|
|
|
|||||||
|
|||||||||
(Received for publication, September 29, 1994; and in revised form, November 16, 1994) From the
The ras-GAP associated protein, p62, is a major tyrosine
phosphoprotein in transformed and growth factor treated cells. Although
its exact function is not known, it can bind directly to src-family
tyrosine kinases and has been implicated as a linker protein bridging
activated src family tyrosine kinases with downstream effectors. One
novel feature of p62, revealed by its predicted amino acid sequence, is
the presence of an RNA-binding region, the KH domain. As p62 becomes
tyrosine phosphorylated when src-kinases become activated, we compared
the RNA binding ability of p62 in both its phosphorylated and
unphosphorylated state. The ability of p62 to bind RNA was severely
impaired when p62 was tyrosine phosphorylated. This suggests that the
ability of p62 to bind RNA is regulated by tyrosine phosphorylation and
implicates the regulation of RNA as a component of tyrosine kinase
signaling pathways. p62 is a major tyrosine phosphorylated substrate in growth
factor treated and transformed cell lines(1, 2) .
Although little is known about its exact function, its ability to be
phosphorylated after numerous stimuli and its association with the
ras-GTPase activating protein (ras-GAP) suggest that it has an
important role in signal transduction, possibly in ras
activation(2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14) .
The cloning of p62 in 1992, however, did not readily suggest the
function of this molecule; analysis of the deduced amino acid sequence
only revealed that p62 is related to RNA binding proteins(15) . Recent studies implicate p62 in cell cycle regulation and tyrosine
kinase mediated signal transduction. p62 (or a related protein) forms
complexes with src during mitosis (16, 17) suggesting
that p62 may play a critical role in cell cycle regulation. Other data
demonstrate that p62 can associate directly with p59 The type of RNA binding domain present in p62 is known as the KH
domain (21) . This RNA binding domain is an evolutionarily
conserved sequence which has been shown to be integral in the RNA
binding ability of FMR1 and hnRNP K(22) . A physiological role
for the FMR1 KH domain has been established with the revelation that a
single point mutation in a conserved residue of the FMR1 KH domain is
associated with severe fragile X syndrome(23, 24) . The presence of p62, an RNA binding protein, as a prominent tyrosine
phosphorylated substrate suggests that some functions of RNA binding
proteins may be regulated by tyrosine kinase signaling pathways. The
regulation of RNA binding proteins might regulate RNA stability or
efficiency of translation, allowing a cell to respond rapidly to
external stimuli by directing protein synthesis in the absence of new
transcription. How tyrosine phosphorylation might regulate RNA is not
known, but one possibility is that phosphorylation regulates binding of
RNA. We, therefore, tested the ability of p62 to bind RNA in both its
phosphorylated and unphosphorylated state.
Samples were analyzed on 10% SDS-polyacrylamide gels and
transferred to nitrocellulose. Immunoblotting was then performed using
the designated primary antibody followed by goat anti-mouse or
anti-rabbit conjugated to horse radish peroxidase (Organon
Teknika-Cappel) and chemiluminescence was used for protein detection
(DuPont). Anti-myc monoclonal 9E10 (35) was obtained from
American Type Culture Collection. Polyclonal antibody against
p59 Because there is no physiological RNA target known to bind
p62, we utilized homopolymeric RNA for binding assays. This method,
first described by Swanson and Dreyfuss(25) , has been used
extensively to study protein/RNA
interactions(17, 22) . Specifically, we chose poly(U)
homopolymer as a binding substrate because it has been previously shown
that p68, a p62-related protein, binds this polymeric RNA specifically (17) . To determine whether tyrosine phosphorylation of p62
affects its ability to bind RNA, an epitope tagged form of p62 was
expressed alone (myc-p62) or co-expressed with p59
Figure 1:
Effect of
p59
As p62 and p59 We were
next interested in defining the nature of the p62/p59
Figure 2:
Phosphorylation of p62 by
p59
Dephosphorylation of
p62 should therefore rescue the ability of p62 to bind RNA. Expression
of p62 (with or without p59 It has been shown that the sites of tyrosine
phosphorylation by p59
Figure 3:
Regulatory tyrosines of RNA binding map to
the tyrosine rich C terminus of p62. p62-myc, with C-terminal
truncation of the tyrosine rich tail (p1-4), was expressed alone (lanes 1, 3, 4), or cotransfected with
p59
We
show here that p62 binding to RNA is highly dependent on the tyrosine
phosphorylation state of p62, with only unphosphorylated p62 able to
interact with RNA. Furthermore, we mapped the negative regulatory
tyrosines, necessary for phosphorylation-mediated inhibition of p62/RNA
binding, to the carboxyl-terminal region of p62. This region, however,
does not directly mediate p62 binding to RNA by virtue of previously
published reports(15) , and also by our observation that
truncation of the carboxyl-terminal region does not abrogate p62/RNA
interaction (Fig. 3). The negative regulatory tyrosines in the
carboxyl-terminal domain of p62 must therefore indirectly mediate the
loss of p62 binding to RNA. One possibility is that p62 only binds to
RNA as an oligomer whose formation is inhibited by tyrosine
phosphorylation. This may explain how the single KH domain in p62 is
capable of binding RNA while another KH homology protein, FMR1,
requires multiple tandem KH domains to bind
RNA(21, 22, 27, 28) . Another
possibility is that the phosphorylated carboxyl terminus which is
negatively charged interacts with the RNA contact site of the KH domain
thus sterically inhibiting the interaction of p62 with RNA. We are
currently testing both of these possibilities. In addition to the KH
domain, p62 contains another RNA binding motif, an RGG box. This motif
was originally shown to confer RNA binding to hnRNP U
protein(29) . It is characterized by several closely spaced
arginine-glycine-glycine (RGG) repeats (6 to 25) usually with
intervening aromatic residues. The RGG box within the p62 sequence is
abbreviated, comprised of only two RGG sequences, amino-terminal to the
KH domain. However, the p62 construct used for our assays did not
include this RGG box. Because this protein can still bind RNA, the
ability of p62 to bind RNA is not dependent on this sequence. We cannot
rule out, however, that this motif does not play any role in the
regulation or specificity of RNA binding. The finding that tyrosine
phosphorylation regulates p62 binding to RNA is remarkable because it
suggests for the first time that tyrosine kinase signaling pathways are
involved in the regulation of RNA. The regulation of RNA by signaling
could allow a quiescent cell to respond very rapidly to external
stimuli, much faster than protein expression from de novo transcription. As many cellular responses to signaling are rapid
(within minutes), it is surprising that most signaling research has
focused on the regulation of new transcription by signaling pathways
rather than the regulation of stored RNAs. Such regulation might be
envisioned to occur either by enhancing mRNA
stability(30, 31) , by regulating the rate and
efficiency of mRNA translation (32) or by specific targeting of
mRNA in the cytoplasm (33) . Specific localization of mRNAs in
the cell could play an important role in the delivery of specific
proteins to specific structures. As many cytoskeletal proteins contain
SH3 domains, one possibility is that p62/p68 helps target RNA to
cytoskeletal structures via SH3-mediated interactions. The finding that
protein/RNA interactions are regulated by tyrosine phosphorylation
suggests that RNA binding proteins will play specific and important
roles during signal transduction, cell growth and differentiation.
Volume 270,
Number 5,
Issue of February 3, 1995 pp. 2010-2013
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS AND DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
and p60
resulting in tyrosine
phosphorylation of p62(16, 17, 18) . Tyrosine
phosphorylated p62 can bind the SH2 domains of Grb2(19) ,
PLC
-1(19, 20) , and ras-GAP(15) .
However, the function of the p62 RNA binding domain is still not known.
DNA Constructs and Transfections
Proteins were
expressed using the vaccinia-T7 expression system as described
previously(34) . To ensure comparable expression levels of p62
(or p1-4), 1 µg of p62 (or p1-4) DNA was transfected as compared to
4 µg of p62 (or p1-4) DNA when p59 DNA (1 µg) was
cotransfected. The construction of plasmids encoding myc-tagged p62,
p1-4, and p59
were as described previously(19) .
The kinase-inactive p59
construct, containing a lysine to
arginine substitution at position 296, was generated by inverse
polymerase chain reaction using the 5` primer CCATGTCTCCGGAGTCCTTC and
the 3` primer TGCCTGGCTTGAGGGTCCTTATGGCTACTT.
Poly(U) Binding, and Immunoblotting
Following
transfection, cells were lysed on ice in 1% Triton X-100, 25 mM Tris (pH 7.4), 150 mM NaCl, 25 mM NaF, 100
uM sodium orthovanadate. Lysates were centrifuged to remove
insoluble material, and where indicated, 20 units of calf intestinal
phosphatase (CIP) (
)(Boehringer Mannheim) were added
followed by 30 min of incubation at room temperature. In assays
designated ``NO CIP,'' cell lysates received identical
treatment except that CIP was omitted. One-fourth of total cell lysate
was added to 20 µl of agarose-poly(U) beads (Pharmacia Biotech
Inc.) or agarose beads (Sigma) for 30 min, 4 °C. Beads were washed
twice with lysis buffer and eluted in Laemmli sample buffer. For
assessment of total protein expression, 2.5% of the cell lysate was
blotted. was generously provided by André Veillette. 4G10 phosphotyrosine antibody was purchased from Upstate
Biotechnology Inc.
in
HeLa cells using the vaccinia T7 expression system(26) . As
reported previously, co-expression of p62 with p59
results in efficient tyrosine phosphorylation of
p62(19) . Cell lysates were divided equally and incubated with
either poly(U) immobilized to agarose or agarose alone. Bound myc-p62
was analyzed by anti-myc immunoblotting (Fig. 1A, lanes 3-6). As expected, poly(U) beads bound p62
efficiently from cell lysates of cells expressing p62 alone (Fig. 1A, lane 4); no binding was detected to
the agarose beads alone (Fig. 1A, lanes 3 and 5). Interestingly, p59
co-expression with p62
resulted in almost no detectable binding of p62 to poly(U) suggesting
that p59
can regulate the ability of p62 to bind RNA (Fig. 1A, lane 6). Inability to detect bound
myc-p62 was not due to poor expression of myc-p62 in this sample;
anti-myc immunoblotting of a portion of the cell extract demonstrated
equivalent expression levels. (Fig. 1A, lanes 1 and 2).
coexpression on p62 binding to RNA. A, coexpression of p59
with p62
abrogates p62/RNA binding. HeLa cell lysates, transfected with either
p62-myc alone (lanes 1, 3, and 4) or
co-transfected with p62-myc and p59
(lanes
2, 5, and 6) were aliquoted and either
immunoblotted (2.5% of lysate) with anti-myc (lanes 1 and 2), or precipitated by an agarose (lanes 3 and 5) or poly(U)-agarose (lanes 4 and 6)
followed by anti-myc immunoblotting. Cell lysates were also
immunoblotted with anti-p59
(lanes 7 and 8). B, p62 binding to RNA is unaffected by
mixing lysates of p59
and p62 in vitro.
p62-myc or p59
were expressed in separate HeLa
cell cultures. Lysates were mixed at various stoichiometries before
binding reaction and anti-myc immunoblotting. p62 association with
agarose is shown in lane 1. p59
lysate was added
to a constant amount of p62 lysate before poly(U) binding at the
proportion of p62 lysate indicated in the figure label above each
respective lane (lanes 2-5).
can form stable
complexes, one possible explanation for this result was p59
competition with p62 for poly(U) binding. A lysate mixing
experiment was done to rule out this possibility. p62 or p59
were expressed independently in separate HeLa cell cultures, and
extracts were mixed and preincubated prior to binding studies. Fig. 1B shows that the addition of increasing amounts
of p59
cell lysate had no affect on binding of p62
binding to poly(U) (Fig. 1B, lanes 2-5).
This argues that an in vivo interaction between p62 and
p59
is necessary for loss of p62/RNA binding.
interaction required for the abrogation of p62 binding to RNA. To
assess the role of phosphorylation in p62/RNA binding, p62 was
co-expressed with a kinase inactive form of p59
(Dfyn).
HeLa cells were co-transfected with cDNAs for p62 and
p59
, p62 and Dfyn or with p62 alone. Co-expression of
kinase inactive p59
did not affect the interaction of p62
with RNA (lane 9). Immunoblotting of whole cell lysates were
performed to confirm p62 and p59
expression levels in the
appropriate transfected cells (Fig. 2, lanes
10-12). The level of endogenous p59
is shown
in lane 10, while lanes 11 and 12 confirmed
increased quantities of p59
in the co-transfections.
Anti-phosphotyrosine immunoblotting was performed on transfected cell
lysates to confirm that Dfyn was, in fact, inactive and that
co-expression of p59
with p62 resulted in tyrosine
phosphorylation of p62 (Fig. 2, lanes 13-15).
This concordance between phosphorylated p62 levels and diminution of
p62/RNA interaction implicates phosphorylation as a key regulatory
element in p62's propensity to bind RNA.
determines its ability to bind RNA. A, inhibition of p62 binding to RNA by p59
is dependent on p59
kinase activity.
Binding assays were performed from cell lysates expressing p62-myc
alone (lanes 1, 4, and 5), or co-expressing
p62-myc and p59
(lanes 2, 6,
and 7), or co-expressing p62-myc and kinase inactive
p59
(Dfyn, lanes 3, 8, and 9). p62 binding to agarose is shown in lanes 4, 6, and 8; p62 binding to poly(U) is shown in lanes 5, 7, and 9. To confirm expression of
p62 and p59
, a portion of the lysates were
immunoblotted with antibodies to myc (lanes 1-3),
p59
(lanes 10-12) and
phosphotyrosine (lanes 13-15) B, phosphatase
treatment of phosphorylated p62 rescues its ability to bind RNA.
Lysates from cells expressing p62-myc alone (lanes 1, 3, 4, and 5) or cotransfected with
p59
(lanes 2 and 6-8)
were aliquoted and incubated for 30 min (room temperature) in the
presence (+) or absence(-) of calf intestinal phosphatase.
Binding studies using either agarose (lanes 3 and 6)
or poly(U) (lanes 4, 5, 7, and 8)
were performed followed by anti-myc immunoblotting. Equivalent levels
of p62 expression was confirmed by myc immunoblotting (lanes 1 and 2). To confirm the phosphatase treatment, a portion
of the lysate was immunoblotted with antibodies to phosphotyrosine (lanes 9-12).
coexpression) and binding to
poly(U) were performed as described previously with one modification:
prior to the binding reaction, lysates were incubated for 30 min with
CIP. As previously shown, under normal binding conditions (no CIP), p62
bound RNA (Fig. 2B, lane 4), an interaction
which was impaired by coexpression of p59
(Fig. 2B, lane 7). Strikingly,
dephosphorylation of p62 (subsequent to p59
-induced
phosphorylation) rescued p62/RNA binding (Fig. 2B, lane 8). Phosphatase treatment of lysates from cells
expression p62 alone left p62 binding to RNA relatively unaffected (Fig. 2B, lane 5). Anti-myc immunoblotting of
whole cell lysates confirmed equivalent expression levels of p62 (Fig. 2B, lanes 1 and 2), and
anti-phosphotyrosine immunoblotting confirmed p62 dephosphorylation
under phosphatase conditions (Fig. 2B, lanes
9-12).
and src reside in the
carboxyl-terminal region of p62 (15, 19) . To test the
involvement of the carboxyl-terminal region of p62 in regulation of RNA
binding, we transfected a p62 construct lacking the tyrosine rich
carboxyl-tail (p1-4(19) ) and compared its binding activity
after co-expression with p59
. Binding studies were done,
as described previously, followed by anti-myc immunoblotting (Fig. 3, lanes 3-6). There was little RNA binding
difference between p1-4 alone and p1-4 co-expressed with p59
both formed strong associations with poly(U). Anti-myc and
anti-p59
immunoblotting were performed to confirm
equivalent and appropriate expression levels of p62 and p59
(Fig. 3, lanes 1 and 2 and data not
shown). Therefore, tyrosine phosphorylation of the carboxyl-terminal
region of p62 is involved in the regulation of p62/RNA binding.
(lanes 2, 5, and 6) in HeLa cells. Anti-myc immunoblotting was performed on
2.5% of each lysate (lanes 1 and 2) and on portions
of lysate passed over agarose (lanes 3 and 5) or
poly(U) column (lanes 4 and 6).
)
We thank Dr. Tim Schedl and Dr. Kathleen Hall for
insightful comments. We are also grateful to Cindy Zhu for generation
of ``Dfyn'' construct, Lisa Gauen, Susan Yang, and Dr.
Richard Wang for critical evaluation of the manuscript. Lastly, we
thank all of the members of our laboratory for assistance.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. P. Paronetto, V. Messina, E. Bianchi, M. Barchi, G. Vogel, C. Moretti, F. Palombi, M. Stefanini, R. Geremia, S. Richard, et al. Sam68 regulates translation of target mRNAs in male germ cells, necessary for mouse spermatogenesis J. Cell Biol., April 20, 2009; 185(2): 235 - 249. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M.-E. Huot, C. M. Brown, N. Lamarche-Vane, and S. Richard An Adaptor Role for Cytoplasmic Sam68 in Modulating Src Activity during Cell Polarization Mol. Cell. Biol., April 1, 2009; 29(7): 1933 - 1943. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
G. Chawla, C.-H. Lin, A. Han, L. Shiue, M. Ares Jr., and D. L. Black Sam68 Regulates a Set of Alternatively Spliced Exons during Neurogenesis Mol. Cell. Biol., January 1, 2009; 29(1): 201 - 213. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. G. Suzuki, S. Imanishi, N. Dohmae, T. Nishimura, T. Shimada, and S. Matsumoto Establishment of a Novel In Vivo Sex-Specific Splicing Assay System To Identify a trans-Acting Factor That Negatively Regulates Splicing of Bombyx mori dsx Female Exons Mol. Cell. Biol., January 1, 2008; 28(1): 333 - 343. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Smida, A. Posevitz-Fejfar, V. Horejsi, B. Schraven, and J. A. Lindquist A novel negative regulatory function of the phosphoprotein associated with glycosphingolipid-enriched microdomains: blocking Ras activation Blood, July 15, 2007; 110(2): 596 - 625. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. P. Paronetto, T. Achsel, A. Massiello, C. E. Chalfant, and C. Sette The RNA-binding protein Sam68 modulates the alternative splicing of Bcl-x J. Cell Biol., March 26, 2007; 176(7): 929 - 939. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Paronetto, F. Zalfa, F. Botti, R. Geremia, C. Bagni, and C. Sette The Nuclear RNA-binding Protein Sam68 Translocates to the Cytoplasm and Associates with the Polysomes in Mouse Spermatocytes Mol. Biol. Cell, January 1, 2006; 17(1): 14 - 24. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 K. E. Lukong, D. Larocque, A. L. Tyner, and S. Richard Tyrosine Phosphorylation of Sam68 by Breast Tumor Kinase Regulates Intranuclear Localization and Cell Cycle Progression J. Biol. Chem., November 18, 2005; 280(46): 38639 - 38647. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
A. Haegebarth, D. Heap, W. Bie, J. J. Derry, S. Richard, and A. L. Tyner The Nuclear Tyrosine Kinase BRK/Sik Phosphorylates and Inhibits the RNA-binding Activities of the Sam68-like Mammalian Proteins SLM-1 and SLM-2 J. Biol. Chem., December 24, 2004; 279(52): 54398 - 54404. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. E. Mabrouk, Q. N. Diep, K. Benkirane, R. M. Touyz, and E. L. Schiffrin SAM68: a downstream target of angiotensin II signaling in vascular smooth muscle cells in genetic hypertension Am J Physiol Heart Circ Physiol, May 1, 2004; 286(5): H1954 - H1962. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. P. Paronetto, D. Farini, I. Sammarco, G. Maturo, G. Vespasiani, R. Geremia, P. Rossi, and C. Sette Expression of a Truncated Form of the c-Kit Tyrosine Kinase Receptor and Activation of Src Kinase in Human Prostatic Cancer Am. J. Pathol., April 1, 2004; 164(4): 1243 - 1251. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. B. Fredj, J. Grange, R. Sadoul, S. Richard, Y. Goldberg, and V. Boyer Depolarization-induced translocation of the RNA-binding protein Sam68 to the dendrites of hippocampal neurons J. Cell Sci., March 1, 2004; 117(7): 1079 - 1090. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Ceman, W. T. O'Donnell, M. Reed, S. Patton, J. Pohl, and S. T. Warren Phosphorylation influences the translation state of FMRP-associated polyribosomes Hum. Mol. Genet., December 15, 2003; 12(24): 3295 - 3305. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 P. Lasko Gene Regulation at the RNA Layer: RNA Binding Proteins in Intercellular Signaling Networks Sci. Signal., April 22, 2003; 2003(179): re6 - re6. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. H. Coyle, B. W. Guzik, Y.-C. Bor, L. Jin, L. Eisner-Smerage, S. J. Taylor, D. Rekosh, and M.-L. Hammarskjold Sam68 Enhances the Cytoplasmic Utilization of Intron-Containing RNA and Is Functionally Regulated by the Nuclear Kinase Sik/BRK Mol. Cell. Biol., January 1, 2003; 23(1): 92 - 103. [Abstract] [Full Text]
|
|
|
|
|
|
A. Ostareck-Lederer, D. H. Ostareck, C. Cans, G. Neubauer, K. Bomsztyk, G. Superti-Furga, and M. W. Hentze c-Src-Mediated Phosphorylation of hnRNP K Drives Translational Activation of Specifically Silenced mRNAs Mol. Cell. Biol., July 1, 2002; 22(13): 4535 - 4543. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 N. N. Huang, D. E. Mootz, A. J. M. Walhout, M. Vidal, and C. P. Hunter MEX-3 interacting proteins link cell polarity to asymmetric gene expression in Caenorhabditis elegans Development, January 2, 2002; 129(3): 747 - 759. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 V. B. Soros, H. V. Carvajal, S. Richard, and A. W. Cochrane Inhibition of Human Immunodeficiency Virus Type 1 Rev Function by a Dominant-Negative Mutant of Sam68 through Sequestration of Unspliced RNA at Perinuclear Bundles J. Virol., September 1, 2001; 75(17): 8203 - 8215. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 C. Gilbert, F. Barabe, E. Rollet-Labelle, S. G. Bourgoin, S. R. McColl, B. B. Damaj, and P. H. Naccache Evidence for a Role for SAM68 in the Responses of Human Neutrophils to Ligation of CD32 and to Monosodium Urate Crystals J. Immunol., April 1, 2001; 166(7): 4664 - 4671. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. J. Derry, S. Richard, H. Valderrama Carvajal, X. Ye, V. Vasioukhin, A. W. Cochrane, T. Chen, and A. L. Tyner Sik (BRK) Phosphorylates Sam68 in the Nucleus and Negatively Regulates Its RNA Binding Ability Mol. Cell. Biol., August 15, 2000; 20(16): 6114 - 6126. [Abstract] [Full Text]
|
|
|
|
|
|
A. M. Hartmann, O. Nayler, F. W. Schwaiger, A. Obermeier, and S. Stamm The Interaction and Colocalization of Sam68 with the Splicing-associated Factor YT521-B in Nuclear Dots Is Regulated by the Src Family Kinase p59fyn Mol. Biol. Cell, November 1, 1999; 10(11): 3909 - 3926. [Abstract] [Full Text]
|
|
|
|
|
|
T. Chen, F.-M. Boisvert, D. P. Bazett-Jones, and S. Richard A Role for the GSG Domain in Localizing Sam68 to Novel Nuclear Structures in Cancer Cell Lines Mol. Biol. Cell, September 1, 1999; 10(9): 3015 - 3033. [Abstract] [Full Text]
|
|
|
|
|
|
V. Lang, M. Semichon, F. Michel, C. Brossard, H. Gary-Gouy, and G. Bismuth Fyn Membrane Localization Is Necessary to Induce the Constitutive Tyrosine Phosphorylation of Sam68 in the Nucleus of T Lymphocytes J. Immunol., June 15, 1999; 162(12): 7224 - 7232. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 M. Di Fruscio, T. Chen, and S. Richard Characterization of Sam68-like mammalian proteins SLM-1 and SLM-2: SLM-1 is a Src substrate during mitosis PNAS, March 16, 1999; 96(6): 2710 - 2715. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. M. Aarts, D. Levy, B. He, S. Stregger, T. Chen, S. Richard, and J. E. Henderson Parathyroid Hormone-related Protein Interacts with RNA J. Biol. Chem., February 19, 1999; 274(8): 4832 - 4838. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. Di Fruscio, T. Chen, S. Bonyadi, P. Lasko, and S. Richard The Identification of Two Drosophila K Homology Domain Proteins. KEP1 AND SAM ARE MEMBERS OF THE Sam68 FAMILY OF GSG DOMAIN PROTEINS J. Biol. Chem., November 13, 1998; 273(46): 30122 - 30130. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
E. E. Saffman, S. Styhler, K. Rother, W. Li, S. Richard, and P. Lasko Premature Translation of oskar in Oocytes Lacking the RNA-Binding Protein Bicaudal-C Mol. Cell. Biol., August 1, 1998; 18(8): 4855 - 4862. [Abstract] [Full Text]
|
|
|
|
|
|
T. Chen and S. Richard Structure-Function Analysis of Qk1: a Lethal Point Mutation in Mouse quaking Prevents Homodimerization Mol. Cell. Biol., August 1, 1998; 18(8): 4863 - 4871. [Abstract] [Full Text]
|
|
|
|
|
|
H. Kanamori, R. E. Dodson, and D. J. Shapiro In Vitro Genetic Analysis of the RNA Binding Site of Vigilin, a Multi-KH-Domain Protein Mol. Cell. Biol., July 1, 1998; 18(7): 3991 - 4003. [Abstract] [Full Text]
|
|
|
|
|
|
H.-L. Li, M. S. Forman, T. Kurosaki, and E. Pure Syk Is Required for BCR-mediated Activation of p90Rsk, but Not p70S6k, via a Mitogen-activated Protein Kinase-independent Pathway in B Cells J. Biol. Chem., July 18, 1997; 272(29): 18200 - 18208. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Fusaki, A. Iwamatsu, M. Iwashima, and J.-i. Fujisawa Interaction between Sam68 and Src Family Tyrosine Kinases, Fyn and Lck, in T Cell Receptor Signaling J. Biol. Chem., March 7, 1997; 272(10): 6214 - 6219. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Barlat, F. Maurier, M. Duchesne, E. Guitard, B. Tocque, and F. Schweighoffer A Role for Sam68 in Cell Cycle Progression Antagonized by a Spliced Variant within the KH Domain J. Biol. Chem., February 7, 1997; 272(6): 3129 - 3132. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Beslu, J. LaRose, N. Casteran, D. Birnbaum, E. Lecocq, P. Dubreuil, and R. Rottapel Phosphatidylinositol-3' Kinase Is Not Required for Mitogenesis or Internalization of the Flt3/Flk2 Receptor Tyrosine Kinase J. Biol. Chem., August 16, 1996; 271(33): 20075 - 20081. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
I. Van Seuningen, J. Ostrowski, X. R. Bustelo, P. R. Sleath, and K. Bomsztyk The K Protein Domain That Recruits the Interleukin 1-responsive K Protein Kinase Lies Adjacent to a Cluster of c-Src and Vav SH3-binding Sites J. Biol. Chem., November 10, 1995; 270(45): 26976 - 26985. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 A R Jones and T Schedl Mutations in gld-1, a female germ cell-specific tumor suppressor gene in Caenorhabditis elegans, affect a conserved domain also found in Src-associated protein Sam68. Genes & Dev., June 15, 1995; 9(12): 1491 - 1504. [Abstract] [PDF]
|
|
|
|
|
|
R. C. Hresko and M. Mueckler A Novel 68-kDa Adipocyte Protein Phosphorylated on Tyrosine in Response to Insulin and Osmotic Shock J. Biol. Chem., June 9, 2000; 275(24): 18114 - 18120. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
J. C. Edwards and S. Kapadia Regulation of the Bovine Kidney Microsomal Chloride Channel p64 by p59fyn, a Src Family Tyrosine Kinase J. Biol. Chem., October 6, 2000; 275(41): 31826 - 31832. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
O. Stoss, M. Olbrich, A. M. Hartmann, H. Konig, J. Memmott, A. Andreadis, and S. Stamm The STAR/GSG Family Protein rSLM-2 Regulates the Selection of Alternative Splice Sites J. Biol. Chem., March 16, 2001; 276(12): 8665 - 8673. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
T. Chen, J. Cote, H. V. Carvajal, and S. Richard Identification of Sam68 Arginine Glycine-rich Sequences Capable of Conferring Nonspecific RNA Binding to the GSG Domain J. Biol. Chem., August 10, 2001; 276(33): 30803 - 30811. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
M. T. Bedford, A. Frankel, M. B. Yaffe, S. Clarke, P. Leder, and S. Richard Arginine Methylation Inhibits the Binding of Proline-rich Ligands to Src Homology 3, but Not WW, Domains J. Biol. Chem., May 19, 2000; 275(21): 16030 - 16036. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |