![]()
|
|
||||||||
(Received for publication, July 7,
1995; and in revised form, September 7, 1995) From the
Asp-229, Glu-257, and Asp-328 constitute the catalytic residues
in cyclodextrin glycosyl transferase from Bacillus circulans strain 251. Via site-directed mutagenesis constructed D229N,
E257Q, and D328N mutant proteins showed a 4,000-60,000-fold
reduction of cyclization activity. A D229N/E257Q double mutant showed a
700,000-fold reduction and was crystallized for use in soaking
experiments with
Cyclodextrin glycosyltransferases (CGTases; E.C. 2.4.1.19) are
monomeric bacterial enzymes that catalyze the conversion of starch into
cyclic or linear Recently, we
reported the nucleotide sequence and crystal structure at 2.0 Å
resolution of this CGTase (2) and its complex with the
inhibitor acarbose(3) . The enzyme consists of 686 amino acids
grouped in five distinct domains, labeled A through E. Domains A, B,
and C are structurally homologous to the equivalent domains of
Although
the crystallization at pH 7.55 of CGTase from B. circulans strain 251 requires the presence of
For the soaking experiments with The double mutant and unliganded native enzyme crystals
were flash frozen to 120 °K using 2-methyl 2,4-pentanediol as
cryoprotectant (19) in order to reduce any residual catalytic
activity and to limit radiation damage. The other two data sets (Table 1) were recorded at room temperature. All data were
obtained from a single crystal per data set on an Enraf Nonius FAST
area detector system mounted on an Elliot GX21 rotating anode generator
as the x-ray source. Data collection and processing was done with
MADNES (20) with profile fitting of the intensities according
to Kabsch(21) . A summary of data collection statistics is
listed in Table 1.
During and
after completion of the refinement, the final models were analyzed with
the PROCHECK package (28) and the program OOPS(29) .
Models for CGTase complexed with maltotetraose and
Figure 1:
pH optima for the wild-type and active
site mutants D229N, E257Q, and D328N of B. circulans strain
251 CGTase. In A the pH profile of wild-type CGTase is shown.
Ramachandran plots (31) of CGTase with bound oligosaccharides are virtually
identical to that of native CGTase(2) . Comparison of native
and complexed structures yields r.m.s. differences in C After completion of the refinement it appeared that the soaking
experiments with
Figure 2:
Stereo views of the electron density
observed for bound maltotetraose in the active site of CGTase. Shown
are the maltotetraose molecules in the structures of CGTase (A) soaked with
Figure 3:
Stereo views of active site residues of
(un)liganded CGTase and with bound maltotetraose. Shown are the active
site CGTase soaked with
Table 3lists
possible hydrogen bonds between maltotetraose and CGTase in the complex
structures. For comparison the equivalent contacts observed in the
complex with acarbose are also listed. From Table 3it is clear
that most intermolecular contacts observed in the complex between
CGTase and acarbose (3) are conserved in the complex with
maltotetraose. A number of interesting differences are observed,
however, which will be discussed in the following paragraphs.
In the
complexes between CGTase and maltotetraose, Asp-229 forms a strong
hydrogen bond with the C-6 hydroxyl group of sugar B, which is absent
in acarbose. Although Asp-229 is now involved in a hydrogen bond with
sugar B, its conformation has not changed from that observed in the
complex with acarbose. The second oxygen atom of the carboxylate group
of Asp-229 is at 2.8-3.0 Å of the C-1 atom of glucose B and
could stabilize a positively charged oxo-carbonium intermediate. The
conformations of the side chains of Asn-229 and Gln-257 in the double
mutant CGTase complexed with maltotetraose are very similar to those
observed in complexes of the native protein. Additional stabilization
of the sugar ring at subsite B comes from stacking interactions with
the aromatic ring of Tyr-100. Unfortunately the density around the
sugar at subsite B is of poor quality in all three complexes. Possibly
this sugar assumes a number of different distorted conformations,
yielding an averaged and decreased electron density. Except for the
complex with G7, the electron density covers the glycosidic linkage
between the B and C sugars, indicating that the majority of the bound
maltotetraoses is uncleaved (cf. Fig. 2). Tyr-195 seems to
interact only weakly with sugar C of maltotetraose. In the high pH
complexes of CGTase with maltotetraose, the distance between its
hydroxyl group and the O-6C hydroxyl group is roughly 3.8 Å.
Nevertheless, the O-6C hydroxyl group could easily interact with the
Tyr-195 hydroxyl group after rotation about the C-5C-C-6C bond. Such a
conformation is actually observed in the double mutant-maltotetraose
complex where the Tyr-195 hydroxyl group is only 2.7 Å away from
the O-6C hydroxyl group. In the other two complexes the O-6C hydroxyl
groups are near and could be directed toward the Tyr-195 hydroxyl group
as well. Tyr-195 has been implicated in the product specificity of
CGTases, although the precise role of this residue is not
known(14, 34) . Perhaps the impossibility of forming
this hydrogen bond causes the decrease in cyclization and coupling
activity observed for a Y195F mutant(14) . An interesting
difference in the side chain conformation of Lys-232 is observed in the
structure derived from data obtained for CGTase crystals soaked with
maltoheptaose, which results in the formation of a strong hydrogen bond
between the side chain amino group and the O-2D hydroxyl atom of the
ligand as illustrated in Fig. 3. This hydrogen bond is not
observed in structures derived from soaking experiments with
Figure 4:
Schematic representation of the
interactions between maltotetraose and CGTase active site residues.
Because acarbose has a better quality electron density complexed with
CGTase but deviates structurally from natural substrates at the A and B
sugars, the contacts shown are a combination of the contacts observed
in the structures of CGTase complexed with maltotetraose and
acarbose.
Figure 5:
Stereo views of
The two
The Maltose-binding site 2
is not involved in crystal packing contacts. The The active site mutant proteins D229N, D328N, E257Q, and
D229N/E257Q still displayed cyclodextrin-forming activity, although
their activities were very low compared with wild-type CGTase. The
activities could not be measured in culture supernatants but only in
purified and concentrated protein samples. These results are in
agreement with those of Klein et al.(7) , who
described low activities for the D229A and D328A mutations in B.
circulans strain 8 CGTase. They disagree with the results obtained
with a CGTase from an alkalophilic Bacillus(39) ,
where no detectable activity could be measured for the same active site
mutations as described in this report. Analogous mutations in the
active site residues of Bacillus stearothermophilus Neopullulanase (40) and Aspergillus oryzae Taka-amylase A (41) also showed no detectable activities.
However, the former two proteins were not purified and concentrated
before measurement. The E257Q and D328N mutants display a negative
shift of 0.5 pH units of their pH optima compared with that of the wild
type (pH 6.0). Glu-257 is thought to donate a proton to the glycosidic
bond during catalysis, and Asp-328 forms a hydrogen bond with Glu-257
in the unliganded structure, in this way elevating the
pK The C-6 hydroxyl group at
sugar residue B is absent in acarbose but present in maltotetraose.
This functional group was suggested to be essential for a contact with
His-140 that could induce a strained conformation in sugar B prior to
breaking of the scissile glycosidic bond(3) . The Asp-229
residue could assist such an arrangement by hydrogen bonding to the C-6
hydroxyl group. Alternatively, this hydroxyl group might polarize
either the O-5 or the C-1 atom of its own sugar in order to activate
the scissile bond. In the structures reported here, the C-6 hydroxyl
group is at about 3 Å from the C The question remains why
maltotetraose is not cleaved by CGTase, even though it has the C-6
hydroxyl group present at subsite B and the enzyme is still
catalytically functional at pH 9. The lower quality of the electron
density observed for maltotetraose, relative to that observed for
acarbose(3) , suggests that acarbose is a better inhibitor than
maltotetraose. This could be attributed to acarbose lacking the C-6
hydroxyl group. In the case of maltotetraose there is apparently an
additional factor that prohibits its cleavage. From biochemical studies
it is known that CGTase does not interconvert mixtures of glucose,
maltose, maltotriose, and maltotetraose (14) and that
maltotetraose is the strongest cyclization inhibiting substrate among
saccharides consisting of one to seven glucose residues in the case of
a The presence of two The crystal
structures of CGTase complexed with maltotetraose and
The atomic
coordinates and structure factors (codes 1cxe, 1cxf, 1cxh, and 1cxi)
have been deposited in the Protein Data Bank, Brookhaven National
Laboratory, Upton, NY.
Volume 270,
Number 49,
Issue of December 8, 1995 pp. 29256-29264
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
-cyclodextrin. Crystal structures were determined
of wild type CGTase soaked at elevated pH with
-cyclodextrin
(resolution, 2.1 Å) and maltoheptaose (2.4 Å). In addition,
structures at cryogenic temperature were solved of the unliganded
enzyme (2.2 Å) and of the D229N/E257Q mutant after soaking with
-cyclodextrin (2.6 Å). In the crystals soaked in
-cyclodextrin and maltoheptaose, a maltotetraose molecule is
observed to bind in the active site. Residue 229 is at hydrogen bonding
distance from the C-6 hydroxyl group of the sugar, which after cleavage
will contain the new reducing end. In the D229N/E257Q double mutant
structure, two
-cyclodextrins are observed to replace two maltoses
at the E-domain, thus providing structural information on product
inhibition via binding to the enzyme's raw starch binding domain.
(14)-linked glucopyranosyl
chains(1) . In general, CGTases produce mixtures of cyclic
compounds named cyclodextrins (CDs), (
)consisting of six,
seven, or eight D-glucopyranose units, which are referred to
as
-,
-, and -cyclodextrins, respectively. Depending on
the major type of cyclodextrin that is produced, CGTases are classified
as
-,
-, or -CGTases. The
-CGTase from Bacillus
circulans strain 251 is one of the CGTases that is currently used
for the industrial production of
-cyclodextrins. This process is,
however, hampered by the sensitivity of the enzyme to product
inhibition and by its relatively low product specificity. We
investigate this enzyme with the aim of gaining more insight into the
factors that determine its functionality, in order to guide the
rational design of mutants with improved properties.
-amylases. The E-domain has been implicated in starch binding (4) and was found to bind two maltose molecules. A third
maltose molecule is bound by the C-domain and is involved in crystal
packing contacts between symmetry related molecules. On the basis of
the structure of the enzyme complexed with acarbose, it was concluded
that Glu-257 acts as the proton donor in the reaction, whereas Asp-229
serves as the general base or nucleophile. Asp-328 is involved in
binding of the substrate and helps to elevate the pK of Glu-257 through a direct hydrogen bond to this residue (2, 3) that exists only when no substrate or inhibitor
is present. Surprisingly, the acarbose inhibitor was not cleaved, even
though this maltotetraose was observed to bind near the catalytic
residues Glu-257 and Asp-229 with the O-glycosidic bond
between the B and C sugar residues, in a seemingly productive way. As a
possible explanation it was suggested that the presence of a hydroxyl
group at the C-6 carbon atom of the B sugar is essential for either the
destabilization of the conformation of the
-sugar or for the
polarization of the atoms of the scissile glycosidic bond. Structural
data on the interaction of CGTase with natural substrates, which do
possess a hydroxyl group at the C-6 atom of the
-sugar, could
clarify this aspect of the catalytic mechanism of CGTases.
-CD or maltose (5) , no oligosaccharides were observed to bind near the active
site carboxylates(2) . Soaking of crystals of a D229A mutant of
the highly similar B. circulans strain 8 CGTase (6) at
pH 6.7 in a
-cyclodextrin solution revealed only the presence of a
single maltose residue in the active site. These experiments were,
however, hindered by the instability of the crystals in the presence of
oligosaccharides, requiring the use of extremely short soaking periods (7) . Therefore, to establish the binding mode of native
substrates in the active site cleft, experiments should ideally be
performed under conditions where the enzyme has no or very low
activity. As the catalytic mechanism of CGTases and
-amylases is
thought to be similar to that of lysozyme (3, 8) and
as the first step of the reaction entails donation of a proton by the
catalytic glutamic acid residue (Glu-257 in the case of CGTase) to the
glycosidic oxygen of the scissile bond(3, 9) , the
rate of the reaction may be significantly reduced by raising the pH of
the soaking solutions. A completely different approach involves the
inactivation of catalytic residues Asp-229, Asp-328, and Glu-257 by
site-directed mutagenesis. Here we report the preparation,
purification, and determination of the catalytic properties of such
mutants, as well as the crystal structures of enzyme-substrate
complexes obtained by soaking crystals of wild type and a D229N/E257Q
double mutant CGTase in solutions of
-cyclodextrin or
maltoheptaose (G7) at elevated pH.
Bacterial Strains, Bacteriophage, and
Plasmids
Escherichia coli MC1061 (hsdR mcrB araD139 D(araABC-leu)7679
DlacX74 galU galK rpsL thi) (10) was used for recombinant DNA manipulations. E. coli CJ236 (dut1 ung1 thi-1 relA1/pCJ105 (Cm
F`)) (11) was used for
site-directed mutagenesis. CGTase (mutant) proteins were produced with
the
-amylase and protease negative Bacillus subtilis strain DB104A (amy his nprR2 nprE18 aprA3)(12) . The bacteriophage M13K07 was used for
preparing single-stranded DNA(13) .Growth Conditions
Plasmid-carrying
bacterial strains were grown on LB medium in the presence of the
antibiotics ampicillin (plasmid pDV58)(2) , erythromycin and
spectinomycin (pDP66S) (14) , or erythromycin and kanamycin
(pDP66K) (
)at concentrations of 100 and 5 µg/ml for E. coli and B. subtilis, respectively(15) .
When appropriate, agar plates contained 1% starch to screen for halo
formation. B. subtilis strain DB104A was grown in a
1.5-3-liter batch fermenter as described previously (14) .DNA Manipulations
Restriction
endonucleases and Klenow enzyme were purchased from Pharmacia LKB
Biotechnology and used according to the manufacturer's
instructions. DNA manipulations and calcium chloride transformation of E. coli strains were as described(15) . Transformation
of B. subtilis was performed according to Bron(16) .Site-directed Mutagenesis
To construct
single amino acid mutations the method described by Kunkel et al.(11) was used. Single-stranded DNA was prepared using
plasmid pDV58 and E. coli strain CJ236 after infection with
bacteriophage M13K07. Three oligonucleotides were used to produce the
mutations GGCATCCGCATGAATGCGGTGAAGCAT for D229N,
ATCGATAACCATAACATGGAGCGT for D328N, and
CGGTCTTTACCTTTGGCCAATGGTTCCTGGGC for E257Q. Successful mutagenesis also
resulted in the appearance of the underlined restriction sites,
allowing rapid screening of presumptive mutants. For D229N this
restriction site was BsmI, for D328N it was ClaI, and
for E257Q it was BalI. After mutagenesis the DNA was
transformed to calcium chloride competent E. coli MC1061
cells. For the construction of the double mutation (D229N/E257Q) mutant
D229N DNA was subcloned in pDP66S (14) (PvuII-Nar I fragment) and used as
a template for polymerase chain reaction mutagenesis
using
VENT-DNA polymerase (New England Biolabs, Beverly, MA) with primer
E257Q.Production and Purification of CGTase (Mutant)
Proteins
Plasmid pDV58 carrying positively characterized
single mutant cgt genes and plasmid pDP66S (14) was
digested with PvuII and NarI. The 1207-base pair
fragment from the expression vector pDP66S was replaced with the
corresponding fragment containing the mutation from the mutagenesis
vector pDV58, ligated, and transformed to E. coli strain
MC1061. For the double mutant the polymerase chain reaction product was
cut with PvuII and Nar I as well and exchanged for
the corresponding fragment from plasmid pDP66K.
After
isolation of pDP66S and pDP66K DNA and restriction analysis, the
plasmid DNA was transformed to B. subtilis strain DB104A. The
organism was grown to an optical density of 13 at 600 nm in a
1.5-3-liter batch fermenter (for approximately 50 h). Every 12 h
additional erythromycin (10 µg/ml) was added to the medium. Under
these conditions high extracellular CGTase levels were produced. The
culture was centrifuged at 4 °C for 30 min at 16,000 g. The supernatant proteins were further purified to
homogeneity by affinity chromatography, using a 30-ml
-cyclodextrin-Sepharose 6FF column (Pharmacia) (17) with a
maximum capacity of 3.5 mg of protein/ml. After washing with 10 mM sodium acetate buffer (pH 5.5), bound CGTase was eluted with the
same buffer containing 10 mg/ml
-cyclodextrin.Enzyme Assay
The
-cyclodextrin-forming activity was measured as described
previously (14) by incubating appropriately diluted enzyme with
5% Paselli SA2 as a substrate dissolved in 10 mM sodium
citrate buffer (pH 6.0). The amount of
-cyclodextrin formed was
determined on the basis of its ability to form a stable, colorless
inclusion complex with phenolphthalein(18) . One unit of
activity is defined as the amount of enzyme able to produce 1 µmol
of
-cyclodextrin/min.Determination of the pH Optima
In order
to define the pH optima for wild-type CGTase and the three single
active site mutants appropriate dilutions of enzyme were incubated in a
5% Paselli solution buffered with a 10 mM sodium citrate/Hepes
buffer with a pH ranging from 2 to 11. After 3 min the reactions were
stopped and the amount of
-cyclodextrin was measured using
phenolphthalein.Crystallization, Soaking, and Data
Collection
Wild-type and mutant CGTases from B.
circulans strain 251 were crystallized as described by Lawson et al.(5) . The cell dimensions are listed in Table 1.
-cyclodextrin,
the crystallization mother liquor was replaced by a soaking solution
composed of 60% (v/v) 2-methyl 2,4-pentanediol, 100 mM CAPS
buffer, pH 9.1, and 0.5% of
-cyclodextrin (w/v). In the case of
the double mutant CGTase crystals, a 1%
-cyclodextrin
concentration was used. For the soaking experiments with maltoheptaose,
the pH of the mother liquor was increased to pH 9.6, and 0.5%
maltoheptaose was added to the buffer. All soaking experiments were
carried out at room temperature. The wild-type enzyme was soaked in the
substrate solutions for 5 days, whereas the double mutant was soaked
for 1 h.Structure Refinement
Refinement of the
crystal structures was done with the TNT package (22) using the
2.0 Å structure of native CGTase (2) as the starting
model for rigid body and subsequent all parameter refinement. This
model consisted of all 686 residues, two calcium ions, and three
maltose molecules. Ideal bond lengths and angles were taken from Engh
and Huber(23) . Free crystallographic R-factors (24) were calculated using a subset of 10% randomly selected
reflections. In the case of wild-type enzyme complexed with
-CD
and G7, free R-factors were only calculated during the last 10
cycles of refinement, whereas for the other structures free R-factors were monitored during the entire refinement.
Adjustments to models were made using FRODO (25) running on an
Evans and Sutherland PS390 computer graphics station and O (26) running on Silicon Graphics workstations on the basis of
-weighted (2 mF
![]()
- D
F
![]()
) and (m
F
![]()
- D
F
![]()
) difference
maps(27) . Water molecules were only included in the structure
if the corresponding peak in the difference electron density map
exceeded 3.5
and the water molecule could form at least one
hydrogen bond with a protein atom or with an already existing water
molecule. Water molecules at more than 3.3 Å from protein atoms
or previously placed water molecules were eliminated from the model.
All water molecules were visually inspected using FRODO or O. Starting
temperature factors were taken from the native protein model or set to
20 Å
for newly added ligands or water molecules.
Refinement statistics are summarized in Table 1.
-CD, as well as
that of the native protein and the D229N/E257Q mutant determined at 120
°K, have been deposited with the Protein Data Bank, Brookhaven
National Laboratory (30) (entries 1cxe, 1cxf, 1cxh, and 1cxi,
respectively).
Characteristics of the Mutant Enzymes
A
single fermenter run with B. subtilis DB104A allowed
purification of up to 300 mg of (mutant) CGTase protein in a
60-70% yield. Whereas no cyclodextrin-forming activities could be
found in crude extracts of strains carrying the D229N, D328N, E257Q,
and D229N/E257Q mutations, expression of these mutant CGTase proteins
could clearly be detected by an enzyme-linked immunosorbent assay.
Analysis of purified mutant proteins showed that they had almost
completely lost their cyclodextrin-forming activity
(4,000-700,000-fold reduction; see Table 2). Because the
double mutant CGTase had the lowest catalytic activity, it was selected
for substrate binding studies. As can be seen in Fig. 1, the pH
optima of the mutants E257Q and D328N have shifted downwards by 0.5
unit compared with the wild-type enzyme. The optimum of mutant D229N
remained at pH 6.0, the value of the wild-type enzyme. Interestingly,
the wild-type enzyme was still partially active at pH 9 (Fig. 1A). Most likely the single and double mutants
have residual activity at elevated pH as well because minor activity
changes were observed with increasing pH values (Fig. 1B).
-Cyclodextrin-producing activity was measured using a 10 mM citrate/Hepes buffer at 50 °C. B shows a comparison
of the pH profiles near the pH optima for wild-type CGTase ()
and the active site mutants D229N (
), E257Q (
), and D328N
(
).
Structure Refinement
In order to analyze
the interaction of CGTase with substrates, x-ray structures were
determined at room temperature (CGTase complexed with
-cyclodextrin or maltoheptaose) and at cryogenic temperature (120
°K; wild-type CGTase and the D229N/E257Q mutant complexed with
-cyclodextrin). Table 1presents a summary of the final
results of the crystallographic refinement. Possibly due to differences
in completeness and resolution between the data sets, structures
refined against data obtained at higher resolution yield slightly lower
crystallographic R-factors, which in addition are closer to
the corresponding free R-factors. coordinates of 0.3-0.4 Å, which are of the same
magnitude as the mean coordinate error of 0.2 Å as derived from
plots(27) . No large structural
rearrangements are observed due to ligand binding or the use of flash
freezing. A comparison of the C coordinates of the
uncomplexed wild-type structures determined at 293 and 120 °K
yielded a r.m.s. difference of 0.3 Å, which indicates that
measuring at cryogenic temperature also does not induce substantial
conformational changes. Only small changes in the protein backbone
conformation of surface loops near the active site and the
maltose-binding sites are observed in all cases. Binding of
-CD to
the E-domain induces relatively the largest changes. Structures refined
with data recorded at cryogenic temperature have average B values for
protein atoms in the order of 10 Å
, which is about
half the magnitude of those of structures refined with data recorded at
room temperature, indicating an overall decrease in flexibility.
-cyclodextrin at pH 9.1 as well as those with
maltoheptaose at pH 9.6 had produced a very similar electron density in
the active site, consistent with that for a maltotetraose molecule.
Apparently even at high pH values the enzyme still has sufficient
residual activity to partially hydrolyze substrates (cf.Fig. 1). Even the experiment with the D229N/E257Q double
mutant at cryogenic temperature (120 °K) showed only electron
density corresponding to a maltotetraose in the active site. The
density for maltotetraose is not unambiguous for all atoms. The
electron density that was observed in OMIT maps (32) in the
active site was, however, of a similar shape in all three complex
structures and overlapped well with the conformation of acarbose in
complex with CGTase(3) . The hydroxymethyl groups of the
maltotetraose molecule in the double mutant structure were well enough
defined in the electron density of the A and C sugars to allow
unambiguous identification of the direction of the polysaccharide
chain. The carbohydrate residues have high temperature factors
(55-65 Å
) compared with an average B-factor of
about 20 Å
for the surrounding protein atoms. This
suggests a low occupancy or the binding of maltotetraose in multiple
(distorted) conformations. In the case of the CGTase of B.
circulans strain 8, soaking of protein crystals with
-cyclodextrin (7) yielded electron density of a similar
quality for a maltose molecule in the active site. The average value
for the B-factors of about 55 Å
suggests that
glucoses B and C interact more strongly with the residues of the active
site than the A and D residues (which have B-factors in the order of 65
Å
) as was also observed for acarbose complexed with
CGTase(3) . No significant differences were found between the
conformations of maltotetraose in the three complexes. The r.m.s.
differences in coordinate positions for the maltotetraose atoms are in
the order of 0.4-0.6 Å and are mainly due to different
orientations of O-6 hydroxyl groups. High B-factors of the
maltotetraose atoms and the imperfect electron density prevent the
accurate determination of deviations from a full
C
chair conformation of the glucose subunits.Binding of Maltotetraose in the Active Site of
CGTase
The mode of binding observed for the maltotetraose
molecule bound in the active site cleft of CGTase resembles closely
that observed for acarbose(3) , where a sharp turn between the
sugar residues at subsites B and C was induced upon binding. This
conformation of maltotetraose agrees with the proposed role of acarbose
as a substrate analog rather than a transition state
analog(3) . Fig. 2and Fig. 3depict the
maltotetraose molecules and their 2F
- F
electron densities in the various structures
solved. Like in the acarbose structure(3) , the maltotetraose
structure consists of two highly similar canonical maltose molecules
(residues A-B and C-D), linked together through an unusual glycosidic
bond formed by the B-C linkage, which lacks the internal hydrogen bond
between the O-2B and O-3C hydroxyl groups. This twisted mode of
substrate binding closely resembles the ligand conformation observed in
the complex between pig pancreatic
-amylase and an
inhibitor(33) . Also in this case a sharp turn in the substrate
is observed at the scissile glycosidic bond.
-CD, CGTase soaked with G7 (B),
and D229N/E257Q CGTase soaked with
-CD (C). Electron
density in 2F - F
maps is contoured at 1
, and
hydroxyl groups of the maltotetraose molecule are
labeled.
-CD and maltoheptaose (A) and the
active site of D229N/E257Q CGTase soaked with
-CD (B).
Corresponding residues of the unliganded enzyme at the same temperature
are drawn with thick lines, and the complexed protein residues
and maltotetraose are drawn with thin lines. Residue types and
sequence numbers, as well as the maltotetraose A and D sugars, are
labeled.
-CD
but is present in the complex with acarbose (cf.Table 3). Although in all structures derived from crystals
soaked with
-CD structural variability is observed for the Lys-232
side chain, the side chain conformations cluster in an entirely
different group than the conformation observed in the CGTase-G7
complex. It seems unlikely that the relatively small change in the
buffer composition from pH 9 to pH 9.6 would induce structural changes
of this nature because at both pH values lysine (pK
= 10.8) is expected to be protonated. The observed
difference could be due to the fact that the initial binding of
cyclodextrins and linear substrates into the active site is
fundamentally different. Longer linear substrates such as amylose,
maltoheptaose, or acarbose most likely enter the active site through
the long groove that extends from the active site to the second
maltose-binding site(2) . For cyclic compounds this is not
possible due to steric constraints, and they can only approach the
active site directly from the solvent. Lys-232 is positioned on the
border of the starch binding groove and the active site cleft, and its
side chain conformation is expected to be affected by the entry of a
longer linear substrate via the groove. One might speculate that the
additional hydrogen bond donated by Lys-232 specifically increases the
binding energy of linear substrates, thus shifting the reaction
equilibrium toward the formation of cyclic carbohydrates from linear
carbohydrates. Fig. 4summarizes the interactions between
maltotetraose and the active site residues of CGTase.
Binding of
Although only a maltotetraose molecule was
present in the active site of the double mutant, density for intact
-Cyclodextrin to Maltose-binding
Sites of CGTase
-CD molecules was found at the two maltose-binding sites in the
E-domain (Fig. 5). The presence of bound
-cyclodextrin at
the E-domain is not surprising because Villette et al.(35) demonstrated earlier that this domain is capable of
binding
-CDs. The maltose-binding site located in the C-domain
displayed electron density for a single maltose molecule only. This
maltose molecule is involved in extensive crystal packing contacts, and
the corresponding maltose-binding sites might not be readily accessible
for
-CD. Alternatively, it has been suggested that the third
maltose-binding site could be merely a crystallographic artifact of
little biological relevance(2) .
-cyclodextrin bound
at maltose-binding sites 1 and 2 in the E-domain of CGTase. Shown are
-CD bound to maltose-binding site 1 (A) and
-CD
bound to maltose-binding site 2 (B). Electron density in
2F - F
maps is contoured at 1
, and hydrophobic residues of
the protein involved in stacking interactions with the oligosaccharides
are indicated. The residue in the middle of the cyclodextrin
ring in B is Leu-600.
-CD molecules
bind to CGTase with the apolar sides of the glucose units stacked on
aromatic amino acid residues of the protein. Similar hydrophobic
stacking interactions have been observed for
-CD bound to the
maltodextrin binding protein (36) and
-CD complexed with
pig pancreatic
-amylase (37) and soybean
-amylase(38) . A list of possible intermolecular hydrogen
bond interactions between the
-CDs and CGTase is presented in Table 4. The numbering A-F of the glucose units in
-CD
is chosen such that residue A corresponds to the nonreducing sugar of
the originally bound maltose(2) , and residue B corresponds to
the reducing sugar. The bound
-CD molecules form essentially the
same set of hydrogen bonds with the enzyme as observed for the maltoses
in the native structure(2) . Some differences are present,
however, and they will be discussed briefly in the following sections.
-CD at maltose-binding site 1 is involved in crystal
packing contacts that result in the formation of two additional weak
hydrogen bonds between residues Ser-385 and Arg-339 of a symmetry
related molecule and sugars C and D of
-CD. Besides the stacking
of this
-CD onto the indole groups of Trp-616 and Trp-662, no
stacking of glucoses of the
-CD ring onto hydrophobic residues of
neighboring protein molecules is observed. In conclusion, the energetic
contribution of crystal packing contacts on
-CD binding seems to
be low. Only weak electron density is observed between the Trp-616
carbonyl oxygen and the O-6A and O-5A hydroxyls of glucose A, whereas
in the native protein structure (2) a water molecule was
observed to mediate hydrogen bonds between maltose and CGTase.
Possibly, the lower resolution of the double mutant structure causes
this water molecule not to be observed. Because flash freezing of the
crystal reduced the unit cell volume by about 3-4% (cf.Table 1), some contacts at maltose-binding site 1 could be
altered by small changes in crystal packing.
-CD that binds at
this site stacks onto the aromatic ring of Tyr-663. In addition, the
side chain of Leu-600 protrudes into the cyclodextrin ring as
illustrated in Fig. 5. The Leu-600 side chain methyl groups
approach the apolar surfaces of sugars C and D of the bound
-cyclodextrin to a distance of about 4-4.5 Å. A
similar mode of binding was observed in the structures of pig
pancreatic
-amylase (37) and soybean
-amylase(38) , where a valine and a leucine residue,
respectively, were observed to protrude into the ring of a bound
cyclodextrin molecule. The water-mediated contact between Asn-603 and
maltose that was observed in the native protein is not substantiated by
electron density in the double mutant structure. The role of this water
molecule appears to be taken over by the main chain amino group of
Gly-601, which is at hydrogen bond distance of the O-2A and O-3A
hydroxyl groups of
-CD.
of this glutamate. In the D328N mutant this is
no longer possible, which explains the observed decrease of the pH
optimum of CGTase. The E257Q mutant displays residual activity as well
and has also a decreased pH optimum. Even the D229N/E257Q double mutant
CGTase is still catalytically functional as is demonstrated by the
presence in the active site of maltotetraose, which is a degradation
product of
-cyclodextrin. Possibly, the third acidic active site
residue, Asp-328, partially takes over the roles of Asp-229 and
Glu-257, even though it is located somewhat more remote from the
glycosidic bond to be cleaved. The pK
of Asp-328
is likely to be affected by a E257Q mutation, and this may explain the
shift in pH optimum observed for the E257Q mutant. Site-directed
mutagenesis of each of these three catalytic site residues yields a
protein with greatly reduced activity, demonstrating that their
function in catalysis is highly correlated. Mutation D229N displays no
effect on the pH optimum, which suggests that this residue does not
affect proton transfer. It is in agreement with the proposal that
Asp-229 acts as a general base or nucleophile near the C-1 atom of the
sugar residue at subsite B(3) .-1 atom of the highly
conserved His-140(42) , which retains a conformation similar to
that in the unliganded protein. The Asp-229 O
-2 atom forms a
strong hydrogen bond with the C-6B hydroxyl group and places it above
the plane of the O-5 and C-1 atoms of its own sugar, whereas the
Asp-229 O
1 atom is positioned close to the C-1B atom. Such a
configuration could well distort the sugar conformation and polarize
the scissile bond between sugars B and C prior to catalysis. The
distorted electron density observed at subsite B suggests that the
conformation of this sugar is indeed destabilized by these contacts,
similar to what was observed in lysozyme-carbohydrate complexes (43, 44, 45) .
-CGTase from an alkalophilic Bacillus sp. (ATCC
21783)(46) . Apparently efficient catalysis is not solely
determined by the exact composition of the oligosaccharide but also by
the size of the sugar polymer. Whether CGTase cannot perform catalysis
because certain contacts with sugars beyond subsites A and D are
lacking requires structural data on longer substrates complexed with
CGTase.
-cyclodextrin molecules in the
double mutant structure at maltose-binding sites 1 and 2 demonstrates
that cyclodextrins are capable of binding strongly to the E-domain.
Especially the cyclodextrin bound to the maltose-binding site near
Tyr-633 could interfere with the catalytic activity of the enzyme
because this maltose-binding site is part of the long groove on the
protein surface leading into the active site(2) . When the
product concentration increases in time, it is clear that cyclodextrins
can compete with raw starch in binding to the E-domain and thus may
block the binding of linear starch polymers and the interaction with
raw starch granules.
It is interesting to find a
hydrophobic amino acid, Leu-600, exposed to the solvent at the second
maltose-binding site. Its involvement in binding an
-CD molecule
by protruding with its side chain into the cyclodextrin ring, suggests
that this site on the protein is intended to bind cyclic or helical
polysaccharides like cyclodextrins and amylose. It should be noted,
however, that Leu-600 appears to make only weak van der Waals contacts
with the
-CD and could function only to position the substrate
correctly. Maltose-binding site 1 is thought to attach the protein
nonspecifically to the raw starch granules; thus the enzyme could also
be inhibited by binding of its products to this site.
-cyclodextrin presented here demonstrate clearly that product
inhibition and enzymatic functionality are tightly interwoven. Because
the cyclodextrin molecules basically bind with only two glucose
residues to the maltose-binding sites, mutations that will specifically
prevent the binding of cyclic products are not immediately obvious.
Mutation of Leu-600 and adjacent residues could reduce the binding of
cyclic products to maltose-binding site 2 while the binding of linear
substrates remains unaffected.
)
)
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
![]()
CiteULike
Complore
Connotea
Del.icio.us
Digg
Reddit
Technorati What's this?
This article has been cited by other articles:
![]() |
B. P Rempel and S. G Withers Covalent inhibitors of glycosidases and their applications in biochemistry and biology Glycobiology, August 1, 2008; 18(8): 570 - 586. [Abstract] [Full Text] [PDF] |
||||
![]() |
R. M. Kelly, H. Leemhuis, L. Gatjen, and L. Dijkhuizen Evolution toward Small Molecule Inhibitor Resistance Affects Native Enzyme Function and Stability, Generating Acarbose-insensitive Cyclodextrin Glucanotransferase Variants J. Biol. Chem., April 18, 2008; 283(16): 10727 - 10734. [Abstract] [Full Text] [PDF] |
||||
![]() |
Z. Wang, Q. Qi, and P. G. Wang Engineering of Cyclodextrin Glucanotransferase on the Cell Surface of Saccharomyces cerevisiae for Improved Cyclodextrin Production. Appl. Envir. Microbiol., March 1, 2006; 72(3): 1873 - 1877. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. A. F. T. van Hijum, S. Kralj, L. K. Ozimek, L. Dijkhuizen, and I. G. H. van Geel-Schutten Structure-Function Relationships of Glucansucrase and Fructansucrase Enzymes from Lactic Acid Bacteria Microbiol. Mol. Biol. Rev., March 1, 2006; 70(1): 157 - 176. [Abstract] [Full Text] [PDF] |
||||
![]() |
X. Robert, R. Haser, H. Mori, B. Svensson, and N. Aghajari Oligosaccharide Binding to Barley {alpha}-Amylase 1 J. Biol. Chem., September 23, 2005; 280(38): 32968 - 32978. [Abstract] [Full Text] [PDF] |
||||
![]() |
L. L. Lairson, C. P. C. Chiu, H. D. Ly, S. He, W. W. Wakarchuk, N. C. J. Strynadka, and S. G. Withers Intermediate Trapping on a Mutant Retaining {alpha}-Galactosyltransferase Identifies an Unexpected Aspartate Residue J. Biol. Chem., July 2, 2004; 279(27): 28339 - 28344. [Abstract] [Full Text] [PDF] |
||||
![]() |
C. A. Tarling, S. He, G. Sulzenbacher, C. Bignon, Y. Bourne, B. Henrissat, and S. G. Withers Identification of the Catalytic Nucleophile of the Family 29 {alpha}-L-Fucosidase from Thermotoga maritima through Trapping of a Covalent Glycosyl-Enzyme Intermediate and Mutagenesis J. Biol. Chem., November 28, 2003; 278(48): 47394 - 47399. [Abstract] [Full Text] [PDF] |
||||
![]() |
J. E. Nielsen and J. A. McCammon Calculating pKa values in enzyme active sites Protein Sci., September 1, 2003; 12(9): 1894 - 1901. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Pinotsis, D. D. Leonidas, E. D. Chrysina, N. G. Oikonomakos, and I. M. Mavridis The binding of {beta}- and {gamma}-cyclodextrins to glycogen phosphorylase b: Kinetic and crystallographic studies Protein Sci., September 1, 2003; 12(9): 1914 - 1924. [Abstract] [Full Text] [PDF] |
||||
![]() |
S. Kralj, G. H. van Geel-Schutten, H. Rahaoui, R. J. Leer, E. J. Faber, M. J. E. C. van der Maarel, and L. Dijkhuizen Molecular Characterization of a Novel Glucosyltransferase from Lactobacillus reuteri Strain 121 Synthesizing a Unique, Highly Branched Glucan with {alpha}-(1->4) and {alpha}-(1->6) Glucosidic Bonds Appl. Envir. Microbiol., September 1, 2002; 68(9): 4283 - 4291. [Abstract] [Full Text] [PDF] |
||||
![]() |
D. Zhang, X. Li, and L.-H. Zhang Isomaltulose Synthase from Klebsiella sp. Strain LX3: Gene Cloning and Characterization and Engineering of Thermostability Appl. Envir. Microbiol., June 1, 2002; 68(6): 2676 - 2682. [Abstract] [Full Text] [PDF] |
||||
![]() |
N. Rashid, J. Cornista, S. Ezaki, T. Fukui, H. Atomi, and T. Imanaka Characterization of an Archaeal Cyclodextrin Glucanotransferase with a Novel C-Terminal |