Cloning of a Human Receptor of the NPY Receptor Family with High Affinity for Pancreatic Polypeptide and Peptide YY

doi:10.1074/jbc.270.49.29123

HOME

HELP

FEEDBACK

SUBSCRIPTIONS

Volume 270, Number 49, Issue of December 8, 1995 pp. 29123-29128
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Cloning of a Human Receptor of the NPY Receptor Family with High Affinity for Pancreatic Polypeptide and Peptide YY (*)

(Received for publication, June 14, 1995; and in revised form, September 7, 1995)

Ingrid Lundell , Anders G. Blomqvist (§), , Magnus M. Berglund , Douglas A. Schober (1), Dwayne Johnson (1), Michael A. Statnick (1), Robert A. Gadski (1), Donald R. Gehlert (1), Dan Larhammar (¶)

From the Department of Medical Pharmacology, Uppsala University, Box 593, S-751 24 Uppsala, Sweden and Lilly Research Laboratories, Eli Lilly and Company, Lilly Corporate Center, Indianapolis, Indiana 46285

ABSTRACT

INTRODUCTION

EXPERIMENTAL PROCEDURES

RESULTS

DISCUSSION

FOOTNOTES

ACKNOWLEDGEMENTS

REFERENCES

ABSTRACT

Neuropeptide Y (NPY), peptide YY (PYY), and pancreatic polypeptide (PP) are structurally related peptides found in all higher vertebrates. NPY is expressed exclusively in neurons, whereas PYY and PP are produced primarily in gut endocrine cells. Several receptor subtypes have been identified pharmacologically, but only the NPY/PYY receptor of subtype Y1 has been cloned. This is a heptahelix receptor that couples to G proteins. We utilized Y1 sequence information from several species to clone a novel human receptor with 43% amino acid sequence identity to human Y1 and 53% identity in the transmembrane regions. The novel receptor displays a pharmacological profile that distinguishes it from all previously described NPY family receptors. It binds PP with an affinity (K) of 13.8 pM, PYY with 1.44 nM, and NPY with 9.9 nM. Because these data may identify the receptor as primarily a PP receptor, we have named it PP1. In stably transfected Chinese hamster ovary cells the PP1 receptor inhibits forskolin-stimulated cAMP synthesis. Northern hybridization detected mRNA in colon, small intestine, pancreas, and prostate. As all three peptides are present in the gut through either endocrine release or innervation, all three peptides may be physiological ligands to the novel NPY family receptor PP1.

INTRODUCTION

Pancreatic polypeptide (PP) ()forms a family of 36-amino acid peptides together with neuropeptide Y (NPY) and peptide YY (PYY) (Larhammar et al., 1993). PP was the first of these to be discovered (Kimmel et al., 1968), but in evolutionary terms it seems to be the most recent member and probably arose by duplication of the PYY gene in early tetrapods (Larhammar et al., 1993). PP is exclusively localized to subsets of endocrine cells in the pancreas and inhibits pancreatic secretion, gall bladder contraction, and gut motility (see Hazelwood (1993) for review). PYY is expressed in PP cells and in somatostatin cells (Böttcher et al., 1993; Upchurch et al., 1994) as well as in endocrine cells of the large intestine (El-Salhy et al., 1983; Lundberg et al., 1982), has similar actions to PP, and, in addition, redistributes blood flow in gut vessels (see Laburthe(1990) for review). Both peptides are released into the circulation in response to a meal (see Hazelwood(1993)). In contrast, NPY is present in the central nervous system but is involved in gastrointestinal function through potent induction of feeding in the hypothalamus.

The NPY family peptides exert their actions via heptahelix (seven-transmembrane region) receptors coupled to G-proteins. Several receptor subtypes have been defined by their ability to bind NPY, PYY, PP, and derivatives of these peptides (Gehlert, 1994). Both NPY and PYY bind to the Y1 and Y2 receptors, while the Y3 receptor binds only NPY. The hypothalamic feeding receptor seems to be distinct from all of these (see Gehlert(1994)). An additional receptor has been described that displays a preference for PYY over NPY and is found in the rat small intestine (Laburthe et al., 1986) and in dog adipocytes (Castan et al., 1992), where it mediates reduction of lipolysis. PP does not bind to any of these subtypes but seems to have a unique receptor in dog intestinal mucosa (Gilbert et al., 1988; Gilbert et al., 1986), rat phaeochromocytoma PC12 cells (Schwartz et al., 1987), and rat adrenal cortex and medulla (Whitcomb et al., 1992) as well as in rat vas deferens (Jørgensen et al., 1990) and rat brain area postrema (Whitcomb et al., 1990). Finally, there is a PP-fold-recognizing receptor located in the distal colon in rabbit (Ballantyne et al., 1993) that binds all three peptides. While the discovery of selective peptide agonists has allowed a preliminary receptor classification, the lack of specific receptor antagonists has made functional studies difficult. For instance, it is unclear which receptor mediates the feeding induction reported for human PP in rats (Clark et al., 1984) and dogs (Inui et al., 1991).

To date only the Y1 receptor has been cloned. Cloning of additional receptor subtypes would be helpful to determine their preferences for the three endogenous peptides and to distinguish their physiological roles. The object of the present investigation was to isolate DNA clones encoding additional members of the NPY receptor subfamily. For this purpose we designed degenerate PCR primers based upon the Y1 receptor sequences from human (Herzog et al., 1992; Larhammar et al., 1992), rat (Eva et al., 1990), mouse (Eva et al., 1992), and Xenopus laevis (Blomqvist et al., 1995). This approach allowed the cloning of a human receptor that has a higher degree of amino acid sequence identity to the Y1 receptor than to other heptahelix receptors. We also describe functional expression of this receptor to identify it as a PP-preferring receptor, hence named PP1.

EXPERIMENTAL PROCEDURES

Generation of a Rat Y1-like Clone by PCR

Degenerate primers were used in different pairwise combinations for PCR on rat genomic DNA using the following conditions: 5 min at 99 °C for one cycle and then 1 min at 94 °C, 2 min at 42 °C, and 3 min at 72 °C for 25 cycles using Taq polymerase. The product of one primer combination was subcloned. The 5` primer was a 29-mer with the sequence CGG GAT CCT A(C/T)A CI(C/T) T(G/A/T/C)A TGG A(C/T)C A(C/T)T GG corresponding to a BamHI cloning site and positions 362-382 in TM2 of the rat Y1 sequence (GenBank accession code Z11504). The 3` primer had the sequence CGG GAT CCC C(A/G)T A(A/G)A A(G/A/T)A TIG G(G/A)T T(G/A/T/C)A C(A/G)C A corresponding to a BamHI site and positions 1004-1026 in TM7. The PCR product was separated on an agarose gel, and a band corresponding to 670 base pairs was cut out, added to 500 µl of water, boiled for 5 min, and reamplified for 1 min at 94 °C, 2 min at 42 °C, and 2 min at 72 °C for 25 cycles. An aliquot of the generated product was ligated to 25 ng of the plasmid vector pT7Blue (Novagen) with T4 DNA ligase (U.S. Biochemical Corp.) and transformed into E. coli DH5 alpha

cells. One clone called R4-7, containing an insert of the expected size, was obtained and characterized further.

Sequencing of the Rat PCR Product

Sequence determinations were performed with dideoxy chain termination in an automated flourescent dye DNA sequencer (Applied Biosystems Inc.) or manually using [ alpha

S]dATP followed by autoradiography. Primers JS1 and JS2 of nucleotide sequence GAGCGGATAACAATTTCACACAGG and GCCAGGGTTTTCCCAGTCACGACGA were used for the ABI sequencing. For manual sequencing either a T7 primer or a M13 forward primer were used.

Generation of a PCR Probe for Screening of Library

A PCR product was generated with the rat clone R4-7 as a template and using the same degenerate primers as described previously using the following conditions: 1 min at 94 °C, 1 min at 55 °C and 2 min at 72 °C for 25 cycles. The product was labeled with [ alpha

P]dCTP by the random priming method (Pharmacia Oligo Labeling kit).

Screening of a Human Genomic Library

A human genomic library made from lymphocytes in the vector lambda DASH

(Stratagene) was plated out with Escherichia coli LE392 as bacterial host strain. Approximately 600,000 plaques were lifted with nylon membranes, and hybridization was done with the rat probe for 16 h with high stringency at 65 °C in 25% formamide, 6 times

SSC, 10% Dextran sulfate, 5 times

Denhardt's solution, and 0.1% SDS. Filters were washed twice at room temperature in 2 times

SSC, 0.1% SDS and twice for 30 min at 65 °C in 0.2 times

SSC, 0.1% SDS. Screenings were carried out in three consecutive steps to obtain single plaques. Six individual clones were selected.

Phage Clone Characterization

Phage DNA was digested with various restriction enzymes and run on agarose gel. The gel was denatured and blotted onto a nylon membrane that was hybridized as described above with the rat probe. The six phage clones were found to be nonidentical but contained the same hybridizing region as shown by identical restriction sites. Hybridizing fragments from different phages were identified and cloned into the plasmid vector Bluescript KS

. A restriction map was constructed for overlapping hybridizing plasmid inserts.

Sequencing of the Human Y1-like Gene

Sequencing was carried out as described above. Several different plasmid clones from two different phage clones were sequenced. One plasmid clone, Hubert (from phage gH2), containing a 1.45-kb PvuII fragment cloned into the SmaI site of Bluescript KS+, was found to contain the entire coding region. From this clone a StyI-BamHI deletion subclone of 750 base pairs was generated for further sequencing.

Southern Hybridization

Genomic DNA was purified from human leucocytes and digested with restriction enzymes. The probe was a PCR-generated fragment corresponding to the entire coding region of the clone Hubert. Hybridization and washes were done at high stringency.

Northern Hybridization

Northern membrane containing mRNA from different human organs and brain regions was purchased from Clontech. The membranes were prehybridized for 4 h at 42 °C in 5 times

SSPE, 10

Denhardt's solution, 100 µg/ml scheared salmon sperm DNA, 50% formamide, and 2% SDS. This was followed by hybridization overnight at 42 °C in the same buffer containing 2 times

cpm of a nick-translated (Life Technologies, Inc.) 1.2-kb fragment containing the entire coding region of the clone Hubert. The membranes were washed three times for 10 min each at room temperature (2 times

SSC, 0.05% SDS). This was followed by a 40-minute wash at 50 °C (0.1 times

SSC, 0.1% SDS) with one change of solution. The blots were then visualized using a PhosphorImager (Molecular Dynamics, Sunnyvale, CA).

Cloning into Expression Vector

As no suitable restriction sites were available flanking the receptor gene for cloning into the expression vector, two oligonucleotides were used as PCR primers to generate a fragment containing the entire coding region. The 5` primer contained a HindIII cloning site and had the sequence CCG GGA AGC TTC CCG CGT CAT CCC TCA AGT GTA TC, and the 3` primer had an EcoRI cloning site and the sequence CGG AAT TCC GGC AAG GGA CAT GGC AGG GAG. The PCR was run with Vent DNA polymerase (Biolabs) and the clone Hubert as a template under the following conditions: 1 min at 94 °C, 1 min at 50 °C, and 2 min at 72 °C for 25 cycles. An aliquot of the PCR reaction was separated on an agarose gel and displayed the expected product of 1.25 kb. The remainder of the reaction was phenol-extracted and cut with HindIII-EcoRI, and the fragment was purified on an agarose gel and ligated into the expression vector pTEJ-8 (Johansen et al., 1990) to give the clone Hubert-pTEJ. This clone was completely sequenced to ascertain identity to the genomic clone.

Transient Transfection Protocol

COS1 African green monkey kidney cells (COS-1) were seeded at a density of 1 times

cells/150-mm dish and incubated for 48 h at 37 °C. Each dish was transfected with 600 µl of Lipofectace (Life Technologies, Inc.) containing 25 µg of Hubert-pTEJ according to kit protocol. Cells plus DNA/Lipofectace mixture were incubated for 6 h. Cells were harvested in PBS 48 h after transfection and pelleted by centrifugation.

Binding Assays

The homogenate binding studies were conducted as described previously (Gehlert et al., 1992). Cell pellets were resuspended using a glass homogenizer in 25 mM HEPES (pH 7.4) buffer containing 2.5 mM CaCl (2)

, 1 mM MgCl (2)

, and 2 g/liter Bacitracin. Saturation experiments were performed in a final volume of 200 µl containing various concentrations of

I-pPYY (SA 2200 Ci/mmol, DuPont NEN) and 5-10 µg of protein for 2 h at room temperature. Nonspecific binding was defined as the amount of radioactivity remaining bound to the cell homogenate after incubation in the presence of 1 µM unlabeled human PP (hPP). In competition studies, various concentrations of the peptides (hPP, hPYY, hNPY, porcine [Leu

-Pro

]NPY, porcine NPY2-36, and porcine NPY13-36) (Peninsula, Belmont, CA, or Bachem, King of Prussia, PA) were included in the incubation mixture along with

I-pPYY. Incubations were terminated by rapid filtration through GF/C filters (Wallac, Gaithersburg, MD), which had been presoaked in 0.3% polyethyleneimine (Sigma), using a TOMTEC (Orange, CT) cell harvester. The filters were washed with 5 ml of 50 mM Tris (pH 7.4) at 4 °C and rapidly dried at 60 °C. The dried filters were treated with MeltiLex A (Wallac) and melt-on scintillator sheets, and the radioactivity retained on the filters was counted using the Wallac 1205 Betaplate counter. The results were analyzed using the Prism software package (Graphpad, San Diego, CA) or the Cheng-Prushoff equation. Protein concentrations were measured using Coomassie Protein Assay Reagent (Pierce) with bovine serum albumin for standards.

cAMP Assay

A cell line with stable PP1 expression was obtained by transfection of Chinese hamster ovary cells with Hubert-pTEJ. cAMP was assayed in whole cells treated for 20 min at 37 °C with 100 µM isobutylmethylxanthine. Cells were incubated with 15 µM forskolin and various concentrations of hPP, hPYY, and hNPY for 15 min at 37 °C. Reactions were terminated by the addition of EDTA to 0.4 µM and heating in a boiling water bath for 4 min. Sample buffer containing cAMP was removed and lyophilized. cAMP was quantitated using radioimmunoassay (Amersham Corp.). Protein content of each well was measured using the Coomassie Protein Assay Reagent (Pierce) with bovine serum albumin as the standard.

RESULTS

Isolation of a Y1-related Rat PCR Product

To generate primers for PCR, we analyzed the sequences for the Y1 receptor from several species. Several degenerate primers were designed and used for PCR on rat genomic DNA. Two of the primers corresponding to TM2 and TM7 generated a product of the expected size. The fragment was cloned; one clone was sequenced and found to have higher sequence identity to the Y1 receptor than to all other receptor sequences.

Isolation of a Full-length Human Homologue

A human genomic library was screened under conditions of high stringency with the rat PCR product as a probe. Many clones hybridized, and six of the most strongly hybridizing ones were analyzed further. Five nonidentical clones contained the same hybridizing fragments in a Southern blot, while the sixth clone had a hybridization pattern indicating that it was truncated near the hybridizing segment but contained the same gene as the other five. Fragments of appropriate sizes were subcloned, and a restriction map was constructed. The subclone Hubert of 1.45 kb was found by sequencing to contain the entire coding region of a receptor with high identity to the rat PCR product. This clone encodes a heptahelix (7-TM) receptor of 375 amino acids (Fig. 1). It has greater amino acid sequence identity to the Y1 receptors (Fig. 2) than to any other receptor with 53% identity in the transmembrane regions and 43% overall identity. The closest non-Y1 receptor is the dog gastrin receptor (Kopin et al., 1992) with an overall identity of about 30% (Fig. 2). The novel receptor gene lacks the intron immediately after TM5 that is present in the Y1 receptor genes in all four species characterized to date. The nucleotide sequence identity to the human Y1 sequence is 58%.

Figure 1: Nucleotide sequence and deduced amino acid sequence of the human PP1 receptor gene. The predominantly hydrophobic segments assumed to penetrate the cell membrane are underlined with dotted lines. Four potential sites for N-linked glycosylation are underlined, three in the amino-terminal part and one in extracellular loop 2.

Figure 2: Amino acid sequence alignment. The human PP1 receptor serves as master sequence in alignment with the human Y1 receptor (Larhammar et al., 1992) and the dog gastrin receptor (Kopin et al., 1992). In the two latter sequences only positions that differ from the PP1 sequence are shown, while dots mean identities. Dashes represent gaps introduced to optimize alignment. The hydrophobic segments assumed to be embedded in the cell membrane are underlined. Four tripeptides in extracellular parts underlined with dotted lines conform to the consensus sequence for N-linked glycosylation. Diamonds show four extracellular cysteines and one intracellular cysteine.

The receptor protein deduced from the nucleotide sequence displays many of the characteristic features of heptahelix receptors ( Fig. 1and Fig. 2). The amino terminus has three potential glycosylation sites, and a fourth is present in the second extracellular loop (as in the Y1 receptor). Four extracellular cysteines, one in the amino-terminal region and one in each of the three extracellular loops, presumably form two disulfide bridges (again like the Y1 receptor). A cysteine in the cytoplasmic tail probably serves as an attachment site for palmitate inserted into the cell membrane.

The sequence similarity to Y1 is most prominent in the transmembrane regions, but the loops also show blocks of resemblance. The sequenced portion of the gene extends 180 base pairs beyond the termination codon, but no polyadenylylation signal was found in agreement with the large size of the mRNA (see below).