and Cytochrome c1 in the Rhodobacter sphaeroides Cytochrome bc1 Complex. EFFECTS OF pH, TEMPERATURE, AND DRIVING FORCE
J. Biol. Chem.,
August 16, 2002;
277(34):
31072 - 31078.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Xiao, A. Chandrasekaran, L. Yu, and C.-A. Yu
Evidence for the Intertwined Dimer of the Cytochrome bc1 Complex in Solution
J. Biol. Chem.,
November 30, 2001;
276(49):
46125 - 46131.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Tian, L. Yu, M. W. Mather, and C.-A. Yu
Flexibility of the Neck Region of the Rieske Iron-Sulfur Protein Is Functionally Important in the Cytochrome bc1 Complex
J. Biol. Chem.,
October 23, 1998;
273(43):
27953 - 27959.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H. Tian, L. Yu, M. W. Mather, and C.-A. Yu
The Involvement of Serine 175 and Alanine 185 of Cytochrome b of Rhodobacter sphaeroides Cytochrome bc1 Complex in Interaction with Iron-Sulfur Protein
J. Biol. Chem.,
September 19, 1997;
272(38):
23722 - 23728.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Xiao, L. Yu, and C.-A. Yu
Confirmation of the Involvement of Protein Domain Movement during the Catalytic Cycle of the Cytochrome bc1 Complex by the Formation of an Intersubunit Disulfide Bond between Cytochrome b and the Iron-Sulfur Protein
J. Biol. Chem.,
December 1, 2000;
275(49):
38597 - 38604.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|