Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, W.
Right arrow Articles by Bateman, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, W.
Right arrow Articles by Bateman, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 48, Issue of December 1, 1995 pp. 28839-28847
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Cloning, Expression, and Characterization of the TATA-binding Protein (TBP) Promoter Binding Factor, a Transcription Activator of the Acanthamoeba TBP Gene (*)

(Received for publication, August 10, 1995; and in revised form, September 15, 1995)

Weibiao Huang Erik Bateman (§)

From the Department of Microbiology and Molecular Genetics, Markey Center for Molecular Genetics, University of Vermont, Burlington, Vermont 05405

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

TATA-binding protein (TBP) gene promoter binding factor (TPBF) is a transactivator which binds to the TBP promoter element (TPE) sequence of the Acanthamoeba TBP gene promoter and stimulates transcription in vitro. We have isolated a cDNA clone encoding TPBF. TPBF is a polypeptide of 327 amino acids with a calculated molecular mass of 37 kDa. The predicted amino acid sequence of TPBF shows no significant homology to other proteins. TPBF has two potential coiled-coil regions, a basic region, a proline-rich region, a histidine-rich N terminus, and a nuclear targeting sequence. The recombinant protein has an apparent molecular mass of 50 kDa, identical with that of TPBF purified from Acanthamoeba. Recombinant TPBF is able to bind DNA and activate transcription with the same specificity as natural Acanthamoeba TPBF, demonstrating the authenticity of the clone. Mobility shift assays of co-translated TPBF polypeptides and chemical cross-linking demonstrate that TPBF is tetrameric in solution and when bound to DNA. Analyses of TPBF mutants show that Coiled-coil II is essential for DNA binding, but Coiled-coil I and the basic region are also involved. TPBF is thus a novel DNA-binding protein with functional similarity to the tumor suppressor protein p53.


INTRODUCTION

Accurate transcription initiation of all three classes of genes in eukaryotic cells requires stepwise assembly of several general transcription factors and the appropriate RNA polymerase on promoter DNA. The TATA-binding protein, TBP, (^1)is involved in transcription by all three RNA polymerases both in vitro and in vivo(1, 2, 3, 4, 5) . TBP is complexed into SL1(1) , TFIID(6) , and TFIIIB (7, 8, 9, 10) for its function in RNA polymerase I, II, and III systems, respectively. These TBP-containing initiation factors are recruited to the different classes of promoters by specific protein-DNA (11, 12) and/or protein-protein interactions(1, 7, 8, 9, 10, 13) .

In the case of TATA-containing class II promoters, TFIID, consisting of TBP and a large number of associated factors (TAFs)(5, 14, 15, 16) , binds directly to DNA through specific interactions between TBP and the TATA box (11, 12) as the first step in formation of the initiation complex. This TFIID-DNA complex then recruits other general transcription factors, such as TFIIB, TFIIE, TFIIF, TFIIH, and RNA polymerase II to form a complete initiation complex(17) .

An additional class of transcription factors, known as sequence-specific transcription activators, is involved in efficient transcription by RNA polymerase II. These activators bind specifically to promoter sequences and modulate levels of expression of the selected genes, providing a regulatory strategy for eukaryotic cells to control development, differentiation, and their responses to extracellular stimuli. Evidence obtained in recent years suggests that sequence-specific activators stimulate transcription through direct or indirect (via coactivators) communication with the general transcription factors. Interactions between activators and general transcription factors TFIIA(18) , TFIIB(19, 20, 21) , TBP(22) , TAFs(23, 24) , TFIIF(25) , and TFIIH (26) have been reported. However, the mechanism of transcription stimulation is not well understood.

Typical eukaryotic transcription activators are composed of discrete structural domains that have specific functions(27) , for example, in multimerization, DNA binding, and transcription activation or repression. Different structural motifs involved in DNA binding and activation have been identified and used to classify transcription activators. A fully functional activator can be constructed by combination of functional domains from different activators(28) .

The Acanthamoeba TBP gene promoter contains two major elements that are necessary for efficient transcription. The TATA box at -30 functions by binding TFIID, which is necessary for basal transcription(29, 30) . The TPE is a 23-base pair element centered around -90, which stimulates basal transcription up to 10-fold in vitro. The TPE binds a regulatory factor called TPBF (31) , which was identified and purified previously in this laboratory (31, 32) . TPBF is of interest because it regulates TBP gene transcription, but also because it is an apparently novel type of DNA-binding protein. Chemical interference assays demonstrated protein-DNA contacts on opposite faces of the DNA helix(32) . This pattern, while reminiscent of the proposed model for p53 tetramer bound to DNA(33) , is distinct from that produced by other factors(32) . Although TPBF was found by gel filtration to be oligomeric(32) , the resolution was not sufficient to distinguish trimeric and tetrameric forms of the protein. Finally, TPBF is phosphorylated, and removal of phosphate increased DNA binding, suggesting that phosphorylation could play a regulatory function in vivo.

In order to determine the basis for these properties of TPBF and to permit further characterization of its role and mechanism in TBP gene expression, we isolated cDNA and genomic DNA clones encoding TPBF. Expression and analysis of cloned TPBF and mutant derivatives demonstrate that TPBF is a novel tetrameric DNA-binding protein. It contains a C-terminal coiled-coil domain necessary for tetramerization, as well as an apparently large central region involved in DNA binding. Other structural features of TPBF are discussed.


EXPERIMENTAL PROCEDURES

Purification of TPBF and Internal Peptide Sequencing

Purification of TPBF essentially followed the scheme described elsewhere(32) . TPBF (5 µg) was loaded onto a 12% SDS-polyacrylamide gel(34) , then blotted onto a polyvinylidene difluoride membrane (Applied Biosystems), and visualized by Ponceau S staining(35, 36) . The TPBF band was cut out and used for tryptic digestion and internal amino acid sequencing by the Harvard Microchemistry Laboratory(36) . Three peptides were sequenced (Fig. 1A). The amino acid sequences -AFQSNYR- in peptide II and -PYLTDDA- in peptide III were used to design two sets of degenerate oligonucleotides for PCR amplification of the target gene.


Figure 1: Nucleotide sequence, predicted amino acid sequence, and schematic diagram of the TPBF gene. A, nucleotide and deduced amino acid sequences of the TPBF cDNA. The underlined sequences correspond to the sequenced peptides. Open triangles show the two arrays of heptad repeats of hydrophobic amino acids. B, schematic presentation of TPBF indicating presumptive functional domains (see text). Relative positioning of the domains is shown by the scale above the gene. These data have been submitted to GenBank under accession number L46867.



Generating a TPBF-specific Probe by the Polymerase Chain Reaction

Two pairs of degenerate primers were synthesized corresponding to amino acid sequences -AFQSNYR- and -PYLTDDA-. 1) GC(G/C)TTCCAGTC(G/C)AACTACCG; 2) CGGTAGTT(G/C)GACTGGAA(G/C)GC; 3) CC(G/C)TACCT(G/C)AC(G/C)GA(C/T)GA(C/T)GC; 4) GC(G/A)TC(G/A)TC(G/C)GT(G/C)AGGTA(G/C)CG.

Amplification of Acanthamoeba castellanii genomic DNA (37) by PCR was performed under the following cycle conditions: the first cycle at 94 °C for 5 min, followed by 30 cycles of 94 °C for 1 min, 48 °C for 1 min, and 72 °C for 2 min, and the last cycle at 72 °C for 10 min. Several PCR products were generated using either primer combination (data not shown). The products were subcloned into the pSK(-) vector (Stratagene) and sequenced. One subclone, encoding the TPBF peptides, was obtained.

Isolation of a cDNA Clone and a Genomic Clone for TPBF

Using the subcloned PCR fragment as a probe, an A. castellanii cDNA library in ZAP (38) was screened. The cDNA library was plated out on twenty 15-cm plates, each containing approximately 50,000 plaques. The plaques were blotted onto nitrocellulose filters (Schleicher & Schuell), and the DNA was denatured, neutralized, and immobilized(34) . The filters were prehybridized at 65 °C for 2 h in 500 mM Na(2)HPO(4), pH 7.2, 1% SDS, 1 mM EDTA, and denatured salmon sperm DNA (100 µg/ml), and then hybridized with a P-labeled TPBF probe for 12 h at 65 °C. Filters were then washed twice for 10 min at room temperature with 500 ml of 1 times SSC containing 0.1% SDS and once for 15 min at 65 °C with 500 ml of 0.1 times SSC containing 0.1% SDS. Positive clones were rescued as double-stranded plasmids in the pSK(-) vector(39) . To obtain a genomic clone of TPBF gene, an Acanthamoeba genomic DNA library, constructed in EMBL3A (29) , was screened using the cDNA-derived probe. One positive TPBF genomic clone was mapped to an 8-kilobase PstI fragment. The 8-kilobase fragment was subcloned into the pSK(-) vector and partially sequenced by primers derived from the cDNA sequence.

Northern Blot Analysis

Total cellular RNA was isolated using guanidine isothiocyanate(38, 40) , and mRNA was selected by two rounds of chromatography on oligo(dT)-cellulose (Life Technologies, Inc.). Samples of 10 µg of mRNA were subjected to electrophoresis on a 1% formaldehyde-agarose gel(34) , transferred to a nitrocellulose filter, and hybridized with the P-labeled cDNA-derived probe as described above.

Southern Blot Analysis

Acanthamoeba genomic DNA was prepared as described elsewhere(37) . 2-µg aliquots were digested with BamHI, EcoRI, HindIII, PstI, MboI, HpaII, or MspI and separated by electrophoresis on a 0.8% agarose gel. Following depurination, the DNA was transferred to a nylon membrane (GeneScreen Plus, DuPont NEN) and probed with P-labeled cDNA(34) .

Primer Extension of mRNA

2 µg of mRNA was dissolved in 10 µl of annealing buffer containing 20 mM Tris-HCl, pH 8.3, and 0.4 M KCl and mixed with 50,000 to 100,000 cpm of labeled primer RT1 (GATGTGTGACAGATCATGGGTGCTGTT). The annealing reaction was incubated at 65 °C for 10 min and then allowed to cool slowly to room temperature. Primer extension (40 µl) was begun by adding 4 µl of 10 times reverse transcription buffer (500 mM Tris-HCl, pH 8.3, 60 mM MgCl(2), 25 mM DTT), 4 µl of dNTP mix (2.5 mM each), 1 unit of RNasin, and 20 units of Superscript II (Life Technologies, Inc.), followed by incubation for 1 h at 42 °C. The reaction was stopped by adding 0.3 M sodium acetate, pH 5.2. Primer extension products were recovered by ethanol precipitation, dissolved in formamide loading buffer, and analyzed by electrophoresis in a 6% polyacrylamide, 8 M urea gel in TBE buffer (34) .

Obtaining Full-length cDNA by Reverse Transcription-Polymerase Chain Reaction

Reverse transcription of mRNA was performed as described above except 5 ng of nonlabeled primer RT2 (TGGCCATGGGCACGCTCATCA) was used. The reaction was extracted with phenol-chloroform once, precipitated with ethanol, and dissolved in 10 µl of TE (10 mM Tris-HCl, pH 7.5, 0.1 mM EDTA) buffer. 1 µl of reverse transcription product was amplified by PCR using primer RT 2 and a primer designed from the TPBF genomic DNA sequence with an NdeI restriction site at its 5` end (CATATGGAACATCAACAAGTTC). The PCR product was subsequently subcloned into pSK(-) vector and sequenced.

Plasmid Construction and Production of Full-length and Mutant TPBF in E. coli

To reconstruct a full-length TPBF cDNA, the 5` one-third of the original cDNA clone was removed by digestion with KpnI and NcoI and replaced with the reverse transcription-PCR product. The full-length cDNA was then cut out from the pSK(-) vector with NdeI and BamHI, gel-purified, and ligated into the NdeI-BamHI sites of pET3a expression vector (Novagen). The expression vector containing the full-length cDNA was digested with XhoI and religated to create a mutant TPBF missing amino acids 254 to 296, which encodes part of Coiled-coil II (Fig. 1B). To express full-length or mutant TPBF, Escherichia coli LE392 (Novagen) was freshly transformed with the expression vector and grown to an A of 0.8 in LB media supplemented with 0.2% maltose and 100 µg/ml ampicillin. 1 times 10^9 plaque-forming units/ml of bacteriophage CE6 (Novagen, (41) ) and 10 mM of MgSO(4) were added to the culture to start infection. The culture was incubated at 30 °C for 3.5 h. Cells were harvested by centrifugation at 5000 times g for 5 min, resuspended in 20 mM Tris-HCl, pH 7.9, 5 mM imidazole, and 500 mM NaCl, and sonicated three times for 30 s. Lysates were centrifuged at 12,000 times g for 20 min to remove debris. Full-length or mutant TPBF was purified from cell lysates using immobilized Ni (HisbulletBind resin, Novagen) according to the supplier's recommendations, except that recombinant TPBF was eluted with 300 mM imidazole. Fractions were pooled, diluted 10-fold with the buffer containing 20 mM HEPES, pH 7.5, 0.2 mM phenylmethylsulfonyl fluoride and 10% glycerol, and applied to a DEAE-cellulose (Whatman) column equilibrated with buffer A (20 mM HEPES, pH 7.5, 10% glycerol, 0.1 mM EDTA, 1 mM DTT, and 0.2 mM phenylmethylsulfonyl fluoride) containing 100 mM KCl. The bound proteins were eluted with buffer A containing 300 mM KCl. Fractions containing TPBF were pooled and dialyzed overnight against buffer A containing 100 mM KCl. Samples were stored at -80 °C.

Production of Rabbit Anti-TPBF Immunoglobulins

1.5 mg of TPBF was purified from E. coli cells as described above. The sample was purified further by electrophoresis on a 12% SDS-polyacrylamide gel. Polyclonal antibodies were produced by injecting a rabbit with gel slices containing TPBF (performed by Cocalico Biologicals, Inc., Reamstown, PA). The antisera were tested for specificity by immunoblotting of Acanthamoeba nuclear extracts using the conditions described below.

Construction of TPBF Mutants for in Vitro Protein Synthesis

To construct C-terminal and N-terminal deletion mutants, full-length TPBF cDNA in pSK(-) vector was used as a template for PCR amplification. Fragments for the N-terminal deletion series were generated by PCR using appropriate N-terminal primers and the reverse primer (Stratagene). The PCR products were subcloned into the EcoRV site of pSK(-) vector, downstream of the T7 polymerase promoter. The orientation of the inserts was confirmed by digestion with XhoI. The same strategy was employed to generate C-terminal deletions except the appropriate C-terminal primers were used in combination with the primer starting from the first methionine site (see above for sequence). Removal of an internal fragment from the full-length cDNA was achieved by digestion of the construct with SstI and religation, producing the internal deletion mutant of TPBF (Delta127-253). Junctions of all constructs for TPBF mutants were sequenced.

In vitro protein syntheses from plasmids encoding full-length and mutant TPBF were carried out with the Single Tube Protein System 2 (Novagen) in which transcription driven by T7 RNA polymerase is coupled to translation by a rabbit reticulocyte lysate (42) . [S]Methionine (DuPont NEN) was incorporated into synthesized proteins. All procedures were performed according to the manufacturer's recommendations.

Electrophoretic Mobility Shift (EMS) Assay

The double-stranded 27-mer DNA fragment containing the Acanthamoeba TBP gene promoter sequence between -96 and -70 was used as the probe for EMS assays(32) . For protein-DNA binding reactions, end-labeled DNA probe was incubated with 5 ng of purified native Acanthamoeba TPBF or purified recombinant TPBF or with 1-2-µl aliquots of TPBF synthesized in the in vitro transcription-translation reaction mixtures. The reaction conditions were as described previously(31) . For the experiments shown in Fig. 4B and Fig. 8A, protein-DNA complexes were analyzed under the previously described conditions. For the experiments in Fig. 5and Fig. 8B, the reactions were run on 6% native polyacrylamide gels at 10 V/cm for 5 h.


Figure 4: DNA binding and transactivation activities of purified recombinant TPBF. A, silver staining of an SDS-PAGE containing purified TPBF proteins used in EMS and in vitro transcription assays. Lane 1, TPBF purified from Acanthamoeba nuclear extracts. Lane 2, full-length recombinant TPBF. Lane 3, mutant TPBF deleting amino acids 254-296. B, DNA binding activity and specificity of recombinant TPBF analyzed by EMS assay with 4% native polyacrylamide gel. 5 ng of proteins was used in each reaction. Lane 1, natural Acanthamoeba TPBF. Lane 2, full-length recombinant TPBF. Lanes 3 and 4, full-length recombinant TPBF plus 50 ng of unlabeled specific and nonspecific competitor DNA, respectively. Lane 5, mutant TPBF. Lane 6, control DNA without protein. C, transcription stimulation by purified recombinant TPBF. In vitro transcription assay was performed using HeLa cell nuclear extracts with the template containing an intact TPE. Lane 1, HeLa nuclear extracts alone. Lanes 2 and 3 had 100 ng of full-length and mutant TPBF included, respectively.




Figure 8: DNA binding activity of TPBF deletion mutants. 5 ng of natural Acanthamoeba TPBF or 2 µl of in vitro synthesized TPBF polypeptides indicated in Fig. 7were analyzed. A, EMS assay of TPBF mutants on a 4% native polyacrylamide gel. Lane 1, Acanthamoeba TPBF. Lanes 2-9 show DNA binding activities of various TPBF polypeptides as indicated on the top of the panel. Lane 10 was a control without protein. Nonspecific binding from reticulocyte lysate is indicated by an open triangle. B, EMS assay of TPBF mutants on a 6% native polyacrylamide gel. Mutants whose DNA binding activities were too faint to be detected in A were assayed. The mutant assayed in each lane is indicated on the top of the panel. The specific protein-DNA complex is indicated by a solid triangle, the nonspecific ones by an open diamond.




Figure 5: Recombinant TPBF binds to DNA as a tetramer. TPBF polypeptides were synthesized by in vitro coupled transcription-translation at the ratios indicated on the top of the panel. 1 µl of each reaction mixture was analyzed by EMS assay with 6% native polyacrylamide gel. Homo-oligomeric complexes are indicated by open triangles while hetero-oligomeric complexes by solid triangles. A minor complex likely caused by the breakdown product of Delta1-76 is indicated by a solid diamond. The band shown by an open diamond is related to nonspecific DNA binding from the reticulocyte lysate.




Figure 7: Structures and synthesis of TPBF mutants. A, map of TPBF deletion mutants. Deletion mutants were generated as described under ``Experimental Procedures.'' Mutants with sequences between amino acids X and Y removed are denoted as DeltaX-Y on the left side of the panel. The column on the right side summarizes DNA binding activities as determined by EMS assays shown in Fig. 8. B, SDS-PAGE analysis of in vitro synthesized TPBF polypeptides. An autoradiogram of S-labeled full-length TPBF (lane 1) and its deletion mutants (lanes 2-8) is shown.



In Vitro Transcription Assay

Transcription with HeLa cell nuclear extracts was performed as described previously(31) . A TBP promoter containing an intact TPBF binding site was used. 100 ng of purified recombinant full-length TPBF and mutant TPBF Delta254-296 were both assayed for their transcription activation. Transcription products were assayed by primer extension as described above.

Chemical Cross-linking of Proteins

Glutaraldehyde or DTSSP (3,3`-dithiobis(sulfosuccinimidylpropionate), Pierce), a thiol-cleavable reagent, was used as cross-linker. 200 ng of purified recombinant TPBF or 20 ng of partially purified natural Acanthamoeba TPBF was incubated in DNA binding buffer without DTT and without DNA(32) . Cross-linking was performed with a 25- to 50-fold molar excess of freshly prepared DTSSP solution or 0.001% glutaraldehyde. Reactions were incubated at room temperature for 30 min and quenched with 50 mM lysine. In some experiments, DTSSP cross-linked proteins were cleaved by incubation with 50 mM DTT at 37 °C for 30 min if necessary. Samples were resolved on 12% SDS-polyacrylamide gels. The gels were either stained with silver (34) or electroblotted for Western blotting analysis (see below).

Western Blotting

Proteins were transferred from a 12% SDS-polyacrylamide gel to a nitrocellulose filter in a Trans-Blot cell (Bio-Rad) using the conditions specified by the supplier. The membrane was blocked using 5% dry milk in phosphate-buffered saline containing 0.1% Nonidet P-40 for 30 min. It was then incubated with 1:200 diluted anti-TPBF sera for 30 min, followed by another 30-min incubation with 1:5000 diluted horseradish peroxidase-linked anti-rabbit Ig (Amersham). The membrane was washed extensively with phosphate-buffered saline containing 0.1% Nonidet P-40 after each incubation period. Signals were detected using a Chemiluminescent Substrate Kit (Kirkegaard & Perry Laboratories).


RESULTS

Isolation of cDNA and Genomic Clones Encoding TPBF

Acanthamoeba TPBF was purified and subjected to internal sequencing as described under ``Experimental Procedures.'' The amino acid sequences of three peptides were obtained (Fig. 1A) and were used to design degenerate oligonucleotides for use in amplification of genomic DNA. PCR yielded a specific 200-bp fragment, which was subcloned and sequenced. 1 times 10^6 plaques of an Acanthamoeba cDNA library were screened, and three positive cDNA clones were identified. All three clones contained sequences encoding peptides I, II, and III (Fig. 1A). Both strands of one of the cDNA clones were then completely sequenced. The 1060-bp cDNA contains an open reading frame of 280 amino acids, encoding a polypeptide with an estimated molecular mass of 30 kDa. The three clones had identical 5` ends, but were not full-length based on the following observations: 1) there is a large discrepancy between the apparent size of natural Acanthamoeba TPBF (50-51 kDa) and the deduced size predicted from the cDNA; 2) the single open reading frame extends to the 5` end of the cDNA; 3) primer extension of mRNA using a primer located 100 bp from the 5` end of the cDNAs generated a product of 150 nucleotides (Fig. 2C and see below), which suggested that 50 bp was missing from the cDNA clone.


Figure 2: Analysis of the TPBF gene and its transcript. A, Southern blot analysis of genomic DNA. 2 µg of Acanthamoeba genomic DNA was digested with the indicated restriction enzymes and probed with radiolabeled TPBF cDNA as described under ``Experimental Procedures.'' Size markers are indicated on the left side of the panel. B, Northern blot analysis of Acanthamoeba mRNA. 10 µg of poly(A) mRNA was probed with radiolabeled TPBF cDNA. The size of TPBF mRNA was estimated by comparison to TBP mRNA and shown on the left margin. C, primer extension of Acanthamoeba mRNA. 2 µg of poly(A) mRNA was used in primer extension with a primer whose sequence was derived from TPBF cDNA (see ``Experimental Procedures''). The size of the primer extension product was determined by sequencing a TPBF genomic clone with the same primer.



We used ``rapid amplification of cDNA ends'' (43) to obtain the missing 5` end of the cDNA. In order to find a rapid amplification of cDNA ends primer, we isolated a genomic clone encoding TPBF and partially sequenced it. Two in-frame methionines were found in the 50-bp sequence preceding the 5` end of the cDNA within the genomic copy of the TPBF gene. Using the primer starting from the first in-frame methionine in combination with primer RT2, we successfully obtained the missing part of the cDNA from mRNA by reverse transcription-PCR and reconstructed the full-length cDNA. The complete (both strands) sequence of the reconstructed TPBF cDNA is presented in Fig. 1A.

The complete cDNA comprises 1088 bp and contains an open reading frame of 327 amino acids with a predicted molecular mass of 37 kDa (Fig. 1A). There are several sequence motifs of potential importance to the function of TPBF as a transcription activator. First, it bears a putative nuclear localization signal of 5 consecutive basic residues KKRRK (residues 132-136, Fig. 1), which appears in many transcription factors(44) . Second, there are two segments containing heptad repeats of hydrophobic residues in the sequence (indicated by open triangles, Coiled-coil I and II). Coiled-coil II contains a perfect hydrophobic 4-3 repeat that could form a coiled-coil structure and drive oligomerization of TPBF(45, 46) . Third, the region between residues 40 and 85 is proline-rich, which, by analogy to other factors, might be important in mediating transcription activation(47) . Fourth, the N-terminal 24 amino acids of TPBF is unusually histidine-rich, containing 10 histidine residues. However, data base searches showed that TPBF lacks significant sequence homology to any other known genes(48) . These features are considered further under ``Discussion.''

Analysis of the Genomic Copy of the TPBF Gene and Its Transcript

Digestion of Acanthamoeba genomic DNA with BamHI, EcoRI, HindIII, or PstI followed by Southern blot analysis generated a single major band in each case (Fig. 2A), suggesting that the TPBF gene is unique within the Acanthamoeba genome. Multiple bands produced by digestion with MboI, HpaI, or MspI are due to the existence of restriction sites within the gene.

Northern analysis (Fig. 2B) indicates that TPBF is transcribed into a single mRNA with a size of about 1,100 nucleotides. Primer extension of Acanthamoeba mRNA generated one single band of the expected size (Fig. 2C), indicating that the transcript begins about 30 bp downstream from an imperfect TATA box within the genomic copy of the TPBF gene. The TPBF transcript appears to be extremely rare. 10 µg of mRNA was required to obtain a clear signal in Northern blot analysis. Similarly, only 3 plaques from 1 times 10^6 were obtained, suggesting that the level of TPBF expression in Acanthamoeba is very low. The low abundance of the TPBF message is in contrast to that of TPBF protein in nuclear extracts, which contain 200 ng of TPBF/mg as judged by Western blotting (data not shown).

Expression of Full-length and Mutant TPBF in E. coli

In order to express full-length TPBF and a TPBF mutant lacking amino acids 254 to 296 (Delta254-296), we subcloned the corresponding cDNAs into the pET3a vector as detailed under ``Experimental Procedures.'' However, due to the toxicity of the proteins in E. coli, we were unable to maintain the expression plasmids in either E. coli BL21(DE3) or in BL21(DE3)pLysS(41) . We therefore had to maintain the plasmids in E. coli LE392 and induce protein expression by infection with CE6 (41) to provide T7 RNA polymerase. Both proteins were expressed at high levels in infected E. coli (Fig. 3, compare lanes 1 and 2, data not shown for Delta254-296).


Figure 3: Purification of recombinant TPBF expressed in E. coli. Recombinant TPBF at various stages of purification was analyzed by SDS-PAGE and stained with Coomassie Blue. Lane 1, E. coli cells transformed with pET3a vector. Lane 2, E. coli cells transformed with pET3a containing TPBF cDNA. Lane 3, lysate from E. coli containing recombinant TPBF. Lane 4, flow-through of E. coli lysate over nickel affinity column. Lane 5, TPBF following elution from nickel affinity column. Lane 6, TPBF following elution from DEAE-cellulose.



The existence of histidine-rich sequences at the N terminus of full-length or deleted TPBF enabled us to purify them by Ni affinity chromatography (Fig. 3, lane 5). The recombinant proteins were further purified by DEAE-cellulose chromatography, yielding a single major band (Fig. 3, lane 6).

The molecular mass of the full-length TPBF as measured by SDS-PAGE is 50 kDa, which differs significantly from the predicted mass of 37 kDa. However, the SDS gel mobility of recombinant TPBF perfectly matches that of natural Acanthamoeba TPBF purified from nuclei (Fig. 4A). The apparent discrepancy between SDS gel mobility and the predicted molecular mass of TPBF may be due to the abundance of positively charged amino acids in the protein. Natural TPBF migrates as a doublet on SDS gel due to phosphorylation(32) . Surprisingly, recombinant TPBF showed the same mobility as the phosphorylated form of TPBF (Fig. 4A, lanes 1 and 2).

Recombinant TPBF Expressed in E. coli Binds the TPE Sequence and Transactivates the Acanthamoeba TBP Gene Promoter

The DNA binding activities of natural TPBF, purified recombinant TPBF, and the TPBF mutant Delta254-296 (shown in Fig. 4A) were compared by gel mobility shift assays. The complex between the recombinant TPBF and DNA had a mobility identical with that of the natural Acanthamoeba TPBF-DNA complex (Fig. 4B, lanes 1 and 2). The binding specificity was tested by competition with either a specific or mutant TPE (Fig. 4B, lanes 3 and 4). The results demonstrated a functional identity between recombinant and natural TPBF. Comparing the intensities of the bands, no significant difference in DNA binding activities was observed between recombinant and natural proteins. In contrast, mutant Delta254-296 completely lacks DNA binding activity (Fig. 4B, lane 5), indicating the importance of the putative coiled-coil region in DNA binding.

Since natural Acanthamoeba TPBF is able to transactivate the TBP gene promoter in HeLa cell nuclear extracts(32) , we tested whether TPBF expressed in E. coli could substitute for natural TPBF in transcription activation. 100 ng of recombinant TPBF was added to in vitro transcription reactions carried out with HeLa cell nuclear extract. The results showed that recombinant TPBF is fully active for transcription activation (Fig. 4C, lane 2). However, a 10-fold greater amount of recombinant TPBF was required to achieve the same level of activation as stimulated by natural TPBF, as determined by titration with rTPBF. This may suggest that a significant portion of recombinant TPBF that is active in DNA binding is deficient in transactivation. As expected, the TPBF mutant Delta254-296 is unable to stimulate transcription (Fig. 4C, lane 3). To ensure that the observed transactivation was TPE-dependent, parallel experiments were done using a TBP promoter that lacks the TPE element. As expected, TPBF was not able to stimulate transcription in the absence of the TPE sequence (data not shown). We have also obtained similar results using Acanthamoeba extracts immunodepleted of TPBF (data not shown).

TPBF Forms a Tetramer When Bound to DNA

We previously reported that TPBF exists as a dimer or higher order oligomer(32) . To definitively determine its oligomerization state, full-length TPBF and a truncated TPBF (Delta1-76) were synthesized individually or in combination using an in vitro transcription-translation system(49) . The truncated protein was mutant Delta1-76 (Fig. 7A) which has DNA binding activity (Fig. 5, lane 6) and can be resolved easily from full-length TPBF in gel mobility shift assays. When individually synthesized proteins were assayed for TPE binding, TPBF formed one shifted protein-DNA band while the mutant generated one major band and a minor band. The minor band is caused by a partial length TPBF polypeptide produced during translation. The wild type and mutant bands had the expected difference in mobility (Fig. 5, lanes 1 and 6). When the polypeptides cotranslated at varying ratios while keeping the total protein amount approximately constant were assayed, five major bands were clearly visible. There is a gradual distribution from the largest to the smallest bands with increasing amounts of the mutant protein (Fig. 5, lanes 1-6). Two of the bands (indicated by open triangles) were seen in individually synthesized proteins. The other three bands (indicated by solid triangles) had intermediate mobilities distributed between the two outer bands. A faint band distributed in between the two lowest major bands may be the product of association between TPBF and the shortened version of the mutant polypeptide.

The formation of five major different complexes by the cotranslated proteins strongly suggests that TPBF forms a tetramer when bound to DNA. The two outer bands correspond to homo-oligomeric complexes (L(4) and S(4)), while the three inner bands correspond to hetero-oligomeric complexes (L(3)S(1), L(2)S(2), and L(1)S(3)).

TPBF Exists as a Tetramer in Solution

In order to determine the oligomerization state of TPBF in solution, we performed cross-linking experiments with either DTSSP or glutaraldehyde, in the absence of DNA. Cross-linking of purified recombinant TPBF with either DTSSP or glutaraldehyde, followed by SDS-PAGE and silver-staining, produced two cross-linked bands with apparent molecular masses of about 160 kDa and 140 kDa (Fig. 6A). The size difference between these two bands indicates they are unlikely to be different oligomers. Most likely, the two bands were generated by cross-linking at different residues. Thus we believe that both bands correspond to one single form of oligomer. The size of the cross-linked bands, about 4 times that of the TPBF monomer, in combination with the above observation that TPBF binds DNA as a tetramer, suggests that TPBF is also tetrameric in the absence of DNA.


Figure 6: Both recombinant and natural TPBF form tetramers in the absence of DNA. Purified recombinant TPBF and partially purified natural Acanthamoeba TPBF were chemically cross-linked with DTSSP or glutaraldehyde, resolved by SDS-PAGE, and followed by silver staining or immunoblotting. A, silver staining of an SDS-PAGE containing cross-linked recombinant TPBF. Lane 1, TPBF alone. Lanes 2 and 3 contained 25- and 50-fold molar excess of DTSSP over TPBF, respectively. Lane 4 contained 0.001% of glutaraldehyde. B, immunoblotting of chemically cross-linked natural TPBF. Lane 1, control without cross-linker. Lanes 2 and 3 show cross-linking with 25- and 50-fold molar excess of DTSSP, respectively. Lane 4 was treatment of the reaction shown in lane 3 with 50 mM DTT. The positions of monomeric and cross-linked TPBF are indicated.



DTSSP cross-linking of partially purified Acanthamoeba TPBF detected by immunoblotting produced two cross-linked products apparently identical with those produced by recombinant protein (Fig. 6B), indicating that recombinant TPBF has the same structure as natural TPBF. This result also demonstrates that both cross-linked bands contain TPBF. Cross-linked bands were removable by treatment with 50 mM DTT, which cleaves the disulfide bond within DTSSP linking the monomers (Fig. 6B, lane 4).

Cross-linking also showed that mutant Delta254-296 is unable to form a tetramer in solution (data not shown). Loss of multimerization of TPBF mutant Delta254-296 is likely due to loss of the Coiled-coil II structure. Multimerization of TPBF is thus evidently necessary for binding to DNA (see also below).

Identification of Regions in TPBF Responsible for DNA Binding

To further delineate the coiled-coil region and investigate other regions required for specific DNA binding, we made a series of TPBF deletion mutants as detailed under ``Experimental Procedures'' and summarized in Fig. 7A. Mutant and wild type proteins were synthesized using coupled in vitro transcription-translation in the presence of [S]methionine. Analysis of proteins by SDS-PAGE and autoradiography showed that a comparable amount of each mutant TPBF was made (Fig. 7B). The sizes of the mutant polypeptides were roughly proportional to the sizes of the mutated genes (compare A and B of Fig. 7). Some of the products migrated as doublets (Fig. 7B) because the translation system utilized either of two methionines located close to the N terminus (Fig. 1A). All these products were assayed by gel mobility shift for their abilities to bind the TPE element. Protein synthesized from the wild type TPBF construct generated a band that had exactly the same mobility as the band produced by natural Acanthamoeba TPBF (Fig. 8A, lanes 1 and 2). Deleting the first 20 amino acids, which are very histidine-rich, did not have an observable effect on DNA binding activity (Fig. 8A, lanes 2 and 3). Removal of amino acid residues 1 to 76 significantly reduced DNA binding activity (Fig. 8A, lanes 3 and 4), indicating that this region is involved in, but not essential for, DNA binding. Further deletion to residue 122 reduced DNA binding activity to near background level (Fig. 8A, lane 5, and 8B, lane 1). Deletion of residues 127-253 totally abolished DNA binding activity suggesting that an essential region had been removed (Fig. 8A, lane 6, and Fig. 8B, lane 2).

To examine the role of Coiled-coil II in DNA binding, we checked the internal deletion Delta254-296 in this system and again found it was inactive in DNA binding (Fig. 8A, lane 7, and Fig. 8B, lane 3). This deletion removes two heptads from Coiled-coil II, presumably preventing tetramerization. We also tested two C-terminal deletion mutants. Interestingly, removal of 7 amino acid residues from the C terminus increased the DNA binding activity severalfold (Fig. 8A, lanes 2 and 9). Removal of Coiled-coil II (mutant Delta278-327) resulted in the production of a polypeptide unable to bind DNA (Fig. 8A, lane 8, and Fig. 8B, lane 4). These results indicated that regions essential for DNA binding are distributed between amino acid residues 123 and 320. Presumably, the C-terminal Coiled-coil II drives tetramerization and is therefore necessary for DNA binding; while the regions that make DNA contact are located between amino acid residues 123 and 280.


DISCUSSION

We have isolated full-length cDNA encoding TPBF, an Acanthamoeba transcription activator, which regulates expression of the TBP gene(31, 32) . To our knowledge, TPBF is the first regulatory protein isolated and cloned that controls expression of a basal transcription factor. Several criteria establish that the cDNA encodes authentic TPBF. First, the cDNA encodes the peptides sequenced from TPBF purified from nuclei. Second, recombinant TPBF expressed in E. coli comigrates with natural Acanthamoeba TPBF (Fig. 4A). Third, recombinant TPBF shows the same DNA binding specificity and activity as natural TPBF. Fourth, recombinant TPBF is able to stimulate transcription in a TPE promoter-dependent fashion. Fifth, recombinant TPBF and natural TPBF bind avidly to a nickel affinity column due to the histidines present in the N terminus. Finally, antibody raised against recombinant TPBF recognizes natural TPBF in Acanthamoeba nuclear extracts. There are, however, some physical differences between recombinant and natural TPBF. For example, TPBF produced in E. coli, which is presumably not phosphorylated, comigrates during SDS-PAGE with the phosphorylated form of natural TPBF. It is thus possible that either recombinant TPBF has been modified or natural TPBF has additional unidentified modifications. Similarly, recombinant TPBF is somewhat less active in stimulating transcription than natural TPBF.

The predicted amino acid sequence of TPBF has no significant homologues in the public data bases(48) , in accord with its unusual DNA binding properties. Many sequence-specific transcription factors have been grouped into several distinct families, such as basic helix-loop-helix, zinc finger, homeodomain, helix turn helix, or leucine zipper proteins (50) . TPBF does not fall into any of these families, as judged by alignment between TPBF and the consensus sequences that characterize each family. However, the TPBF sequence contains several regions that suggest a function (Fig. 1B). The N-terminal domain is remarkably histidine-rich, and these histidines can coordinate with chelated nickel. While we do not yet know whether TPBF requires metal for any of its activities, it conceivably contains Zn or Ni, perhaps arranged in a configuration similar to the metal ions in urease(51) . Metal coordination by histidines might stabilize a particular protein conformation analogous to zinc fingers or zinc clusters(50) . While the histidines are not required for DNA binding based on mutagenesis, they could be involved in another function that our assays did not assess, for example, transcription activation. A similar possibility exists for the proline-rich region between amino acid residues 40 and 85. Proline-rich domains can function as activation regions in some transcription factors such as CTF(47) . However, we have been unable to localize the transactivation domain directly since we have been unable to establish a homologous system to assay mutant TPBFs. We failed to recover activated transcription by simply adding back-purified recombinant or native TPBF into a nuclear extract in which TPBF has been sequestered by specific TPE DNA, or nickel affinity chromatography (data not shown). All these results suggest TPBF might employ a coactivator or adaptor to mediate its transactivation activity(18, 52) . It will be of considerable interest to identify the transactivation domain of TPBF as well as its target.

Adjacent to and overlapping the proline-rich domain, there is a potential coiled-coil domain (Coiled-coil I) comprising a heptad repeat of hydrophobic residues. While this region could potentially contribute to tetramerization (see below), deletion mutagenesis suggests it is not necessary, but instead may have a stabilizing effect on the overall structure. However, because this region contains two proline residues which are likely to destabilize or prevent helix formation, the importance of Coiled-coil I is somewhat unclear.

In the central portion of TPBF, there is a putative nuclear localization signal and a region that is rich in basic residues. By analogy with leucine zipper proteins or basic helix-loop-helix proteins, it is possible that this latter region may be involved in DNA binding.

At the C terminus of TPBF there is an additional coiled-coil domain (Coiled-coil II), containing hydrophobic 4-3 repeats. Positions a and d (the positions within a heptad repeat are conventionally referred to as a, b, c, d, e, f, and g, see (53) ) of the heptads in the array named Coiled-coil II are almost perfectly hydrophobic. Although this region resembles a leucine zipper, its perfectly amphipathic hydrophobic character suggests that it is likely to form higher order oligomers, since perfect coiled-coil domains can form trimeric or tetrameric bundles(54) . In accord with this prediction, direct chemical cross-linking and cotranslation experiments establish that TPBF exists as a tetramer both in solution and when bound to DNA.

Analyses of several TPBF deletion mutants supports the predictions made from inspection of its sequence. Although our analyses were constrained by an inability to express all mutants in E. coli, several important conclusions were reached. Chemical cross-linking and binding studies of mutant proteins demonstrate that Coiled-coil II is essential for tetramerization and therefore DNA binding. Coiled-coil II is the major, if not the only, region driving tetramerization of TPBF. Although Coiled-coil I is not essential for DNA binding (Fig. 6B), removal of the region greatly reduces DNA binding activity, suggesting its involvement in either stabilizing tetramer or tetramer-DNA complex. Other proteins with two or more separate coiled-coil domains have been reported(55, 56) . The reovirus cell attachment protein 1 has two coiled-coils, one is involved in the formation of a loose multimer while the other stabilizes the multimer (56) . Our prediction of how the two coiled-coils function in TPBF is similar to this model, i.e. Coiled-coil II mediates tetramerization of TPBF, and the tetramer is further stabilized by Coiled-coil I. This idea is supported by the preferential formation of homotetramer of wild type TPBF over a truncated version lacking Coiled-coil I (Fig. 5, lane 2). It is likely that the association of cotranslated polypeptides is not random. Instead, it favors the formation of tetramers containing Coiled-coil I, which provides additional stabilization. However, Coiled-coil I may also be involved in stabilizing tetramer-DNA interactions.

TPBF requires a relatively large domain for efficient, sequence-specific DNA binding. Unlike GCN4, for example, which only requires the C-terminal 56 amino acid residues for DNA binding(57) , the region in TPBF required for efficient DNA binding spreads from 20 to 320. Since the mutant Delta1-122 had very weak DNA binding activity, the region from 20 to 122 is most likely involved in determining the binding efficiency but not specificity. The region involved in determining DNA sequence specificity is therefore contained within amino acids 123 to 281. We have preliminary evidence suggesting the basic region from 123 to 194 is in fact necessary for DNA binding. (^2)However, finer mapping needs to be done to further define the region necessary for sequence-specific DNA binding.

Previous studies showed that TPBF makes numerous symmetrical contacts with TPE(32) . The overall pattern of the base and phosphate contacts, suggesting that TPBF contacts DNA symmetrically on opposite faces of the helix, is unique. This binding pattern is in keeping with the novel structural features of TPBF, especially its divergent coiled-coil region and the widely spread basic region. One of the unique features of TPBF is that it is tetrameric, which is probably determined by the arrangement of hydrophobic residues in positions a and d in Coiled-coil II(54) . Tetramerization of TPBF can explain the protein-DNA contacts inferred from chemical interference assays. First, TPBF is able to occupy a large region of DNA since it contains a four-stranded helical bundle. Second, the region for tetramerization is located at the C terminus of TPBF allowing four DNA binding domains of TPBF, located more than 100 amino acid residues from the tetramerization domain, to reach relatively distal binding sites. It is possible that the tetramerized TPBF contacts the DNA helix perpendicularly from one side. Thus, its four DNA binding domains can make symmetrical contacts on opposite faces of the DNA helix. Interestingly, this DNA binding pattern resembles the way tumor suppressor p53 binds to its specific DNA recognition sequence(33) . Although no obvious similarities exist between these two proteins in amino acid sequence or specific DNA binding sites, it is possible that they belong to a novel family of DNA-binding proteins that function in regulating expression of genes involved in growth and differentiation.


FOOTNOTES

*
This work was supported in part by National Eye Institute Grant EY 08706 (to E. B.), National Science Foundation, Vermont EPSCOR Grant RII8610679, and a grant from the Lucille P. Markey Charitable Trust to the Department of Microbiology and Molecular Genetics, University of Vermont. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) L46867[GenBank].

§
To whom correspondence should be addressed. Tel.: 802-656-8608; Fax: 802-656-8749; ebateman@moose.uvm.edu.

(^1)
The abbreviations used are: TBP, TATA-binding protein; TF, transcription factor; TPE, TBP promoter element; TPBF, TBP promoter binding factor; PAGE, polyacrylamide gel electrophoresis; PCR, polymerase chain reaction; DTT, dithiothreitol; DTSSP, 3,3`-dithiobis(sulfosuccinimidylpropionate); bp, base pair(s); EMS, electrophoretic mobility shift.

(^2)
W. Huang and E. Bateman, unpublished data.


ACKNOWLEDGEMENTS

We thank Dr. Feng Liu for help in TPBF purification. We also thank Drs. David Pederson and Tom Orfeo for comments on the manuscript.


REFERENCES

  1. Comai, L., Tanese, N., and Tjian, R. (1992) Cell 68, 965-976 [CrossRef][Medline] [Order article via Infotrieve]
  2. Cormack, B. P., and Struhl, K. (1992) Cell 69, 685-696 [CrossRef][Medline] [Order article via Infotrieve]
  3. Schultz, M. C., Reeder, R. H., and Hahn, S. (1992) Cell 69, 697-702 [CrossRef][Medline] [Order article via Infotrieve]
  4. Yamashita, S., Hisatake, K., Doi, K., Roeder, R. G., Horikoshi, M., and Nakatani, Y. (1993) Science 261, 463-466 [Abstract/Free Full Text]
  5. Hernandez, N. (1993) Genes & Dev. 7, 1291-1308
  6. Pugh, B. F., and Tjian, R. (1992) J. Biol. Chem. 267, 679-682 [Free Full Text]
  7. Kassavetis, G. A., Joazeiro, C. A. P., Pisano, M., Geiduschek, E. P., Colbert, T., Hahn, S., and Blanco, J. A. (1992) Cell 71, 1055-1064 [CrossRef][Medline] [Order article via Infotrieve]
  8. Lobo, S. M., Tanaka, M., Sullivan, M. L., and Hernandez, N. (1992) Cell 71, 1029-1040 [CrossRef][Medline] [Order article via Infotrieve]
  9. Taggart, A. K. P., Fisher, T. S., and Pugh, B. F. (1992) Cell 71, 1015-1028 [CrossRef][Medline] [Order article via Infotrieve]
  10. White, R. J., and Jackson, S. P. (1992) Cell 71, 1041-1053 [CrossRef][Medline] [Order article via Infotrieve]
  11. Sawadogo, M., and Roeder, R. G. (1985) Cell 43, 165-175 [CrossRef][Medline] [Order article via Infotrieve]
  12. Nakajima, N., Horikoshi, M., and Roeder, R. G. (1988) Mol. Cell Biol. 8, 4028-4040 [Abstract/Free Full Text]
  13. Jantzen, H., Chow, A. M., King, D. S., and Tjian, R. (1992) Genes & Dev. 6, 1950-1963
  14. Rigby, P. W. J. (1993) Cell 72, 7-10 [CrossRef][Medline] [Order article via Infotrieve]
  15. Sharp, P. A. (1992) Cell 68, 819-821 [CrossRef][Medline] [Order article via Infotrieve]
  16. Greenblatt, J. (1991) Cell 66, 1067-1070 [CrossRef][Medline] [Order article via Infotrieve]
  17. Buratowski, S. (1994) Cell 77, 1-3 [CrossRef][Medline] [Order article via Infotrieve]
  18. Ge, H., and Roeder, R. (1994) Cell 78, 513-523 [CrossRef][Medline] [Order article via Infotrieve]
  19. Lin, Y. S., and Green, M. R. (1991) Cell 64, 971-981 [CrossRef][Medline] [Order article via Infotrieve]
  20. Xu, X., Prorock, C., Ishikawa, H., Maldonado, E., Ito, Y., and Gelinas, C. (1993) Mol. Cell Biol. 13, 6733-6741 [Abstract/Free Full Text]
  21. Kim, T. K., and Roeder, R. G. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 4170-4174 [Abstract/Free Full Text]
  22. Stringer, K. F., Ingles, C. J., and Greenblatt, J. (1990) Nature 345, 783-786 [CrossRef][Medline] [Order article via Infotrieve]
  23. Goodrich, J. A., Hoey, T., Thut, C., Admon, A., and Tjian, R. (1993) Cell 75, 519-530 [CrossRef][Medline] [Order article via Infotrieve]
  24. Hoey, T., Weinzierl, R. O. J., Gill, G., Chen, J. L., Dynlacht, B. D., and Tjian, R. (1993) Cell 72, 247-260 [CrossRef][Medline] [Order article via Infotrieve]
  25. Joliot, V., Demma, M., and Prywes, R. (1995) Nature 373, 632-635 [CrossRef][Medline] [Order article via Infotrieve]
  26. Xiao, H., Pearson, A., Coulombe, B., Truant, R., Zhang, S., Regier, J. L., Triezenberg, S. J., Reinberg, D., Flores, O., Ingles, C. J., and Greenblatt, J. (1994) Mol. Cell Biol. 14, 7013-7024 [Abstract/Free Full Text]
  27. Tjian, R., and Maniatis, T. (1994) Cell 77, 5-8 [CrossRef][Medline] [Order article via Infotrieve]
  28. Sadowski, I., Ma, J., Triezenberg, S., and Ptashne, M. (1988) Nature 335, 563-564 [CrossRef][Medline] [Order article via Infotrieve]
  29. Wong, J., Liu, F., and Bateman, E. (1992) Nucleic Acids Res. 20, 4817-4824 [Abstract/Free Full Text]
  30. Radebaugh, C. A., Matthews, J. L., Geiss, G. K., Liu, F., Wong, J.-M., Bateman, E., Camier, S., Sentenac, A., and Paule, M. R. (1994) Mol. Cell. Biol. 14, 597-605 [Abstract/Free Full Text]
  31. Liu, F., and Bateman, E. (1993) Nucleic Acids Res. 21, 4321-4329 [Abstract/Free Full Text]
  32. Liu, F., and Bateman, E. (1994) J. Biol. Chem. 269, 18541-18548 [Abstract/Free Full Text]
  33. Cho, Y., Gorina, S., Jeffrey, P. D., and Pavletich, N. P. (1994) Science 265, 346-355 [Abstract/Free Full Text]
  34. Ausubel, F. M., Brent, R., Kingston, R., et al. (1989) Current Protocols in Molecular Biology , Greene Publishing Associates and Wiley-Interscience, New York
  35. Matsudaira, P. (1987) J. Biol. Chem. 262, 10035-10038 [Abstract/Free Full Text]
  36. Matsudaira, P. (1993) A Practical Guide to Protein and Peptide Purification for Microsequencing , 2nd Ed, Academic Press, New York
  37. Hammer, J. A., Bowers, B., Paterson, B. M., and Korn, E. D. (1987) J. Cell Biol. 105, 913-925 [Abstract/Free Full Text]
  38. Wong, J., Liu, F., and Bateman, E. (1992) Gene (Amst.) 117, 91-97 [CrossRef][Medline] [Order article via Infotrieve]
  39. Short, J. M., Fernandez, J. M., Sorge, J. A., and Huse, W. D. (1988) Nucleic Acids Res. 16, 7583-7600 [Abstract/Free Full Text]
  40. MacDonald, R. J., Swift, G. H., Przybyla, A. E., and Chirgwin, J. M. (1987) Methods Enzymol. 152, 219-234 [Medline] [Order article via Infotrieve]
  41. Studier, F. W., Rosenberg, A. H., Dunn, J. J., and Dubendroff, J. W. (1990) Methods Enzymol. 185, 60-89 [Medline] [Order article via Infotrieve]
  42. Craig, D., Howell, M. T., Gibbs, C. L., Hunt, T., and Jackson, R. J. (1992) Nucleic Acids Res. 20, 4987-4995 [Abstract/Free Full Text]
  43. Frohman, M. A., Dush, M. K., and Martin, G. R. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 8998-9002 [Abstract/Free Full Text]
  44. Boulikas, T. (1995) J. Cell Biol. 55, 32-58 [Abstract/Free Full Text]
  45. Parry, D. A. D., and Cohen, C. (1994) Science 263, 488-489 [Free Full Text]
  46. Harbury, P. B., Kim, P. S., and Alber, T. (1994) Nature 371, 80-83 [CrossRef][Medline] [Order article via Infotrieve]
  47. Mermod, N., O'Neill, E. A., Kelly, T. J., and Tjian, R. (1989) Cell 58, 741-753 [CrossRef][Medline] [Order article via Infotrieve]
  48. Altschul, S. F., Gish, W., Miller, W., Myers, E. W., and Lipman, D. J. (1990) J. Mol. Biol. 215, 403-410 [CrossRef][Medline] [Order article via Infotrieve]
  49. Hope, I. A., and Struhl, K. (1987) EMBO J. 6, 2781-2784 [Medline] [Order article via Infotrieve]
  50. Pabo, C. O., and Sauer, R. T. (1992) Annu. Rev. Biochem 61, 1053-1095 [CrossRef][Medline] [Order article via Infotrieve]
  51. Jabri, E., Carr, M. B., Hausinger, R. P., and Karplus, P. A. (1995) Science 268, 998-1004 [Abstract/Free Full Text]
  52. Berger, S. L., Pina, B., Silverman, N., Marcus, G. A., Apapite, J., Regier, J. L., Triezenberg, S. J. and Guarente, L. (1992) Cell 70, 251-265 [CrossRef][Medline] [Order article via Infotrieve]
  53. Hodges, R., Sodak, J., Smillie, L., and Jurasek, L. (1972) Cold Spring Harbor Symp. Quant. Biol. 37, 299-310
  54. Harbury, P. B., Zhang, T., Kim, P. S., and Alber, T. (1993) Science 262, 1401-1407 [Abstract/Free Full Text]
  55. Westwood, J. T., and Wu, C. (1993) Mol. Cell. Biol. 13, 3481-3486 [Abstract/Free Full Text]
  56. Leone, G., Maybaum, L., and Lee, P. W. K. (1992) Cell 71, 479-488 [CrossRef][Medline] [Order article via Infotrieve]
  57. Ellenberger, T. E., Brandl, C. J., Struhl, K., and Harrison, S. C. (1992) Cell 71, 1223-1237 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
L. Chen, Z. Peng, and E. Bateman
In vivo interactions of the Acanthamoeba TBP gene promoter
Nucleic Acids Res., February 19, 2004; 32(4): 1251 - 1260.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Guillebault, S. Sasorith, E. Derelle, J.-M. Wurtz, J.-C. Lozano, S. Bingham, L. Tora, and H. Moreau
A New Class of Transcription Initiation Factors, Intermediate between TATA Box-binding Proteins (TBPs) and TBP-like Factors (TLFs), Is Present in the Marine Unicellular Organism, the Dinoflagellate Crypthecodinium cohnii
J. Biol. Chem., October 18, 2002; 277(43): 40881 - 40886.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Chen and E. Bateman
Linker Scanning Analysis of TBP Promoter Binding Factor DNA Binding, Activation, and Repression Domains
J. Biol. Chem., January 28, 2000; 275(4): 2771 - 2776.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
W. Huang and E. Bateman
Transcription of the Acanthamoeba TATA-binding Protein Gene. A SINGLE TRANSCRIPTION FACTOR ACTS BOTH AS AN ACTIVATOR AND A REPRESSOR
J. Biol. Chem., February 7, 1997; 272(6): 3852 - 3859.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Huang, W.
Right arrow Articles by Bateman, E.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Huang, W.
Right arrow Articles by Bateman, E.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement