Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carter, M. S.
Right arrow Articles by Wilkinson, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carter, M. S.
Right arrow Articles by Wilkinson, M. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 48, Issue of December 1, 1995 pp. 28995-29003
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A Regulatory Mechanism That Detects Premature Nonsense Codons in T-cell Receptor Transcripts in Vivo Is Reversed by Protein Synthesis Inhibitors in Vitro(*)

(Received for publication, July 12, 1995; and in revised form, September 27, 1995)

Mark S. Carter (1) (2) Jessica Doskow (1) Phillip Morris (1) Shulin Li (1) Ronald P. Nhim (1) Sara Sandstedt (1) Miles F. Wilkinson (1)(§)

From the  (1)Department of Immunology, University of Texas MD Anderson Cancer Center, Houston, Texas 77030 and the (2)Molecular Microbiology & Immunology Graduate Program, Oregon Health Sciences University, Portland, Oregon 97201

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Gene rearrangement during the ontogeny of T- and B-cells generates an enormous repertoire of T-cell receptor (TCR) and immunoglobulin (Ig) genes. Because of the error-prone nature of this rearrangement process, two-thirds of rearranged TCR and Ig genes are expected to be out-of-frame and thus contain premature terminations codons (ptcs). We performed sequence analysis of reverse transcriptase-polymerase chain reaction products from fetal and adult thymus and found that newly transcribed TCR-beta pre-mRNAs (intron-bearing) are frequently derived from ptc-bearing genes but such transcripts rarely accumulate as mature (fully spliced) TCR-beta transcripts. Transfection studies in the SL12.4 T-cell line showed that the presence of a ptc in any of several TCR-beta exons triggered a decrease in mRNA levels. Ptc-bearing TCR-beta transcripts were selectively depressed in levels in a cell clone that contained both an in-frame and an out-of-frame gene, thus demonstrating the allelic specificity of this down-regulatory response. Protein synthesis inhibitors with different mechanism of action (anisomysin, cycloheximide, emetine, pactamycin, puromycin, and polio virus) all reversed the down-regulatory response. Ptc-bearing transcripts were induced within 0.5 h after cycloheximide treatment. The reversal by protein synthesis inhibitors was not restricted to lymphoid cells, as shown with TCR-beta and beta-globin constructs transfected in HeLa cells. Collectively, the data suggest that the ptc-mediated mRNA decay pathway requires an unstable protein, a ribosome, or a ribosome-like entity. Protein synthesis inhibitors may be useful tools toward elucidating the molecular mechanism of ptc-mediated mRNA decay, an enigmatic response that can occur in the nuclear fraction of mammalian cells.


INTRODUCTION

T-cell receptor (TCR) (^1)and immunoglobulin (Ig) genes undergo programmed rearrangement events during lymphocyte ontogeny. During this process, variable (V) elements are juxtaposed to joining (J) elements to create functional genes(1, 2) . In some TCR and Ig genes, diversity (D) elements are also included in this rearrangement process. The tremendous combinatorial possibilities afforded by this rearrangement mechanism permit the generation of a wide variety of antigen receptors. Additional variability is provided by the enzyme terminal transferase which introduces random nucleotides at the junctions between V, D, and, J elements(1, 2) . Variability is also engendered by the low fidelity of the rearrangement event itself; the borders of each element are not fixed, sometimes leading to small deletions at the junctions between the V, D, and J elements. The collective result of these insertional and deletional events is that a large fraction of rearrangement events will generate out-of-frame (nonproductive) genes that contain premature termination codons (ptcs).

Since out-of-frame TCR and Ig genes are commonly generated during normal lymphocyte development, there may exist a mechanism that diminishes the expression of these nonfunctional ptc-containing genes. Consistent with this hypothesis, most Ig and TCR cDNA clones obtained from cDNA libraries have been in-frame(3, 4, 5, 6) . Studies with cultured cells have provided evidence that out-of-frame Ig transcripts are down-regulated compared with in-frame transcripts (7, 8, 9, 10) . In addition, several other genes exhibit depressed mRNA levels when mutated to contain ptcs ((11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26) ; reviewed in (27) ). One approach toward analyzing mechanisms responsible for ptc-mediated decay is to study this event in simpler eukaryotic organisms that are more amenable to genetic analysis. Toward this end, it has been shown that Saccharomyces cerevisiae and Caenorhabditis elegans down-regulate ptc-bearing mRNAs (28, 29, 30, 31, 32) . In S. cerevisiae, the decay of ptc-bearing mRNAs appears to be a cytoplasmic event. Several genes have been identified (the upf and smg series) that participate in ptc-mediated mRNA decay in S. cerevisiae and C. elegans(28, 29, 30, 31, 32) . Determination of the precise functional role of the upf and smg proteins may contribute greatly to our understanding of this novel regulatory process.

Vertebrates may use a ptc-mediated decay mechanism that differs from the down-regulatory mechanism in lower eukaryotic cells. In vertebrates it has been shown that many ptc-bearing mRNAs are degraded in the nuclear fraction, rather than the cytoplasmic fraction. Preferential nuclear degradation has been demonstrated for ptc-bearing triosephosphate isomerase, dihydrofolate reductase, beta-globin, v-src, major urinary protein (MUP), and Ig transcripts (9, 12, 14-17, 20, 23, 24, 26). This is an unexpected observation, since termination codons are generally considered to be recognized only by ribosomes in the cytoplasm. Several models have been put forward to explain how ptcs could affect nuclear events (see ``Discussion''). In order to elucidate the novel mechanism that is responsible for the recognition and decay of ptc-bearing mRNAs in vertebrates, it is necessary to identify a system that efficiently down-regulates such aberrant mRNAs. In addition, the identification of an approach to reverse the down-regulatory response would be a useful tool toward understanding the underlying mechanism and its associated components.

In our previous work (33, 34) we showed that mature mRNA derived from a transcriptionally active TCR-beta gene in the SL12.4 T-lymphoma cell clone failed to accumulate in the cytoplasm, although TCR splicing intermediates were easily detectable in the nucleus. We showed that incubation of SL12.4 cells with several different protein synthesis inhibitors dramatically induced the accumulation of mature TCR transcripts in the cytoplasm(35) . In the present study, we show that the rearranged TCR-beta gene in the SL12.4 T cell clone is out-of-frame and therefore contains ptcs. We then demonstrate in transfection experiments that the inducibility by protein synthesis inhibitors is exclusively restricted to ptc-bearing TCR-beta transcripts. Protein synthesis inhibitors efficiently reversed the down-regulatory effect of ptcs in any of a number of TCR exons. The reversal of ptc-mediated mRNA decay by protein synthesis inhibitors was a general response that was not restricted to particular stages of T-cells, nor was it restricted to lymphoid cells. The ability to reverse this response may be useful toward studying the molecular mechanism of nonsense codon-mediated decay in the nucleus of vertebrate cells.

Since nonfunctional ptc-bearing TCR genes are generated as a part of normal thymic ontogeny, we then asked if this down-regulatory mechanism operates in normal T-cells in vivo. We show that although ptc-bearing TCR-beta genes are transcribed normally and give rise to normal levels of pre-mRNA in the thymus, that the levels of mature mRNA derived from these nonfunctional genes is selectively depressed. This constitutes the first in vivo evidence in higher eukaryotes that the ptc-mediated mRNA decay pathway selectively depresses mature mRNA levels, not pre-mRNA levels. Our findings reveal new insights into the ptc-induced down-regulatory mechanism and serve to further generalize the importance of this mechanism.


MATERIALS AND METHODS

Cell Culture, Transfections, and Northern blot Analysis

The SL12.4, RS4.2, and AKR1 murine T-lymphoma cell clones were cultured as described previously(33, 36) . Cells were treated with cycloheximide (CHX) for 2 h at a concentration (100 µg/ml) that we have previously shown is sufficient to inhibit protein synthesis (as assessed by [S]methionine incorporation) by >95%(33, 36) . Stable transfections of the T-lymphoma cell clones were performed by electroporating 5-20 µg of DNA in 1 times HBS buffer (280 mM NaCl, 1.5 mM Na(2)HPO(4), 50 mM Hepes, pH 7.05) with a Moonlight Cat Door electroporator (Seattle, WA) at 2900-3200 V. After transfection, the cells were split at different dilutions (1:5 to 1:100) among the wells in a 24-well plate. The antibiotic G418 (800 µg/ml) was added the following day, and after 12-20 days of selection in the presence of the antibiotic, all wells with viable cells were tested for expression of the constructs by Northern blot analysis. For any given construct, at least two independent wells were shown to express the construct and display the regulatory response to CHX shown in the figures. Cytoplasmic RNA from the T-lymphoma cell lines was prepared as described(33) .

HeLa cells were stably transfected with 5-20 µg of DNA by calcium phosphate precipitation(37) , and individual stably transfected clones were isolated for Northern blot analysis. Transient transfections were performed by electroporation with an Invitrogen Electroporator II according to the manufacturer's instructions (Invitrogen Corp., San Diego). Total cellular RNA was harvested 2 days after transfection. For polio virus infection, near confluent HeLa cells were infected with polio virus type I (Mahoney strain) at a concentration of 75 plaque-forming unit/cell. The virus was incubated with the HeLa cells for 30 min at room temperature, followed by addition of Dulbecco's modified Eagle's medium without serum (designated time point 0 of the infection). Total RNA from HeLa cells was prepared as described(33) . Cytoplasmic RNA was prepared by lysis in 0.6% Nonidet P-40, 0.15 M NaCl, 10 mM Tris (pH 8), 0.1 mM EDTA. RNA was electrophoresed, blotted, and probed as described(34) . The relative amount of RNA loaded per lane was assessed by methylene blue staining of the rRNA content (38) as well as hybridization with the housekeeping genes cyclophillin and CHO-A(39) .

Oligonucleotides

The following oligonucleotides were used: V, sense orientation (ends at the -9 position with respect to the initiator ATG of V), CAAGAGACAGTATCTGA; V-A, sense (V exon, corresponds to amino acids G-Y), GGGCTGAGGCTGATCCATTA; V-B, sense (corresponds to amino acids G-G), AGGAGATATCCCTGATGG; V-C, sense (begins 7 nucleotides downstream of the TATA box), CAGGGCTGGAACATACG; V-D, antisense (begins at amino acid 59), ATCTCCTTTCTCCGTGC; V-E, antisense (corresponds to amino acids D-H), GTCAGCGAC(C/G/T)TATGAGTAATG (the underlined nucleotide(s) denotes the site of mutagenesis); I-J-A, antisense (intron sequence 13-32 nucleotides upstream of J exon), CTGCAACCTAGGCACCTCAGAGAG; I-J-B, antisense (intron sequence 40-63 nucleotides upstream of J, includes KpnI site at 5` end), ACAGGTACCCAGTACCCAGCCATTTG; E1-A, antisense (C exon 1, nucleotides 2-23, includes SacII site at 5` end), ACACCGCGGTGGAGTCACATTTCTCAGAT; E1-B, antisense (C exon 1, nucleotides 25-47, 2 nucleotide mismatch to generate SacI site), GAGAGCTCAAACAAGGAGACCTT; E2, antisense (C exon 2, nucleotides 1-17), TGAGGTAATCCCACAGT; glob, antisense (corresponds to amino acids F-P of human beta-globin), AAGAACCTCTAGGTCCAAGG. The sequence information used to design the oligonucleotides was obtained from the following sources: V, V, and V(40) , C and J(41) , and beta-globin(42) . The V oligonucleotide was designed on the basis of our own sequence analysis of cloned V genomic DNA.

Reverse Transcriptase-PCR Analysis and Sequencing

Total cellular RNA (1 µg) from fetal (day 16 post-coitum) or adult thymus from BALB/c mice was used to prepare cDNA. To analyze V mRNAs, reverse transcriptase-PCR was performed as described (35) using oligo(dT) as a primer for cDNA synthesis and the following oligonucleotides for the PCR reaction (40 cycles). Mature V, V, and V transcripts were amplified using oligonucleotides V-A + E1-A. Pre-mRNA transcripts were amplified using either oligonucleotide V-A + I-J-A, oligonucleotide V-A + I-J-B, or by nested PCR using V-A + I-J-B (10 cycles), followed with V-B + I-J-B (30 cycles). Anchored PCR was performed according the manufacturer's instructions (Life Technologies, Inc., Gaithersburg, MD) for 5` rapid amplification of cDNA ends. In brief, cDNA was generated using a primer complementary to TCR-beta sequences, the cDNA was dC-tailed with terminal transferase, then PCR was performed using an ``anchor primer'' (complementary to the C-tail) and an oligonucleotide complementary with TCR-beta mRNA. For TCR-beta mature mRNA, the E1-A oligonucleotide was used for cDNA synthesis and the E1-B oligonucleotide was used for PCR. For TCR-beta pre-mRNA, the I-J-B oligonucleotide was used to generate cDNA, and the I-J-A was used for PCR. The PCR products were subcloned into Bluescript KS (Strategene Inc.), followed by dideoxy sequencing analysis. The sequences obtained were compared with known V, D, J, and C sequences (40, 41) to determine whether the V(D)J exon was in-frame with respect to the C first exon. N-region diversity was observed at the V, D, and J junctions of most PCR products. The sequence of the V, D, and J elements was as reported in the literature, except that polymorphisms were sometimes noted for J (nucleotide 14 (C) was deleted) and J (a G was inserted after the T residue at position 9). When several identical sequences were obtained from a given PCR reaction, only one sequence was considered in the results shown in Table 1.



To obtain the sequence of the VJ junctional region in the VC transcript in the SL12.4 cell clone, cDNA was prepared using 1 µg of RNA from SL12.4 cells treated for 6 h with CHX (100 µg/ml). Oligo(dT) was used as a primer for cDNA synthesis, and the oligonucleotides V and E2 were used for PCR.

Plasmid Constructions

pVbeta8Cbeta2

A productively rearranged VDJC genomic fragment was subcloned into pUC13 (obtained from M. Blackman, P. Marrack, and J. Kappler).

pNEO

The beta-actin promoter region of pHbetaAPr-1 (43) was removed by EcoRI/BamHI digestion and replaced with the multiple cloning site of Bluescript KS present on a 0.5-kb PvuII fragment.

pIF

An 18-kb KpnI/SalI fragment, derived from pVbeta8Cbeta2, that contains VDJC and the downstream enhancer, was subcloned into pNEO.

pVDJ

A 3.2-kb KpnI/ClaI fragment, containing the VDJ region, subcloned into a modified version of Bluescript KS that lacked sequences between the EcoRV and SmaI sites.

pRV

10-nucleotide XhoI linkers were introduced into the unique EcoRV site within the V exon of pVDJ. The number of XhoI linkers inserted into individual recombinant clones was determined by DNA sequence analysis.

pFS1

A 3.2-kb KpnI/ClaI fragment that contains the VDJ region was released from pRV and used to replace the analogous region of pVbeta8Cbeta2. An 18-kb KpnI/SalI fragment that contains the entire gene was then excised and subcloned into pNEO.

pStu

pStu was generated analogously to pRV except that a single XhoI linker was introduced into the unique StuI site.

pCbeta2

A 2-kb PstI C fragment subcloned into the PstI site of pKS.

pFS2

The VDJ region of pStu was subcloned into pCbeta2 cut with KpnI and ClaI. A 0.8-kb BamHI fragment containing the TCR-beta enhancer was then subcloned into the unique BamHI site downstream of C. The VDJC region was then excised with XbaI and KpnI, and this 6-kb fragment was subcloned into pNEO.

pFS3

A fragment containing C exons 1 and 2 was released from pCbeta2 by linearizing with BglII, followed by S1 nuclease treatment and digestion with XhoI. This 1.25-kb blunt-end/XhoI fragment was subcloned into Bluescript KS at the XhoI and EcoRV sites. To introduce a frameshift, the plasmid was then linearized with NcoI, made blunt with Klenow enzyme, and religated to create a four nucleotide insertion at the NcoI site (confirmed by sequence analysis).

pDeltaPrVbeta8

A promoterless V fragment was generated by PCR using pVDJ as a template and oligonucleotides V-C and -D. The PCR fragment was blunt-ended and inserted into Bluescript KS at the StuI and EcoRV sites.

pDeltaPrVDJ

pVDJ was digested with NdeI and BamHI and the 2.8-kb fragment inserted into the NdeI and BamHI sites of pDeltaPrVbeta8.

pDeltaPrStu

pDeltaPrStu was created analogous to pDeltaPrVDJ except that a pStu NdeI/BamHI fragment was used.

pAc/IF

pDeltaPrVDJ was digested with SalI and BamHI, and the 3.2-kb fragment was inserted into the SalI and BamHI sites of pHbetaApr-1.

pAc/FS2

pAc/FS2 was created analagous to pAC/IF except that a pDeltaPrStu SalI/BamHI fragment was used.

pAc/IFDelta

pAc/IFDelta is identical to pAc/IF except that it contains a deletion between the PmlI site in C exon 1 and the BsaBI site in C exon 4.

pGLOB

The human beta-globin gene was isolated from pbetaglobin/pSP64 (42) with HindIII and PstI, subcloned into pSP72 (Promega, Madison, WI), then released with HindIII and BglII and subcloned into pNEO.

pGLOB39

A beta-globin gene fragment containing exons 1 and 2 was released from pbetaglobin/pSP64 with HindIII and DraI, the ends were filled in by Klenow, and the 1.1-kb fragment was subcloned into Bluescript KS at the EcoRV site. A nonsense mutation (UAG) was created at codon 39 using the Bio-Rad mutagenesis kit (Hercules, CA) with the oligonucleotide glob, the 1.1-kb insert was released with HindIII and BamHI and subcloned into pNEO. This construct was then linearized with BamHI and a 1.6-kb fragment containing the 3` end of beta-globin was subcloned into the BamHI site.

pUAA

Codon 50 in pVDJ was mutated using the oligonucleotide V-E by the approach described for pGLOB39. A 3.2-kb KpnI-ClaI fragment containing this mutation was used to replace the equivalent region in pFS2.

pUAC

pUAC was generated in the same manner as pUAA.


RESULTS

Down-regulation of Out-of-frame TCR mRNAs Derived from Actively Transcribed Genes in Thymocytes in Vivo

The TCR-beta gene undergoes programmed rearrangement events as T-lymphocytes migrate through the thymic environment(2) . First, D and J elements are joined, followed by juxtaposition of the fused DJ element with any one of several V gene elements (in some cases, J elements are fused directly to V elements). As a result of the sequence variation at the V-D, D-J, or V-J junctions, out-of-frame TCR-beta genes are commonly generated containing a ptc in either the V(D)J exon or the first C exon. To determine if a down-regulatory mechanism depresses the expression of such out-of-frame TCR-beta transcripts in vivo, we assessed the relative levels of in-frame and out-of-frame TCR-beta mRNA by sequence analysis of reverse transcriptase-PCR products from fetal and adult thymus. TCR-beta pre-mRNA and mature mRNA molecules were independently assessed using a 3` primer complementary to either exon or intron sequences, respectively. The 5` primers included a pan-V primer used to amplify V, V, and V transcripts or an anchor primer used to amplify random V transcripts. Sequence analysis of the reverse transcriptase-PCR products from adult thymus showed that 43% of V pre-mRNAs were out-of-frame (Table 1). This proportion of out-of-frame pre-mRNAs is similar to the percentage of TCR-beta genes known to be out-of-frame in thymocytes. Mallick et al.(44) showed that the average frequency of out-of-frame V, V, V, V, and V genes in the adult mouse thymus is 25%. The reason that the percentage of out-of-frame TCR-beta genes was not the theoretically expected value of 67% may be because T-cells which have generated nonproductive rearrangements on both chromosomes do not survive and thus do not contribute to the gene pool (44) .

The proportion of out-of-frame pre-mRNA TCR-beta transcripts that we found in the adult thymus differed strikingly from the value we determined for TCR-beta mature mRNA. Of 28 independent mature cDNAs sequenced, none were out-of-frame (Table 1). The samples sequenced included V, V, and V transcripts, as well as random V transcripts detected by anchored PCR.

The proportion of in-frame and out-of-frame TCR transcripts was also determined in day 16 fetal thymus. At day 16 of gestation, the thymus is dominated by immature double-negative (CD4CD8) and double-positive (CD4CD8) thymocytes that might be subject to different regulation than more mature thymocytes. Our analysis revealed that TCR-beta pre-mRNAs were commonly out-of-frame (38%), but mature mRNAs rarely were (4%; Table 1). Collectively, the results show that both fetal and adult thymus actively transcribe in-frame and out-of-frame TCR-beta genes but selectively depresss the levels of mature out-of-frame transcripts.

Down-regulation of TCR-beta mRNA Levels by Premature Termination Codons

To study the mechanism responsible for the decreased abundance of out-of-frame TCR-beta mRNAs, we assessed the expression of TCR-beta constructs in stably transfected T-cell lines. First, the expression of several frameshifted versions of a VDJC (V) gene were compared with the in-frame version of this gene. These frameshifted genes possessed ptcs in either the VDJ exon, the C exon, or the C exon (the second, third, or fifth exons of the TCR-beta gene, respectively; see Fig. 1). Northern blot analysis revealed that the in-frame version of the V gene was expressed at high levels in the SL12.4 T-lymphoma cell clone (Fig. 1). In contrast, all out-of-frame V constructs were expressed at very low levels in SL12.4 cells (Fig. 1). Transcript levels for the three frameshifted constructs were all at least 10-fold lower than for the in-frame construct, as assessed by densitometry.


Figure 1: Down-regulation of TCR-beta transcripts that possess stop codons in internal exons. Upper panel, the V constructs transfected into SL12.4 cells: construct A, pIF; construct B, pFS1; construct C, pFS2; construct D, pFS3. Lower panel, Northern blot analysis of cytoplasmic RNA (10 µg) from stably transfected SL12.4 cells incubated in the presence or absence of cycloheximide (CHX). Hybridization with the V probe shows the expression of the transfected genes, while hybridization with the cyclophillin probe shows that the blots are equally loaded.



Since the basis for the decrease in mRNA levels may be due to recognition of the premature nonsense codon by a ribosome, we tested whether the addition of protein synthesis inhibitors could reverse the down-regulation. Incubation with the protein synthesis inhibitor CHX dramatically induced mRNAs derived from the three constructs that possessed ptcs (Fig. 1). In contrast, CHX had little or no effect on mRNA expression from the in-frame construct (Fig. 1). Thus, incubation with CHX specifically reversed the down-regulation of out-of-frame TCR-beta transcripts.

Two of the out-of-frame VDJ constructs shown in Fig. 1were generated by adding a 10-nucleotide XhoI linker at different sites within the exon. To test if the reading frameshift caused by the XhoI linker was depressing expression, we tested the effect of adding three XhoI linkers to the normal gene (construct A); this would maintain the correct frame by introducing 30 nucleotides. The construct containing three XhoI linkers at the EcoRV site of the VDJ exon was expressed at high levels, regardless of the presence of CHX (data not shown). In contrast, when four XhoI linkers were introduced at the EcoRV site so that the construct was now out-of-frame, the expression pattern was the same as the construct with a single XhoI linker (e.g. CHX-inducible).

Next, a nonsense codon was introduced into an in-frame TCR-beta gene to determine if a ptc could trigger the down-regulatory response without a frameshift. A UAA nonsense codon was introduced in place of a UAU codon within the VDJ exon. This single nucleotide mutation was sufficient to efficiently down-regulate mRNA levels (Fig. 2). Treatment with CHX reversed the down-regulation (Fig. 2). As a control, the UAU codon was converted to a synonomous UAC codon. This construct expressed high levels of TCR-beta mRNA regardless of whether CHX was present or absent (Fig. 2).


Figure 2: A premature nonsense codon is sufficient to trigger down-regulation. Northern blot analysis of total cellular RNA (2 µg) obtained from SL12.4 cells stably transfected with pUAA, a V construct that possesses a ptc at amino acid position 50, or pUAC, a construct that possesses a UAC codon at this same position. Hybridization with the V probe shows the expression of the transfected genes, while hybridization with the cyclophillin probe shows that the blots are equally loaded.



To determine whether the down-regulatory mechanism displayed stage specificity in its effects, an out-of-frame V gene was transfected into two T-lymphoma cell clones (RS4.2 and AKR1) that display a more mature phenotype than the SL12.4 cell clone used in our study. Although the RS4.2 cell clone has a double negative phenotype (CD48) like SL12.4 cells, it constitutively expresses TCR-beta transcripts and displays a pattern of cell surface markers indicative of a more mature phenotype (36, 45) . The AKR1 clone exhibits an even more mature phenotype: it is a double-positive cell clone that constitutively expresses both TCR-alpha and -beta mRNA(33) . We observed that the transfected out-of-frame V gene was expressed at very low levels in stably transfected lines of either RS4.2 or AKR1 cells (Fig. 3). CHX treatment induced the out-of-frame V transcript in both cell lines (Fig. 3). Thus, the RS4.2 and AKR1 T-cell clones exhibit the same down-regulatory response as the less mature SL12.4 cell clone.


Figure 3: Down-regulation of TCR-beta transcripts in T-cells at different stages of maturation. Northern blot analysis of cytoplasmic RNA (10 µg) obtained from RS4.2 (CD4CD8) or AKR1 (CD4CD8) T-lymphoma cells stably transfected with the out-of-frame V construct pFS1-1. Hybridization with the V probe shows the expression of the transfected genes, while hybridization with the cyclophillin (cyclo) probe shows RNA loading. Note that the lane from CHX-treated AKR1 cells is underloaded, as demonstrated with the cyclophillin probe.



Allelic Specificity of the Down-regulatory Mechanism

In past studies, we showed that although the SL12.4 T-lymphoma cell clone possesses a fully rearranged endogenous TCR-beta gene that is transcriptionally active (as assessed by nuclear run-on analysis) and gives rise to abundant nuclear pre-mRNAs (detected by Northern blot analysis), it expresses very low levels of mature mRNAs in the cytoplasm(33, 34) . Since we found that CHX induces TCR-beta transcripts in this cell clone by a post-transcriptional mechanism(33) , we considered the possibility that the rearranged TCR-beta gene in the SL12.4 cell clone is out-of-frame. Sequence analysis of reverse transcriptase-PCR products generated from these cells showed that indeed SL12.4 cells expressed an out-of-frame VJC gene possessing a ptc in the first C exon (Fig. 4). Northern blot analysis showed that SL12.4 cells expressed transcripts from this nonproductively rearranged V gene only after CHX treatment (Fig. 4). In contrast, an in-frame V gene stably transfected into the same cells generated high levels of transcripts whether CHX was present or not (Fig. 4). Since the in-frame V and out-of-frame V mRNAs are differentially regulated in the same cell clone, this demonstrates that the down-regulatory mechanism is allelic-specific.


Figure 4: Differential expression of in-frame and out-of-frame TCR-beta transcripts in the SL12.4 T cell clone. Upper panel, the nucleotide sequence of the out-of-frame TCR-beta mRNA transcribed from the endogenous VC gene in the SL12.4 cell clone. Lower left panel, the positions of the stop codons in the endogenous out-of-frame VC gene and the transfected in-frame VC gene. Lower right panel, Northern blot analysis of cytoplasmic RNA (10 µg) prepared from SL12.4 cells stably transfected with the in-frame VC construct (pIF).



To further confirm allelic specificity, TCR-beta mRNA expression was examined in the BW5147 cell clone, which possesses a productively rearranged V gene and a nonproductively rearranged V gene(46) . Northern blot analysis showed that levels of the mature 1.3-kb V transcript were high, while the 1.3-kb V transcript was barely detectable (at least a 30-fold difference in expression; data not shown). This further supports the notion that the down-regulatory mechanism discriminates between in-frame and out-of-frame transcripts within a single cell.

Protein Synthesis Inhibitors Reverse Nonsense Codon-mediated mRNA Decay in HeLa Cells

To assess the cell type specificity of the ptc-mediated regulatory mechanism, in-frame and out-of-frame TCR-beta constructs were transfected into HeLa (epithelial) cells. For these experiments, the TCR-beta promoter was replaced with the ubiquitously transcribed beta-actin promoter (Fig. 5A). Fig. 5B shows that the presence of a ptc strongly down-regulated TCR-beta mRNA levels in stably transfected HeLa cells. Addition of CHX selectively reversed the down-regulation of the out-of-frame transcripts and had no discernible effect on in-frame transcript levels (Fig. 5B). The kinetics of induction triggered by CHX was rapid. An increase in out-of-frame TCR-beta mRNA levels was evident as early as 0.5 h following CHX treatment (Fig. 5B).


Figure 5: The down-regulation of TCR transcripts bearing premature nonsense codons in stably and transiently transfected HeLa cells. A: construct A, pAc/IF; construct B, pAc/FS2; construct C, pAc/IFDelta. All TCR constructs are driven by a human beta-actin promoter (first exon shown) and all contain the first beta-actin intron. B, Northern blot analysis of cytoplasmic RNA (2 µg) from HeLa cells stably transfected with the constructs shown. CHX-treated cells were incubated for 2 h with the drug. Hybridization with the V probe shows the expression of the transfected genes, while hybridization with the CHO-A probe shows the amount of RNA loaded. C, Northern blot analysis of of cytoplasmic RNA (2 µg) from HeLa cells stably transfected with construct B. D, Northern blot analysis of total cellular RNA (10 µg) from HeLa cells transiently transfected with constructs A (9 µg), B (9 µg), and/or C (3 µg) for 2 days. The cells were incubated with CHX for 2 h unless otherwise indicated.



We next assessed whether transiently transfected TCR-beta genes are subject to the same down-regulatory response as stably integrated TCR-beta genes. To our knowledge, a comparative study of the ptc-mediated regulatory mechanism in transiently and stably transfected cells has not been reported previously. HeLa cells were chosen for the transient transfection experiments, since they are more efficiently transfected than SL12.4 cells. Fig. 5D (left panel) shows that an out-of-frame TCR-beta construct was expressed at dramatically reduced levels compared with the in-frame construct in transiently transfected HeLa cells. The out-of-frame construct was also expressed at low levels relative to a co-transfected in-frame TCR-beta gene that contained a deletion (construct C, Fig. 5A) to permit independent analysis of its expression (Fig. 5D, right panel). CHX only weakly induced the out-of-frame transcripts after either a 2 h or 4 h (Fig. 5D) incubation in these transiently transfected cells. We conclude that although the down-regulatory mechanism is able to act efficiently on ptc-bearing transcripts derived from ``free DNA'' in transiently transfected cells, CHX is not able to efficiently reverse this down-regulatory response.

Nonsense Codon-mediated mRNA Decay Is Reversed by Protein Synthesis Inhibitors with Different Mechanisms of Action

Since CHX may induce out-of-frame TCR-beta transcripts by a nonspecific mechanism independent of its effects on protein synthesis, we tested the effect of other known protein synthesis inhibitors. Fig. 6shows that the protein synthesis inhibitors anisomycin, emitine, pactamycin, and puromycin induced out-of-frame TCR transcripts in stably transfected HeLa cells as effectively as CHX. We also tested the effect of polio virus infection, since polio virus is known to be an efficient inhibitor of translation(47) . Infection with polio virus caused a time-dependent increase in out-of-frame TCR-beta transcripts in HeLa cells (Fig. 7). In contrast, polio virus infection caused a gradual decline of in-frame transcript levels, presumably due to the block in transcription known to be triggered by polio virus infection(48) .


Figure 6: Protein synthesis inhibitors with different mechanisms of action all reverse the down-regulatory response. Northern blot analysis of cytoplasmic RNA (2 µg) from HeLa cells stably transfected with construct B from Fig. 5. The cells were incubated with cycloheximide (100 µg/ml), pactamycin (3 µg/ml), anisomycin (100 µg/ml), emetine (300 µg/ml), and puromycin (300 µg/ml), or medium alone for 2 h. Hybridization with the V probe shows the expression of the transfected genes, while hybridization with the CHO-A probe shows the amount of RNA loaded.




Figure 7: Polio virus infection selectively induces ptc-bearing TCR transcripts. Northern blot analysis of cytoplasmic RNA (2 µg) from HeLa cells stably transfected with constructs A and B (from Fig. 5) followed by infection with polio virus. Hybridization with the V probe shows the expression of the transfected genes, while hybridization with the CHO-A probe depicts the expression of a control transcript.



CHX Reverses the Down-regulation of beta-Globin mRNA That Possesses a Premature Termination Codon

To determine whether CHX has a general capacity to reverse nonsense codon-mediated down-regulation, its effect on the expression of beta-globin mRNA was assessed. A ptc was introduced at codon 39 of the human beta-globin gene, since that has been previously shown to depress globin mRNA levels(16, 17, 26) . The mutant and wild type beta-globin constructs were stably transfected into HeLa cells. We observed that the wild type beta-globin construct was expressed at high levels in HeLa cells, regardless of whether CHX was present or not, while the ptc-bearing construct was expressed at high levels only if the cells were incubated with CHX (Fig. 8). Thus, CHX is able to reverse the down-regulatory effect of ptcs in nonlymphoid transcripts expressed in nonlymphoid cells.


Figure 8: Cycloheximide reverses the down-regulation of beta-globin transcripts that possess a premature nonsense codon. Upper panel: construct A, pGLOB (wild type beta-globin construct); construct B, pGLOB39 (beta-globin construct that possesses a ptc at position 39). Lower panel, Northern blot analysis of cytoplasmic RNA (2 µg) obtained from HeLa cells stably transfected with pGLOB or pGLOB39. Hybridization with the beta-globin probe (exon 2) shows the expression of the transfected genes, while hybridization with the CHO-A probe shows that the blots are equally loaded.




DISCUSSION

We have shown that ptcs trigger a diminution in mature TCR-beta transcript levels in fetal and adult thymocytes in vivo (Table 1) and in transfected T-cells cultured in vitro (Fig. 2). Out-of-frame TCR genes that bear ptcs are commonly generated by programmed rearrangement during lymphocyte development. Most T-cells possess a nonproductively rearranged TCR-beta gene on one chromosome and a productively rearranged TCR-beta gene on the other chromosome(2) . Thus, it is critical that the down-regulatory mechanism exhibit allelic specificity: that it only depress the expression of the ptc-bearing gene, not the functionally rearranged gene. Our demonstration that the down-regulatory mechanism is indeed allelic-specific (Fig. 4) suggests that this mechanism may be biologically relevant to the immune system. Consistent with our results, Maquat's laboratory has shown that the down-regulation of ptc-bearing triosephosphate isomerase transcripts is allele-specific (11) and that ptcs act in cis, not in trans, to down-regulate triosephosphate isomerase mRNA levels (23) . A general down-regulatory mechanism may be present in all cell types, where it serves to protect cells from dominant negative mutations that result from mutant nonsense codons. Since mutant proteins of the dominant negative class can be potent inhibitors of the corresponding wild-type protein(49) , it is likely that there has been selection pressure to evolve a mechanism to reduce the expression of such deleterious proteins. In the case of the TCR-beta protein, it is known that a truncated amino-terminal version that has lost the ability to bind to CD3 molecules gains the ability to be secreted (50) and thus could potentially interfere with immune reactions.

It is not clear how the down-regulatory mechanism can distinguish a premature termination codon from a bona fide termination codon. One possibility is that the termination codons which trigger down-regulation lie upstream of an intron. This model is consistent with the fact that most normal stop codons in mammalian genes lie in the terminal exon (51) and hence would not be followed by an intron. Evidence for this model is that ptcs in any of the internal TCR-beta exons we tested, including the penultimate exon, all result in strongly reduced expression (Fig. 1). Furthermore, removal of the introns downstream of a ptc in the TCR-beta gene reversed the down-regulatory response. (^2)Similarly, it has been shown that removal of introns downstream of ptcs in the triosephosphate isomerase gene inhibits the degradation of the encoded message(14, 21) . If nonsense codon-mediated decay is intron-dependent, then it is reasonable to suppose that the down-regulatory mechanism involves the nucleus. In fact, several reports have provided evidence that the presence of ptcs in transcripts causes their decay in the nuclear fraction of mammalian cells, not in the cytoplasmic fraction (9, 12, 14-17, 20, 23, 24, 26). We have also found this to be the case for TCR-beta transcripts, based on nuclear subcellular fractionation studies and cytoplasmic half-life measurements.^2

Two models have been proposed by Urlaub et al.(12) to explain how translation signals may affect nuclear mRNA stability. The translational translocation model proposes that translation of mRNA in the cytoplasm is first initiated while mRNA is still traversing through the nuclear pore. According to this model, if the ribosome encounters a ptc, export of the mRNA is interrupted, leading to degradation of the mRNA while it is still associated with the nucleus. In contrast, the nuclear-scanning model proposes that a codon scanner exists in the nucleus that searches for ptcs in mRNAs. Recognition of a ptc by the codon-scanner leads to nuclear degradation of the mRNA. More recently, a third model was suggested by Cheng & Maquat (19) in which recognition of a ptc by a cytoplasmic ribosome causes the transmission of a signal to the nucleus, triggering the degradation of the ptc-bearing mRNA in the nucleus. The key difference between these models is the locality of ptc recognition. For the translational translocation and the signaling models, recognition occurs in the cytoplasm, whereas the nuclear scanning model proposes that recognition of nonsense codons takes place in the nucleus.

Given that the down-regulation of many mRNAs occurs in the nuclear fraction of mammalian cells, it is important to determine if the regulation is exerted on pre-mRNA or mature mRNA. In this study, we assessed this question in fetal and adult thymus and determined that the presence of ptcs dramatically down-regulated mature TCR-beta mRNAs, but had little or no effect on TCR-beta pre-mRNA levels (Table 1). This implies that the nuclear down-regulation triggered by ptcs in vivo is not due to a decreased rate of gene transcription or decreased stability of the primary transcript. Thus, the most likely mechanisms by which ptcs depress TCR-beta mature mRNA levels are by: 1) inhibiting the splicing of one or more introns present in TCR-beta pre-mRNAs or 2) decreasing the stability of partially or fully spliced TCR-beta transcripts. Our conclusions are consistent with several reports that show that ptcs have no effect on gene transcription in cultured cell lines(8, 12, 16, 19) . In contrast, no consensus has emerged regarding the effect of ptcs on pre-mRNA levels in cell lines; ptcs exert no discernible effect on triosephosphate isomerase pre-mRNA levels and thus appear not to affect splicing(19) , while ptcs apparently inhibit the splicing of Ig-kappa chain and MVM pre-mRNAs(9, 15) .

Protein synthesis inhibitors prevented the down-regulation of ptc-bearing TCR transcripts in T-cells at different stages of maturation (Fig. 3) and in nonlymphoid cells (Fig. 5Fig. 6Fig. 7). In addition, we showed that CHX treatment induced a reversal in ptc-mediated down-regulation of beta-globin transcripts (Fig. 8). Consistent with our observations, it was reported that CHX induces ptc-bearing iduronidase transcripts in fibroblasts, as assessed by Northern blot analysis(25) . In contrast, Lozano et al.(9) showed that CHX only marginally affects the levels of ptc-bearing Ig-kappa transcripts, as judged by reverse transcriptase-PCR analysis. The mechanistic basis for the apparent difference between Ig and TCR regulation is not known. CHX may induce events in B-cells that renders them still sensitive to the effects of nonsense codons. Alternatively, B- and T-cells may utilize different regulatory mechanisms to detect nonsense codons. Although this latter hypothesis is formally possible, it seems unlikely, since we find that protein synthesis inhibitors reverses the down-regulatory effect of ptcs in HeLa cells (Fig. 5Fig. 6Fig. 7Fig. 8), as well as T-cells(35) . In addition, the effect of CHX does not appear to be context-specific, since CHX induced transcripts containing ptcs in any of several different exons (Fig. 1).

We suggest that protein synthesis inhibitors debilitate the down-regulatory mechanism in one of two ways. One possibility is that protein synthesis inhibitors directly prevent a ribosome in the cytoplasm or a ribosome-like entity in the nucleus from reading mRNAs to determine if they possess mutant nonsense codons. The rapid reversal of the down-regulatory response by CHX treatment (Fig. 5C) is consistent with this possibility. This hypothesis is also supported by a study that showed that ptc-mediated mRNA decay is partially inhibited by the presence of a stable hairpin loop in the 5` end of an mRNA or by co-transfection with a nonsense suppressor tRNA(18) . Our observation that protein synthesis inhibitors that act by different mechanisms all efficiently reverse the down-regulation of ptc-bearing TCR-beta transcripts (Fig. 6) suggests that either a translocating ribosome or a modified translocating ribosome is responsible. This entity is likely to contain components of the 60 S ribosomal subunit, since anisomycin, CHX, and puromycin all affect the function of this ribosomal subunit. Components of the 40 S subunit are also likely to be involved, since emetine, which specifically binds the 40 S subunit, also reversed the down-regulatory response. Since many of the inhibitors that we used are polysome stabilizers, it is possible that they act by eliciting a build-up of ribosomes on ptc-bearing RNAs, thus shielding these mRNAs from ribonuclease attack. This is unlikely since the polysome destabilizers puromycin and pactamycin, which generate naked ribosome-free transcripts, also induced ptc-bearing TCR-beta transcripts in HeLa cells (Fig. 6) and T-cells(35) . Interestingly, puromycin is known to cause premature termination of protein synthesis, yet like the other metabolic inhibitors we used, it induced the accumulation of ptc-bearing mRNAs. This suggests that the act of premature translational termination is not sufficient to trigger the down-regulatory response. Instead, recognition of a nonsense codon is critical to engage the down-regulatory mechanism.

A second possible mechanism by which protein synthesis inhibitors reverse the down-regulatory response may be by preventing the translation of an unstable protein critical for the down-regulatory response. Since ptc-mediated down-regulation appears to involve the nucleus, an emerging possibility is that this response may not be mediated by a classical ribosome. An unstable protein(s) may be an essential component of this putative nonclassical ribosome. Alternatively, an unstable protein could be involved in putative ptc-mediated signaling events(19) , or it could mediate the degradation of ptc-bearing mRNAs. Our observation that ptc-bearing mRNAs are induced within 30 min after CHX treatment suggests that the half-life of such a labile protein would be relatively short. Evidence suggests that a labile protein also regulates the half-life of wild type c-fos transcripts(52) , although other evidence suggests that the rate of c-fos mRNA decay is regulated by other factors(53) . The nature of the labile proteins that may mediate the decay of unstable normal mRNAs (such as as c-fos) and aberrant mRNAs containing premature nonsense codons remains to be determined.

The use of various drugs to inhibit protein synthesis allowed us to determine that de novo protein synthesis is necessary for ptc-mediated degradation. However, their use does not address the question of whether a cytoplasmic ribosome or a nuclear ribosome-like entity is involved in this regulation, since these drugs can accumulate in the nucleus as well as the cytoplasm. To address this question, we chose to use the polio virus, since it replicates in the cytoplasm of infected cells and selectively inhibits cytoplasmic translation by cleaving a protein that is a component of one of the initiation factors necessary for cap-dependent translation(47) . Infection with polio virus resulted in an increase in the levels of ptc-containing TCR-beta transcripts (Fig. 7). This result supports the notion that cytoplasmic ribosomes are involved in this mechanism. Hence, polio virus infection could be preventing ribosomal recognition of ptcs in the cytoplasm. Alternatively, polio virus may prevent the cytoplasmic translation of an unstable protein destined for either the nucleus or the cytoplasm that is necessary for ptc-mediated mRNA decay. One caveat with interpreting this data is that since polio virus affects many host processes(48) , it is possible that the reversal of the down-regulatory response elicited by polio virus may be due to one of its other activities.

Although CHX strongly induced ptc-bearing TCR-beta mRNAs in stably transfected SL12.4 (Fig. 1Fig. 2Fig. 3Fig. 4) and HeLa cells (Fig. 5, A-C), CHX was a weak inducer in transiently transfected HeLa cells (Fig. 5D). Thus, it appears that ptc-bearing TCR-beta transcripts are not efficiently rescued by protein synthesis inhibitors in transiently transfected cells. Possible explanations for this result include: (i) the declining rate of transcription from DNA templates two days after transient transfection may preclude significant increases in mRNA levels when protein synthesis inhibitors are added at this time; (ii) the high level of mRNAs transcribed from the large number of transiently transfected DNA templates (in the small percentage of cells that efficiently incorporate the exogenous DNA) may overwhelm the putative alternative pathway for nuclear mRNA transport used when the ptc-scanning pathway is blocked by protein synthesis inhibitors; (iii) the nonchromosomally integrated DNA generated by transient transfection may be localized inappropriately for the transcribed RNA to be efficiently exported from the nucleus when the ptc-scanning pathway is blocked.

The level of down-regulation triggered by ptcs appears to vary depending on the gene. For example, TCR and Ig transcripts display a decrease in mRNA levels of 10-100-fold in response to ptcs ( (7, 8, 9, 10) and herein), while fully spliced triose-phosphate isomerase, v-src, and minute virus of mice transcripts are down-regulated by only 3-4-fold by the presence of ptcs(11, 14, 15, 24) . The basis for this difference is not known. Ptc-bearing TCR and Ig genes are generated as a part of normal lymphoid ontogeny, and thus it is possible that these genes have evolved cis-acting elements that improve their ability to be regulated by the ptc-mediated mRNA decay pathway. Since the rapid decay of some ptc-bearing mammalian transcripts appears to require introns(14, 15, 16, 17, 18, 19, 20, 21) , it is conceivable that splicing efficiency could influence the level of down-regulation induced by ptcs. TCR transcripts exhibit inefficient splicing (34) and thus may be localized to the nucleus for sufficient lengths of time to permit stringent scanning for ptcs.

Chromosomal context may be important for maximal down-regulation of ptc-bearing transcripts. The out-of-frame VJC gene in SL12.4 cells gave rise to almost undetectable levels of mature transcripts; levels were induced by >50-fold after CHX treatment ( (33, 34, 35) and herein, Fig. 4). In contrast, transfected out-of-frame TCR-beta genes that presumably integrated at nonhomologous sites gave rise to mature mRNAs that were expressed at low-to-moderate levels and induced only 10-20-fold by CHX (Fig. 1Fig. 2Fig. 3). Similarly, it has been shown that endogenous out-of-frame Ig genes are expressed at almost undetectable levels (up to 100-fold less than in-frame genes), while transfected out-of-frame Ig genes are less dramatically down-regulated(7, 8, 9, 10) . The presence of ptcs depressed dihydrofolate reductase mRNA levels by 5-20-fold when the mRNA was derived from the endogenous gene, but not at all when the mRNA was derived from stably transfected dihydrofolate reductase genomic clones(12) . More recent experiments suggest that the promoter dictates whether the down-regulatory response is engaged: the beta-globin and cytomegalovirus immediate-early promoters permitted regulation, whereas the HSV tk promoter did not(17) . Taken together, these results suggest that nuclear context may strongly influence the down-regulatory mechanism engaged by ptcs. The TCR-beta gene is a useful model for studying the molecular mechanism underlying this down-regulatory network, since: (i) the TCR-beta gene acquires mutant nonsense codons during normal development; (ii) its expression is efficiently suppressed by premature nonsense codons; and (iii) this regulation can be manipulated by treatment with protein synthesis inhibitors.


FOOTNOTES

*
This work was supported by Grants GM39586 and T32 ML07781 from the National Institutes of Health. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: University of Texas M. D. Anderson Cancer Center, Immunology Dept., Box 180, 1515 Holcombe Blvd., Houston, TX 77030. Tel.: 713-794-5526; Fax: 713-745-0846; miles_wilkinson@isqm.mda.uth.tmc.edu.

(^1)
The abbreviations used are: TCR, T-cell receptor; V, variable; J, joining; D, diversity; CHX, cycloheximide; Ig, immunoglobulin; ptc(s), premature termination codon(s); PCR, polymerase chain reaction; kb, kilobase.

(^2)
M. S. Carter and M. F. Wilkinson, manuscript in preparation.


ACKNOWLEDGEMENTS

We thank Nahum Sonenberg for his kind gift of the polio virus. We appreciate the help and advice of Anna Sasaki and Lian Qian and the technical support of Minh Vu.


REFERENCES

  1. Hood, L., Kronenberg, M., and Hunkapiller, T. (1985) Cell 40, 225-229 [CrossRef][Medline] [Order article via Infotrieve]
  2. Kronenberg, M., Siu, G., Hood, L. E., and Shastri, N. (1986) Annu. Rev. Immunol. 4, 529-591 [CrossRef][Medline] [Order article via Infotrieve]
  3. Behlke, M. A., Spinella, D. G., Chou, H. S., Sha, W., Hartl, D. L., and Loh, D. Y. (1985) Science 229, 566-570 [Abstract/Free Full Text]
  4. Barth, R. K., Kim, B. S., Lan, N. C., Hunkapiller, T., Sobieck, N., Winoto, A., Gershenfeld, H., Okada, C., Hansburg, D., Weissman, I. L., and Hood, L. (1985) Nature 316, 517-523 [CrossRef][Medline] [Order article via Infotrieve]
  5. Singer, P. A., McEvilly, R. J., Noonan, D. J., Dixon, F. J., and Theofilopoulos, A. N. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 7018-7022 [Abstract/Free Full Text]
  6. Tuaillon, N., Taylor, L. D., Lonberg, N., Tucker, P. W., and Capra, J. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3720-3724 [Abstract/Free Full Text]
  7. Baumann, B., Potash, M. J., and Kohler, G. (1985) EMBO J. 4, 351-359 [Medline] [Order article via Infotrieve]
  8. Jack, H., Berg, J., and Wabl, M. (1989) Eur. J. Immunol. 19, 843-847 [Medline] [Order article via Infotrieve]
  9. Lozano, F., Maertzdorf, B., Pannell, R., and Milstein, C. (1994) EMBO J. 13, 4617-4622 [Medline] [Order article via Infotrieve]
  10. Connor, A., Wiersma, E., and Shulman, M. J. (1994) J. Biol. Chem. 269, 25178-25184 [Abstract/Free Full Text]
  11. Daar, I. O., and Maquat, L. E. (1988) Mol. Cell. Biol. 8, 802-813 [Abstract/Free Full Text]
  12. Urlaub, G., Mitchell, P. J., Ciudad, C. J., and Chasin, L. A. (1989) Mol. Cell. Biol. 9, 2868-2880 [Abstract/Free Full Text]
  13. Chorney, M. J., Sawada, I., Gillespie, G. A., Srivastava, R., Pan, J., and Weissman, S. M. (1990) Mol. Cell. Biol. 10, 243-253 [Abstract/Free Full Text]
  14. Cheng, J., Fogel-Petrovic, M., and Maquat, L. E. (1990) Mol. Cell. Biol. 10, 5215-5225 [Abstract/Free Full Text]
  15. Naeger, L. K., Schoborg, R. V., Zhao, Q., Tullis, G. E., and Pintel, D. J. (1992) Genes & Dev. 6, 1107-1119
  16. Baserga, S. J., and Benz, E. J., Jr. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2935-2939 [Abstract/Free Full Text]
  17. Enssle, J., Kugler, W., Hentze, M. W., and Kulozik, A. E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10091-10095 [Abstract/Free Full Text]
  18. Belgrader, P., Cheng, J., and Maquat, L. E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 482-486 [Abstract/Free Full Text]
  19. Cheng, J., and Maquat, L. E. (1993) Mol. Cell. Biol. 13, 1892-1902 [Abstract/Free Full Text]
  20. Belgrader, P., Cheng, J., Zhou, X., Stephenson, L. S., and Maquat, L. E. (1994) Mol. Cell. Biol. 14, 8219-8228 [Abstract/Free Full Text]
  21. Cheng, J., Belgrader, P., Zhou, X., and Maquat, L. E. (1994) Mol. Cell. Biol. 14, 6317-6325 [Abstract/Free Full Text]
  22. Barker, G. F., and Beemon, K. (1994) Mol. Cell. Biol. 14, 1986-1996 [Abstract/Free Full Text]
  23. Belgrader, P., and Maquat, L. E. (1994) Mol. Cell. Biol. 14, 6326-6336 [Abstract/Free Full Text]
  24. Simpson, S. B., and Stoltzfus, C. M. (1994) Mol. Cell. Biol. 14, 1835-1844 [Abstract/Free Full Text]
  25. Menon, K. P., and Neufeld, E. F. (1994) Cell. Mol. Biol. 40, 999-1005
  26. Kugler, W., Enssle, J., Hentze, M. W., and Kulozik, A. E. (1995) Nucleic Acids Res. 23, 413-418 [Abstract/Free Full Text]
  27. Maquat, L. E. (1995) RNA 1, 453-465 [Abstract]
  28. Leeds, P., Peltz, S. W., Jacobson, A., and Culbertson, M. R. (1991) Genes & Dev. 5, 2303-2314
  29. Pulak, R., and Anderson, P. (1993) Genes & Dev. 7, 1885-1897
  30. Peltz, S. W., He, F., Welch, E., and Jacobson, A. (1994) Prog. Nucleic Acids Res. Mol. Biol. 47, 271-298 [Medline] [Order article via Infotrieve]
  31. Cui, Y., Hagan, K. W., Zhang, S., and Peltz, S. W. (1995) Genes & Dev. 9, 423-436
  32. He, F., and Jacobson, A. (1995) Genes & Dev. 9, 437-454
  33. Wilkinson, M. F., and MacLeod, C. L. (1988) EMBO J. 7, 101-109 [Medline] [Order article via Infotrieve]
  34. Qian, L., Theodor, L., Carter, M., Vu, M. N., Sasaki, A. W., and Wilkinson, M. F. (1993) Mol. Cell. Biol. 13, 1686-1696 [Abstract/Free Full Text]
  35. Qian, L., Vu, M. N., Carter, M. S., Doskow, J., and Wilkinson, M. F. (1993) J. Immunol. 151, 6801-6814 [Abstract]
  36. Wilkinson, M. F., and MacLeod, C. L. (1988) Eur. J. Immunol. 18, 873-879 [Medline] [Order article via Infotrieve]
  37. Kriegler, M. P. (1990) in Gene Transfer and Expression: A Laboratory Manual , pp. 96-98, Stockon, New York
  38. Wilkinson, M., Doskow, J., and Lindsey, S. (1990) Nucleic Acids Res. 19, 679 [Free Full Text]
  39. Harpold, M. M., Evans, R. M., Salditt-Georgleff, M., and Darnell, J. E., Jr. (1979) Cell 17, 1025-1035 [CrossRef][Medline] [Order article via Infotrieve]
  40. Chou, H. S., Anderson, S. J., Louie, M. C., Godambe, S. A., Pozzi, M. R., Behlke, M. A., Huppi, K., and Loh, D. Y. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1992-1996 [Abstract/Free Full Text]
  41. Gascoigne, N. R. J., Chien, Y., Becker, D. M., Kavaler, J., and Davis, M. M. (1984) Nature 310, 387-391 [CrossRef][Medline] [Order article via Infotrieve]
  42. Krainer, A. R., Maniatis, T., Ruskin, B., and Green, M. R. (1984) Cell 36, 993-1005 [CrossRef][Medline] [Order article via Infotrieve]
  43. Gunning, P., Leavitt, J., Muscat, G., Ng, S., and Kedes, L. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 4831-4835 [Abstract/Free Full Text]
  44. Mallick, C. A., Dudley, E. C., Viney, J. L., Owen, M. J., and Hayday, A. C. (1993) Cell 73, 513-519 [CrossRef][Medline] [Order article via Infotrieve]
  45. MacLeod, C. L., Hays, E. F., Hyman, R., and Bourgeois, S. (1984) Cancer Res. 44, 1784-1790 [Abstract/Free Full Text]
  46. Lee, N. E., and Davis, M. M. (1988) J. Immunol. 140, 1665-1695 [Abstract]
  47. Etchinson, D., Milburn, S. C., Edery, I., Sonenberg, N., and Hershey, J. W. B. (1982) J. Biol. Chem. 257, 14806-14810 [Abstract/Free Full Text]
  48. Fields, B. N., and Knipe, D. M. (1991) Fundamental Virology , 2nd Ed., pp. 409-450, Raven Press, New York
  49. Hershowitz, I. (1987) Nature 329, 219-222 [CrossRef][Medline] [Order article via Infotrieve]
  50. Gascoigne, N. R. J. (1990) J. Biol. Chem. 265, 9296-9301 [Abstract/Free Full Text]
  51. Hawkins, J. D. (1988) Nucleic Acids Res. 16, 9893-9908 [Abstract/Free Full Text]
  52. Koeller, D. M., Horowitz, J. A., Casey, J. L., Klausner, R. D., and Harford, J. B. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7778-7782 [Abstract/Free Full Text]
  53. Winstall, E., Gamache, M., and Raymond, V. (1995) Mol. Cell. Biol. 15, 3796-3804 [Abstract]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
N. Wittkopp, E. Huntzinger, C. Weiler, J. Sauliere, S. Schmidt, M. Sonawane, and E. Izaurralde
Nonsense-Mediated mRNA Decay Effectors Are Essential for Zebrafish Embryonic Development and Survival
Mol. Cell. Biol., July 1, 2009; 29(13): 3517 - 3528.
[Abstract] [Full Text] [PDF]


Home page
J. Clin. Endocrinol. Metab.Home page
M. Fukami, G. Nishimura, K. Homma, T. Nagai, K. Hanaki, A. Uematsu, T. Ishii, C. Numakura, H. Sawada, M. Nakacho, et al.
Cytochrome P450 Oxidoreductase Deficiency: Identification and Characterization of Biallelic Mutations and Genotype-Phenotype Correlations in 35 Japanese Patients
J. Clin. Endocrinol. Metab., May 1, 2009; 94(5): 1723 - 1731.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Yamashita, N. Izumi, I. Kashima, T. Ohnishi, B. Saari, Y. Katsuhata, R. Muramatsu, T. Morita, A. Iwamatsu, T. Hachiya, et al.
SMG-8 and SMG-9, two novel subunits of the SMG-1 complex, regulate remodeling of the mRNA surveillance complex during nonsense-mediated mRNA decay
Genes & Dev., May 1, 2009; 23(9): 1091 - 1105.
[Abstract] [Full Text] [PDF]


Home page
Plant CellHome page
H.-R. Song, J.-D. Song, J.-N. Cho, R. M. Amasino, B. Noh, and Y.-S. Noh
The RNA Binding Protein ELF9 Directly Reduces SUPPRESSOR OF OVEREXPRESSION OF CO1 Transcript Levels in Arabidopsis, Possibly via Nonsense-Mediated mRNA Decay
PLANT CELL, April 1, 2009; 21(4): 1195 - 1211.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
A. D. Bhalla, J. P. Gudikote, J. Wang, W.-K. Chan, Y.-F. Chang, O. R. Olivas, and M. F. Wilkinson
Nonsense Codons Trigger an RNA Partitioning Shift
J. Biol. Chem., February 13, 2009; 284(7): 4062 - 4072.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
M. Moosajee, K. Gregory-Evans, C. D. Ellis, M. C. Seabra, and C. Y. Gregory-Evans
Translational bypass of nonsense mutations in zebrafish rep1, pax2.1 and lamb1 highlights a viable therapeutic option for untreatable genetic eye disease
Hum. Mol. Genet., December 15, 2008; 17(24): 3987 - 4000.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
L. B. Gardner
Hypoxic Inhibition of Nonsense-Mediated RNA Decay Regulates Gene Expression and the Integrated Stress Response
Mol. Cell. Biol., June 1, 2008; 28(11): 3729 - 3741.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
J. Weischenfeldt, I. Damgaard, D. Bryder, K. Theilgaard-Monch, L. A. Thoren, F. C. Nielsen, S. E. W. Jacobsen, C. Nerlov, and B. T. Porse
NMD is essential for hematopoietic stem and progenitor cells and for eliminating by-products of programmed DNA rearrangements
Genes & Dev., May 15, 2008; 22(10): 1381 - 1396.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
L. Ajamian, L. Abrahamyan, M. Milev, P. V. Ivanov, A. E. Kulozik, N. H. Gehring, and A. J. Mouland
Unexpected roles for UPF1 in HIV-1 RNA metabolism and translation
RNA, May 1, 2008; 14(5): 914 - 927.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Watatani, K. Ichikawa, N. Nakanishi, M. Fujimoto, H. Takeda, N. Kimura, H. Hirose, S. Takahashi, and Y. Takahashi
Stress-induced Translation of ATF5 mRNA Is Regulated by the 5'-Untranslated Region
J. Biol. Chem., February 1, 2008; 283(5): 2543 - 2553.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Shi, Z. Hu, K. Pabon, and K. W. Scotto
Caffeine Regulates Alternative Splicing in a Subset of Cancer-Associated Genes: a Role for SC35
Mol. Cell. Biol., January 15, 2008; 28(2): 883 - 895.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. Barbier, M. Dutertre, D. Bittencourt, G. Sanchez, L. Gratadou, P. de la Grange, and D. Auboeuf
Regulation of H-ras Splice Variant Expression by Cross Talk between the p53 and Nonsense-Mediated mRNA Decay Pathways
Mol. Cell. Biol., October 15, 2007; 27(20): 7315 - 7333.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y.-F. Chang, W.-K. Chan, J. S. Imam, and M. F. Wilkinson
Alternatively Spliced T-cell Receptor Transcripts Are Up-regulated in Response to Disruption of Either Splicing Elements or Reading Frame
J. Biol. Chem., October 12, 2007; 282(41): 29738 - 29747.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
M. Sone, T. Hayashi, H. Tarui, K. Agata, M. Takeichi, and S. Nakagawa
The mRNA-like noncoding RNA Gomafu constitutes a novel nuclear domain in a subset of neurons
J. Cell Sci., August 1, 2007; 120(15): 2498 - 2506.
[Abstract] [Full Text] [PDF]


Home page
Plant Cell PhysiolHome page
K. Hori and Y. Watanabe
Context Analysis of Termination Codons in mRNA that are Recognized by Plant NMD
Plant Cell Physiol., July 1, 2007; 48(7): 1072 - 1078.
[Abstract] [Full Text] [PDF]


Home page
Br. J. Ophthalmol.Home page
S. P Meredith, A. J Richards, D. W Flanagan, J. D Scott, A. V Poulson, and M. P Snead
Clinical characterisation and molecular analysis of Wagner syndrome
Br. J. Ophthalmol., May 1, 2007; 91(5): 655 - 659.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. H. Mangs, H. J.L. Speirs, C. Goy, D. J. Adams, M. A. Markus, and B. J. Morris
XE7: A novel splicing factor that interacts with ASF/SF2 and ZNF265
Nucleic Acids Res., October 18, 2006; 34(17): 4976 - 4986.
[Abstract] [Full Text] [PDF]


Home page
Am. J. Respir. Crit. Care Med.Home page
J. D. Cogan, M. W. Pauciulo, A. P. Batchman, M. A. Prince, I. M. Robbins, L. K. Hedges, K. C. Stanton, L. A. Wheeler, J. A. Phillips III, J. E. Loyd, et al.
High Frequency of BMPR2 Exonic Deletions/Duplications in Familial Pulmonary Arterial Hypertension
Am. J. Respir. Crit. Care Med., September 1, 2006; 174(5): 590 - 598.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
M. T. Hyvonen, A. Uimari, T. A. Keinanen, S. Heikkinen, R. Pellinen, T. Wahlfors, A. Korhonen, A. Narvanen, J. Wahlfors, L. Alhonen, et al.
Polyamine-regulated unproductive splicing and translation of spermidine/spermine N1-acetyltransferase
RNA, August 1, 2006; 12(8): 1569 - 1582.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
E. Kamhi, G. Yahalom, G. Kass, Y. Hacham, R. Sperling, and J. Sperling
AUG sequences are required to sustain nonsense-codon-mediated suppression of splicing
Nucleic Acids Res., July 19, 2006; 34(12): 3421 - 3433.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
C. Stockklausner, S. Breit, G. Neu-Yilik, N. Echner, M. W. Hentze, A. E. Kulozik, and N. H. Gehring
The uORF-containing thrombopoietin mRNA escapes nonsense-mediated decay (NMD).
Nucleic Acids Res., January 1, 2006; 34(8): 2355 - 2363.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
J. E. WEIL and K. L. BEEMON
A 3' UTR sequence stabilizes termination codons in the unspliced RNA of Rous sarcoma virus
RNA, January 1, 2006; 12(1): 102 - 110.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
K. Yamanegi, S. Tang, and Z.-M. Zheng
Kaposi's Sarcoma-Associated Herpesvirus K8{beta} Is Derived from a Spliced Intermediate of K8 Pre-mRNA and Antagonizes K8{alpha} (K-bZIP) To Induce p21 and p53 and Blocks K8{alpha}-CDK2 Interaction
J. Virol., November 15, 2005; 79(22): 14207 - 14221.
[Abstract] [Full Text] [PDF]


Home page
JCBHome page
M. A. Ferraiuolo, S. Basak, J. Dostie, E. L. Murray, D. R. Schoenberg, and N. Sonenberg
A role for the eIF4E-binding protein 4E-T in P-body formation and mRNA decay
J. Cell Biol., September 12, 2005; 170(6): 913 - 924.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Paillusson, N. Hirschi, C. Vallan, C. M. Azzalin, and O. Muhlemann
A GFP-based reporter system to monitor nonsense-mediated mRNA decay
Nucleic Acids Res., March 30, 2005; 33(6): e54 - e54.
[Abstract] [Full Text] [PDF]


Home page
IOVSHome page
A. J. Richards, S. Meredith, A. Poulson, P. Bearcroft, G. Crossland, D. M. Baguley, J. D. Scott, and M. P. Snead
A Novel Mutation of COL2A1 Resulting in Dominantly Inherited Rhegmatogenous Retinal Detachment
Invest. Ophthalmol. Vis. Sci., February 1, 2005; 46(2): 663 - 668.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
M. BUHLER and O. MUHLEMANN
Alternative splicing induced by nonsense mutations in the immunoglobulin {micro} VDJ exon is independent of truncation of the open reading frame
RNA, February 1, 2005; 11(2): 139 - 146.
[Abstract] [Full Text] [PDF]


Home page
Int ImmunolHome page
Y. Zhao, Q. Pan-Hammarstrom, Z. Zhao, S. Wen, and L. Hammarstrom
Selective IgG2 deficiency due to a point mutation causing abnormal splicing of the C{gamma}2 gene
Int. Immunol., January 1, 2005; 17(1): 95 - 101.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
A. Skandalis and E. Uribe
A survey of splice variants of the human hypoxanthine phosphoribosyl transferase and DNA polymerase beta genes: products of alternative or aberrant splicing?
Nucleic Acids Res., December 15, 2004; 32(22): 6557 - 6564.
[Abstract] [Full Text] [PDF]


Home page
RNAHome page
C. WACHTEL, B. LI, J. SPERLING, and R. SPERLING
Stop codon-mediated suppression of splicing is a novel nuclear scanning mechanism not affected by elements of protein synthesis and NMD
RNA, November 18, 2004; 10(11): 1740 - 1750.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
A. Grimson, S. O'Connor, C. L. Newman, and P. Anderson
SMG-1 Is a Phosphatidylinositol Kinase-Related Protein Kinase Required for Nonsense-Mediated mRNA Decay in Caenorhabditis elegans
Mol. Cell. Biol., September 1, 2004; 24(17): 7483 - 7490.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. J. LeBlanc and K. L. Beemon
Unspliced Rous Sarcoma Virus Genomic RNAs Are Translated and Subjected to Nonsense-Mediated mRNA Decay before Packaging
J. Virol., May 15, 2004; 78(10): 5139 - 5146.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
L. Delpy, C. Sirac, E. Magnoux, S. Duchez, and M. Cogne
RNA surveillance down-regulates expression of nonfunctional {kappa} alleles and detects premature termination within the last {kappa} exon
PNAS, May 11, 2004; 101(19): 7375 - 7380.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
M. A. Ferraiuolo, C.-S. Lee, L. W. Ler, J. L. Hsu, M. Costa-Mattioli, M.-J. Luo, R. Reed, and N. Sonenberg
A nuclear translation-like factor eIF4AIII is recruited to the mRNA during splicing and functions in nonsense-mediated decay
PNAS, March 23, 2004; 101(12): 4118 - 4123.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
M. Zeniou, R. Gattoni, A. Hanauer, and J. Stevenin
Delineation of the mechanisms of aberrant splicing caused by two unusual intronic mutations in the RSK2 gene involved in Coffin-Lowry syndrome
Nucleic Acids Res., February 18, 2004; 32(3): 1214 - 1223.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. Ohno, M. Milone, X.-M. Shen, and A. G. Engel
A frameshifting mutation in CHRNE unmasks skipping of the preceding exon
Hum. Mol. Genet., December 1, 2003; 12(23): 3055 - 3066.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
F. Pagani, E. Buratti, C. Stuani, and F. E. Baralle
Missense, Nonsense, and Neutral Mutations Define Juxtaposed Regulatory Elements of Splicing in Cystic Fibrosis Transmembrane Regulator Exon 9
J. Biol. Chem., July 11, 2003; 278(29): 26580 - 26588.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
J. K. Lamba, M. Adachi, D. Sun, J. Tammur, E. G. Schuetz, R. Allikmets, and J. D. Schuetz
Nonsense mediated decay downregulates conserved alternatively spliced ABCC4 transcripts bearing nonsense codons
Hum. Mol. Genet., January 15, 2003; 12(2): 99 - 109.
[Abstract] [Full Text] [PDF]


Home page
J. Lipid Res.Home page
P. Tarugi, G. Ballarini, B. Bembi, C. Battisti, S. Palmeri, F. Panzani, E. Di Leo, C. Martini, A. Federico, and S. Calandra
Niemann-Pick type C disease: mutations of NPC1 gene and evidence of abnormal expression of some mutant alleles in fibroblasts
J. Lipid Res., November 1, 2002; 43(11): 1908 - 1919.
[Abstract] [Full Text] [PDF]


Home page
Nucleic Acids ResHome page
S. G. Khan, V. Muniz-Medina, T. Shahlavi, C. C. Baker, H. Inui, T. Ueda, S. Emmert, T. D. Schneider, and K. H. Kraemer
The human XPC DNA repair gene: arrangement, splice site information content and influence of a single nucleotide polymorphism in a splice acceptor site on alternative splicing and function
Nucleic Acids Res., August 15, 2002; 30(16): 3624 - 3631.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
M. Caputi, R. J. Kendzior Jr., and K. L. Beemon
A nonsense mutation in the fibrillin-1 gene of a Marfan syndrome patient induces NMD and disrupts an exonic splicing enhancer
Genes & Dev., July 15, 2002; 16(14): 1754 - 1759.
[Abstract] [Full Text] [PDF]


Home page
ScienceHome page
J. Wang, J. I. Hamilton, M. S. Carter, S. Li, and M. F. Wilkinson
Alternatively Spliced TCR mRNA Induced by Disruption of Reading Frame
Science, July 5, 2002; 297(5578): 108 - 110.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
J. Wang, V. M. Vock, S. Li, O. R. Olivas, and M. F. Wilkinson
A Quality Control Pathway That Down-regulates Aberrant T-cell Receptor (TCR) Transcripts by a Mechanism Requiring UPF2 and Translation
J. Biol. Chem., May 17, 2002; 277(21): 18489 - 18493.
[Abstract] [Full Text] [PDF]


Home page
Proc. Natl. Acad. Sci. USAHome page
B. Li, C. Wachtel, E. Miriami, G. Yahalom, G. Friedlander, G. Sharon, R. Sperling, and J. Sperling
Stop codons affect 5' splice site selection by surveillance of splicing
PNAS, April 16, 2002; 99(8): 5277 - 5282.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
K. S. Brocke, G. Neu-Yilik, N. H. Gehring, M. W. Hentze, and A. E. Kulozik
The human intronless melanocortin 4-receptor gene is NMD insensitive
Hum. Mol. Genet., February 1, 2002; 11(3): 331 - 335.
[Abstract] [Full Text] [PDF]


Home page
J. Cell Sci.Home page
E. Wagner and J. Lykke-Andersen
mRNA surveillance: the perfect persist
J. Cell Sci., January 8, 2002; 115(15): 3033 - 3038.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
Y. Watanabe, K. E. Magor, and P. Parham
Exon 5 Encoding the Transmembrane Region of HLA-A Contains a Transitional Region for the Induction of Nonsense-Mediated mRNA Decay
J. Immunol., December 15, 2001; 167(12): 6901 - 6911.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
A. Yamashita, T. Ohnishi, I. Kashima, Y. Taya, and S. Ohno
Human SMG-1, a novel phosphatidylinositol 3-kinase-related protein kinase, associates with components of the mRNA surveillance complex and is involved in the regulation of nonsense-mediated mRNA decay
Genes & Dev., September 1, 2001; 15(17): 2215 - 2228.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
K. S. Rajavel and E. F. Neufeld
Nonsense-Mediated Decay of Human HEXA mRNA
Mol. Cell. Biol., August 15, 2001; 21(16): 5512 - 5519.
[Abstract] [Full Text] [PDF]


Home page
Mol. Pharmacol.Home page
X.-D. Lei, B. Chapman, and O. Hankinson
Loss of CYP1A1 Messenger RNA Expression Due to Nonsense-Mediated Decay
Mol. Pharmacol., August 1, 2001; 60(2): 388 - 393.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
J. T. Mendell, S. M. Medghalchi, R. G. Lake, E. N. Noensie, and H. C. Dietz
Novel Upf2p Orthologues Suggest a Functional Link between Translation Initiation and Nonsense Surveillance Complexes
Mol. Cell. Biol., December 1, 2000; 20(23): 8944 - 8957.
[Abstract] [Full Text]


Home page
BloodHome page
L. Romao, A. Inacio, S. Santos, M. Avila, P. Faustino, P. Pacheco, and J. Lavinha
Nonsense mutations in the human beta -globin gene lead to unexpected levels of cytoplasmic mRNA accumulation
Blood, October 15, 2000; 96(8): 2895 - 2901.
[Abstract] [Full Text] [PDF]


Home page
Genes Dev.Home page
Q. M. Mitrovich and P. Anderson
Unproductively spliced ribosomal protein mRNAs are natural targets of mRNA surveillance in C. elegans
Genes & Dev., September 1, 2000; 14(17): 2173 - 2184.
[Abstract] [Full Text]


Home page
Hum Mol GenetHome page
P. A. Frischmeyer and HarryC. Dietz
Nonsense-mediated mRNA decayin health and disease
Hum. Mol. Genet., September 1, 1999; 8(10): 1893 - 1900.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
D. Chan, S. Freddi, Y. M. Weng, and J. F. Bateman
Interaction of Collagen alpha 1(X) Containing Engineered NC1 Mutations with Normal alpha 1(X) in Vitro. IMPLICATIONS FOR THE MOLECULAR BASIS OF SCHMID METAPHYSEAL CHONDRODYSPLASIA
J. Biol. Chem., May 7, 1999; 274(19): 13091 - 13097.
[Abstract] [Full Text] [PDF]


Home page
Mol. Biol. CellHome page
A. Buzina and M. J. Shulman
Infrequent Translation of a Nonsense Codon Is Sufficient to Decrease mRNA Level
Mol. Biol. Cell, March 1, 1999; 10(3): 515 - 524.
[Abstract] [Full Text]


Home page
Mol. Cell. Biol.Home page
J. Zhang, X. Sun, Y. Qian, J. P. LaDuca, and L. E. Maquat
At Least One Intron Is Required for the Nonsense-Mediated Decay of Triosephosphate Isomerase mRNA: a Possible Link between Nuclear Splicing and Cytoplasmic Translation
Mol. Cell. Biol., September 1, 1998; 18(9): 5272 - 5283.
[Abstract] [Full Text]


Home page
Proc. Natl. Acad. Sci. USAHome page
X. Sun, H. A. Perlick, H. C. Dietz, and L. E. Maquat
A mutated human homologue to yeast Upf1 protein has a dominant-negative effect on the decay of nonsensecontaining mRNAs in mammalian cells
PNAS, August 18, 1998; 95(17): 10009 - 10014.
[Abstract] [Full Text] [PDF]


Home page
JEMHome page
S. Li, D. Leonard, and M. F. Wilkinson
T Cell Receptor (TCR) Mini-Gene mRNA Expression Regulated by Nonsense Codons: A Nuclear-associated Translation-like Mechanism
J. Exp. Med., March 17, 1997; 185(6): 985 - 992.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Carter, M. S.
Right arrow Articles by Wilkinson, M. F.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Carter, M. S.
Right arrow Articles by Wilkinson, M. F.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement