|
Volume 270,
Number 48,
Issue of December 1, 1995 pp. 28995-29003
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A
Regulatory Mechanism That Detects Premature Nonsense Codons in T-cell
Receptor Transcripts in Vivo Is Reversed by Protein Synthesis
Inhibitors in Vitro(*)
(Received for publication, July 12, 1995; and in revised form, September 27, 1995)
Mark S.
Carter
(1), (2),
Jessica
Doskow
(1),
Phillip
Morris
(1),
Shulin
Li
(1),
Ronald
P.
Nhim
(1),
Sara
Sandstedt
(1),
Miles F.
Wilkinson
(1)(§)From the
(1)Department of Immunology, University of
Texas MD Anderson Cancer Center, Houston, Texas 77030 and the
(2)Molecular Microbiology & Immunology Graduate
Program, Oregon Health Sciences University, Portland, Oregon 97201
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
ABSTRACT
Gene rearrangement during the ontogeny of T- and B-cells
generates an enormous repertoire of T-cell receptor (TCR) and
immunoglobulin (Ig) genes. Because of the error-prone nature of this
rearrangement process, two-thirds of rearranged TCR and Ig genes are
expected to be out-of-frame and thus contain premature terminations
codons (ptcs). We performed sequence analysis of reverse
transcriptase-polymerase chain reaction products from fetal and adult
thymus and found that newly transcribed TCR- pre-mRNAs
(intron-bearing) are frequently derived from ptc-bearing genes but such
transcripts rarely accumulate as mature (fully spliced) TCR-
transcripts. Transfection studies in the SL12.4 T-cell line showed that
the presence of a ptc in any of several TCR- exons triggered a
decrease in mRNA levels. Ptc-bearing TCR- transcripts were
selectively depressed in levels in a cell clone that contained both an
in-frame and an out-of-frame gene, thus demonstrating the allelic
specificity of this down-regulatory response. Protein synthesis
inhibitors with different mechanism of action (anisomysin,
cycloheximide, emetine, pactamycin, puromycin, and polio virus) all
reversed the down-regulatory response. Ptc-bearing transcripts were
induced within 0.5 h after cycloheximide treatment. The reversal by
protein synthesis inhibitors was not restricted to lymphoid cells, as
shown with TCR- and -globin constructs transfected in HeLa
cells. Collectively, the data suggest that the ptc-mediated mRNA decay
pathway requires an unstable protein, a ribosome, or a ribosome-like
entity. Protein synthesis inhibitors may be useful tools toward
elucidating the molecular mechanism of ptc-mediated mRNA decay, an
enigmatic response that can occur in the nuclear fraction of mammalian
cells.
INTRODUCTION
T-cell receptor (TCR) ( )and immunoglobulin (Ig) genes
undergo programmed rearrangement events during lymphocyte ontogeny.
During this process, variable (V) elements are juxtaposed to joining
(J) elements to create functional genes(1, 2) . In
some TCR and Ig genes, diversity (D) elements are also included in this
rearrangement process. The tremendous combinatorial possibilities
afforded by this rearrangement mechanism permit the generation of a
wide variety of antigen receptors. Additional variability is provided
by the enzyme terminal transferase which introduces random nucleotides
at the junctions between V, D, and, J elements(1, 2) .
Variability is also engendered by the low fidelity of the rearrangement
event itself; the borders of each element are not fixed, sometimes
leading to small deletions at the junctions between the V, D, and J
elements. The collective result of these insertional and deletional
events is that a large fraction of rearrangement events will generate
out-of-frame (nonproductive) genes that contain premature termination
codons (ptcs). Since out-of-frame TCR and Ig genes are commonly
generated during normal lymphocyte development, there may exist a
mechanism that diminishes the expression of these nonfunctional
ptc-containing genes. Consistent with this hypothesis, most Ig and TCR
cDNA clones obtained from cDNA libraries have been
in-frame(3, 4, 5, 6) . Studies with
cultured cells have provided evidence that out-of-frame Ig transcripts
are down-regulated compared with in-frame transcripts (7, 8, 9, 10) . In addition, several
other genes exhibit depressed mRNA levels when mutated to contain ptcs ((11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26) ;
reviewed in (27) ). One approach toward analyzing mechanisms
responsible for ptc-mediated decay is to study this event in simpler
eukaryotic organisms that are more amenable to genetic analysis. Toward
this end, it has been shown that Saccharomyces cerevisiae and Caenorhabditis elegans down-regulate ptc-bearing mRNAs (28, 29, 30, 31, 32) . In S. cerevisiae, the decay of ptc-bearing mRNAs appears to be a
cytoplasmic event. Several genes have been identified (the upf and smg series) that participate in ptc-mediated mRNA
decay in S. cerevisiae and C.
elegans(28, 29, 30, 31, 32) .
Determination of the precise functional role of the upf and smg proteins may contribute greatly to our understanding of
this novel regulatory process. Vertebrates may use a ptc-mediated
decay mechanism that differs from the down-regulatory mechanism in
lower eukaryotic cells. In vertebrates it has been shown that many
ptc-bearing mRNAs are degraded in the nuclear fraction, rather than the
cytoplasmic fraction. Preferential nuclear degradation has been
demonstrated for ptc-bearing triosephosphate isomerase, dihydrofolate
reductase, -globin, v-src, major urinary protein (MUP),
and Ig transcripts (9, 12, 14-17, 20, 23, 24, 26). This is an
unexpected observation, since termination codons are generally
considered to be recognized only by ribosomes in the cytoplasm. Several
models have been put forward to explain how ptcs could affect nuclear
events (see ``Discussion''). In order to elucidate the novel
mechanism that is responsible for the recognition and decay of
ptc-bearing mRNAs in vertebrates, it is necessary to identify a system
that efficiently down-regulates such aberrant mRNAs. In addition, the
identification of an approach to reverse the down-regulatory response
would be a useful tool toward understanding the underlying mechanism
and its associated components. In our previous work (33, 34) we showed that mature mRNA derived from a
transcriptionally active TCR- gene in the SL12.4 T-lymphoma cell
clone failed to accumulate in the cytoplasm, although TCR splicing
intermediates were easily detectable in the nucleus. We showed that
incubation of SL12.4 cells with several different protein synthesis
inhibitors dramatically induced the accumulation of mature TCR
transcripts in the cytoplasm(35) . In the present study, we
show that the rearranged TCR- gene in the SL12.4 T cell clone is
out-of-frame and therefore contains ptcs. We then demonstrate in
transfection experiments that the inducibility by protein synthesis
inhibitors is exclusively restricted to ptc-bearing TCR-
transcripts. Protein synthesis inhibitors efficiently reversed the
down-regulatory effect of ptcs in any of a number of TCR exons. The
reversal of ptc-mediated mRNA decay by protein synthesis inhibitors was
a general response that was not restricted to particular stages of
T-cells, nor was it restricted to lymphoid cells. The ability to
reverse this response may be useful toward studying the molecular
mechanism of nonsense codon-mediated decay in the nucleus of vertebrate
cells. Since nonfunctional ptc-bearing TCR genes are generated as a
part of normal thymic ontogeny, we then asked if this down-regulatory
mechanism operates in normal T-cells in vivo. We show that
although ptc-bearing TCR- genes are transcribed normally and give
rise to normal levels of pre-mRNA in the thymus, that the
levels of mature mRNA derived from these nonfunctional genes
is selectively depressed. This constitutes the first in vivo evidence in higher eukaryotes that the ptc-mediated mRNA decay
pathway selectively depresses mature mRNA levels, not pre-mRNA levels.
Our findings reveal new insights into the ptc-induced down-regulatory
mechanism and serve to further generalize the importance of this
mechanism.
MATERIALS AND METHODS
Cell Culture, Transfections, and Northern blot AnalysisThe SL12.4, RS4.2, and AKR1 murine T-lymphoma cell clones
were cultured as described previously(33, 36) . Cells
were treated with cycloheximide (CHX) for 2 h at a concentration (100
µg/ml) that we have previously shown is sufficient to inhibit
protein synthesis (as assessed by [ S]methionine
incorporation) by >95%(33, 36) . Stable
transfections of the T-lymphoma cell clones were performed by
electroporating 5-20 µg of DNA in 1 HBS buffer (280
mM NaCl, 1.5 mM Na HPO , 50
mM Hepes, pH 7.05) with a Moonlight Cat Door electroporator
(Seattle, WA) at 2900-3200 V. After transfection, the cells were
split at different dilutions (1:5 to 1:100) among the wells in a
24-well plate. The antibiotic G418 (800 µg/ml) was added the
following day, and after 12-20 days of selection in the presence
of the antibiotic, all wells with viable cells were tested for
expression of the constructs by Northern blot analysis. For any given
construct, at least two independent wells were shown to express the
construct and display the regulatory response to CHX shown in the
figures. Cytoplasmic RNA from the T-lymphoma cell lines was prepared as
described(33) .HeLa cells were stably transfected with
5-20 µg of DNA by calcium phosphate
precipitation(37) , and individual stably transfected clones
were isolated for Northern blot analysis. Transient transfections were
performed by electroporation with an Invitrogen Electroporator II
according to the manufacturer's instructions (Invitrogen Corp.,
San Diego). Total cellular RNA was harvested 2 days after transfection.
For polio virus infection, near confluent HeLa cells were infected with
polio virus type I (Mahoney strain) at a concentration of 75
plaque-forming unit/cell. The virus was incubated with the HeLa cells
for 30 min at room temperature, followed by addition of
Dulbecco's modified Eagle's medium without serum
(designated time point 0 of the infection). Total RNA from HeLa cells
was prepared as described(33) . Cytoplasmic RNA was prepared by
lysis in 0.6% Nonidet P-40, 0.15 M NaCl, 10 mM Tris
(pH 8), 0.1 mM EDTA. RNA was electrophoresed, blotted, and
probed as described(34) . The relative amount of RNA loaded per
lane was assessed by methylene blue staining of the rRNA content (38) as well as hybridization with the housekeeping genes
cyclophillin and CHO-A(39) .
OligonucleotidesThe following oligonucleotides were used: V ,
sense orientation (ends at the -9 position with respect to the
initiator ATG of V ), CAAGAGACAGTATCTGA;
V -A, sense (V exon, corresponds to
amino acids G -Y ), GGGCTGAGGCTGATCCATTA;
V -B, sense (corresponds to amino acids
G -G ), AGGAGATATCCCTGATGG;
V -C, sense (begins 7 nucleotides downstream of the
TATA box), CAGGGCTGGAACATACG; V -D, antisense (begins
at amino acid 59), ATCTCCTTTCTCCGTGC; V -E, antisense
(corresponds to amino acids D -H ),
GTCAGCGAC(C/G/T)TATGAGTAATG (the underlined nucleotide(s) denotes the
site of mutagenesis); I-J -A, antisense (intron sequence
13-32 nucleotides upstream of J exon),
CTGCAACCTAGGCACCTCAGAGAG; I-J -B, antisense (intron
sequence 40-63 nucleotides upstream of J ,
includes KpnI site at 5` end), ACAGGTACCCAGTACCCAGCCATTTG;
E1-A, antisense (C exon 1, nucleotides 2-23,
includes SacII site at 5` end), ACACCGCGGTGGAGTCACATTTCTCAGAT;
E1-B, antisense (C exon 1, nucleotides 25-47, 2
nucleotide mismatch to generate SacI site),
GAGAGCTCAAACAAGGAGACCTT; E2, antisense (C exon 2,
nucleotides 1-17), TGAGGTAATCCCACAGT; glob, antisense
(corresponds to amino acids F -P of
human -globin), AAGAACCTCTAGGTCCAAGG. The sequence information
used to design the oligonucleotides was obtained from the following
sources: V , V , and
V (40) , C and
J (41) , and -globin(42) . The
V oligonucleotide was designed on the basis of our own
sequence analysis of cloned V genomic DNA.
Reverse Transcriptase-PCR Analysis and SequencingTotal cellular RNA (1 µg) from fetal (day 16 post-coitum)
or adult thymus from BALB/c mice was used to prepare cDNA. To analyze
V mRNAs, reverse transcriptase-PCR was performed as
described (35) using oligo(dT) as a primer for cDNA synthesis
and the following oligonucleotides for the PCR reaction (40 cycles).
Mature V , V , and
V transcripts were amplified using oligonucleotides
V -A + E1-A. Pre-mRNA transcripts were amplified
using either oligonucleotide V -A +
I-J -A, oligonucleotide V -A +
I-J -B, or by nested PCR using V -A
+ I-J -B (10 cycles), followed with
V -B + I-J -B (30 cycles). Anchored
PCR was performed according the manufacturer's instructions (Life
Technologies, Inc., Gaithersburg, MD) for 5` rapid amplification of
cDNA ends. In brief, cDNA was generated using a primer complementary to
TCR- sequences, the cDNA was dC-tailed with terminal transferase,
then PCR was performed using an ``anchor primer''
(complementary to the C-tail) and an oligonucleotide complementary with
TCR- mRNA. For TCR- mature mRNA, the E1-A oligonucleotide was
used for cDNA synthesis and the E1-B oligonucleotide was used for PCR.
For TCR- pre-mRNA, the I-J -B oligonucleotide was
used to generate cDNA, and the I-J -A was used for PCR.
The PCR products were subcloned into Bluescript KS (Strategene Inc.),
followed by dideoxy sequencing analysis. The sequences obtained were
compared with known V , D ,
J , and C sequences (40, 41) to determine whether the V(D)J exon was in-frame with respect to the C first
exon. N-region diversity was observed at the V, D, and J junctions of
most PCR products. The sequence of the V, D, and J elements was as
reported in the literature, except that polymorphisms were sometimes
noted for J (nucleotide 14 (C) was deleted) and
J (a G was inserted after the T residue at position
9). When several identical sequences were obtained from a given PCR
reaction, only one sequence was considered in the results shown in Table 1.
To obtain the sequence of the VJ junctional region in
the V C transcript in the SL12.4
cell clone, cDNA was prepared using 1 µg of RNA from SL12.4 cells
treated for 6 h with CHX (100 µg/ml). Oligo(dT) was used as a
primer for cDNA synthesis, and the oligonucleotides V and E2 were used for PCR.
Plasmid Constructions
pV 8C 2A productively rearranged
V D J C
genomic fragment was subcloned into pUC13 (obtained from M. Blackman,
P. Marrack, and J. Kappler).
pNEOThe -actin promoter region of
pH APr-1 (43) was removed by EcoRI/BamHI
digestion and replaced with the multiple cloning site of Bluescript KS
present on a 0.5-kb PvuII fragment.
pIFAn 18-kb KpnI/SalI fragment,
derived from pV 8C 2, that contains
V D J C
and the downstream enhancer, was subcloned into pNEO.
pVDJA 3.2-kb KpnI/ClaI
fragment, containing the
V D J region,
subcloned into a modified version of Bluescript KS that lacked
sequences between the EcoRV and SmaI sites.
pRV10-nucleotide XhoI linkers were
introduced into the unique EcoRV site within the
V exon of pVDJ. The number of XhoI linkers
inserted into individual recombinant clones was determined by DNA
sequence analysis.
pFS1A 3.2-kb KpnI/ClaI fragment
that contains the
V D J region was
released from pRV and used to replace the analogous region of
pV 8C 2. An 18-kb KpnI/SalI fragment that
contains the entire gene was then excised and subcloned into pNEO.
pStupStu was generated analogously to pRV except
that a single XhoI linker was introduced into the unique StuI site.
pC 2A 2-kb PstI C
fragment subcloned into the PstI site of pKS.
pFS2The
V D J region of
pStu was subcloned into pC 2 cut with KpnI and ClaI. A 0.8-kb BamHI fragment containing the
TCR- enhancer was then subcloned into the unique BamHI
site downstream of C . The
V D J C
region was then excised with XbaI and KpnI, and this
6-kb fragment was subcloned into pNEO.
pFS3A fragment containing C
exons 1 and 2 was released from pC 2 by linearizing with BglII, followed by S1 nuclease treatment and digestion with XhoI. This 1.25-kb blunt-end/XhoI fragment was
subcloned into Bluescript KS at the XhoI and EcoRV
sites. To introduce a frameshift, the plasmid was then linearized with NcoI, made blunt with Klenow enzyme, and religated to create a
four nucleotide insertion at the NcoI site (confirmed by
sequence analysis).
p PrV 8A promoterless
V fragment was generated by PCR using pVDJ as a
template and oligonucleotides V -C and -D. The PCR
fragment was blunt-ended and inserted into Bluescript KS at the StuI and EcoRV sites.
p PrVDJpVDJ was digested with NdeI
and BamHI and the 2.8-kb fragment inserted into the NdeI and BamHI sites of p PrV 8.
p PrStup PrStu was created analogous to
p PrVDJ except that a pStu NdeI/BamHI fragment
was used.
pAc/IFp PrVDJ was digested with SalI
and BamHI, and the 3.2-kb fragment was inserted into the SalI and BamHI sites of pH Apr-1.
pAc/FS2pAc/FS2 was created analagous to pAC/IF
except that a p PrStu SalI/BamHI fragment was
used.
pAc/IF pAc/IF is identical to pAc/IF
except that it contains a deletion between the PmlI site in
C exon 1 and the BsaBI site in C exon 4.
pGLOBThe human -globin gene was isolated
from p globin/pSP64 (42) with HindIII and PstI, subcloned into pSP72 (Promega, Madison, WI), then
released with HindIII and BglII and subcloned into
pNEO.
pGLOB39A -globin gene fragment containing
exons 1 and 2 was released from p globin/pSP64 with HindIII and DraI, the ends were filled in by Klenow,
and the 1.1-kb fragment was subcloned into Bluescript KS at the EcoRV site. A nonsense mutation (UAG) was created at codon 39
using the Bio-Rad mutagenesis kit (Hercules, CA) with the
oligonucleotide glob, the 1.1-kb insert was released with HindIII and BamHI and subcloned into pNEO. This
construct was then linearized with BamHI and a 1.6-kb fragment
containing the 3` end of -globin was subcloned into the BamHI site.
pUAACodon 50 in pVDJ was mutated using the
oligonucleotide V -E by the approach described for
pGLOB39. A 3.2-kb KpnI-ClaI fragment containing this
mutation was used to replace the equivalent region in pFS2.
pUACpUAC was generated in the same manner as
pUAA.
RESULTS
Down-regulation of Out-of-frame TCR mRNAs Derived from
Actively Transcribed Genes in Thymocytes in VivoThe TCR-
gene undergoes programmed rearrangement events as T-lymphocytes migrate
through the thymic environment(2) . First, D
and J elements are joined, followed by juxtaposition of
the fused DJ element with any one of several
V gene elements (in some cases, J elements are fused directly to V elements). As a
result of the sequence variation at the V-D, D-J, or V-J junctions,
out-of-frame TCR- genes are commonly generated containing a ptc in
either the V(D)J exon or the first C exon. To determine if a down-regulatory mechanism depresses the
expression of such out-of-frame TCR- transcripts in vivo,
we assessed the relative levels of in-frame and out-of-frame TCR-
mRNA by sequence analysis of reverse transcriptase-PCR products from
fetal and adult thymus. TCR- pre-mRNA and mature mRNA molecules
were independently assessed using a 3` primer complementary to either
exon or intron sequences, respectively. The 5` primers included a
pan-V primer used to amplify V ,
V , and V transcripts or an anchor
primer used to amplify random V transcripts. Sequence
analysis of the reverse transcriptase-PCR products from adult thymus
showed that 43% of V pre-mRNAs were out-of-frame (Table 1). This proportion of out-of-frame pre-mRNAs is
similar to the percentage of TCR- genes known to be
out-of-frame in thymocytes. Mallick et al.(44) showed
that the average frequency of out-of-frame V ,
V , V , V , and
V genes in the adult mouse thymus is 25%. The reason
that the percentage of out-of-frame TCR- genes was not the
theoretically expected value of 67% may be because T-cells which have
generated nonproductive rearrangements on both chromosomes do
not survive and thus do not contribute to the gene pool (44) . The proportion of out-of-frame pre-mRNA TCR-
transcripts that we found in the adult thymus differed strikingly from
the value we determined for TCR- mature mRNA. Of 28
independent mature cDNAs sequenced, none were out-of-frame (Table 1). The samples sequenced included V ,
V , and V transcripts, as well as
random V transcripts detected by anchored PCR. The
proportion of in-frame and out-of-frame TCR transcripts was also
determined in day 16 fetal thymus. At day 16 of gestation, the thymus
is dominated by immature double-negative
(CD4 CD8 ) and double-positive
(CD4 CD8 ) thymocytes that might be
subject to different regulation than more mature thymocytes. Our
analysis revealed that TCR- pre-mRNAs were commonly out-of-frame
(38%), but mature mRNAs rarely were (4%; Table 1). Collectively,
the results show that both fetal and adult thymus actively transcribe
in-frame and out-of-frame TCR- genes but selectively depresss the
levels of mature out-of-frame transcripts.
Down-regulation of TCR- mRNA Levels by Premature
Termination CodonsTo study the mechanism responsible for the
decreased abundance of out-of-frame TCR- mRNAs, we assessed the
expression of TCR- constructs in stably transfected T-cell lines.
First, the expression of several frameshifted versions of a
V D J C
(V ) gene were compared with the in-frame version of
this gene. These frameshifted genes possessed ptcs in either the
VDJ exon, the C exon, or the
C exon (the second, third, or fifth exons of the
TCR- gene, respectively; see Fig. 1). Northern blot
analysis revealed that the in-frame version of the V
gene was expressed at high levels in the SL12.4 T-lymphoma cell clone (Fig. 1). In contrast, all out-of-frame V constructs were expressed at very low levels in SL12.4 cells (Fig. 1). Transcript levels for the three frameshifted
constructs were all at least 10-fold lower than for the in-frame
construct, as assessed by densitometry.
Figure 1:
Down-regulation of TCR-
transcripts that possess stop codons in internal exons. Upper
panel, the V constructs transfected into SL12.4
cells: construct A, pIF; construct B, pFS1; construct C, pFS2; construct D, pFS3. Lower
panel, Northern blot analysis of cytoplasmic RNA (10 µg) from
stably transfected SL12.4 cells incubated in the presence or absence of
cycloheximide (CHX). Hybridization with the V probe shows the expression of the transfected genes, while
hybridization with the cyclophillin probe shows that the blots are
equally loaded.
Since the basis for the
decrease in mRNA levels may be due to recognition of the premature
nonsense codon by a ribosome, we tested whether the addition of protein
synthesis inhibitors could reverse the down-regulation. Incubation with
the protein synthesis inhibitor CHX dramatically induced mRNAs derived
from the three constructs that possessed ptcs (Fig. 1). In
contrast, CHX had little or no effect on mRNA expression from the
in-frame construct (Fig. 1). Thus, incubation with CHX
specifically reversed the down-regulation of out-of-frame TCR-
transcripts. Two of the out-of-frame VDJ constructs
shown in Fig. 1were generated by adding a 10-nucleotide XhoI linker at different sites within the exon. To test if the
reading frameshift caused by the XhoI linker was depressing
expression, we tested the effect of adding three XhoI linkers
to the normal gene (construct A); this would maintain the correct frame
by introducing 30 nucleotides. The construct containing three XhoI linkers at the EcoRV site of the VDJ exon was expressed at high levels, regardless of the presence of
CHX (data not shown). In contrast, when four XhoI linkers were
introduced at the EcoRV site so that the construct was now
out-of-frame, the expression pattern was the same as the construct with
a single XhoI linker (e.g. CHX-inducible). Next, a
nonsense codon was introduced into an in-frame TCR- gene to
determine if a ptc could trigger the down-regulatory response without a
frameshift. A UAA nonsense codon was introduced in place of a UAU codon
within the VDJ exon. This single nucleotide mutation
was sufficient to efficiently down-regulate mRNA levels (Fig. 2). Treatment with CHX reversed the down-regulation (Fig. 2). As a control, the UAU codon was converted to a
synonomous UAC codon. This construct expressed high levels of TCR-
mRNA regardless of whether CHX was present or absent (Fig. 2).
Figure 2:
A premature nonsense codon is sufficient
to trigger down-regulation. Northern blot analysis of total cellular
RNA (2 µg) obtained from SL12.4 cells stably transfected with pUAA,
a V construct that possesses a ptc at amino acid
position 50, or pUAC, a construct that possesses a UAC codon at this
same position. Hybridization with the V probe shows
the expression of the transfected genes, while hybridization with the
cyclophillin probe shows that the blots are equally
loaded.
To determine whether the down-regulatory mechanism displayed stage
specificity in its effects, an out-of-frame V gene
was transfected into two T-lymphoma cell clones (RS4.2 and AKR1) that
display a more mature phenotype than the SL12.4 cell clone used in our
study. Although the RS4.2 cell clone has a double negative phenotype
(CD4 8 ) like SL12.4 cells, it
constitutively expresses TCR- transcripts and displays a pattern
of cell surface markers indicative of a more mature phenotype (36, 45) . The AKR1 clone exhibits an even more mature
phenotype: it is a double-positive cell clone that constitutively
expresses both TCR- and - mRNA(33) . We observed that
the transfected out-of-frame V gene was expressed at
very low levels in stably transfected lines of either RS4.2 or AKR1
cells (Fig. 3). CHX treatment induced the out-of-frame
V transcript in both cell lines (Fig. 3).
Thus, the RS4.2 and AKR1 T-cell clones exhibit the same down-regulatory
response as the less mature SL12.4 cell clone.
Figure 3:
Down-regulation of TCR- transcripts
in T-cells at different stages of maturation. Northern blot analysis of
cytoplasmic RNA (10 µg) obtained from RS4.2
(CD4 CD8 ) or AKR1
(CD4 CD8 ) T-lymphoma cells stably
transfected with the out-of-frame V construct
pFS1-1. Hybridization with the V probe shows the
expression of the transfected genes, while hybridization with the
cyclophillin (cyclo) probe shows RNA loading. Note that the
lane from CHX-treated AKR1 cells is underloaded, as demonstrated with
the cyclophillin probe.
Allelic Specificity of the Down-regulatory
MechanismIn past studies, we showed that although the SL12.4
T-lymphoma cell clone possesses a fully rearranged endogenous TCR-
gene that is transcriptionally active (as assessed by nuclear run-on
analysis) and gives rise to abundant nuclear pre-mRNAs (detected by
Northern blot analysis), it expresses very low levels of mature mRNAs
in the cytoplasm(33, 34) . Since we found that CHX
induces TCR- transcripts in this cell clone by a
post-transcriptional mechanism(33) , we considered the
possibility that the rearranged TCR- gene in the SL12.4 cell clone
is out-of-frame. Sequence analysis of reverse transcriptase-PCR
products generated from these cells showed that indeed SL12.4 cells
expressed an out-of-frame
V J C gene
possessing a ptc in the first C exon (Fig. 4).
Northern blot analysis showed that SL12.4 cells expressed transcripts
from this nonproductively rearranged V gene only
after CHX treatment (Fig. 4). In contrast, an in-frame
V gene stably transfected into the same cells
generated high levels of transcripts whether CHX was present or not (Fig. 4). Since the in-frame V and
out-of-frame V mRNAs are differentially regulated in
the same cell clone, this demonstrates that the down-regulatory
mechanism is allelic-specific.
Figure 4:
Differential expression of in-frame and
out-of-frame TCR- transcripts in the SL12.4 T cell clone. Upper panel, the nucleotide sequence of the out-of-frame
TCR- mRNA transcribed from the endogenous
V C gene in the SL12.4 cell clone. Lower left panel, the positions of the stop codons in the
endogenous out-of-frame V C gene and
the transfected in-frame V C gene. Lower right panel, Northern blot analysis of cytoplasmic RNA
(10 µg) prepared from SL12.4 cells stably transfected with the
in-frame V C construct
(pIF).
To further confirm allelic
specificity, TCR- mRNA expression was examined in the BW5147 cell
clone, which possesses a productively rearranged V gene and a nonproductively rearranged V gene(46) . Northern blot analysis showed that levels of
the mature 1.3-kb V transcript were high, while the
1.3-kb V transcript was barely detectable (at least
a 30-fold difference in expression; data not shown). This further
supports the notion that the down-regulatory mechanism discriminates
between in-frame and out-of-frame transcripts within a single cell.
Protein Synthesis Inhibitors Reverse Nonsense
Codon-mediated mRNA Decay in HeLa CellsTo assess the cell type
specificity of the ptc-mediated regulatory mechanism, in-frame and
out-of-frame TCR- constructs were transfected into HeLa
(epithelial) cells. For these experiments, the TCR- promoter was
replaced with the ubiquitously transcribed -actin promoter (Fig. 5A). Fig. 5B shows that the
presence of a ptc strongly down-regulated TCR- mRNA levels in
stably transfected HeLa cells. Addition of CHX selectively reversed the
down-regulation of the out-of-frame transcripts and had no discernible
effect on in-frame transcript levels (Fig. 5B). The
kinetics of induction triggered by CHX was rapid. An increase in
out-of-frame TCR- mRNA levels was evident as early as 0.5 h
following CHX treatment (Fig. 5B).
Figure 5:
The
down-regulation of TCR transcripts bearing premature nonsense codons in
stably and transiently transfected HeLa cells. A: construct A, pAc/IF; construct B, pAc/FS2; construct C, pAc/IF . All TCR constructs are driven by a
human -actin promoter (first exon shown) and all contain the first
-actin intron. B, Northern blot analysis of cytoplasmic
RNA (2 µg) from HeLa cells stably transfected with the constructs
shown. CHX-treated cells were incubated for 2 h with the drug.
Hybridization with the V probe shows the expression
of the transfected genes, while hybridization with the CHO-A probe
shows the amount of RNA loaded. C, Northern blot analysis of
of cytoplasmic RNA (2 µg) from HeLa cells stably transfected with
construct B. D, Northern blot analysis of total cellular RNA
(10 µg) from HeLa cells transiently transfected with constructs A
(9 µg), B (9 µg), and/or C (3 µg) for 2 days. The cells
were incubated with CHX for 2 h unless otherwise
indicated.
We next assessed
whether transiently transfected TCR- genes are subject to the same
down-regulatory response as stably integrated TCR- genes. To our
knowledge, a comparative study of the ptc-mediated regulatory mechanism
in transiently and stably transfected cells has not been reported
previously. HeLa cells were chosen for the transient transfection
experiments, since they are more efficiently transfected than SL12.4
cells. Fig. 5D (left panel) shows that an
out-of-frame TCR- construct was expressed at dramatically reduced
levels compared with the in-frame construct in transiently transfected
HeLa cells. The out-of-frame construct was also expressed at low levels
relative to a co-transfected in-frame TCR- gene that contained a
deletion (construct C, Fig. 5A) to permit independent
analysis of its expression (Fig. 5D, right panel). CHX
only weakly induced the out-of-frame transcripts after either a 2 h or
4 h (Fig. 5D) incubation in these transiently
transfected cells. We conclude that although the down-regulatory
mechanism is able to act efficiently on ptc-bearing transcripts derived
from ``free DNA'' in transiently transfected cells, CHX is
not able to efficiently reverse this down-regulatory response.
Nonsense Codon-mediated mRNA Decay Is Reversed by Protein
Synthesis Inhibitors with Different Mechanisms of ActionSince
CHX may induce out-of-frame TCR- transcripts by a nonspecific
mechanism independent of its effects on protein synthesis, we tested
the effect of other known protein synthesis inhibitors. Fig. 6shows that the protein synthesis inhibitors anisomycin,
emitine, pactamycin, and puromycin induced out-of-frame TCR transcripts
in stably transfected HeLa cells as effectively as CHX. We also tested
the effect of polio virus infection, since polio virus is known to be
an efficient inhibitor of translation(47) . Infection with
polio virus caused a time-dependent increase in out-of-frame TCR-
transcripts in HeLa cells (Fig. 7). In contrast, polio virus
infection caused a gradual decline of in-frame transcript levels,
presumably due to the block in transcription known to be triggered by
polio virus infection(48) .
Figure 6:
Protein synthesis inhibitors with
different mechanisms of action all reverse the down-regulatory
response. Northern blot analysis of cytoplasmic RNA (2 µg) from
HeLa cells stably transfected with construct B from Fig. 5. The
cells were incubated with cycloheximide (100 µg/ml), pactamycin (3
µg/ml), anisomycin (100 µg/ml), emetine (300 µg/ml), and
puromycin (300 µg/ml), or medium alone for 2 h. Hybridization with
the V probe shows the expression of the transfected
genes, while hybridization with the CHO-A probe shows the amount of RNA
loaded.
Figure 7:
Polio virus infection selectively induces
ptc-bearing TCR transcripts. Northern blot analysis of cytoplasmic RNA
(2 µg) from HeLa cells stably transfected with constructs A and B
(from Fig. 5) followed by infection with polio virus.
Hybridization with the V probe shows the expression
of the transfected genes, while hybridization with the CHO-A probe
depicts the expression of a control
transcript.
CHX Reverses the Down-regulation of -Globin mRNA
That Possesses a Premature Termination CodonTo determine
whether CHX has a general capacity to reverse nonsense codon-mediated
down-regulation, its effect on the expression of -globin mRNA was
assessed. A ptc was introduced at codon 39 of the human -globin
gene, since that has been previously shown to depress globin mRNA
levels(16, 17, 26) . The mutant and wild type
-globin constructs were stably transfected into HeLa cells. We
observed that the wild type -globin construct was expressed at
high levels in HeLa cells, regardless of whether CHX was present or
not, while the ptc-bearing construct was expressed at high levels only
if the cells were incubated with CHX (Fig. 8). Thus, CHX is able
to reverse the down-regulatory effect of ptcs in nonlymphoid
transcripts expressed in nonlymphoid cells.
Figure 8:
Cycloheximide reverses the down-regulation
of -globin transcripts that possess a premature nonsense codon. Upper panel: construct A, pGLOB (wild type
-globin construct); construct B, pGLOB39 ( -globin
construct that possesses a ptc at position 39). Lower panel,
Northern blot analysis of cytoplasmic RNA (2 µg) obtained from HeLa
cells stably transfected with pGLOB or pGLOB39. Hybridization with the
-globin probe (exon 2) shows the expression of the transfected
genes, while hybridization with the CHO-A probe shows that the blots
are equally loaded.
DISCUSSION
We have shown that ptcs trigger a diminution in mature
TCR- transcript levels in fetal and adult thymocytes in vivo (Table 1) and in transfected T-cells cultured in vitro (Fig. 2). Out-of-frame TCR genes that bear ptcs are
commonly generated by programmed rearrangement during lymphocyte
development. Most T-cells possess a nonproductively rearranged
TCR- gene on one chromosome and a productively rearranged
TCR- gene on the other chromosome(2) . Thus, it is
critical that the down-regulatory mechanism exhibit allelic
specificity: that it only depress the expression of the ptc-bearing
gene, not the functionally rearranged gene. Our demonstration that the
down-regulatory mechanism is indeed allelic-specific (Fig. 4)
suggests that this mechanism may be biologically relevant to the immune
system. Consistent with our results, Maquat's laboratory has
shown that the down-regulation of ptc-bearing triosephosphate isomerase
transcripts is allele-specific (11) and that ptcs act in
cis, not in trans, to down-regulate triosephosphate
isomerase mRNA levels (23) . A general down-regulatory
mechanism may be present in all cell types, where it serves to protect
cells from dominant negative mutations that result from mutant nonsense
codons. Since mutant proteins of the dominant negative class can be
potent inhibitors of the corresponding wild-type protein(49) ,
it is likely that there has been selection pressure to evolve a
mechanism to reduce the expression of such deleterious proteins. In the
case of the TCR- protein, it is known that a truncated
amino-terminal version that has lost the ability to bind to CD3
molecules gains the ability to be secreted (50) and thus could
potentially interfere with immune reactions. It is not clear how the
down-regulatory mechanism can distinguish a premature termination codon from a bona fide termination codon. One
possibility is that the termination codons which trigger
down-regulation lie upstream of an intron. This model is consistent
with the fact that most normal stop codons in mammalian genes
lie in the terminal exon (51) and hence would not be
followed by an intron. Evidence for this model is that ptcs in any of
the internal TCR- exons we tested, including the penultimate exon,
all result in strongly reduced expression (Fig. 1). Furthermore,
removal of the introns downstream of a ptc in the TCR- gene
reversed the down-regulatory response. ( )Similarly, it has
been shown that removal of introns downstream of ptcs in the
triosephosphate isomerase gene inhibits the degradation of the encoded
message(14, 21) . If nonsense codon-mediated decay is
intron-dependent, then it is reasonable to suppose that the
down-regulatory mechanism involves the nucleus. In fact, several
reports have provided evidence that the presence of ptcs in transcripts
causes their decay in the nuclear fraction of mammalian cells, not in
the cytoplasmic fraction (9, 12, 14-17, 20, 23, 24, 26). We have
also found this to be the case for TCR- transcripts, based on
nuclear subcellular fractionation studies and cytoplasmic half-life
measurements. Two models have been proposed by Urlaub et al.(12) to explain how translation signals may
affect nuclear mRNA stability. The translational translocation model
proposes that translation of mRNA in the cytoplasm is first initiated
while mRNA is still traversing through the nuclear pore. According to
this model, if the ribosome encounters a ptc, export of the mRNA is
interrupted, leading to degradation of the mRNA while it is still
associated with the nucleus. In contrast, the nuclear-scanning model
proposes that a codon scanner exists in the nucleus that searches for
ptcs in mRNAs. Recognition of a ptc by the codon-scanner leads to
nuclear degradation of the mRNA. More recently, a third model was
suggested by Cheng & Maquat (19) in which recognition of a
ptc by a cytoplasmic ribosome causes the transmission of a signal to
the nucleus, triggering the degradation of the ptc-bearing mRNA in the
nucleus. The key difference between these models is the locality of ptc
recognition. For the translational translocation and the signaling
models, recognition occurs in the cytoplasm, whereas the nuclear
scanning model proposes that recognition of nonsense codons takes place
in the nucleus. Given that the down-regulation of many mRNAs occurs
in the nuclear fraction of mammalian cells, it is important to
determine if the regulation is exerted on pre-mRNA or mature mRNA. In
this study, we assessed this question in fetal and adult thymus and
determined that the presence of ptcs dramatically down-regulated mature
TCR- mRNAs, but had little or no effect on TCR- pre-mRNA
levels (Table 1). This implies that the nuclear down-regulation
triggered by ptcs in vivo is not due to a decreased
rate of gene transcription or decreased stability of the primary
transcript. Thus, the most likely mechanisms by which ptcs depress
TCR- mature mRNA levels are by: 1) inhibiting the splicing of one
or more introns present in TCR- pre-mRNAs or 2) decreasing the
stability of partially or fully spliced TCR- transcripts. Our
conclusions are consistent with several reports that show that ptcs
have no effect on gene transcription in cultured cell
lines(8, 12, 16, 19) . In contrast,
no consensus has emerged regarding the effect of ptcs on pre-mRNA
levels in cell lines; ptcs exert no discernible effect on
triosephosphate isomerase pre-mRNA levels and thus appear not to affect
splicing(19) , while ptcs apparently inhibit the splicing of
Ig- chain and MVM pre-mRNAs(9, 15) . Protein
synthesis inhibitors prevented the down-regulation of ptc-bearing TCR
transcripts in T-cells at different stages of maturation (Fig. 3) and in nonlymphoid cells (Fig. 5Fig. 6Fig. 7). In addition, we showed that
CHX treatment induced a reversal in ptc-mediated down-regulation of
-globin transcripts (Fig. 8). Consistent with our
observations, it was reported that CHX induces ptc-bearing iduronidase
transcripts in fibroblasts, as assessed by Northern blot
analysis(25) . In contrast, Lozano et al.(9) showed that CHX only marginally affects the levels of
ptc-bearing Ig- transcripts, as judged by reverse
transcriptase-PCR analysis. The mechanistic basis for the apparent
difference between Ig and TCR regulation is not known. CHX may induce
events in B-cells that renders them still sensitive to the effects of
nonsense codons. Alternatively, B- and T-cells may utilize different
regulatory mechanisms to detect nonsense codons. Although this latter
hypothesis is formally possible, it seems unlikely, since we find that
protein synthesis inhibitors reverses the down-regulatory effect of
ptcs in HeLa cells (Fig. 5Fig. 6Fig. 7Fig. 8), as well as
T-cells(35) . In addition, the effect of CHX does not appear to
be context-specific, since CHX induced transcripts containing ptcs in
any of several different exons (Fig. 1). We suggest that
protein synthesis inhibitors debilitate the down-regulatory mechanism
in one of two ways. One possibility is that protein synthesis
inhibitors directly prevent a ribosome in the cytoplasm or a
ribosome-like entity in the nucleus from reading mRNAs to determine if
they possess mutant nonsense codons. The rapid reversal of the
down-regulatory response by CHX treatment (Fig. 5C) is
consistent with this possibility. This hypothesis is also supported by
a study that showed that ptc-mediated mRNA decay is partially inhibited
by the presence of a stable hairpin loop in the 5` end of an mRNA or by
co-transfection with a nonsense suppressor tRNA(18) . Our
observation that protein synthesis inhibitors that act by different
mechanisms all efficiently reverse the down-regulation of
ptc-bearing TCR- transcripts (Fig. 6) suggests that either
a translocating ribosome or a modified translocating ribosome is
responsible. This entity is likely to contain components of the 60 S
ribosomal subunit, since anisomycin, CHX, and puromycin all affect the
function of this ribosomal subunit. Components of the 40 S subunit are
also likely to be involved, since emetine, which specifically binds the
40 S subunit, also reversed the down-regulatory response. Since many of
the inhibitors that we used are polysome stabilizers, it is possible
that they act by eliciting a build-up of ribosomes on ptc-bearing RNAs,
thus shielding these mRNAs from ribonuclease attack. This is unlikely
since the polysome destabilizers puromycin and pactamycin,
which generate naked ribosome-free transcripts, also induced
ptc-bearing TCR- transcripts in HeLa cells (Fig. 6) and
T-cells(35) . Interestingly, puromycin is known to cause
premature termination of protein synthesis, yet like the other
metabolic inhibitors we used, it induced the accumulation of
ptc-bearing mRNAs. This suggests that the act of premature
translational termination is not sufficient to trigger the
down-regulatory response. Instead, recognition of a nonsense codon is
critical to engage the down-regulatory mechanism. A second possible
mechanism by which protein synthesis inhibitors reverse the
down-regulatory response may be by preventing the translation of an
unstable protein critical for the down-regulatory response. Since
ptc-mediated down-regulation appears to involve the nucleus, an
emerging possibility is that this response may not be mediated by a
classical ribosome. An unstable protein(s) may be an essential
component of this putative nonclassical ribosome. Alternatively, an
unstable protein could be involved in putative ptc-mediated signaling
events(19) , or it could mediate the degradation of ptc-bearing
mRNAs. Our observation that ptc-bearing mRNAs are induced within 30 min
after CHX treatment suggests that the half-life of such a labile
protein would be relatively short. Evidence suggests that a labile
protein also regulates the half-life of wild type c-fos transcripts(52) , although other evidence suggests that
the rate of c-fos mRNA decay is regulated by other
factors(53) . The nature of the labile proteins that may
mediate the decay of unstable normal mRNAs (such as as c-fos)
and aberrant mRNAs containing premature nonsense codons remains to be
determined. The use of various drugs to inhibit protein synthesis
allowed us to determine that de novo protein synthesis is
necessary for ptc-mediated degradation. However, their use does not
address the question of whether a cytoplasmic ribosome or a nuclear
ribosome-like entity is involved in this regulation, since these drugs
can accumulate in the nucleus as well as the cytoplasm. To address this
question, we chose to use the polio virus, since it replicates in the
cytoplasm of infected cells and selectively inhibits cytoplasmic
translation by cleaving a protein that is a component of one of the
initiation factors necessary for cap-dependent
translation(47) . Infection with polio virus resulted in an
increase in the levels of ptc-containing TCR- transcripts (Fig. 7). This result supports the notion that cytoplasmic ribosomes are involved in this mechanism. Hence, polio virus
infection could be preventing ribosomal recognition of ptcs in the
cytoplasm. Alternatively, polio virus may prevent the cytoplasmic
translation of an unstable protein destined for either the nucleus or
the cytoplasm that is necessary for ptc-mediated mRNA decay. One caveat
with interpreting this data is that since polio virus affects many host
processes(48) , it is possible that the reversal of the
down-regulatory response elicited by polio virus may be due to one of
its other activities. Although CHX strongly induced ptc-bearing
TCR- mRNAs in stably transfected SL12.4 (Fig. 1Fig. 2Fig. 3Fig. 4) and HeLa cells (Fig. 5, A-C), CHX was a weak inducer in transiently
transfected HeLa cells (Fig. 5D). Thus, it appears that
ptc-bearing TCR- transcripts are not efficiently rescued by
protein synthesis inhibitors in transiently transfected cells. Possible
explanations for this result include: (i) the declining rate of
transcription from DNA templates two days after transient transfection
may preclude significant increases in mRNA levels when protein
synthesis inhibitors are added at this time; (ii) the high level of
mRNAs transcribed from the large number of transiently transfected DNA
templates (in the small percentage of cells that efficiently
incorporate the exogenous DNA) may overwhelm the putative alternative
pathway for nuclear mRNA transport used when the ptc-scanning pathway
is blocked by protein synthesis inhibitors; (iii) the nonchromosomally
integrated DNA generated by transient transfection may be localized
inappropriately for the transcribed RNA to be efficiently exported from
the nucleus when the ptc-scanning pathway is blocked. The level of
down-regulation triggered by ptcs appears to vary depending on the
gene. For example, TCR and Ig transcripts display a decrease in mRNA
levels of 10-100-fold in response to ptcs ( (7, 8, 9, 10) and herein), while
fully spliced triose-phosphate isomerase, v-src, and minute
virus of mice transcripts are down-regulated by only 3-4-fold by
the presence of
ptcs(11, 14, 15, 24) . The basis for
this difference is not known. Ptc-bearing TCR and Ig genes are
generated as a part of normal lymphoid ontogeny, and thus it is
possible that these genes have evolved cis-acting elements that improve
their ability to be regulated by the ptc-mediated mRNA decay pathway.
Since the rapid decay of some ptc-bearing mammalian transcripts appears
to require
introns(14, 15, 16, 17, 18, 19, 20, 21) ,
it is conceivable that splicing efficiency could influence the level of
down-regulation induced by ptcs. TCR transcripts exhibit inefficient
splicing (34) and thus may be localized to the nucleus for
sufficient lengths of time to permit stringent scanning for ptcs. Chromosomal context may be important for maximal down-regulation of
ptc-bearing transcripts. The out-of-frame
V J C gene in
SL12.4 cells gave rise to almost undetectable levels of mature
transcripts; levels were induced by >50-fold after CHX treatment ( (33, 34, 35) and herein, Fig. 4). In
contrast, transfected out-of-frame TCR- genes that presumably
integrated at nonhomologous sites gave rise to mature mRNAs that were
expressed at low-to-moderate levels and induced only 10-20-fold
by CHX (Fig. 1Fig. 2Fig. 3). Similarly, it has
been shown that endogenous out-of-frame Ig genes are expressed at
almost undetectable levels (up to 100-fold less than in-frame genes),
while transfected out-of-frame Ig genes are less dramatically
down-regulated(7, 8, 9, 10) . The
presence of ptcs depressed dihydrofolate reductase mRNA levels by
5-20-fold when the mRNA was derived from the endogenous gene, but
not at all when the mRNA was derived from stably transfected
dihydrofolate reductase genomic clones(12) . More recent
experiments suggest that the promoter dictates whether the
down-regulatory response is engaged: the -globin and
cytomegalovirus immediate-early promoters permitted regulation, whereas
the HSV tk promoter did not(17) . Taken together, these results
suggest that nuclear context may strongly influence the down-regulatory
mechanism engaged by ptcs. The TCR- gene is a useful model for
studying the molecular mechanism underlying this down-regulatory
network, since: (i) the TCR- gene acquires mutant nonsense codons
during normal development; (ii) its expression is efficiently
suppressed by premature nonsense codons; and (iii) this regulation can
be manipulated by treatment with protein synthesis inhibitors.
FOOTNOTES
- *
- This work was supported by Grants GM39586 and T32
ML07781 from the National Institutes of Health. The costs of
publication of this article were defrayed in part by the payment of
page charges. This article must therefore by hereby marked
``advertisement'' in accordance with 18 U.S.C.
Section 1734 solely to indicate this fact.
- §
- To whom correspondence should be addressed:
University of Texas M. D. Anderson Cancer Center, Immunology Dept., Box
180, 1515 Holcombe Blvd., Houston, TX 77030. Tel.: 713-794-5526; Fax:
713-745-0846; miles_wilkinson@isqm.mda.uth.tmc.edu.
- (
) - The abbreviations used are: TCR, T-cell
receptor; V, variable; J, joining; D, diversity; CHX, cycloheximide;
Ig, immunoglobulin; ptc(s), premature termination codon(s); PCR,
polymerase chain reaction; kb, kilobase.
- (
) - M. S.
Carter and M. F. Wilkinson, manuscript in preparation.
ACKNOWLEDGEMENTS
We thank Nahum Sonenberg for his kind gift of the
polio virus. We appreciate the help and advice of Anna Sasaki and Lian
Qian and the technical support of Minh Vu.
REFERENCES
- Hood, L., Kronenberg, M., and Hunkapiller, T. (1985) Cell 40, 225-229
[CrossRef][Medline]
[Order article via Infotrieve]
- Kronenberg, M., Siu, G., Hood, L. E., and Shastri, N. (1986) Annu. Rev. Immunol. 4, 529-591
[CrossRef][Medline]
[Order article via Infotrieve]
- Behlke, M. A., Spinella, D. G., Chou, H. S., Sha, W., Hartl, D. L., and Loh, D. Y. (1985) Science 229, 566-570
[Abstract/Free Full Text]
- Barth, R. K., Kim, B. S., Lan, N. C., Hunkapiller, T., Sobieck, N., Winoto, A., Gershenfeld, H., Okada, C., Hansburg, D., Weissman, I. L., and Hood, L. (1985) Nature 316, 517-523
[CrossRef][Medline]
[Order article via Infotrieve]
- Singer, P. A., McEvilly, R. J., Noonan, D. J., Dixon, F. J., and Theofilopoulos, A. N. (1986) Proc. Natl. Acad. Sci. U. S. A. 83, 7018-7022
[Abstract/Free Full Text]
- Tuaillon, N., Taylor, L. D., Lonberg, N., Tucker, P. W., and Capra, J. D. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3720-3724
[Abstract/Free Full Text]
- Baumann, B., Potash, M. J., and Kohler, G. (1985) EMBO J. 4, 351-359
[Medline]
[Order article via Infotrieve]
- Jack, H., Berg, J., and Wabl, M. (1989) Eur. J. Immunol. 19, 843-847
[Medline]
[Order article via Infotrieve]
- Lozano, F., Maertzdorf, B., Pannell, R., and Milstein, C. (1994) EMBO J. 13, 4617-4622
[Medline]
[Order article via Infotrieve]
- Connor, A., Wiersma, E., and Shulman, M. J. (1994) J. Biol. Chem. 269, 25178-25184
[Abstract/Free Full Text]
- Daar, I. O., and Maquat, L. E. (1988) Mol. Cell. Biol. 8, 802-813
[Abstract/Free Full Text]
- Urlaub, G., Mitchell, P. J., Ciudad, C. J., and Chasin, L. A. (1989) Mol. Cell. Biol. 9, 2868-2880
[Abstract/Free Full Text]
- Chorney, M. J., Sawada, I., Gillespie, G. A., Srivastava, R., Pan, J., and Weissman, S. M. (1990) Mol. Cell. Biol. 10, 243-253
[Abstract/Free Full Text]
- Cheng, J., Fogel-Petrovic, M., and Maquat, L. E. (1990) Mol. Cell. Biol. 10, 5215-5225
[Abstract/Free Full Text]
- Naeger, L. K., Schoborg, R. V., Zhao, Q., Tullis, G. E., and Pintel, D. J. (1992) Genes & Dev. 6, 1107-1119
- Baserga, S. J., and Benz, E. J., Jr. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 2935-2939
[Abstract/Free Full Text]
- Enssle, J., Kugler, W., Hentze, M. W., and Kulozik, A. E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10091-10095
[Abstract/Free Full Text]
- Belgrader, P., Cheng, J., and Maquat, L. E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 482-486
[Abstract/Free Full Text]
- Cheng, J., and Maquat, L. E. (1993) Mol. Cell. Biol. 13, 1892-1902
[Abstract/Free Full Text]
- Belgrader, P., Cheng, J., Zhou, X., Stephenson, L. S., and Maquat, L. E. (1994) Mol. Cell. Biol. 14, 8219-8228
[Abstract/Free Full Text]
- Cheng, J., Belgrader, P., Zhou, X., and Maquat, L. E. (1994) Mol. Cell. Biol. 14, 6317-6325
[Abstract/Free Full Text]
- Barker, G. F., and Beemon, K. (1994) Mol. Cell. Biol. 14, 1986-1996
[Abstract/Free Full Text]
- Belgrader, P., and Maquat, L. E. (1994) Mol. Cell. Biol. 14, 6326-6336
[Abstract/Free Full Text]
- Simpson, S. B., and Stoltzfus, C. M. (1994) Mol. Cell. Biol. 14, 1835-1844
[Abstract/Free Full Text]
- Menon, K. P., and Neufeld, E. F. (1994) Cell. Mol. Biol. 40, 999-1005
- Kugler, W., Enssle, J., Hentze, M. W., and Kulozik, A. E. (1995) Nucleic Acids Res. 23, 413-418
[Abstract/Free Full Text]
- Maquat, L. E. (1995) RNA 1, 453-465
[Abstract]
- Leeds, P., Peltz, S. W., Jacobson, A., and Culbertson, M. R. (1991) Genes & Dev. 5, 2303-2314
- Pulak, R., and Anderson, P. (1993) Genes & Dev. 7, 1885-1897
- Peltz, S. W., He, F., Welch, E., and Jacobson, A. (1994) Prog. Nucleic Acids Res. Mol. Biol. 47, 271-298
[Medline]
[Order article via Infotrieve]
- Cui, Y., Hagan, K. W., Zhang, S., and Peltz, S. W. (1995) Genes & Dev. 9, 423-436
- He, F., and Jacobson, A. (1995) Genes & Dev. 9, 437-454
- Wilkinson, M. F., and MacLeod, C. L. (1988) EMBO J. 7, 101-109
[Medline]
[Order article via Infotrieve]
- Qian, L., Theodor, L., Carter, M., Vu, M. N., Sasaki, A. W., and Wilkinson, M. F. (1993) Mol. Cell. Biol. 13, 1686-1696
[Abstract/Free Full Text]
- Qian, L., Vu, M. N., Carter, M. S., Doskow, J., and Wilkinson, M. F. (1993) J. Immunol. 151, 6801-6814
[Abstract]
- Wilkinson, M. F., and MacLeod, C. L. (1988) Eur. J. Immunol. 18, 873-879
[Medline]
[Order article via Infotrieve]
- Kriegler, M. P. (1990) in Gene Transfer and Expression: A Laboratory Manual , pp. 96-98, Stockon, New York
- Wilkinson, M., Doskow, J., and Lindsey, S. (1990) Nucleic Acids Res. 19, 679
[Free Full Text]
- Harpold, M. M., Evans, R. M., Salditt-Georgleff, M., and Darnell, J. E., Jr. (1979) Cell 17, 1025-1035
[CrossRef][Medline]
[Order article via Infotrieve]
- Chou, H. S., Anderson, S. J., Louie, M. C., Godambe, S. A., Pozzi, M. R., Behlke, M. A., Huppi, K., and Loh, D. Y. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 1992-1996
[Abstract/Free Full Text]
- Gascoigne, N. R. J., Chien, Y., Becker, D. M., Kavaler, J., and Davis, M. M. (1984) Nature 310, 387-391
[CrossRef][Medline]
[Order article via Infotrieve]
- Krainer, A. R., Maniatis, T., Ruskin, B., and Green, M. R. (1984) Cell 36, 993-1005
[CrossRef][Medline]
[Order article via Infotrieve]
- Gunning, P., Leavitt, J., Muscat, G., Ng, S., and Kedes, L. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 4831-4835
[Abstract/Free Full Text]
- Mallick, C. A., Dudley, E. C., Viney, J. L., Owen, M. J., and Hayday, A. C. (1993) Cell 73, 513-519
[CrossRef][Medline]
[Order article via Infotrieve]
- MacLeod, C. L., Hays, E. F., Hyman, R., and Bourgeois, S. (1984) Cancer Res. 44, 1784-1790
[Abstract/Free Full Text]
- Lee, N. E., and Davis, M. M. (1988) J. Immunol. 140, 1665-1695
[Abstract]
- Etchinson, D., Milburn, S. C., Edery, I., Sonenberg, N., and Hershey, J. W. B. (1982) J. Biol. Chem. 257, 14806-14810
[Abstract/Free Full Text]
- Fields, B. N., and Knipe, D. M. (1991) Fundamental Virology , 2nd Ed., pp. 409-450, Raven Press, New York
- Hershowitz, I. (1987) Nature 329, 219-222
[CrossRef][Medline]
[Order article via Infotrieve]
- Gascoigne, N. R. J. (1990) J. Biol. Chem. 265, 9296-9301
[Abstract/Free Full Text]
- Hawkins, J. D. (1988) Nucleic Acids Res. 16, 9893-9908
[Abstract/Free Full Text]
- Koeller, D. M., Horowitz, J. A., Casey, J. L., Klausner, R. D., and Harford, J. B. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 7778-7782
[Abstract/Free Full Text]
- Winstall, E., Gamache, M., and Raymond, V. (1995) Mol. Cell. Biol. 15, 3796-3804
[Abstract]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

CiteULike Complore Connotea Del.icio.us Digg Reddit Technorati What's this?
This article has been cited by other articles:

|
 |

|
 |
 
N. Wittkopp, E. Huntzinger, C. Weiler, J. Sauliere, S. Schmidt, M. Sonawane, and E. Izaurralde
Nonsense-Mediated mRNA Decay Effectors Are Essential for Zebrafish Embryonic Development and Survival
Mol. Cell. Biol.,
July 1, 2009;
29(13):
3517 - 3528.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Fukami, G. Nishimura, K. Homma, T. Nagai, K. Hanaki, A. Uematsu, T. Ishii, C. Numakura, H. Sawada, M. Nakacho, et al.
Cytochrome P450 Oxidoreductase Deficiency: Identification and Characterization of Biallelic Mutations and Genotype-Phenotype Correlations in 35 Japanese Patients
J. Clin. Endocrinol. Metab.,
May 1, 2009;
94(5):
1723 - 1731.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yamashita, N. Izumi, I. Kashima, T. Ohnishi, B. Saari, Y. Katsuhata, R. Muramatsu, T. Morita, A. Iwamatsu, T. Hachiya, et al.
SMG-8 and SMG-9, two novel subunits of the SMG-1 complex, regulate remodeling of the mRNA surveillance complex during nonsense-mediated mRNA decay
Genes & Dev.,
May 1, 2009;
23(9):
1091 - 1105.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
H.-R. Song, J.-D. Song, J.-N. Cho, R. M. Amasino, B. Noh, and Y.-S. Noh
The RNA Binding Protein ELF9 Directly Reduces SUPPRESSOR OF OVEREXPRESSION OF CO1 Transcript Levels in Arabidopsis, Possibly via Nonsense-Mediated mRNA Decay
PLANT CELL,
April 1, 2009;
21(4):
1195 - 1211.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. D. Bhalla, J. P. Gudikote, J. Wang, W.-K. Chan, Y.-F. Chang, O. R. Olivas, and M. F. Wilkinson
Nonsense Codons Trigger an RNA Partitioning Shift
J. Biol. Chem.,
February 13, 2009;
284(7):
4062 - 4072.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Moosajee, K. Gregory-Evans, C. D. Ellis, M. C. Seabra, and C. Y. Gregory-Evans
Translational bypass of nonsense mutations in zebrafish rep1, pax2.1 and lamb1 highlights a viable therapeutic option for untreatable genetic eye disease
Hum. Mol. Genet.,
December 15, 2008;
17(24):
3987 - 4000.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. B. Gardner
Hypoxic Inhibition of Nonsense-Mediated RNA Decay Regulates Gene Expression and the Integrated Stress Response
Mol. Cell. Biol.,
June 1, 2008;
28(11):
3729 - 3741.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Weischenfeldt, I. Damgaard, D. Bryder, K. Theilgaard-Monch, L. A. Thoren, F. C. Nielsen, S. E. W. Jacobsen, C. Nerlov, and B. T. Porse
NMD is essential for hematopoietic stem and progenitor cells and for eliminating by-products of programmed DNA rearrangements
Genes & Dev.,
May 15, 2008;
22(10):
1381 - 1396.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Ajamian, L. Abrahamyan, M. Milev, P. V. Ivanov, A. E. Kulozik, N. H. Gehring, and A. J. Mouland
Unexpected roles for UPF1 in HIV-1 RNA metabolism and translation
RNA,
May 1, 2008;
14(5):
914 - 927.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Watatani, K. Ichikawa, N. Nakanishi, M. Fujimoto, H. Takeda, N. Kimura, H. Hirose, S. Takahashi, and Y. Takahashi
Stress-induced Translation of ATF5 mRNA Is Regulated by the 5'-Untranslated Region
J. Biol. Chem.,
February 1, 2008;
283(5):
2543 - 2553.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Shi, Z. Hu, K. Pabon, and K. W. Scotto
Caffeine Regulates Alternative Splicing in a Subset of Cancer-Associated Genes: a Role for SC35
Mol. Cell. Biol.,
January 15, 2008;
28(2):
883 - 895.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Barbier, M. Dutertre, D. Bittencourt, G. Sanchez, L. Gratadou, P. de la Grange, and D. Auboeuf
Regulation of H-ras Splice Variant Expression by Cross Talk between the p53 and Nonsense-Mediated mRNA Decay Pathways
Mol. Cell. Biol.,
October 15, 2007;
27(20):
7315 - 7333.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y.-F. Chang, W.-K. Chan, J. S. Imam, and M. F. Wilkinson
Alternatively Spliced T-cell Receptor Transcripts Are Up-regulated in Response to Disruption of Either Splicing Elements or Reading Frame
J. Biol. Chem.,
October 12, 2007;
282(41):
29738 - 29747.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Sone, T. Hayashi, H. Tarui, K. Agata, M. Takeichi, and S. Nakagawa
The mRNA-like noncoding RNA Gomafu constitutes a novel nuclear domain in a subset of neurons
J. Cell Sci.,
August 1, 2007;
120(15):
2498 - 2506.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Hori and Y. Watanabe
Context Analysis of Termination Codons in mRNA that are Recognized by Plant NMD
Plant Cell Physiol.,
July 1, 2007;
48(7):
1072 - 1078.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. P Meredith, A. J Richards, D. W Flanagan, J. D Scott, A. V Poulson, and M. P Snead
Clinical characterisation and molecular analysis of Wagner syndrome
Br. J. Ophthalmol.,
May 1, 2007;
91(5):
655 - 659.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. H. Mangs, H. J.L. Speirs, C. Goy, D. J. Adams, M. A. Markus, and B. J. Morris
XE7: A novel splicing factor that interacts with ASF/SF2 and ZNF265
Nucleic Acids Res.,
October 18, 2006;
34(17):
4976 - 4986.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. D. Cogan, M. W. Pauciulo, A. P. Batchman, M. A. Prince, I. M. Robbins, L. K. Hedges, K. C. Stanton, L. A. Wheeler, J. A. Phillips III, J. E. Loyd, et al.
High Frequency of BMPR2 Exonic Deletions/Duplications in Familial Pulmonary Arterial Hypertension
Am. J. Respir. Crit. Care Med.,
September 1, 2006;
174(5):
590 - 598.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. T. Hyvonen, A. Uimari, T. A. Keinanen, S. Heikkinen, R. Pellinen, T. Wahlfors, A. Korhonen, A. Narvanen, J. Wahlfors, L. Alhonen, et al.
Polyamine-regulated unproductive splicing and translation of spermidine/spermine N1-acetyltransferase
RNA,
August 1, 2006;
12(8):
1569 - 1582.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Kamhi, G. Yahalom, G. Kass, Y. Hacham, R. Sperling, and J. Sperling
AUG sequences are required to sustain nonsense-codon-mediated suppression of splicing
Nucleic Acids Res.,
July 19, 2006;
34(12):
3421 - 3433.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. Stockklausner, S. Breit, G. Neu-Yilik, N. Echner, M. W. Hentze, A. E. Kulozik, and N. H. Gehring
The uORF-containing thrombopoietin mRNA escapes nonsense-mediated decay (NMD).
Nucleic Acids Res.,
January 1, 2006;
34(8):
2355 - 2363.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. E. WEIL and K. L. BEEMON
A 3' UTR sequence stabilizes termination codons in the unspliced RNA of Rous sarcoma virus
RNA,
January 1, 2006;
12(1):
102 - 110.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Yamanegi, S. Tang, and Z.-M. Zheng
Kaposi's Sarcoma-Associated Herpesvirus K8{beta} Is Derived from a Spliced Intermediate of K8 Pre-mRNA and Antagonizes K8{alpha} (K-bZIP) To Induce p21 and p53 and Blocks K8{alpha}-CDK2 Interaction
J. Virol.,
November 15, 2005;
79(22):
14207 - 14221.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Ferraiuolo, S. Basak, J. Dostie, E. L. Murray, D. R. Schoenberg, and N. Sonenberg
A role for the eIF4E-binding protein 4E-T in P-body formation and mRNA decay
J. Cell Biol.,
September 12, 2005;
170(6):
913 - 924.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Paillusson, N. Hirschi, C. Vallan, C. M. Azzalin, and O. Muhlemann
A GFP-based reporter system to monitor nonsense-mediated mRNA decay
Nucleic Acids Res.,
March 30, 2005;
33(6):
e54 - e54.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. J. Richards, S. Meredith, A. Poulson, P. Bearcroft, G. Crossland, D. M. Baguley, J. D. Scott, and M. P. Snead
A Novel Mutation of COL2A1 Resulting in Dominantly Inherited Rhegmatogenous Retinal Detachment
Invest. Ophthalmol. Vis. Sci.,
February 1, 2005;
46(2):
663 - 668.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. BUHLER and O. MUHLEMANN
Alternative splicing induced by nonsense mutations in the immunoglobulin {micro} VDJ exon is independent of truncation of the open reading frame
RNA,
February 1, 2005;
11(2):
139 - 146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Zhao, Q. Pan-Hammarstrom, Z. Zhao, S. Wen, and L. Hammarstrom
Selective IgG2 deficiency due to a point mutation causing abnormal splicing of the C{gamma}2 gene
Int. Immunol.,
January 1, 2005;
17(1):
95 - 101.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Skandalis and E. Uribe
A survey of splice variants of the human hypoxanthine phosphoribosyl transferase and DNA polymerase beta genes: products of alternative or aberrant splicing?
Nucleic Acids Res.,
December 15, 2004;
32(22):
6557 - 6564.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
C. WACHTEL, B. LI, J. SPERLING, and R. SPERLING
Stop codon-mediated suppression of splicing is a novel nuclear scanning mechanism not affected by elements of protein synthesis and NMD
RNA,
November 18, 2004;
10(11):
1740 - 1750.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Grimson, S. O'Connor, C. L. Newman, and P. Anderson
SMG-1 Is a Phosphatidylinositol Kinase-Related Protein Kinase Required for Nonsense-Mediated mRNA Decay in Caenorhabditis elegans
Mol. Cell. Biol.,
September 1, 2004;
24(17):
7483 - 7490.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. J. LeBlanc and K. L. Beemon
Unspliced Rous Sarcoma Virus Genomic RNAs Are Translated and Subjected to Nonsense-Mediated mRNA Decay before Packaging
J. Virol.,
May 15, 2004;
78(10):
5139 - 5146.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
L. Delpy, C. Sirac, E. Magnoux, S. Duchez, and M. Cogne
RNA surveillance down-regulates expression of nonfunctional {kappa} alleles and detects premature termination within the last {kappa} exon
PNAS,
May 11, 2004;
101(19):
7375 - 7380.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. A. Ferraiuolo, C.-S. Lee, L. W. Ler, J. L. Hsu, M. Costa-Mattioli, M.-J. Luo, R. Reed, and N. Sonenberg
A nuclear translation-like factor eIF4AIII is recruited to the mRNA during splicing and functions in nonsense-mediated decay
PNAS,
March 23, 2004;
101(12):
4118 - 4123.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Zeniou, R. Gattoni, A. Hanauer, and J. Stevenin
Delineation of the mechanisms of aberrant splicing caused by two unusual intronic mutations in the RSK2 gene involved in Coffin-Lowry syndrome
Nucleic Acids Res.,
February 18, 2004;
32(3):
1214 - 1223.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. Ohno, M. Milone, X.-M. Shen, and A. G. Engel
A frameshifting mutation in CHRNE unmasks skipping of the preceding exon
Hum. Mol. Genet.,
December 1, 2003;
12(23):
3055 - 3066.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
F. Pagani, E. Buratti, C. Stuani, and F. E. Baralle
Missense, Nonsense, and Neutral Mutations Define Juxtaposed Regulatory Elements of Splicing in Cystic Fibrosis Transmembrane Regulator Exon 9
J. Biol. Chem.,
July 11, 2003;
278(29):
26580 - 26588.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. K. Lamba, M. Adachi, D. Sun, J. Tammur, E. G. Schuetz, R. Allikmets, and J. D. Schuetz
Nonsense mediated decay downregulates conserved alternatively spliced ABCC4 transcripts bearing nonsense codons
Hum. Mol. Genet.,
January 15, 2003;
12(2):
99 - 109.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
P. Tarugi, G. Ballarini, B. Bembi, C. Battisti, S. Palmeri, F. Panzani, E. Di Leo, C. Martini, A. Federico, and S. Calandra
Niemann-Pick type C disease: mutations of NPC1 gene and evidence of abnormal expression of some mutant alleles in fibroblasts
J. Lipid Res.,
November 1, 2002;
43(11):
1908 - 1919.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. G. Khan, V. Muniz-Medina, T. Shahlavi, C. C. Baker, H. Inui, T. Ueda, S. Emmert, T. D. Schneider, and K. H. Kraemer
The human XPC DNA repair gene: arrangement, splice site information content and influence of a single nucleotide polymorphism in a splice acceptor site on alternative splicing and function
Nucleic Acids Res.,
August 15, 2002;
30(16):
3624 - 3631.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
M. Caputi, R. J. Kendzior Jr., and K. L. Beemon
A nonsense mutation in the fibrillin-1 gene of a Marfan syndrome patient induces NMD and disrupts an exonic splicing enhancer
Genes & Dev.,
July 15, 2002;
16(14):
1754 - 1759.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, J. I. Hamilton, M. S. Carter, S. Li, and M. F. Wilkinson
Alternatively Spliced TCR mRNA Induced by Disruption of Reading Frame
Science,
July 5, 2002;
297(5578):
108 - 110.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. Wang, V. M. Vock, S. Li, O. R. Olivas, and M. F. Wilkinson
A Quality Control Pathway That Down-regulates Aberrant T-cell Receptor (TCR) Transcripts by a Mechanism Requiring UPF2 and Translation
J. Biol. Chem.,
May 17, 2002;
277(21):
18489 - 18493.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
B. Li, C. Wachtel, E. Miriami, G. Yahalom, G. Friedlander, G. Sharon, R. Sperling, and J. Sperling
Stop codons affect 5' splice site selection by surveillance of splicing
PNAS,
April 16, 2002;
99(8):
5277 - 5282.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Brocke, G. Neu-Yilik, N. H. Gehring, M. W. Hentze, and A. E. Kulozik
The human intronless melanocortin 4-receptor gene is NMD insensitive
Hum. Mol. Genet.,
February 1, 2002;
11(3):
331 - 335.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
E. Wagner and J. Lykke-Andersen
mRNA surveillance: the perfect persist
J. Cell Sci.,
January 8, 2002;
115(15):
3033 - 3038.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Y. Watanabe, K. E. Magor, and P. Parham
Exon 5 Encoding the Transmembrane Region of HLA-A Contains a Transitional Region for the Induction of Nonsense-Mediated mRNA Decay
J. Immunol.,
December 15, 2001;
167(12):
6901 - 6911.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Yamashita, T. Ohnishi, I. Kashima, Y. Taya, and S. Ohno
Human SMG-1, a novel phosphatidylinositol 3-kinase-related protein kinase, associates with components of the mRNA surveillance complex and is involved in the regulation of nonsense-mediated mRNA decay
Genes & Dev.,
September 1, 2001;
15(17):
2215 - 2228.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
K. S. Rajavel and E. F. Neufeld
Nonsense-Mediated Decay of Human HEXA mRNA
Mol. Cell. Biol.,
August 15, 2001;
21(16):
5512 - 5519.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
X.-D. Lei, B. Chapman, and O. Hankinson
Loss of CYP1A1 Messenger RNA Expression Due to Nonsense-Mediated Decay
Mol. Pharmacol.,
August 1, 2001;
60(2):
388 - 393.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
J. T. Mendell, S. M. Medghalchi, R. G. Lake, E. N. Noensie, and H. C. Dietz
Novel Upf2p Orthologues Suggest a Functional Link between Translation Initiation and Nonsense Surveillance Complexes
Mol. Cell. Biol.,
December 1, 2000;
20(23):
8944 - 8957.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
L. Romao, A. Inacio, S. Santos, M. Avila, P. Faustino, P. Pacheco, and J. Lavinha
Nonsense mutations in the human beta -globin gene lead to unexpected levels of cytoplasmic mRNA accumulation
Blood,
October 15, 2000;
96(8):
2895 - 2901.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
Q. M. Mitrovich and P. Anderson
Unproductively spliced ribosomal protein mRNAs are natural targets of mRNA surveillance in C. elegans
Genes & Dev.,
September 1, 2000;
14(17):
2173 - 2184.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
P. A. Frischmeyer and HarryC. Dietz
Nonsense-mediated mRNA decayin health and disease
Hum. Mol. Genet.,
September 1, 1999;
8(10):
1893 - 1900.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
D. Chan, S. Freddi, Y. M. Weng, and J. F. Bateman
Interaction of Collagen alpha 1(X) Containing Engineered NC1 Mutations with Normal alpha 1(X) in Vitro. IMPLICATIONS FOR THE MOLECULAR BASIS OF SCHMID METAPHYSEAL CHONDRODYSPLASIA
J. Biol. Chem.,
May 7, 1999;
274(19):
13091 - 13097.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
A. Buzina and M. J. Shulman
Infrequent Translation of a Nonsense Codon Is Sufficient to Decrease mRNA Level
Mol. Biol. Cell,
March 1, 1999;
10(3):
515 - 524.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
J. Zhang, X. Sun, Y. Qian, J. P. LaDuca, and L. E. Maquat
At Least One Intron Is Required for the Nonsense-Mediated Decay of Triosephosphate Isomerase mRNA: a Possible Link between Nuclear Splicing and Cytoplasmic Translation
Mol. Cell. Biol.,
September 1, 1998;
18(9):
5272 - 5283.
[Abstract]
[Full Text]
|
 |
|

|
 |

|
 |
 
X. Sun, H. A. Perlick, H. C. Dietz, and L. E. Maquat
A mutated human homologue to yeast Upf1 protein has a dominant-negative effect on the decay of nonsensecontaining mRNAs in mammalian cells
PNAS,
August 18, 1998;
95(17):
10009 - 10014.
[Abstract]
[Full Text]
[PDF]
|
 |
|

|
 |

|
 |
 
S. Li, D. Leonard, and M. F. Wilkinson
T Cell Receptor (TCR) Mini-Gene mRNA Expression Regulated by Nonsense Codons: A Nuclear-associated Translation-like Mechanism
J. Exp. Med.,
March 17, 1997;
185(6):
985 - 992.
[Abstract]
[Full Text]
[PDF]
|
 |
|
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
|
Advertisement
Advertisement
|