|
|
|
|||||||
|
|||||||||
(Received for publication, August 10, 1995; and in revised form, September 15, 1995) From the
TATA-binding protein (TBP) gene promoter binding factor (TPBF)
is a transactivator which binds to the TBP promoter element (TPE)
sequence of the Acanthamoeba TBP gene promoter and stimulates
transcription in vitro. We have isolated a cDNA clone encoding
TPBF. TPBF is a polypeptide of 327 amino acids with a calculated
molecular mass of 37 kDa. The predicted amino acid sequence of TPBF
shows no significant homology to other proteins. TPBF has two potential
coiled-coil regions, a basic region, a proline-rich region, a
histidine-rich N terminus, and a nuclear targeting sequence. The
recombinant protein has an apparent molecular mass of 50 kDa, identical
with that of TPBF purified from Acanthamoeba. Recombinant TPBF
is able to bind DNA and activate transcription with the same
specificity as natural Acanthamoeba TPBF, demonstrating the
authenticity of the clone. Mobility shift assays of co-translated TPBF
polypeptides and chemical cross-linking demonstrate that TPBF is
tetrameric in solution and when bound to DNA. Analyses of TPBF mutants
show that Coiled-coil II is essential for DNA binding, but Coiled-coil
I and the basic region are also involved. TPBF is thus a novel
DNA-binding protein with functional similarity to the tumor suppressor
protein p53.
Accurate transcription initiation of all three classes of genes
in eukaryotic cells requires stepwise assembly of several general
transcription factors and the appropriate RNA polymerase on promoter
DNA. The TATA-binding protein, TBP, ( In the case of TATA-containing class II promoters, TFIID, consisting
of TBP and a large number of associated factors
(TAFs)(5, 14, 15, 16) , binds
directly to DNA through specific interactions between TBP and the TATA
box (11, 12) as the first step in formation of the
initiation complex. This TFIID-DNA complex then recruits other general
transcription factors, such as TFIIB, TFIIE, TFIIF, TFIIH, and RNA
polymerase II to form a complete initiation complex(17) . An
additional class of transcription factors, known as sequence-specific
transcription activators, is involved in efficient transcription by RNA
polymerase II. These activators bind specifically to promoter sequences
and modulate levels of expression of the selected genes, providing a
regulatory strategy for eukaryotic cells to control development,
differentiation, and their responses to extracellular stimuli. Evidence
obtained in recent years suggests that sequence-specific activators
stimulate transcription through direct or indirect (via coactivators)
communication with the general transcription factors. Interactions
between activators and general transcription factors
TFIIA(18) , TFIIB(19, 20, 21) ,
TBP(22) , TAFs(23, 24) , TFIIF(25) ,
and TFIIH (26) have been reported. However, the mechanism of
transcription stimulation is not well understood. Typical eukaryotic
transcription activators are composed of discrete structural domains
that have specific functions(27) , for example, in
multimerization, DNA binding, and transcription activation or
repression. Different structural motifs involved in DNA binding and
activation have been identified and used to classify transcription
activators. A fully functional activator can be constructed by
combination of functional domains from different
activators(28) . The Acanthamoeba TBP gene promoter
contains two major elements that are necessary for efficient
transcription. The TATA box at -30 functions by binding TFIID,
which is necessary for basal transcription(29, 30) .
The TPE is a 23-base pair element centered around -90, which
stimulates basal transcription up to 10-fold in vitro. The TPE
binds a regulatory factor called TPBF (31) , which was
identified and purified previously in this laboratory (31, 32) . TPBF is of interest because it regulates
TBP gene transcription, but also because it is an apparently novel type
of DNA-binding protein. Chemical interference assays demonstrated
protein-DNA contacts on opposite faces of the DNA helix(32) .
This pattern, while reminiscent of the proposed model for p53 tetramer
bound to DNA(33) , is distinct from that produced by other
factors(32) . Although TPBF was found by gel filtration to be
oligomeric(32) , the resolution was not sufficient to
distinguish trimeric and tetrameric forms of the protein. Finally, TPBF
is phosphorylated, and removal of phosphate increased DNA binding,
suggesting that phosphorylation could play a regulatory function in
vivo. In order to determine the basis for these properties of
TPBF and to permit further characterization of its role and mechanism
in TBP gene expression, we isolated cDNA and genomic DNA clones
encoding TPBF. Expression and analysis of cloned TPBF and mutant
derivatives demonstrate that TPBF is a novel tetrameric DNA-binding
protein. It contains a C-terminal coiled-coil domain necessary for
tetramerization, as well as an apparently large central region involved
in DNA binding. Other structural features of TPBF are discussed.
Figure 1:
Nucleotide sequence, predicted amino
acid sequence, and schematic diagram of the TPBF gene. A,
nucleotide and deduced amino acid sequences of the TPBF cDNA. The underlined sequences correspond to the sequenced peptides. Open triangles show the two arrays of heptad repeats of
hydrophobic amino acids. B, schematic presentation of TPBF
indicating presumptive functional domains (see text). Relative
positioning of the domains is shown by the scale above the gene. These
data have been submitted to GenBank
Amplification of Acanthamoeba castellanii genomic DNA (37) by PCR was
performed under the following cycle conditions: the first cycle at 94
°C for 5 min, followed by 30 cycles of 94 °C for 1 min, 48
°C for 1 min, and 72 °C for 2 min, and the last cycle at 72
°C for 10 min. Several PCR products were generated using either
primer combination (data not shown). The products were subcloned into
the pSK(-) vector (Stratagene) and sequenced. One subclone,
encoding the TPBF peptides, was obtained.
In vitro protein syntheses from plasmids encoding full-length and mutant
TPBF were carried out with the Single Tube Protein System 2 (Novagen)
in which transcription driven by T7 RNA polymerase is coupled to
translation by a rabbit reticulocyte lysate (42) .
[
Figure 4:
DNA binding and transactivation activities
of purified recombinant TPBF. A, silver staining of an
SDS-PAGE containing purified TPBF proteins used in EMS and in vitro transcription assays. Lane 1, TPBF purified from Acanthamoeba nuclear extracts. Lane 2, full-length
recombinant TPBF. Lane 3, mutant TPBF deleting amino acids
254-296. B, DNA binding activity and specificity of
recombinant TPBF analyzed by EMS assay with 4% native polyacrylamide
gel. 5 ng of proteins was used in each reaction. Lane 1,
natural Acanthamoeba TPBF. Lane 2, full-length
recombinant TPBF. Lanes 3 and 4, full-length
recombinant TPBF plus 50 ng of unlabeled specific and nonspecific
competitor DNA, respectively. Lane 5, mutant TPBF. Lane
6, control DNA without protein. C, transcription
stimulation by purified recombinant TPBF. In vitro transcription assay was performed using HeLa cell nuclear extracts
with the template containing an intact TPE. Lane 1, HeLa
nuclear extracts alone. Lanes 2 and 3 had 100 ng of
full-length and mutant TPBF included,
respectively.
Figure 8:
DNA
binding activity of TPBF deletion mutants. 5 ng of natural Acanthamoeba TPBF or 2 µl of in vitro synthesized
TPBF polypeptides indicated in Fig. 7were analyzed. A,
EMS assay of TPBF mutants on a 4% native polyacrylamide gel. Lane
1, Acanthamoeba TPBF. Lanes 2-9 show DNA
binding activities of various TPBF polypeptides as indicated on the top of the panel. Lane 10 was a control without
protein. Nonspecific binding from reticulocyte lysate is indicated by
an open triangle. B, EMS assay of TPBF mutants on a 6% native
polyacrylamide gel. Mutants whose DNA binding activities were too faint
to be detected in A were assayed. The mutant assayed in each
lane is indicated on the top of the panel. The specific
protein-DNA complex is indicated by a solid triangle, the
nonspecific ones by an open
diamond.
Figure 5:
Recombinant TPBF binds to DNA as a
tetramer. TPBF polypeptides were synthesized by in vitro coupled transcription-translation at the ratios indicated on the top of the panel. 1 µl of each reaction mixture was
analyzed by EMS assay with 6% native polyacrylamide gel.
Homo-oligomeric complexes are indicated by open triangles while hetero-oligomeric complexes by solid triangles. A
minor complex likely caused by the breakdown product of
Figure 7:
Structures and synthesis of TPBF mutants. A, map of TPBF deletion mutants. Deletion mutants were
generated as described under ``Experimental Procedures.''
Mutants with sequences between amino acids X and Y removed are denoted as
Figure 2:
Analysis of the TPBF gene and its
transcript. A, Southern blot analysis of genomic DNA. 2 µg
of Acanthamoeba genomic DNA was digested with the indicated
restriction enzymes and probed with radiolabeled TPBF cDNA as described
under ``Experimental Procedures.'' Size markers are indicated
on the left side of the panel. B, Northern blot analysis of Acanthamoeba mRNA. 10 µg of poly(A)
We used ``rapid amplification of
cDNA ends'' (43) to obtain the missing 5` end of the cDNA.
In order to find a rapid amplification of cDNA ends primer, we isolated
a genomic clone encoding TPBF and partially sequenced it. Two in-frame
methionines were found in the 50-bp sequence preceding the 5` end of
the cDNA within the genomic copy of the TPBF gene. Using the primer
starting from the first in-frame methionine in combination with primer
RT2, we successfully obtained the missing part of the cDNA from mRNA by
reverse transcription-PCR and reconstructed the full-length cDNA. The
complete (both strands) sequence of the reconstructed TPBF cDNA is
presented in Fig. 1A. The complete cDNA comprises
1088 bp and contains an open reading frame of 327 amino acids with a
predicted molecular mass of 37 kDa (Fig. 1A). There are
several sequence motifs of potential importance to the function of TPBF
as a transcription activator. First, it bears a putative nuclear
localization signal of 5 consecutive basic residues KKRRK (residues
132-136, Fig. 1), which appears in many transcription
factors(44) . Second, there are two segments containing heptad
repeats of hydrophobic residues in the sequence (indicated by open
triangles, Coiled-coil I and II). Coiled-coil II contains a
perfect hydrophobic 4-3 repeat that could form a coiled-coil
structure and drive oligomerization of TPBF(45, 46) .
Third, the region between residues 40 and 85 is proline-rich, which, by
analogy to other factors, might be important in mediating transcription
activation(47) . Fourth, the N-terminal 24 amino acids of TPBF
is unusually histidine-rich, containing 10 histidine residues. However,
data base searches showed that TPBF lacks significant sequence homology
to any other known genes(48) . These features are considered
further under ``Discussion.''
Northern
analysis (Fig. 2B) indicates that TPBF is transcribed
into a single mRNA with a size of about 1,100 nucleotides. Primer
extension of Acanthamoeba mRNA generated one single band of
the expected size (Fig. 2C), indicating that the
transcript begins about 30 bp downstream from an imperfect TATA box
within the genomic copy of the TPBF gene. The TPBF transcript appears
to be extremely rare. 10 µg of mRNA was required to obtain a clear
signal in Northern blot analysis. Similarly, only 3 plaques from 1
Figure 3:
Purification of recombinant TPBF expressed
in E. coli. Recombinant TPBF at various stages of purification
was analyzed by SDS-PAGE and stained with Coomassie Blue. Lane
1, E. coli cells transformed with pET3a vector. Lane
2, E. coli cells transformed with pET3a containing TPBF
cDNA. Lane 3, lysate from E. coli containing
recombinant TPBF. Lane 4, flow-through of E. coli lysate over nickel affinity column. Lane 5, TPBF
following elution from nickel affinity column. Lane 6, TPBF
following elution from DEAE-cellulose.
The existence of histidine-rich
sequences at the N terminus of full-length or deleted TPBF enabled us
to purify them by Ni The molecular mass of the
full-length TPBF as measured by SDS-PAGE is 50 kDa, which differs
significantly from the predicted mass of 37 kDa. However, the SDS gel
mobility of recombinant TPBF perfectly matches that of natural Acanthamoeba TPBF purified from nuclei (Fig. 4A). The apparent discrepancy between SDS gel
mobility and the predicted molecular mass of TPBF may be due to the
abundance of positively charged amino acids in the protein. Natural
TPBF migrates as a doublet on SDS gel due to
phosphorylation(32) . Surprisingly, recombinant TPBF showed the
same mobility as the phosphorylated form of TPBF (Fig. 4A, lanes 1 and 2).
Since natural Acanthamoeba TPBF is able to
transactivate the TBP gene promoter in HeLa cell nuclear
extracts(32) , we tested whether TPBF expressed in E. coli could substitute for natural TPBF in transcription activation. 100
ng of recombinant TPBF was added to in vitro transcription
reactions carried out with HeLa cell nuclear extract. The results
showed that recombinant TPBF is fully active for transcription
activation (Fig. 4C, lane 2). However, a
10-fold greater amount of recombinant TPBF was required to achieve the
same level of activation as stimulated by natural TPBF, as determined
by titration with rTPBF. This may suggest that a significant portion of
recombinant TPBF that is active in DNA binding is deficient in
transactivation. As expected, the TPBF mutant
The formation of five major different complexes
by the cotranslated proteins strongly suggests that TPBF forms a
tetramer when bound to DNA. The two outer bands correspond to
homo-oligomeric complexes (L
Figure 6:
Both recombinant and natural TPBF form
tetramers in the absence of DNA. Purified recombinant TPBF and
partially purified natural Acanthamoeba TPBF were chemically
cross-linked with DTSSP or glutaraldehyde, resolved by SDS-PAGE, and
followed by silver staining or immunoblotting. A, silver
staining of an SDS-PAGE containing cross-linked recombinant TPBF. Lane 1, TPBF alone. Lanes 2 and 3 contained
25- and 50-fold molar excess of DTSSP over TPBF, respectively. Lane
4 contained 0.001% of glutaraldehyde. B, immunoblotting
of chemically cross-linked natural TPBF. Lane 1, control
without cross-linker. Lanes 2 and 3 show
cross-linking with 25- and 50-fold molar excess of DTSSP, respectively. Lane 4 was treatment of the reaction shown in lane 3 with 50 mM DTT. The positions of monomeric and
cross-linked TPBF are indicated.
DTSSP cross-linking of
partially purified Acanthamoeba TPBF detected by
immunoblotting produced two cross-linked products apparently identical
with those produced by recombinant protein (Fig. 6B),
indicating that recombinant TPBF has the same structure as natural
TPBF. This result also demonstrates that both cross-linked bands
contain TPBF. Cross-linked bands were removable by treatment with 50
mM DTT, which cleaves the disulfide bond within DTSSP linking
the monomers (Fig. 6B, lane 4). Cross-linking also showed that mutant
To examine the role of Coiled-coil II in DNA
binding, we checked the internal deletion We have isolated full-length cDNA encoding TPBF, an Acanthamoeba transcription activator, which regulates
expression of the TBP gene(31, 32) . To our knowledge,
TPBF is the first regulatory protein isolated and cloned that controls
expression of a basal transcription factor. Several criteria establish
that the cDNA encodes authentic TPBF. First, the cDNA encodes the
peptides sequenced from TPBF purified from nuclei. Second, recombinant
TPBF expressed in E. coli comigrates with natural Acanthamoeba TPBF (Fig. 4A). Third,
recombinant TPBF shows the same DNA binding specificity and activity as
natural TPBF. Fourth, recombinant TPBF is able to stimulate
transcription in a TPE promoter-dependent fashion. Fifth, recombinant
TPBF and natural TPBF bind avidly to a nickel affinity column due to
the histidines present in the N terminus. Finally, antibody raised
against recombinant TPBF recognizes natural TPBF in Acanthamoeba nuclear extracts. There are, however, some physical differences
between recombinant and natural TPBF. For example, TPBF produced in E. coli, which is presumably not phosphorylated, comigrates
during SDS-PAGE with the phosphorylated form of natural TPBF. It is
thus possible that either recombinant TPBF has been modified or natural
TPBF has additional unidentified modifications. Similarly, recombinant
TPBF is somewhat less active in stimulating transcription than natural
TPBF. The predicted amino acid sequence of TPBF has no significant
homologues in the public data bases(48) , in accord with its
unusual DNA binding properties. Many sequence-specific transcription
factors have been grouped into several distinct families, such as basic
helix-loop-helix, zinc finger, homeodomain, helix turn helix, or
leucine zipper proteins (50) . TPBF does not fall into any of
these families, as judged by alignment between TPBF and the consensus
sequences that characterize each family. However, the TPBF sequence
contains several regions that suggest a function (Fig. 1B). The N-terminal domain is remarkably
histidine-rich, and these histidines can coordinate with chelated
nickel. While we do not yet know whether TPBF requires metal for any of
its activities, it conceivably contains Zn Adjacent to and overlapping the proline-rich domain, there is a
potential coiled-coil domain (Coiled-coil I) comprising a heptad repeat
of hydrophobic residues. While this region could potentially contribute
to tetramerization (see below), deletion mutagenesis suggests it is not
necessary, but instead may have a stabilizing effect on the overall
structure. However, because this region contains two proline residues
which are likely to destabilize or prevent helix formation, the
importance of Coiled-coil I is somewhat unclear. In the central
portion of TPBF, there is a putative nuclear localization signal and a
region that is rich in basic residues. By analogy with leucine zipper
proteins or basic helix-loop-helix proteins, it is possible that this
latter region may be involved in DNA binding. At the C terminus of
TPBF there is an additional coiled-coil domain (Coiled-coil II),
containing hydrophobic 4-3 repeats. Positions a and d (the positions within a heptad repeat are conventionally
referred to as a, b, c, d, e, f, and g, see (53) ) of the
heptads in the array named Coiled-coil II are almost perfectly
hydrophobic. Although this region resembles a leucine zipper, its
perfectly amphipathic hydrophobic character suggests that it is likely
to form higher order oligomers, since perfect coiled-coil domains can
form trimeric or tetrameric bundles(54) . In accord with this
prediction, direct chemical cross-linking and cotranslation experiments
establish that TPBF exists as a tetramer both in solution and when
bound to DNA. Analyses of several TPBF deletion mutants supports the
predictions made from inspection of its sequence. Although our analyses
were constrained by an inability to express all mutants in E.
coli, several important conclusions were reached. Chemical
cross-linking and binding studies of mutant proteins demonstrate that
Coiled-coil II is essential for tetramerization and therefore DNA
binding. Coiled-coil II is the major, if not the only, region driving
tetramerization of TPBF. Although Coiled-coil I is not essential for
DNA binding (Fig. 6B), removal of the region greatly
reduces DNA binding activity, suggesting its involvement in either
stabilizing tetramer or tetramer-DNA complex. Other proteins with two
or more separate coiled-coil domains have been
reported(55, 56) . The reovirus cell attachment
protein TPBF requires a
relatively large domain for efficient, sequence-specific DNA binding.
Unlike GCN4, for example, which only requires the C-terminal 56 amino
acid residues for DNA binding(57) , the region in TPBF required
for efficient DNA binding spreads from 20 to 320. Since the mutant
Previous studies showed that TPBF
makes numerous symmetrical contacts with TPE(32) . The overall
pattern of the base and phosphate contacts, suggesting that TPBF
contacts DNA symmetrically on opposite faces of the helix, is unique.
This binding pattern is in keeping with the novel structural features
of TPBF, especially its divergent coiled-coil region and the widely
spread basic region. One of the unique features of TPBF is that it is
tetrameric, which is probably determined by the arrangement of
hydrophobic residues in positions a and d in
Coiled-coil II(54) . Tetramerization of TPBF can explain the
protein-DNA contacts inferred from chemical interference assays. First,
TPBF is able to occupy a large region of DNA since it contains a
four-stranded helical bundle. Second, the region for tetramerization is
located at the C terminus of TPBF allowing four DNA binding domains of
TPBF, located more than 100 amino acid residues from the
tetramerization domain, to reach relatively distal binding sites. It is
possible that the tetramerized TPBF contacts the DNA helix
perpendicularly from one side. Thus, its four DNA binding domains can
make symmetrical contacts on opposite faces of the DNA helix.
Interestingly, this DNA binding pattern resembles the way tumor
suppressor p53 binds to its specific DNA recognition
sequence(33) . Although no obvious similarities exist between
these two proteins in amino acid sequence or specific DNA binding
sites, it is possible that they belong to a novel family of DNA-binding
proteins that function in regulating expression of genes involved in
growth and differentiation.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank(TM)/EMBL Data Bank with accession number(s)
L46867[GenBank].
Volume 270,
Number 48,
Issue of December 1, 1995 pp. 28839-28847
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)is involved in
transcription by all three RNA polymerases both in vitro and in
vivo(1, 2, 3, 4, 5) .
TBP is complexed into SL1(1) , TFIID(6) , and TFIIIB (7, 8, 9, 10) for its function in
RNA polymerase I, II, and III systems, respectively. These
TBP-containing initiation factors are recruited to the different
classes of promoters by specific protein-DNA (11, 12) and/or protein-protein
interactions(1, 7, 8, 9, 10, 13) .
Purification of TPBF and Internal Peptide
Sequencing
Purification of TPBF essentially followed the scheme
described elsewhere(32) . TPBF (5 µg) was loaded onto
a 12% SDS-polyacrylamide gel(34) , then blotted onto a
polyvinylidene difluoride membrane (Applied Biosystems), and visualized
by Ponceau S staining(35, 36) . The TPBF band was cut
out and used for tryptic digestion and internal amino acid sequencing
by the Harvard Microchemistry Laboratory(36) . Three peptides
were sequenced (Fig. 1A). The amino acid sequences
-AFQSNYR- in peptide II and -PYLTDDA- in peptide III were used to
design two sets of degenerate oligonucleotides for PCR amplification of
the target gene.
under accession number
L46867.
Generating a TPBF-specific Probe by the Polymerase Chain
Reaction
Two pairs of degenerate primers were synthesized
corresponding to amino acid sequences -AFQSNYR- and -PYLTDDA-. 1)
GC(G/C)TTCCAGTC(G/C)AACTACCG; 2) CGGTAGTT(G/C)GACTGGAA(G/C)GC; 3)
CC(G/C)TACCT(G/C)AC(G/C)GA(C/T)GA(C/T)GC; 4)
GC(G/A)TC(G/A)TC(G/C)GT(G/C)AGGTA(G/C)CG.Isolation of a cDNA Clone and a Genomic Clone for
TPBF
Using the subcloned PCR fragment as a probe, an A.
castellanii cDNA library in ZAP (38) was screened.
The cDNA library was plated out on twenty 15-cm plates, each containing
approximately 50,000 plaques. The plaques were blotted onto
nitrocellulose filters (Schleicher & Schuell), and the DNA was
denatured, neutralized, and immobilized(34) . The filters were
prehybridized at 65 °C for 2 h in 500 mM
Na
HPO
, pH 7.2, 1% SDS, 1 mM EDTA, and
denatured salmon sperm DNA (100 µg/ml), and then hybridized with a P-labeled TPBF probe for 12 h at 65 °C. Filters were
then washed twice for 10 min at room temperature with 500 ml of 1
SSC containing 0.1% SDS and once for 15 min at 65 °C with
500 ml of 0.1 SSC containing 0.1% SDS. Positive clones were
rescued as double-stranded plasmids in the pSK(-)
vector(39) . To obtain a genomic clone of TPBF gene, an Acanthamoeba genomic DNA library, constructed in EMBL3A (29) , was screened using the cDNA-derived probe. One positive
TPBF genomic clone was mapped to an 8-kilobase PstI fragment.
The 8-kilobase fragment was subcloned into the pSK(-) vector and
partially sequenced by primers derived from the cDNA sequence.
Northern Blot Analysis
Total cellular RNA was
isolated using guanidine isothiocyanate(38, 40) , and
mRNA was selected by two rounds of chromatography on
oligo(dT)-cellulose (Life Technologies, Inc.). Samples of 10 µg of
mRNA were subjected to electrophoresis on a 1% formaldehyde-agarose
gel(34) , transferred to a nitrocellulose filter, and
hybridized with the P-labeled cDNA-derived probe as
described above.
Southern Blot Analysis
Acanthamoeba genomic DNA was prepared as described elsewhere(37) .
2-µg aliquots were digested with BamHI, EcoRI, HindIII, PstI, MboI, HpaII, or MspI and separated by electrophoresis on a 0.8% agarose gel.
Following depurination, the DNA was transferred to a nylon membrane
(GeneScreen Plus, DuPont NEN) and probed with P-labeled
cDNA(34) .
Primer Extension of mRNA
2 µg of mRNA was
dissolved in 10 µl of annealing buffer containing 20 mM Tris-HCl, pH 8.3, and 0.4 M KCl and mixed with 50,000 to
100,000 cpm of labeled primer RT1 (GATGTGTGACAGATCATGGGTGCTGTT). The
annealing reaction was incubated at 65 °C for 10 min and then
allowed to cool slowly to room temperature. Primer extension (40
µl) was begun by adding 4 µl of 10 reverse
transcription buffer (500 mM Tris-HCl, pH 8.3, 60 mM
MgCl, 25 mM DTT), 4 µl of dNTP mix (2.5 mM each), 1 unit of RNasin, and 20 units of Superscript II (Life
Technologies, Inc.), followed by incubation for 1 h at 42 °C. The
reaction was stopped by adding 0.3 M sodium acetate, pH 5.2.
Primer extension products were recovered by ethanol precipitation,
dissolved in formamide loading buffer, and analyzed by electrophoresis
in a 6% polyacrylamide, 8 M urea gel in TBE buffer (34) .Obtaining Full-length cDNA by Reverse
Transcription-Polymerase Chain Reaction
Reverse transcription of
mRNA was performed as described above except 5 ng of nonlabeled primer
RT2 (TGGCCATGGGCACGCTCATCA) was used. The reaction was extracted with
phenol-chloroform once, precipitated with ethanol, and dissolved in 10
µl of TE (10 mM Tris-HCl, pH 7.5, 0.1 mM EDTA)
buffer. 1 µl of reverse transcription product was amplified by PCR
using primer RT 2 and a primer designed from the TPBF genomic DNA
sequence with an NdeI restriction site at its 5` end
(CATATGGAACATCAACAAGTTC). The PCR product was subsequently subcloned
into pSK(-) vector and sequenced.Plasmid Construction and Production of Full-length and
Mutant TPBF in E. coli
To reconstruct a full-length TPBF cDNA,
the 5` one-third of the original cDNA clone was removed by digestion
with KpnI and NcoI and replaced with the reverse
transcription-PCR product. The full-length cDNA was then cut out from
the pSK(-) vector with NdeI and BamHI,
gel-purified, and ligated into the NdeI-BamHI sites
of pET3a expression vector (Novagen). The expression vector containing
the full-length cDNA was digested with XhoI and religated to
create a mutant TPBF missing amino acids 254 to 296, which encodes part
of Coiled-coil II (Fig. 1B). To express full-length or
mutant TPBF, Escherichia coli LE392 (Novagen) was freshly
transformed with the expression vector and grown to an A of 0.8 in LB media supplemented with 0.2%
maltose and 100 µg/ml ampicillin. 1
10
plaque-forming units/ml of bacteriophage CE6 (Novagen, (41) ) and 10 mM of MgSO
were added to the
culture to start infection. The culture was incubated at 30 °C for
3.5 h. Cells were harvested by centrifugation at 5000 g for 5 min, resuspended in 20 mM Tris-HCl, pH 7.9, 5
mM imidazole, and 500 mM NaCl, and sonicated three
times for 30 s. Lysates were centrifuged at 12,000 g for 20 min to remove debris. Full-length or mutant TPBF was
purified from cell lysates using immobilized Ni (His
Bind resin, Novagen) according to the supplier's
recommendations, except that recombinant TPBF was eluted with 300
mM imidazole. Fractions were pooled, diluted 10-fold with the
buffer containing 20 mM HEPES, pH 7.5, 0.2 mM phenylmethylsulfonyl fluoride and 10% glycerol, and applied to a
DEAE-cellulose (Whatman) column equilibrated with buffer A (20 mM HEPES, pH 7.5, 10% glycerol, 0.1 mM EDTA, 1 mM DTT, and 0.2 mM phenylmethylsulfonyl fluoride) containing
100 mM KCl. The bound proteins were eluted with buffer A
containing 300 mM KCl. Fractions containing TPBF were pooled
and dialyzed overnight against buffer A containing 100 mM KCl.
Samples were stored at -80 °C.Production of Rabbit Anti-TPBF Immunoglobulins
1.5
mg of TPBF was purified from E. coli cells as described above.
The sample was purified further by electrophoresis on a 12%
SDS-polyacrylamide gel. Polyclonal antibodies were produced by
injecting a rabbit with gel slices containing TPBF (performed by
Cocalico Biologicals, Inc., Reamstown, PA). The antisera were tested
for specificity by immunoblotting of Acanthamoeba nuclear
extracts using the conditions described below.Construction of TPBF Mutants for in Vitro Protein
Synthesis
To construct C-terminal and N-terminal deletion
mutants, full-length TPBF cDNA in pSK(-) vector was used as a
template for PCR amplification. Fragments for the N-terminal deletion
series were generated by PCR using appropriate N-terminal primers and
the reverse primer (Stratagene). The PCR products were subcloned into
the EcoRV site of pSK(-) vector, downstream of the T7
polymerase promoter. The orientation of the inserts was confirmed by
digestion with XhoI. The same strategy was employed to
generate C-terminal deletions except the appropriate C-terminal primers
were used in combination with the primer starting from the first
methionine site (see above for sequence). Removal of an internal
fragment from the full-length cDNA was achieved by digestion of the
construct with SstI and religation, producing the internal
deletion mutant of TPBF (
127-253). Junctions of all
constructs for TPBF mutants were sequenced.S]Methionine (DuPont NEN) was incorporated into
synthesized proteins. All procedures were performed according to the
manufacturer's recommendations.
Electrophoretic Mobility Shift (EMS) Assay
The
double-stranded 27-mer DNA fragment containing the Acanthamoeba TBP gene promoter sequence between -96 and -70 was
used as the probe for EMS assays(32) . For protein-DNA binding
reactions, end-labeled DNA probe was incubated with 5 ng of purified
native Acanthamoeba TPBF or purified recombinant TPBF or with
1-2-µl aliquots of TPBF synthesized in the in vitro transcription-translation reaction mixtures. The reaction
conditions were as described previously(31) . For the
experiments shown in Fig. 4B and Fig. 8A, protein-DNA complexes were analyzed under the
previously described conditions. For the experiments in Fig. 5and Fig. 8B, the reactions were run on 6%
native polyacrylamide gels at 10 V/cm for 5 h.
1-76
is indicated by a solid diamond. The band shown by an open
diamond is related to nonspecific DNA binding from the
reticulocyte lysate.
X-Y on the left side of the panel. The column on the right side summarizes DNA binding activities as determined by EMS assays
shown in Fig. 8. B, SDS-PAGE analysis of in vitro synthesized TPBF polypeptides. An autoradiogram of S-labeled full-length TPBF (lane 1) and its
deletion mutants (lanes 2-8) is
shown.
In Vitro Transcription Assay
Transcription with
HeLa cell nuclear extracts was performed as described
previously(31) . A TBP promoter containing an intact TPBF
binding site was used. 100 ng of purified recombinant full-length TPBF
and mutant TPBF 254-296 were both assayed for their
transcription activation. Transcription products were assayed by primer
extension as described above.Chemical Cross-linking of Proteins
Glutaraldehyde
or DTSSP (3,3`-dithiobis(sulfosuccinimidylpropionate), Pierce), a
thiol-cleavable reagent, was used as cross-linker. 200 ng of purified
recombinant TPBF or 20 ng of partially purified natural Acanthamoeba TPBF was incubated in DNA binding buffer without
DTT and without DNA(32) . Cross-linking was performed with a
25- to 50-fold molar excess of freshly prepared DTSSP solution or
0.001% glutaraldehyde. Reactions were incubated at room temperature for
30 min and quenched with 50 mM lysine. In some experiments,
DTSSP cross-linked proteins were cleaved by incubation with 50 mM DTT at 37 °C for 30 min if necessary. Samples were resolved on
12% SDS-polyacrylamide gels. The gels were either stained with silver (34) or electroblotted for Western blotting analysis (see
below).
Western Blotting
Proteins were transferred from a
12% SDS-polyacrylamide gel to a nitrocellulose filter in a Trans-Blot
cell (Bio-Rad) using the conditions specified by the supplier. The
membrane was blocked using 5% dry milk in phosphate-buffered saline
containing 0.1% Nonidet P-40 for 30 min. It was then incubated with
1:200 diluted anti-TPBF sera for 30 min, followed by another 30-min
incubation with 1:5000 diluted horseradish peroxidase-linked
anti-rabbit Ig (Amersham). The membrane was washed extensively with
phosphate-buffered saline containing 0.1% Nonidet P-40 after each
incubation period. Signals were detected using a Chemiluminescent
Substrate Kit (Kirkegaard & Perry Laboratories).
Isolation of cDNA and Genomic Clones Encoding
TPBF
Acanthamoeba TPBF was purified and subjected to
internal sequencing as described under ``Experimental
Procedures.'' The amino acid sequences of three peptides were
obtained (Fig. 1A) and were used to design degenerate
oligonucleotides for use in amplification of genomic DNA. PCR yielded a
specific 200-bp fragment, which was subcloned and sequenced. 1
10
plaques of an Acanthamoeba cDNA library were
screened, and three positive cDNA clones were identified. All three
clones contained sequences encoding peptides I, II, and III (Fig. 1A). Both strands of one of the cDNA clones were
then completely sequenced. The 1060-bp cDNA contains an open reading
frame of 280 amino acids, encoding a polypeptide with an estimated
molecular mass of 30 kDa. The three clones had identical 5` ends, but
were not full-length based on the following observations: 1) there is a
large discrepancy between the apparent size of natural Acanthamoeba TPBF (50-51 kDa) and the deduced size predicted from the
cDNA; 2) the single open reading frame extends to the 5` end of the
cDNA; 3) primer extension of mRNA using a primer located 100 bp from
the 5` end of the cDNAs generated a product of 150 nucleotides (Fig. 2C and see below), which suggested that 50 bp was
missing from the cDNA clone.
mRNA
was probed with radiolabeled TPBF cDNA. The size of TPBF mRNA was
estimated by comparison to TBP mRNA and shown on the left margin.
C, primer extension of Acanthamoeba mRNA. 2 µg of
poly(A)
mRNA was used in primer extension with a
primer whose sequence was derived from TPBF cDNA (see
``Experimental Procedures''). The size of the primer
extension product was determined by sequencing a TPBF genomic clone
with the same primer.
Analysis of the Genomic Copy of the TPBF Gene and Its
Transcript
Digestion of Acanthamoeba genomic DNA with BamHI, EcoRI, HindIII, or PstI
followed by Southern blot analysis generated a single major band in
each case (Fig. 2A), suggesting that the TPBF gene is
unique within the Acanthamoeba genome. Multiple bands produced
by digestion with MboI, HpaI, or MspI are
due to the existence of restriction sites within the gene. 10 were obtained, suggesting that the level of TPBF
expression in Acanthamoeba is very low. The low abundance of
the TPBF message is in contrast to that of TPBF protein in nuclear
extracts, which contain 200 ng of TPBF/mg as judged by Western
blotting (data not shown).
Expression of Full-length and Mutant TPBF in E.
coli
In order to express full-length TPBF and a TPBF mutant
lacking amino acids 254 to 296 (254-296), we subcloned the
corresponding cDNAs into the pET3a vector as detailed under
``Experimental Procedures.'' However, due to the toxicity of
the proteins in E. coli, we were unable to maintain the
expression plasmids in either E. coli BL21(DE3) or in
BL21(DE3)pLysS(41) . We therefore had to maintain the plasmids
in E. coli LE392 and induce protein expression by infection
with CE6 (41) to provide T7 RNA polymerase. Both proteins
were expressed at high levels in infected E. coli (Fig. 3, compare lanes 1 and 2, data not
shown for
254-296).
affinity chromatography (Fig. 3, lane 5). The recombinant proteins were further
purified by DEAE-cellulose chromatography, yielding a single major band (Fig. 3, lane 6).
Recombinant TPBF Expressed in E. coli Binds the TPE
Sequence and Transactivates the Acanthamoeba TBP Gene
Promoter
The DNA binding activities of natural TPBF, purified
recombinant TPBF, and the TPBF mutant 254-296 (shown in Fig. 4A) were compared by gel mobility shift assays.
The complex between the recombinant TPBF and DNA had a mobility
identical with that of the natural Acanthamoeba TPBF-DNA
complex (Fig. 4B, lanes 1 and 2). The
binding specificity was tested by competition with either a specific or
mutant TPE (Fig. 4B, lanes 3 and 4).
The results demonstrated a functional identity between recombinant and
natural TPBF. Comparing the intensities of the bands, no significant
difference in DNA binding activities was observed between recombinant
and natural proteins. In contrast, mutant 254-296 completely
lacks DNA binding activity (Fig. 4B, lane 5),
indicating the importance of the putative coiled-coil region in DNA
binding.254-296 is
unable to stimulate transcription (Fig. 4C, lane
3). To ensure that the observed transactivation was TPE-dependent,
parallel experiments were done using a TBP promoter that lacks the TPE
element. As expected, TPBF was not able to stimulate transcription in
the absence of the TPE sequence (data not shown). We have also obtained
similar results using Acanthamoeba extracts immunodepleted of
TPBF (data not shown).TPBF Forms a Tetramer When Bound to DNA
We
previously reported that TPBF exists as a dimer or higher order
oligomer(32) . To definitively determine its oligomerization
state, full-length TPBF and a truncated TPBF (1-76) were
synthesized individually or in combination using an in vitro transcription-translation system(49) . The truncated
protein was mutant 1-76 (Fig. 7A) which has
DNA binding activity (Fig. 5, lane 6) and can be
resolved easily from full-length TPBF in gel mobility shift assays.
When individually synthesized proteins were assayed for TPE binding,
TPBF formed one shifted protein-DNA band while the mutant generated one
major band and a minor band. The minor band is caused by a partial
length TPBF polypeptide produced during translation. The wild type and
mutant bands had the expected difference in mobility (Fig. 5, lanes 1 and 6). When the polypeptides cotranslated at
varying ratios while keeping the total protein amount approximately
constant were assayed, five major bands were clearly visible. There is
a gradual distribution from the largest to the smallest bands with
increasing amounts of the mutant protein (Fig. 5, lanes
1-6). Two of the bands (indicated by open
triangles) were seen in individually synthesized proteins. The
other three bands (indicated by solid triangles) had
intermediate mobilities distributed between the two outer bands. A
faint band distributed in between the two lowest major bands may be the
product of association between TPBF and the shortened version of the
mutant polypeptide. and S), while the
three inner bands correspond to hetero-oligomeric complexes
(L
S, LS, and
LS).TPBF Exists as a Tetramer in Solution
In order to
determine the oligomerization state of TPBF in solution, we performed
cross-linking experiments with either DTSSP or glutaraldehyde, in the
absence of DNA. Cross-linking of purified recombinant TPBF with either
DTSSP or glutaraldehyde, followed by SDS-PAGE and silver-staining,
produced two cross-linked bands with apparent molecular masses of about
160 kDa and 140 kDa (Fig. 6A). The size difference
between these two bands indicates they are unlikely to be different
oligomers. Most likely, the two bands were generated by cross-linking
at different residues. Thus we believe that both bands correspond to
one single form of oligomer. The size of the cross-linked bands, about
4 times that of the TPBF monomer, in combination with the above
observation that TPBF binds DNA as a tetramer, suggests that TPBF is
also tetrameric in the absence of DNA.
254-296 is unable
to form a tetramer in solution (data not shown). Loss of
multimerization of TPBF mutant 254-296 is likely due to loss
of the Coiled-coil II structure. Multimerization of TPBF is thus
evidently necessary for binding to DNA (see also below).Identification of Regions in TPBF Responsible for DNA
Binding
To further delineate the coiled-coil region and
investigate other regions required for specific DNA binding, we made a
series of TPBF deletion mutants as detailed under ``Experimental
Procedures'' and summarized in Fig. 7A. Mutant and
wild type proteins were synthesized using coupled in vitro transcription-translation in the presence of
[S]methionine. Analysis of proteins by SDS-PAGE
and autoradiography showed that a comparable amount of each mutant TPBF
was made (Fig. 7B). The sizes of the mutant
polypeptides were roughly proportional to the sizes of the mutated
genes (compare A and B of Fig. 7). Some of the
products migrated as doublets (Fig. 7B) because the
translation system utilized either of two methionines located close to
the N terminus (Fig. 1A). All these products were
assayed by gel mobility shift for their abilities to bind the TPE
element. Protein synthesized from the wild type TPBF construct
generated a band that had exactly the same mobility as the band
produced by natural Acanthamoeba TPBF (Fig. 8A, lanes 1 and 2). Deleting
the first 20 amino acids, which are very histidine-rich, did not have
an observable effect on DNA binding activity (Fig. 8A, lanes 2 and 3). Removal of amino acid residues 1 to
76 significantly reduced DNA binding activity (Fig. 8A, lanes 3 and 4), indicating that this region is
involved in, but not essential for, DNA binding. Further deletion to
residue 122 reduced DNA binding activity to near background level (Fig. 8A, lane 5, and 8B, lane
1). Deletion of residues 127-253 totally abolished DNA
binding activity suggesting that an essential region had been removed (Fig. 8A, lane 6, and Fig. 8B, lane 2).
254-296 in this
system and again found it was inactive in DNA binding (Fig. 8A, lane 7, and Fig. 8B, lane 3). This deletion removes two heptads from Coiled-coil
II, presumably preventing tetramerization. We also tested two
C-terminal deletion mutants. Interestingly, removal of 7 amino acid
residues from the C terminus increased the DNA binding activity
severalfold (Fig. 8A, lanes 2 and 9).
Removal of Coiled-coil II (mutant 278-327) resulted in the
production of a polypeptide unable to bind DNA (Fig. 8A, lane 8, and Fig. 8B, lane 4). These results indicated that regions essential for
DNA binding are distributed between amino acid residues 123 and 320.
Presumably, the C-terminal Coiled-coil II drives tetramerization and is
therefore necessary for DNA binding; while the regions that make DNA
contact are located between amino acid residues 123 and 280.
or
Ni
, perhaps arranged in a configuration similar to
the metal ions in urease(51) . Metal coordination by histidines
might stabilize a particular protein conformation analogous to zinc
fingers or zinc clusters(50) . While the histidines are not
required for DNA binding based on mutagenesis, they could be involved
in another function that our assays did not assess, for example,
transcription activation. A similar possibility exists for the
proline-rich region between amino acid residues 40 and 85. Proline-rich
domains can function as activation regions in some transcription
factors such as CTF(47) . However, we have been unable to
localize the transactivation domain directly since we have been unable
to establish a homologous system to assay mutant TPBFs. We failed to
recover activated transcription by simply adding back-purified
recombinant or native TPBF into a nuclear extract in which TPBF has
been sequestered by specific TPE DNA, or nickel affinity chromatography
(data not shown). All these results suggest TPBF might employ a
coactivator or adaptor to mediate its transactivation
activity(18, 52) . It will be of considerable interest
to identify the transactivation domain of TPBF as well as its target.
1 has two coiled-coils, one is involved in the formation
of a loose multimer while the other stabilizes the multimer (56) . Our prediction of how the two coiled-coils function in
TPBF is similar to this model, i.e. Coiled-coil II mediates
tetramerization of TPBF, and the tetramer is further stabilized by
Coiled-coil I. This idea is supported by the preferential formation of
homotetramer of wild type TPBF over a truncated version lacking
Coiled-coil I (Fig. 5, lane 2). It is likely that the
association of cotranslated polypeptides is not random. Instead, it
favors the formation of tetramers containing Coiled-coil I, which
provides additional stabilization. However, Coiled-coil I may also be
involved in stabilizing tetramer-DNA interactions.
1-122 had very weak DNA binding activity, the region from 20
to 122 is most likely involved in determining the binding efficiency
but not specificity. The region involved in determining DNA sequence
specificity is therefore contained within amino acids 123 to 281. We
have preliminary evidence suggesting the basic region from 123 to 194
is in fact necessary for DNA binding. ()However, finer
mapping needs to be done to further define the region necessary for
sequence-specific DNA binding.
))
We thank Dr. Feng Liu for help in TPBF purification.
We also thank Drs. David Pederson and Tom Orfeo for comments on the
manuscript.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  L. Chen, Z. Peng, and E. Bateman In vivo interactions of the Acanthamoeba TBP gene promoter Nucleic Acids Res., February 19, 2004; 32(4): 1251 - 1260. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 D. Guillebault, S. Sasorith, E. Derelle, J.-M. Wurtz, J.-C. Lozano, S. Bingham, L. Tora, and H. Moreau A New Class of Transcription Initiation Factors, Intermediate between TATA Box-binding Proteins (TBPs) and TBP-like Factors (TLFs), Is Present in the Marine Unicellular Organism, the Dinoflagellate Crypthecodinium cohnii J. Biol. Chem., October 18, 2002; 277(43): 40881 - 40886. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Chen and E. Bateman Linker Scanning Analysis of TBP Promoter Binding Factor DNA Binding, Activation, and Repression Domains J. Biol. Chem., January 28, 2000; 275(4): 2771 - 2776. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
W. Huang and E. Bateman Transcription of the Acanthamoeba TATA-binding Protein Gene. A SINGLE TRANSCRIPTION FACTOR ACTS BOTH AS AN ACTIVATOR AND A REPRESSOR J. Biol. Chem., February 7, 1997; 272(6): 3852 - 3859. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |