Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parada, C. A.
Right arrow Articles by Roeder, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parada, C. A.
Right arrow Articles by Roeder, R. G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 5, Issue of February 3, 1995 pp. 2274-2283
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
A Novel LBP-1-mediated Restriction of HIV-1 Transcription at the Level of Elongation in Vitro(*)

(Received for publication, August 19, 1994; and in revised form, November 1, 1994)

Camilo A. Parada (§) Jong-Bok Yoon (¶) Robert G. Roeder

From the Laboratory of Biochemistry and Molecular Biology, the Rockefeller University, New York, New York 10021

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The cellular factor, LBP-1, can repress HIV-1 transcription by preventing the binding of TFIID to the promoter. Here we have analyzed the effect of recombinant LBP-1 on HIV-1 transcription in vitro by using a ``pulse-chase'' assay. LBP-1 had no effect on initiation from a preformed preinitiation complex and elongation to position +13 (``pulse''). However, addition of LBP-1 after RNA polymerase was stalled at +13 strongly inhibited further elongation (``chase'') by reducing RNA polymerase processivity. Severe mutations of the high affinity LBP-1 binding sites between -4 and +21 did not relieve the LBP-1-dependent block. However, LBP-1 could bind independently to upstream low affinity sites (-80 to -4), suggesting that these sites mediate the effect of LBP-1 on elongation. These results demonstrate a novel function of LBP-1, restricting HIV-1 transcription at the level of elongation. In addition, Tat was found to suppress the antiprocessivity effect of LBP-1 on HIV-1 transcription in nuclear extracts. These findings strongly suggest that LBP-1 may provide a natural mechanism for restricting the elongation of HIV-1 transcripts and that this may be a target for the action of Tat in enhancing transcription.


INTRODUCTION

Transcription from the HIV-1 (^1)promoter is regulated through upstream elements (-120 to -77) by the inducible activator NF-kappaB and through a downstream element (+14 to +44) by the virus-coded Tat protein (reviewed in (1) ). In between lie DNA elements that are recognized by the constitutive activator SP1, which may facilitate Tat and NF-kappaB functions(2, 3) , and core promoter elements (TATA and Initiator) which are recognized by the basic transcriptional machinery(4, 5, 6) . Embedded within the latter elements are additional sites, recognized minimally by the cellular factor LBP-1 (7, 8) , that may contribute to basal promoter activity.

The viral Tat protein is essential for virus replication and activates transcription throughout a stem-loop structure (TAR) in the nascent HIV-1 mRNA(1) , most likely in conjunction with other cellular cofactors (9, 10 and references therein). Various in vivo studies have documented stimulatory effects of Tat on transcriptional elongation (11, 12, 13, 14) and, in some cases, on transcription initiation as well(12, 13, 14, 15) . Consistent with a more commonly observed effect of Tat on elongation in vivo, in vitro studies have revealed a large effect of Tat mainly at the level of elongation and further documented distinct classes (weakly versus highly processive) of elongation complexes(16, 17, 18, 19, 20) . While the precise mechanism for Tat effects on elongation is unknown, the simplest model invokes an alteration in processivity of the elongation complex in a co-transcriptional manner, possibly analogous to the action of the RNA-bound N protein in conferring anti-termination properties on the associated RNA polymerase(21) . On the other hand, and consistent with possible effects of Tat on levels of initiation as well, it has been shown that activation by Tat (but not NF-kappaB) requires a specific TATA element(3, 22, 23) , that Tat can function when tethered to the promoter by fused DNA binding domains(24, 25, 26, 27) , and that Tat can stabilize preinitiation complexes(20) . To explain these diverse phenomena, it has been suggested (12, 13, 28, 29, 30) that TAR-bound Tat could function during assembly of the subsequent PIC (``reach back'' mechanism) to effect formation of a more processive complex, analogous to that formed by conventional activators, and possibly the rate of initiation as well.

Possibly related to the issue of Tat function is the demonstration of short stable HIV-1 transcripts that may either decrease or remain unchanged (depending on the assay) following induction by Tat of long transcripts(11, 31, 32, 33, 34, 35) . While such transcripts could be derived (possibly by processing; (30) and (33) ) from less processive elongation complexes, their formation could provide initial RNA binding sites for Tat function. A downstream element (-1 to +26), designated IST, that induces synthesis of short transcripts has been described (32, 35) . While IST mutations eliminating short transcript synthesis failed to eliminate Tat induction of long transcripts(35) , it has been suggested (28) that the low but demonstrable basal transcription in the transfection assays employed might generate sufficient nascent RNA for initiation of the Tat response. The cellular factors responsible for IST function are unknown. However, the cellular factor LBP-1 was previously shown (7, 8, 37) to interact in a concentration-dependent manner with a high affinity site (-4 to +21) overlapping both Inr-like elements (5, 6) and the IST element (32, 35) and with a low affinity site (-38 to -16) that overlaps the TATA box. Promoter mutagenesis studies led to the conclusion that LBP-1 is not involved in either IST function (35) or Tat induction(36) , but studies to be described here leave this possibility open. While LBP-1 per se has not been shown to activate transcription via the high affinity recognition sites which contribute to promoter activity(7, 37) , high concentrations of this factor have been shown to repress transcription initiation when bound to upstream sites prior to TFIID binding to the interspersed TATA element(37) . Here, we document the ability of a recombinant LBP-1 isoform (38) to reduce the processivity of RNA polymerase initiated at the HIV-1 promoter, and we discuss a possible relationship to Tat-induced transcription.


EXPERIMENTAL PROCEDURES

DNA Templates

The wild type HIV-1 template contained long terminal repeat sequences from -167 to +80 in the chloramphenicol acetyltransferase expression plasmid p-167(39) . The HIV-1/IS4 template was identical except that it contained long terminal repeat sequences from -167 to +58 with triple mutations in each of the three LBP-1 recognition elements in the high efficiency binding sites (-4 to +21) (see (37) and the legend to Fig. 5). The adenovirus major late (AdML) template contained promoter sequences from -404 to +10 in pML(C(2)AT) plasmid(40) . The HIV-1 and AdML plasmids were linearized with MscI and SmaI in order to score accurately initiated run-off transcripts of 600 nt and 380 nt, respectively. Restricted DNAs were ethanol-precipitated, and pellets were washed twice with 70% ethanol prior to resuspension in TE buffer (10 mM Tris-HCl, pH 7.5, and 0.2 mM EDTA).


Figure 5: Analysis of the LBP-1b elongation block on normal and mutated (IS4) promoters. PICs formed with both HIV-1 (WT DNA) and HIV-1/IS4 (IS4 DNA) promoters were isolated as described under ``Experimental Procedures'' and analyzed by the pulse-chase assay. After the pulse, increasing amounts of LBP-1b were added as indicated (lanes 3, 4, 7, and 8), and reaction mixtures were incubated at 30 °C for 7 min. The chase was performed thereafter for 20 min at 30 °C. The reaction products from the pulse are indicated as 13-mer (lanes 1 and 5) and from the chase as 600 nt (lanes 2 and 6). However, because of base substitution near the start site in IS4 (below), the corresponding paused transcripts are several nucleotides shorter. A schematic drawing in the bottom of the figure shows the HIV-1 promoter containing low affinity LBP-1 binding sites flanking the TATA box and either wild type or mutated (IS4) high affinity LBP-1 recognition sites. The DNA sequence of the Wt promoter region from -4 to +21 is ACTGGGTCTCTCTGGTTAGACCAGA (LBP-1 binding sites underlined) while that of the Mt/IS4 promoter on this region is AGATGGTCTCTAGTGTTAGCAAAGA (mutated residues in bold type)(37) .



Expression and Purification of Recombinant Tat and LBP-1b

Histidine-tagged Tat (41) and histidine-tagged LBP-1b (38) were expressed in Escherichia coli and purified to homogeneity as described.

Standard in Vitro Transcription and ``Pulse-Chase'' Analyses

HeLa nuclear extracts were prepared as described(42) . Standard reactions for preinitiation complex (PIC) formation (12.5 µl) contained: 15 mM Tris-HCl, pH 7.9, 20 mM HEPES-KOH, pH 8.0, 12% glycerol, 0.1 mM EDTA, 4 mM dithiothreitol, 6 mM MgCl(2), 70 mM KCl, 5 mM creatine phosphate (Sigma), 40 µg/ml creatine kinase (Sigma), 5 units of RNasin (Promega), 60 µg of nuclear extract proteins, and linearized HIV-1 and AdML template DNAs (50 ng each). In the various analyses, the components were preincubated for 10-30 min (as indicated) to allow PIC formation. In the analysis of Fig. 8, PIC formation was followed by addition of 12.5 µM [alpha-P]UTP (3000 Ci/mmol) and 500 µM each of CTP, GTP, and ATP and further incubation for the indicated periods of time. Other additions (LBP-1 and Tat), and exceptions to the order of addition, were as indicated in the figures and figure legends. In the pulse-chase analysis of Fig. 1, PIC formation was followed by sequential additions of LBP-1, 50 µM dATP, 25 µM GTP and CTP, and 0.25 µM (10 µCi) [alpha-P]UTP, and incubation was for 3 min at 30 °C (``pulse''); this was followed by the addition of 500 µM each of ATP, GTP, and CTP and 1000 µM UTP, and further incubation was at 30 °C for 20 min (``chase''). The modified pulse-chase analysis for other figures is detailed below.


Figure 8: Effect of Tat on elongation block of HIV-1 transcripts by LBP-1b. Standard transcription assays were performed, as indicated in the figure and detailed under ``Experimental Procedures,'' with 50 ng each of HIV-1 and AdML promoters and 100 ng of poly(dI-dC). PIC formation was followed by the addition of LBP-1, Tat, GTP, CTP, ATP, and [alpha-P]UTP and further incubation for 60 min at 30 °C.




Figure 1: Specific inhibition of HIV-1 transcription by recombinant LBP-1b in vitro. The pulse-chase analysis was performed with unfractionated nuclear extract as indicated in the figure and detailed under ``Experimental Procedures.'' After PIC formation, transcription from both HIV-1 and AdML promoters was initiated with the addition of dATP, GTP, CTP and [alpha-P]UTP (pulse) in the presence or absence of LBP-1 as indicated.



All reactions were terminated by addition of 50 µl of 25 mM EDTA solution and extracted with phenol/chloroform. Nucleic acids were precipitated with ethanol after addition of yeast tRNA and ammonium acetate to final concentrations of 20 µg/ml and 3 M, pH 7.5, respectively. Reaction products ( Fig. 1and Fig. 8) were analyzed by electrophoresis through a denaturing 6% polyacrylamide gel containing 50% urea. In order to determine the level of either activation or repression of HIV-1 transcription by Tat or LBP-1, respectively, labeled bands were excised from the gel, and the radioactivity was measured by liquid scintillation counting.

Isolation of PICs by Gel Filtration and Pulse-Chase Assay

The isolation of PICs by gel filtration and subsequent pulse-chase assay (Fig. 2Fig. 3Fig. 4Fig. 5) were as described (43) with the following modifications. The PICs for 8 standard transcription reactions were formed by incubating about 50 µg of HeLa nuclear extract with 800 ng of HIV-1 promoter in a final volume of 50 µl for 20 min at 30 °C, under buffer conditions described above except for the presence of 8 mM MgCl(2) and 80 mM KCl. Then the protein-DNA complexes (PICs) were isolated by spin dialysis (44) through Bio-Gel A-1.5m columns equilibrated with transcription buffer without nucleotides. The isolated complexes (in about 80 µl) were used immediately for pulse-chase analysis. The pulse involved incubation of 10 µl of gel-filtered PICs with 25 µM (each) CTP and GTP, 50 µM dATP, and 0.25 µM [alpha-P]UTP (10 µCi, 3000 Ci/mmol) at 30 °C for 5 min. In the absence of ATP, this procedure leads to formation of a stably stalled RNA polymerase at around position +13 on the HIV-1 promoter. The chase was carried out by incubating stalled elongation complexes with 500 µM each CTP, GTP, and ATP and 1 mM UTP for 10 to 20 min at 30 °C. It should be noted that the processivity of RNA polymerase during the chase is highly dependent on the concentration of salt in the assay(43, 45) . At 200 mM KCl or 0.2% sarkosyl, the chase of transcripts is very efficient, and most of the transcripts are full-length (600 nt) (data not shown). In the present study, all transcription analyses were performed at 70 mM KCl, except when otherwise indicated. The reaction products from all the pulse-chase analyses described here were processed as described above and fractionated on denaturing 20% polyacrylamide gels.


Figure 2: Kinetic analysis of HIV-1 transcript formation in a single round of transcription. The pulse-chase assay with isolated PICs was performed as indicated in the figure and detailed under ``Experimental Procedures,'' except that the KCl concentration was 50 mM. The transcription products from the pulse are shown in lane 1 (indicated as 13-mer), and those from the chase are shown in lanes 2-8 (full-length run-off transcripts are 600 nt). Numbers on the top of each lane indicate the period of time for pulse (lane 1) and chase (lanes 2-8), respectively. In lane 8, after a 10-min chase, 200 mM KCl (*) was added to the reaction and further incubated at 30 °C for 10 min. The arrow shows a short RNA transcript of 70 nt suggesting that RNA polymerase pauses at position +70 downstream of the promoter. The other discrete pause site evident in lanes 2-8 lies near position +110. It should be noted that in this kind of assay the amount of radioactivity present in any given lane does not change by more than 10% (C. A. Parada, J.-B. Yoon, and R. G. Roeder, unpublished observation). Furthermore, in other analyses, the distribution of transcripts observed after a 10-min chase (lane 7) remained unchanged even after a 60-min chase (data not shown).




Figure 3: Effect of recombinant LBP-1b on HIV-1 transcription in vitro. Pulse-chase assays were performed with isolated PICs as diagrammed in Fig. 2and detailed under ``Experimental Procedures.'' A, lack of an effect of LBP-1b on initiation/early elongation of HIV-1 transcripts. HIV-1 PICs were isolated under standard transcription reaction conditions (without NTPs) at 70 mM KCl. PICs were then incubated either in the absence (lane 1) or in the presence of increasing amounts of LBP-1 (lanes 2 and 3) for 7 min at 30 °C before performing a pulse (P) reaction as in Fig. 2. The various transcription reaction products are indicated. B, block of elongation of HIV-1 transcripts by LBP-1b. After the formation of an early elongation complex with RNA polymerase stalled at position +13 (pulse), as detailed under ``Experimental Procedures,'' 50 ng and 100 ng of LBP-1b were added to transcription reactions in the absence (lanes 1-4) or presence (lanes 5-8) of 60 µg of HeLa nuclear extract and incubated for 7 min at 30 °C. Unlabeled NTPs were then added, and the reaction mixture was further incubated for another 20 min to score formation of 600-nt transcripts (chase). Lanes 1 and 5 show the reaction products (13-mer) of the pulse (P). Numbers on the side refer to transcript size markers.




Figure 4: Characterization of the HIV-1 transcription block by LBP-1b. A, effect of KCl on HIV-1 elongation complexes paused by LBP-1b. Pulse-chase assays were performed with isolated PICs either in the absence (lanes 1 and 3) or in the presence (lanes 2 and 4) of LBP-1b as diagrammed in Fig. 2and detailed in the legend to Fig. 3. In addition, 200 mM KCl was added to the reaction in lane 4 (*) after the standard chase, and all reactions then were incubated for an additional 20 min at 30 °C. The paused transcripts observed after a 20-min chase under standard conditions (lane 3) were not further extended even in a 60-min chase. B, reversal of LBP-1b elongation block by oligonucleotides that bind LBP-1. The pulse was performed as diagrammed in Fig. 2and detailed under ``Experimental Procedures.'' LBP-1b (100 ng) was then added either alone (lane 3) or with an oligonucleotide containing high affinity LBP-1 recognition sites (Wt, lane 4), or with an oligonucleotide containing mutations in high affinity LBP-1 recognition sites (IS4 mutation, see Fig. 5legend) (Mt, lane 5). The reaction mixtures were then incubated for 7 min at 30 °C prior to execution of the chase. Both Wt and Mt oligonucleotides were present at a 100-fold molar excess over the DNA template. Lanes 1 and 2 show the products of control pulse (13-mer) and chase (600 nt) reactions, respectively.



Gel Mobility Shift Assay

These analyses were performed as described (38) with some modifications. Ten fmol of double-stranded radiolabeled oligonucleotide containing high affinity LBP-1 recognition sites from the HIV-1 promoter (-4 to +21) were used to measure binding of recombinant LBP-1b. The reaction mixture contained 20 mM HEPES-KOH, pH 8.0, 1 mM dithiothreitol, 4% Ficoll type 400, 70 mM KCl, 1 mM spermidine, 0.03% Nonidet P-40, and 100 µg/ml bovine serum albumin. The amounts of nonspecific competitor poly(dI-dC), or specific oligonucleotide competitors, are indicated. Reaction products were analyzed by a 4% (60:1, acrylamide:bisacrylamide) nondenaturing gel in 0.5 times Tris borate-EDTA buffer and 0.03% Nonidet P-40.


RESULTS

LBP-1 Specifically Inhibits HIV-1 Transcription by a Mechanism That Does Not Affect Transcription Initiation

A cDNA cloning project directed toward a further investigation of the role of LBP-1 in HIV-1 transcription resulted in the isolation of four human cDNAs encoding variant forms of LBP-1(38) . In an initial functional characterization, isoforms LBP-1a, LBP-1b, and LBP-1c each were found to behave similarly to natural LBP-1 with respect to site-specific DNA binding and the ability to inhibit HIV-1 transcription at the level of initiation (by blocking TFIID binding to the TATA box; (37) ). In each case, this inhibition was relieved by mutations in the high affinity LBP-1 recognition sites (mutant IS4) on the HIV-1 promoter. In contrast, the variant (LBP-1d) which shows no DNA binding also failed to inhibit transcription. Given the apparently similar properties of LBP-1a, -1b, and -1c relative to each other and to highly purified natural LBP-1, we used the recombinant LBP-1b, which contains all putative LBP-1 domains (38) , for further studies.

During the course of our studies on repression of HIV-1 transcription initiation by LBP-1b in extracts from HeLa cells, it was observed that recombinant LBP-1b (hereafter referred to as LBP-1 in this paper) could inhibit transcription in a dose-dependent manner even when added after preinitiation complex (PIC) formation. Thus, in the analysis of Fig. 1, the HIV-1 template and a control adenovirus MLP template were preincubated with nuclear extract prior to addition of LBP-1. Transcription was subsequently scored by the pulse-chase assay diagrammed in Fig. 1(see below also). Since these assay conditions preclude the inhibition of TFIID binding to the promoter by exogenous LBP-1 (by preforming a stable PIC) and score only a single round of transcription(37) , it was surprising to find that even under these conditions LBP-1 specifically inhibited HIV-1 transcription and not MLP transcription (Fig. 1, lanes 1-4). This result suggested that LBP-1 could also repress HIV-1 transcription by a mechanism different from that involving exclusion of TFIID binding to the TATA box. Moreover, this effect was specific for the HIV-1 promoter when compared to a control adenovirus promoter (MLP) lacking LBP-1 binding sites.

Characterization of Initiation and Elongation of HIV-1 Transcripts by a Pulse-Chase Analysis of Isolated Preinitiation Complexes

To determine how LBP-1 inhibits HIV-1 transcription subsequent to preinitiation complex (PIC) formation (see below), we developed a modified pulse-chase assay (diagrammed in Fig. 2) that involves both the formation (in crude extracts) and the purification (by gel filtration) of PICs prior to functional analysis(43) . During the subsequent pulse, the isolated HIV-1 PICs were incubated under transcription conditions with GTP, CTP, [alpha-P]UTP, and dATP (but not ATP), thus allowing initiation and elongation only to position +13 since the first A is encountered at the +14 position in the HIV-1 promoter. During the chase, the artificially stalled elongation complexes were incubated further with an excess of all four ribonucleoside triphosphates in order to dilute the labeled UTP and to allow normal elongation past position +13. Under these conditions, it was expected that most of the artificially stalled RNA complexes would resume elongation and produce a 600-nt run-off RNA. The data in Fig. 2show such a pulse-chase assay for isolated PICs in the absence of added LBP-1. Here, the pulse produced, as expected, a small population of short transcripts of about 13 nucleotides (lane 1). However, a 10-min chase at 50 mM KCl resulted in a distribution of partially elongated (paused) transcripts which extended to points lying between nucleotide 110 (the position of a discrete transcript) and nucleotide 600 (lane 7, see also the legend to Fig. 2). Importantly, most of these arrested transcripts were further elongated to 600 nt (the end of the template) when 200 mM KCl was added to an equivalent reaction and incubated for an additional period of time (Fig. 2, lane 8 versus lane 7), indicating that most of the transcription complexes are reversibly paused rather than terminated(45, 46, 47) . The clear restriction of elongation of HIV-1 transcripts in this particular pulse-chase assay at 50 mM KCl may reflect either interactions (during PIC formation) of factors which limit processivity or the loss (during PIC isolation) of elongation or anti-pausing activities (e.g. TFIIS, TFIIF, or TFIIX) which enhance RNA polymerase II processivity (reviewed in (48) ; see also (46) and (49) ).

The kinetic analysis during the chase showed a clear pause site near +70, with the accumulated transcripts chased as a function of time (Fig. 2, lanes 2-7). This pause was observed previously both in vitro, with a (dC)(n)-tailed HIV-1 promoter which allows initiation independent of promoter elements(50) , and in vivo(11, 32, 33, 34, 35) . Thus, it was interesting to find that, under our assay conditions, the RNA polymerase pauses at +70 even at high concentrations of KCl and sarkosyl where the elongation complex is highly processive (data not shown). The mechanistic relevance of this pause to Tat function is presented under ``Discussion.''

Pulse-Chase Assays Reveal That LBP-1 Can Block Elongation of HIV-1 Transcripts from Isolated Preinitiation Complexes

LBP-1 inhibited HIV-1 transcription in the cell-free system under conditions where PICs were preformed (Fig. 1). To investigate this repression of HIV-1 transcription by LBP-1, we used the modified pulse-chase assay (involving PIC isolation) described in Fig. 2. As expected, and consistent with our earlier observation that prebinding of TFIID to the promoter prevented repression of initiation by LBP-1(37) , the addition of LBP-1 during the pulse did not block formation of the 13-mer (i.e. did not inhibit initiation and very early elongation steps) (Fig. 3A, lanes 2 and 3 versus lane 1). However, addition of LBP-1 during the chase blocked the normal elongation of HIV-1 transcripts to a 600-nt run-off RNA in a protein concentration-dependent manner (Fig. 3B, left). It should also be noted that, under the moderate salt concentration (70 mM KCl) employed here, a large fraction of the stalled complexes produced full-length run-off transcripts during the chase (although a partial restriction to elongation was still apparent). Hence, when LBP-1 was present at a molar ratio (relative to the promoter) of about 10 (50 ng), there was a partial block of elongation proximal to the promoter and, interestingly, also a block of transcripts more distal to the promoter (Fig. 3B, lane 2 versus lane 3). In contrast, when the LBP-1 to promoter ratio was increased to about 20 (100 ng of LBP-1), there was a nearly complete elongation block proximal to the promoter, with a corresponding reduction of 70-nucleotide and longer transcripts (Fig. 3B, lane 4 versus lanes 3 and 2). Although we did not observe a uniform accumulation of short RNA transcripts as a result of the addition of LBP-1, the pulse-chase assay has revealed a novel in vitro LBP-1 activity, namely, the ability to restrict the elongation of HIV-1 transcripts by reducing the processivity of RNA polymerase.

It is worth noting that LBP-1 binds as a dimer to its recognition site (38) and that the HIV-1 promoter contains three high affinity and six low affinity LBP-1 recognition sites (Fig. 7). Thus, the molar ratio of LBP-1 to the HIV-1 promoter (relative to the above considerations) is no more than 2 when 100 ng of LBP-1 are present in any given reaction. This indicates that a low concentration of recombinant LBP-1 in our assay conditions can lead to a block of elongation.


Figure 7: Binding of LBP-1b to upstream low affinity sites on the HIV-1 promoter. Gel mobility shift analysis was performed with 5 ng of LBP-1b and 20 fmol of a radiolabeled DNA fragment (-120 to -31) derived from the HIV-1 promoter. Competitor oligonucleotides, used at 100-fold molar excess compared to the probe, are indicated. Both ``long'' (L) and ``short'' (S) are double-stranded oligonucleotides that contain three or two high affinity LBP-1 sites and correspond to position -17 to +27 and -16 to +15, respectively. The L^m oligonucleotide contains mutated high affinity sites (IS4). The drawing below the figure shows the HIV-1 promoter as well as the location of the probe and competitors used in this assay. Low affinity LBP-1 binding sites that flank the TATA box (37) and the potential low affinity LBP-1 binding sites (-68 CCTGGGCGGGACTGG -53) that overlap the Sp1 binding sites (-77 to -45) are also indicated.



The pulse-chase assay involves PIC purification by gel filtration which removes most (approximately 90%) of the HeLa nuclear proteins. In order to mimic more closely the conditions under which exogenous LBP-1 inhibited the HIV-1 transcription when PICs were preformed in a standard in vitro system (unfractionated nuclear extract) (Fig. 1), we studied the effect of LBP-1 in a pulse-chase assay in which nuclear extract proteins were added back (with LBP-1) during the chase (Fig. 3B, right). Under these conditions, the elongation block proximal to the promoter was overcome totally by the presence of the extract proteins with promoter distal elongation products clearly evident (Fig. 3B, compare lanes 7 and 8 with lane 6). Significantly, however, the transcripts were heterogeneous in size (mostly from 150 to 400 nt), and the level of full-length (600 nt) run-off transcripts was still decreased in an LBP-1 concentration-dependent manner. This was revealed more clearly when the transcription products were fractionated in a 6% denaturing polyacrylamide gel (data not shown). Although we do not know how HeLa nuclear extract components overcome the LBP-1 block proximal to the promoter, it is likely that this involves endogenous elongation factors such as TFIIF, TFIIS, and TFIIX (references above) or the more recently described elongation activities such as P-TEF (46) and SIII (51) in the extract. At the same time, it is significant that even in the presence of HeLa nuclear extract factors, LBP-1 can still restrict the processivity of RNA polymerase and result in a potential block of elongation distal to the promoter. This result correlates with the inhibition of HIV-1 transcription by LBP-1 in the crude cell-free system under conditions where PICs are preformed before addition of LBP-1 (Fig. 1).

Since the pulse-chase analysis at both 50 and 70 mM KCl showed a restriction of HIV-1 transcription at the level of elongation in the absence of exogenously added LBP-1 (Fig. 2, 3B, 4A, 4B, and 5), we tested whether the potential recruitment of endogenous LBP-1 in HeLa nuclear extracts into the PIC was involved in this restriction. However, even when LBP-1-depleted nuclear extracts were employed for PIC formation and isolation, HIV-1 transcription was still restricted at the level of elongation (data not shown). As mentioned above, this restriction most likely reflects the absence of elongation factors in isolated PICs(18, 46, 47, 52) . Furthermore, since the LBP-1 block of elongation is observed when LBP-1 is added either after PIC formation (Fig. 1) or after 13-mer formation (Fig. 3B), it seems likely that LBP-1 might function during early elongation events by competing with elongation factors (see ``Discussion''). We do not know why HIV-1 transcription is not restricted at the level of elongation in standard (untreated) HeLa nuclear extracts ( Fig. 1and Fig. 8). However, since the sole addition of a low concentration of recombinant LBP-1 leads to a block of elongation ( Fig. 1and Fig. 8), this argues for a model in which LBP-1 function may be subject either to a competition with elongation factors or to a tight regulation (i.e. by phosphorylation or by an interacting repressor) which may be altered during nuclear extract isolation and manipulation.

Characterization of the Elongation Block Indicates That LBP-1 Causes RNA Polymerase Pausing, and That the DNA Binding Activity of LBP-1 Is Required for the Inhibition of HIV-1 Transcription Elongation

To have a better understanding of the mechanism of the elongation block, we asked whether LBP-1 caused termination, rather than simply pausing, of the RNA polymerase. The analysis was performed at an LBP-1/template molar ratio of about 15, which resulted in elongation blocks both proximal and distal to the promoter (Fig. 4A, lane 2 versus lane 3; see the legend also). However, when an equivalent reaction (with LBP-1) was incubated for an additional 20 min in the presence of 200 mM KCl, most of the blocked intermediate transcripts were chased to 600 nucleotide products (Fig. 4A, compare lane 4 versus lane 2). This indicated that for most transcripts LBP-1 had caused pausing, but not termination, by RNA polymerase. However, we cannot exclude the possibility that some of the nonchased transcripts (e.g. those at +70) might reflect terminated RNAs.

We next tested whether the DNA binding activity of LBP-1 was required for the HIV-1 promoter elongation block. Evidence for this was indicated both by the ability of oligonucleotides containing wild type, but not mutated, LBP-1 binding sites to reverse the effect of LBP-1 (Fig. 4B, compare lanes 4 and 5 with lane 3) and by the inability of LBP-1d (the isoform which does not bind to DNA) to block HIV-1 elongation (data not shown).

Neither Triple Mutations (IS4) nor Severe Mutations of the Three High Affinity LBP-1 Recognition Sites Relieve the Block of HIV-1 Elongation by LBP-1

We next tested whether high affinity binding of LBP-1 to the HIV-1 promoter is necessary to block elongation. Since it was shown previously that LBP-1 binds first to the high affinity binding sites prior to the low affinity sites on the HIV-1 promoter(7, 8, 37) , it seemed likely that LBP-1 blocked early elongation events by interacting with both the high affinity binding sites and RNA polymerase II. Thus, to investigate directly the contribution of the high affinity LBP-1 binding sites to the block of HIV-1 elongation by LBP-1, the pulse-chase assay was used to compare the wild type template with a mutant template (HIV-l/IS4; (37) ) containing 3 point mutations in each of the three high affinity LBP-1 recognition sites. When the wild type HIV-1 promoter was incubated with LBP-1 at a factor to template molar ratio of about 20 or more, the elongation block was mostly proximal to the promoter (Fig. 5, lanes 1-4). However, when the mutant HIV-l/IS4 promoter was incubated with the same or double the amount of LBP-1, the elongation block persisted (Fig. 5, lanes 5-8; see the legend also); the uniformly lower signal in these lanes reflects an effect of the mutations on overall promoter activity, consistent with earlier observations(7) . Although our laboratory has shown that LBP-1 inhibits both initiation and elongation of HIV-1 transcription, we have no evidence that LBP-1 is involved in transcriptional activation of the HIV-1 promoter; hence, it is not clear whether LBP-1 or another (possibly less abundant or less stable) cellular factor functions through these sites to activate transcription.

The failure of mutations in the high affinity LBP-1 recognition sites to relieve the inhibition of elongation by LBP-1 suggested that the binding of LBP-1 to these sites might not be the sole mechanism by which LBP-1 can block HIV-1 elongation. Thus, it remained possible that LBP-1 could still bind to the template under the conditions employed, either to the mutated high affinity LBP-1 sites themselves or, in an independent manner, to the low affinity sites located immediately upstream of high affinity sites (between -4 and -80). To gain insight into this question, a gel retardation assay was employed to test the direct binding of LBP-1 to radiolabeled oligonucleotide probes containing either wild type or mutated high affinity LBP-1 binding sites. Somewhat surprisingly, LBP-1 still bound to a probe containing the mutated LBP-1 sites, although the binding was 4-fold lower when compared with binding to the wild type sites (Fig. 6, compare lanes 9-12 with lanes 2-4, respectively). Interestingly, when poly(dI-dC) was included in the reaction as a nonspecific competitor, LBP-1 bound with a much lower efficiency (more than 40-fold) to the mutated LBP-1 probe relative to the wild type probe (Fig. 6, compare lanes 13-15 with lanes 5-7, respectively). Thus, the binding of LBP-1 to the high affinity sites compared to the low affinity sites becomes more prominent in the presence of nonspecific competitors. This observation could explain why mutations of high affinity LBP-1 recognition sites (IS4) relieved the inhibition of HIV-1 transcription at the level of initiation when poly(dI-dC) was present in the transcription reaction(37) .


Figure 6: Binding of LBP-1b to both wild type (Wt) and mutant (Mt(IS4)) high affinity LBP-1 sites. The gel mobility shift assay was performed as described under ``Experimental Procedures.'' Ten fmol of either Wt probe (lanes 1-7) or Mt (IS4) probe (lanes 8-15) was mixed with or without the indicated amounts of poly(dI-dC) before the addition of LBP-1b as indicated. Both the free and bound probe are shown by the brackets.



Competition analyses with the gel retardation assay indicated that the binding of LBP-1 both to the wild type and to the mutated LBP-1 sites was specific even though the binding affinity to the latter sites was low. Furthermore, although it is unclear what the difference is between the lower and upper bands in the LBP-1bulletDNA complex (Fig. 6), both complexes are specifically bound by LBP-1 (data not shown). Hence, it remained possible that LBP-1 could bind to mutated sites with higher efficiency in the context of the HIV-1 promoter and other interacting factors, even in the presence of poly(dI-dC), and thus block elongation. To further investigate this possibility, we used the pulse-chase assay to test for elongation blocks by LBP-1 on two HIV-1 promoters containing different and more drastic mutations in the high affinity LBP-1 binding sites. Although DNA probes containing these mutations did not exhibit LBP-1 binding by any (direct binding or oligonucleotide competition) assays, templates with these mutations showed the same sensitivity to elongation inhibition by LBP-1 as did templates with HIV-l/IS4 and wild type promoter (data not shown). Taken together, these results indicate that the binding of LBP-1 to high affinity sites is not necessary for LBP-1 to restrict elongation of HIV-1 transcripts.

LPB-1 Binds Independently to the Low Affinity LBP-1 Recognition Sites

Based on the above-mentioned results, we hypothesized that LBP-1 could bind the low affinity sites under appropriate conditions and thus effect a block of HIV-1 promoter function. Indeed, a gel retardation assay with a probe (-120 to -31) containing only the low affinity sites (bottom of Fig. 7and the figure legend) showed significant binding of LBP-1 (Fig. 7, lane 1). Specificity was indicated by complete competition with an oligonucleotide containing either two (S) or three (L) LBP-1 recognition sites, but only partial competition (as expected) with an LBP-1 oligonucleotide (Lm) containing IS4 mutations in (Fig. 7, lanes 2-4). Although we do not know why the IS4 oligonucleotide did not partially relieve the block of elongation by LBP-1 in a transcription assay (Fig. 4B), we assume that competition by IS4 oligonucleotide is simply less efficient when LBP-1 binds (possibly with interacting factors) to its recognition sites in the entire HIV-1 promoter.

Thus, it is evident that LBP-1 can bind independently (in the absence of high affinity sites) to low affinity LBP-1 recognition sites. In addition, this observation correlates with DNase I footprinting analysis showing LBP-1 mediated protection of low affinity sites using either wild type or IS4 promoters or promoters containing severe mutations of high affinity LBP-1 recognition sites (data not shown). Overall, our results suggest that LBP-1, most likely through the low affinity LBP-1 binding sites on the HIV-1 promoter, can compromise the processivity of the RNA polymerase and, therefore, restrict the elongation of HIV-1 transcripts in vitro.

Tat Protein Can Overcome the LBP-1-induced Elongation Restriction of HIV-1 Transcripts

The novel finding that LBP-1 impairs HIV-1 elongation is particularly interesting because, as mentioned earlier (introduction), the HIV-1 promoter is highly restricted at the level of elongation in vivo in a manner that can be overcome by Tat protein. In contrast, the HIV-1 promoter is actively transcribed under standard in vitro conditions (untreated nuclear extracts) which generate full-length transcripts in the absence of Tat(16, 17, 18, 30) . This indicates that under these conditions HIV-1 transcription apparently is not restricted at the level of elongation. However, a significantly enhanced transcription by Tat has been observed following preincubation of HeLa nuclear extracts with citrate(18) , poly(rI-rC), or ATP(16, 17) . All of these conditions specifically impair RNA polymerase II elongation activity, and not initiation, on the HIV-1 promoter, and they do not impair either initiation or elongation on a control AdML promoter. Since LBP-1 also was found to restrict HIV-1 transcription at the level of elongation, it was important to test whether Tat could overcome this restriction as well. However, since LBP-1 can inhibit PIC formation in the cell-free system(37) , PICs were allowed to form on both HIV-1 and AdML promoters before the addition of LBP-1 and Tat proteins. In this particular assay, LBP-1 specifically inhibited transcription from the HIV-1 promoter, with no significant effect on the AdML promoter, and Tat protein in large part overcame this restriction to HIV-1 transcription (Fig. 8, compare lanes 1-4 with lanes 5-8). This Tat effect is dependent on the presence of wild type TAR RNA (data not shown). Although the reversal of LBP-1-induced inhibition of HIV-1 transcription by Tat was relatively inefficient at the highest LBP-1/template molar ratio (approximately 10) tested (Fig. 8, lane 4 versus lane 8), these results nevertheless suggested that LBP-1 could be a part of the natural mechanism which restricts HIV-1 transcription at the level of elongation in a manner that potentially can be overcome by Tat protein.

In a further analysis we also tested the effect of LBP-1 on the high levels of Tat-activated transcription observed in nuclear extracts under conditions (citrate treatment, see above) which lower their capacity for transcription elongation (but not initiation) on the HIV-1 promoter(18) . Somewhat surprisingly, LBP-1 suppressed Tat function under these conditions, but did not further decrease basal activity (data not shown), indicating that combined effects of LBP-1 and citrate treatment may modify the transcription complex in such a way that Tat could no longer make it processive. In addition, while the elongation restriction effected by citrate does not preclude synthesis of TAR RNA for Tat function(18) , LBP-1 under these particular conditions might do so and thus inhibit Tat function indirectly. These considerations suggest, first, that Tat function may require a narrow window of conditions (e.g. cellular factor concentrations) which substantially restrict elongation while still allowing the formation and the function of a TatbulletTAR complex and, second, that these processes can involve individual effects of either LBP-1 or other (co)factors altered by citrate treatment.


DISCUSSION

This report shows that the cellular factor LBP-1 has the ability to restrict the processivity of RNA polymerase complexes initiated at the HIV-1 promoter and, further, that the HIV-1-encoded Tat protein can partially overcome the LBP-1-induced elongation block. These results are important because recent studies have shown that elongation from the HIV-1 promoter is limited in the absence of Tat, and that LBP-1 sites in the HIV-1 promoter overlap an element (IST) implicated in the generation of short transcripts, whose accumulation in some cases is correlated with restricted elongation in the absence of Tat.

Promoter Sites Important for LBP-1 Function

The HIV-1 promoter contains both downstream high affinity and upstream low affinity sites for recognition by LBP-1 (Fig. 7). Consistent with our observation that previously described point mutations in each of the three high affinity sites failed to relieve the LBP-1-mediated block to elongation of HIV-1 transcripts, we have shown that LBP-1 can still bind (albeit with lower efficiency) to the corresponding mutated promoter region. While these results leave open the possibility of LBP-1 function through the mutated downstream sites, LBP-1 also blocked transcription elongation from templates with more severe downstream site mutations that precluded any binding to this region. Consistent with the suggestion from this result that upstream LBP-1 sites might suffice for the in vitro elongation block, LBP-1 was shown to bind specifically and independently to these sites. However, a functional cooperativity between high and low affinity sites could be evident under other conditions.

The present results may also be relevant to the function of the IST element, which overlaps the high affinity LBP-1 sites. While a study of the effects of mutations in these sites reportedly eliminated a role for LBP-1 in IST function(35) , this possibility is left open by our demonstration that LBP-1 can still bind to templates bearing the same mutations. On the other hand, the IST also exhibits another function, namely enhanced promoter activity, that has not yet been demonstrated for the recombinant LBP-1 isoform employed here. Moreover, an understanding of the exact relationship between the downstream LBP-1 and IST elements has been difficult because of functional initiator elements that overlap the LBP-1/IST sites(6) . Likewise, dissection of functions of the upstream LBP-1 sites is complicated because of their multiplicity and interspersion among the TATA and Sp1 sites. This multiplicity of LBP-1 sites may provide a functional redundancy that could have precluded their implication in HIV-1 promoter functions in previous studies.

Mechanism of Action of LBP-1 in Blocking Transcriptional Elongation

Inhibition of elongation by LBP-1 appears to involve both the DNA binding activity of LBP-1 and promoter proximal binding sites, suggesting that LBP-1 may function either at an early step in elongation or in a closely coupled step (e.g. initiation, see below). Promoter-proximal sequences or interacting factors that affect the elongation properties of RNA polymerase have been reported previously for both prokaryotic and other eukaryotic genes (reviewed in Refs. 21, 48, and 53). In the case of the bacteriophage P(R)` promoter(54) , this involves interactions of the Q protein both at an upstream site and at a downstream site which effects both polymerase pausing and a conformation essential for recognition by Q protein (see Fig. 9A). Similarly, in the case of the Drosophila hsp70 promoter(55) , heat shock factor (HSF) reverses an RNA polymerase elongation block (around +23) that is effected both by an element near the initiation site and by an upstream site(s) that are recognized by the GAGA protein (Fig. 9B). A regulated block to elongation of the c-myc P2 promoter also is determined by the promoter proximal region(56, 57) .


Figure 9: Models for promoter-proximal events that govern downstream elongation and termination properties of RNA polymerase. A, bacteriophage P(R)` promoter. In the absence of the Q protein, E. coli RNA polymerase initiates and, after a transient pause at +16/+17, elongates and terminates at downstream terminators. When present, Q binds via an upstream recognition element (black box) and, via Nus A, interacts with a paused RNA polymerase and effects a modification that permits elongation through downstream terminators. The +2 to +6 element (striped box) effects RNA polymerase pausing and a conformational change essential for Q/Nus A interaction (reviewed in (21) and (54) ). B, Drosophila hsp70 promoter. In the absence of HSF, RNA polymerase II initiates transcription but pauses at +23 under the influence of GAGA factor bound to an upstream element(s) (black box) and a region (striped box) surrounding the initiation site. After heat shock, the binding of HSF to upstream sites (not shown) effects release of the elongation block (reviewed in (21) and (55) ). C, HIV-1 promoter. In the absence of a strong activator, the binding of LBP-1 to low (striped squares) and high (solid squares) affinity LBP-1 recognition sites during initiation or early elongation events may effect RNA polymerase II conformation and/or interactions with elongation factors. This LBP-1 action renders the elongation complex nonprocessive and leads to the accumulation of randomly terminated RNAs. In this model, LBP-1 function may be formally analogous to the functions of the downstream site (+2 to +6) in the P(R)` promoter and GAGA factor/initiation region in the hsp70 promoter, in effecting pausing or an elongation block, respectively. Just as Q/Nus A and HSF alter RNA polymerase elongation properties on the P(R)` and hsp70 promoters, respectively, it is proposed that Tat may alter the elongation restriction imposed on RNA polymerase by LBP-1 on the HIV-1 promoter (see text for further discussion).



Thus, during the very early phase of elongation by RNA polymerase II on the HIV-1 promoter (e.g. from a stalled position at +13 in the present analysis), the binding of LBP-1 to the low affinity sites flanking the TATA box, or possibly to the high affinity sites, might prevent productive interactions of cellular factors important for promoter clearance (58) and/or distal elongation(46, 47, 49, 51, 52, 59) , such that the transcription complex is only weakly processive (Fig. 9C). Lu et al.(1993) (34) have also suggested that the TATA box in HIV-1 contributes, in the absence of an strong activator, to the formation of nonprocessive transcription complexes. This model could explain how LBP-1 might restrict HIV-1 elongation in the absence of Tat and yet facilitate a Tat response by allowing TAR RNA formation with concomitant pausing for effective Tat binding and function from a promoter proximal position (Fig. 9C, see below also). Consistent with this model, an effect of Tat in reversing the LBP-1-mediated elongation block in standard (untreated) nuclear extracts was demonstrated (Fig. 8).

General Models for Tat Function

The apparent function of Tat from TAR-bound elongation complexes in the vicinity of the promoter (introduction) suggests a more direct role (in Tat function) for nonprocessive complexes which result either in discrete short transcripts or in more randomly terminated transcripts. Although a role for IST-dependent short transcripts in Tat function was questioned on the basis of a mutagenesis study(35) , it was suggested (28) that the low level of Tat-independent transcription evident in the transient transfection assays employed (leading in part to full-length transcripts) might have generated sufficient RNA for Tat binding and function and thus bypassed a normal IST/short transcript requirement. Similarly, we have found that mutations in the same high affinity LBP-1/IST sites do not eliminate Tat function under in vitro conditions where some basal activity is evident (data not shown). Moreover, the fact that these same mutations do not eliminate either LBP-1 binding or the LBP-1-mediated restriction to elongation (discussed above) leaves open the possibility of LBP-1 involvement in IST and/or Tat function.

On the basis of past and present data, several models for Tat action may be considered, all based on the assumption that at least some fraction of the elongation complexes generated in the absence of Tat are only weakly processive. First (Model A), as in the earliest models, Tat may alter the processivity of the associated elongation complex in a co-transcriptional manner. Second (Model B), TAR-bound Tat in weakly processive complexes may enhance, in a stoichiometric fashion, the processivity of subsequently formed transcription complexes at the time of preinitiation complex assembly or function (``reach back'' model). Third (Model C), TAR-bound Tat in a weakly processive complex may enhance the processivity of the following de novo elongation complex (as in Model B) which in turn provides a recognition site for Tat for alteration of the succeeding complex, and so on. In the latter model, appropriate Tat function might still require transient pausing of an otherwise highly processive complex in the vicinity of the promoter. Possibly relevant to this point, GAGA protein-dependent RNA polymerase pausing on the hsp70 promoter (55) is observed even after induction of elongation by heat shock factor(60) . Clearly, Models B and C can explain how Tat could effect a switch in the elongation properties of a nascent complex (to a more processive form) during the process of initiation complex formation (assembly) or function (initiation or very early elongation events). All models can accommodate roles for promoter-proximal DNA elements and interacting factors, including LBP-1 in the present case, in restricting elongation and/or initiation and setting the stage for Tat function. Models B and C also allow the possibility of Tat effects on the rate of initiation through direct interactions with PIC components(20, 61) . In fact, there could be a causal relationship between effects of Tat on initiation and increased processivity, as has been indicated (13, 62, 63) or predicted (21, 28, 30) for conventional activators acting at 5` sites. This could explain some observed nonadditive effects of upstream activators and Tat(25) .

The present study has defined a potentially important role for an LBP-1 isoform (LBP-1b) in restricting the processivity of RNA polymerase on the HIV-1 promoter. Further studies must determine the molecular targets of LBP-1, the essential LBP-1 binding sites and their relationship to the IST, the functions of individual isoforms of LBP-1, whether LBP-1 is required not only for a general restriction of processivity but also for the Tat activation process per se, and how and at what step Tat overcomes the LBP-1 restriction to processivity.


FOOTNOTES

*
This work was supported by National Institutes of Health Grant AI27397 (to R. G. R.) and by general support from the Pew Charitable Trust to the Rockefeller University. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Postdoctoral Fellow of the Leukemia Society of America.

Postdoctoral Fellow of the American Foundation for AIDS Research.

(^1)
The abbreviations used are: HIV, human immunodeficiency virus; AdML, adenovirus major late promoter; nt, nucleotide(s); PIC, preinitiation complex; HSF, heat shock factor.


ACKNOWLEDGEMENTS

We thank D. Luse and members of the Roeder laboratory, especially Ananda Roy, Richard Bernstein, and Sean Stevens, for helpful discussions and critical comments on the manuscript; Carmen Balmaceda for excellent technical assistance, and Craig Rosen for the Tat (1-67) plasmid.


REFERENCES

  1. Jones, K. A., and Peterlin, B. M. (1994) Annu. Rev. Biochem. 63, 717-743 [CrossRef][Medline] [Order article via Infotrieve]
  2. Perkins, N. D., Edwards, N. L., Duckett, C. S., Agranoff, A. B., Schmid, R. M., and Nabel, G. J. (1993) EMBO J. 12, 3551-3558 [Medline] [Order article via Infotrieve]
  3. Berkhout, B., and Jeang, K.-T. (1992) J. Virol. 66, 139-149 [Abstract/Free Full Text]
  4. Meisterernst, M., Roy, A. L., Lieu, H. M., and Roeder, R. G. (1991) Cell 66, 981-993 [CrossRef][Medline] [Order article via Infotrieve]
  5. Roy, A. L., Meisterernst, M., Pognonec, P., and Roeder, R. G. (1991) Nature 354, 245-248 [CrossRef][Medline] [Order article via Infotrieve]
  6. Zenzie-Gregory, B., O'Shea-Greenfield, A., and Smale, S. T. (1992) J. Biol. Chem. 267, 2823-2830 [Abstract/Free Full Text]
  7. Jones, K. A., Luciw, P. A., and Duchange, N. (1988) Genes & Dev. 2, 1101-1114
  8. Wu, F. K., Garcia, J. A., Harrich, D., and Gaynor, R. B. (1988) EMBO J. 7, 2117-2130 [Medline] [Order article via Infotrieve]
  9. Braddock, M., Powell, R., Blanchard, A. D., Kingsman, A. J., and Kingsman, S. M. (1993) FASEB J. 7, 214-222 [Abstract]
  10. Madore, S. J., and Cullen, B. R. (1993) J. Virol. 67, 3703-3711 [Abstract/Free Full Text]
  11. Kao, S.-Y., Calman, A. F., Luciw, P. A., and Peterlin, B. M. (1987) Nature 330, 489-493 [CrossRef][Medline] [Order article via Infotrieve]
  12. Laspia, M. F., Rice, A. P., and Mathews, M. B. (1989) Cell 59, 283-292 [CrossRef][Medline] [Order article via Infotrieve]
  13. Laspia, M. F., Rice, A. P., and Mathews, M. B. (1990) Genes & Dev. 4, 2397-2408
  14. Kessler, M., and Mathews, M. B. (1991) Proc. Natl. Acad. Sci. U. S. A. 88, 10018-10022 [Abstract/Free Full Text]
  15. Jeang, K.-T., Berkhout, B., and Dropulic, B. (1993) J. Biol. Chem. 268, 24940-24949 [Abstract/Free Full Text]
  16. Marciniak, R. A., Calnan, B. J., Frankel, A. D., and Sharp, P. A. (1990) Cell 63, 791-802 [CrossRef][Medline] [Order article via Infotrieve]
  17. Marciniak, R. A., and Sharp, P. A. (1991) EMBO J. 10, 4189-4196 [Medline] [Order article via Infotrieve]
  18. Kato, H., Sumimoto, H., Pognonec, P., Chen, C. H., Rosen, C. A., and Roeder, R. G. (1992) Genes & Dev. 6, 655-666
  19. Graeble, M. A., Churcher, M. J., Lowe, A. D., Gait, M. J., and Karn, J. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 6184-6188 [Abstract/Free Full Text]
  20. Bohan, C. A., Kashanchi, F., Ensoli, B., Buonaguro, L., Boris- Lawrie, K. A., and Brady, J. N. (1992) Gene Expression 2, 391-407 [Medline] [Order article via Infotrieve]
  21. Greenblatt, J., Nodwell, J. R., and Mason, S. W. (1993) Nature 364, 401-406 [CrossRef][Medline] [Order article via Infotrieve]
  22. Olsen, H. S., and Rosen, C. A. (1992) J. Virol. 66, 5594-5597 [Abstract/Free Full Text]
  23. Bielinska, A., Krasnow, S., and Nabel, G. J. (1989) J. Virol. 63, 4097-4100 [Abstract/Free Full Text]
  24. Berkhout, B., Gatignol, A., Rabson, A. B., and Jeang, K.-T. (1990) Cell 62, 757-767 [CrossRef][Medline] [Order article via Infotrieve]
  25. Southgate, C., and Green, M. R. (1991) Genes & Dev. 5, 2496-2507
  26. Han, P., Brown, R., and Barsoum, J. (1991) Nucleic Acids Res. 19, 7225-7229 [Abstract/Free Full Text]
  27. Kamine, J., and Chinnadurai, G. (1992) J. Virol. 66, 3932-3936 [Abstract/Free Full Text]
  28. Cullen, B. R. (1993) Cell 73, 417-420 [CrossRef][Medline] [Order article via Infotrieve]
  29. Sharp, P. A., and Marciniak, R. A. (1989) Cell 59, 229-230 [CrossRef][Medline] [Order article via Infotrieve]
  30. Toohey, M. G., and Jones, K. A. (1989) Genes & Dev. 3, 265-282
  31. Selby, M. J., Bain, E. S., Luciw, P. A., and Peterlin, B. M. (1989) Genes & Dev. 3, 547-558
  32. Ratnasabapathy, R., Sheldon, R. M., Johal, L., and Hernandez, N. (1990) Genes & Dev. 4, 2061-2074
  33. Kessler, M., and Mathews, M. B. (1992) J. Virol. 66, 4488-4496 [Abstract/Free Full Text]
  34. Lu, X., Welsh, T. M., and Peterlin, B. M. (1993) J. Virol. 67, 1752-1760 [Abstract/Free Full Text]
  35. Sheldon, M., Ratnasabapathy, R., and Hernandez, N. (1993) Mol. Cell. Biol. 13, 1251-1263 [Abstract/Free Full Text]
  36. Malim, M. H., Fenrick, R., Ballard, D. W., Jaiber, J., Bohnlein, E., and Cullen, B. R. (1989) J. Virol. 63, 3213-3219 [Abstract/Free Full Text]
  37. Kato, H., Horikoshi, M., and Roeder, R. G. (1991) Science 251, 1476-1479 [Abstract/Free Full Text]
  38. Yoon, J.-B., Li, G., and Roeder, R. G. (1994) Mol. Cell. Biol. 14, 176-1785
  39. Rosen, C. A., Sodroski, J. G., and Haseltine, W. A. (1985) Cell 41, 813-823 [CrossRef][Medline] [Order article via Infotrieve]
  40. Sawadogo, M., and Roeder, R. G. (1985) Proc. Natl. Acad. Sci. U. S. A. 82, 4394-4398 [Abstract/Free Full Text]
  41. Gentz, R., Chen, C.-H., and Rosen, C. A. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 821-824 [Abstract/Free Full Text]
  42. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1983) Nucleic Acids Res. 5, 1475-1449
  43. Izban, M. G., and Luse, D. S. (1991) Genes & Dev. 5, 683-696
  44. Kreuzer, K. N., and Alberts, B. M. (1984) J. Biol. Chem. 259, 5339-5346 [Abstract/Free Full Text]
  45. Kephart, D. D., Marshall, N. F., and Price, D. H. (1992) Mol. Cell. Biol. 12, 2067-2077 [Abstract/Free Full Text]
  46. Marshall, N. F., and Price, D. H. (1992) Mol. Cell. Biol. 12, 2078-2090 [Abstract/Free Full Text]
  47. Izban, M. G., and Luse, D. S. (1992) Genes & Dev. 6, 1342-1356
  48. Wright, S. (1993) Mol. Biol. Cell 4, 661-668 [Medline] [Order article via Infotrieve]
  49. Bengal, E., Flores, O., Krauskopf, A., Reinberg, D., and Aloni, Y. (1991) Mol. Cell. Biol. 11, 1195-1206 [Abstract/Free Full Text]
  50. Bengal, E., and Aloni, Y. (1991) J. Virol. 65, 4910-4918 [Abstract/Free Full Text]
  51. Bradsher, J. N., Tan, S., McLaury, H.-J., Conaway, J. W., and Conaway, R. C. (1993) J. Biol. Chem. 268, 25594-25603 [Abstract/Free Full Text]
  52. Izban, M. G., and Luse, D. S. (1992) J. Biol. Chem. 267, 13647-13655 [Abstract/Free Full Text]
  53. Spencer, C. A., and Groudine, M. (1990) Oncogene 5, 777-786 [Medline] [Order article via Infotrieve]
  54. Yarnell, W. S., and Roberts, J. W. (1992) Cell 69, 1181-1189 [CrossRef][Medline] [Order article via Infotrieve]
  55. Lee, H.-S., Kraus, K. W., Wolfner, M. F., and Lis, J. T. (1992) Genes & Dev. 6, 284-295
  56. Krumm, A., Meulia, T., Brunvand, M., and Groudine, M. (1992) Genes & Dev. 6, 2201-2213
  57. Strobl, C. J., and Eick, D. (1992) EMBO J. 11, 3307-3314 [Medline] [Order article via Infotrieve]
  58. Goodrich, J. A., and Tjian, R. (1994) Cell 77, 145-156 [CrossRef][Medline] [Order article via Infotrieve]
  59. Reines, D. (1992) J. Biol. Chem. 267, 3795-3800 [Abstract/Free Full Text]
  60. Giardina, C., Perez-Riba, M., and Lis, J. T. (1992) Genes & Dev. 6, 2190-2200
  61. Fashanachi, F., Piras, G., Radonovich, M. F., Duvall, J. F., Fattaey, A., Chiang, C.-M., Roeder, R. G., and Brady, J. N. (1994) Nature 367, 295-299 [CrossRef][Medline] [Order article via Infotrieve]
  62. Meulia, T., Krumm, A., and Groudine, M. (1993) Mol. Cell. Biol. 13, 5647-5658 [Abstract/Free Full Text]
  63. Yankulov, K., Blau, J., Purton, T., Roberts, S., and Bentley, D. (1994) Cell 77, 749-759 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Nucleic Acids ResHome page
M. C. Frith, J. L. Spouge, U. Hansen, and Z. Weng
Statistical significance of clusters of motifs represented by position specific scoring matrices in nucleotide sequences
Nucleic Acids Res., July 15, 2002; 30(14): 3214 - 3224.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
Y. K. Kim, C. F. Bourgeois, C. Isel, M. J. Churcher, and J. Karn
Phosphorylation of the RNA Polymerase II Carboxyl-Terminal Domain by CDK9 Is Directly Responsible for Human Immunodeficiency Virus Type 1 Tat-Activated Transcriptional Elongation
Mol. Cell. Biol., July 1, 2002; 22(13): 4622 - 4637.
[Abstract] [Full Text] [PDF]


Home page
J. Immunol.Home page
E. E. Drouin, C. E. Schrader, J. Stavnezer, and U. Hansen
The Ubiquitously Expressed DNA-Binding Protein Late SV40 Factor Binds Ig Switch Regions and Represses Class Switching to IgA
J. Immunol., March 15, 2002; 168(6): 2847 - 2856.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
C. F. Bourgeois, Y. K. Kim, M. J. Churcher, M. J. West, and J. Karn
Spt5 Cooperates with Human Immunodeficiency Virus Type 1 Tat by Preventing Premature RNA Release at Terminator Sequences
Mol. Cell. Biol., February 15, 2002; 22(4): 1079 - 1093.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
D. P. Tran, S. J. Kim, N. J. Park, T. M. Jew, and H. G. Martinson
Mechanism of Poly(A) Signal Transduction to RNA Polymerase II In Vitro
Mol. Cell. Biol., November 1, 2001; 21(21): 7495 - 7508.
[Abstract] [Full Text] [PDF]


Home page
J. Virol.Home page
J. J. Coull, F. Romerio, J.-M. Sun, J. L. Volker, K. M. Galvin, J. R. Davie, Y. Shi, U. Hansen, and D. M. Margolis
The Human Factors YY1 and LSF Repress the Human Immunodeficiency Virus Type 1 Long Terminal Repeat via Recruitment of Histone Deacetylase 1
J. Virol., August 1, 2000; 74(15): 6790 - 6799.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
C. Casse, F. Giannoni, V. T. Nguyen, M.-F. Dubois, and O. Bensaude
The Transcriptional Inhibitors, Actinomycin D and alpha -Amanitin, Activate the HIV-1 Promoter and Favor Phosphorylation of the RNA Polymerase II C-terminal Domain
J. Biol. Chem., June 4, 1999; 274(23): 16097 - 16106.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
N. Zambrano, G. Minopoli, P. de Candia, and T. Russo
The Fe65 Adaptor Protein Interacts through Its PID1 Domain with the Transcription Factor CP2/LSF/LBP1
J. Biol. Chem., August 7, 1998; 273(32): 20128 - 20133.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
Y. Jiang, M. Yan, and J. D. Gralla
Abortive Initiation and First Bond Formation at an Activated Adenovirus E4 Promoter
J. Biol. Chem., November 10, 1995; 270(45): 27332 - 27338.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
L. Ramamurthy, V. Barbour, A. Tuckfield, D. R. Clouston, D. Topham, J. M. Cunningham, and S. M. Jane
Targeted Disruption of the CP2 Gene, a Member of the NTF Family of Transcription Factors
J. Biol. Chem., March 9, 2001; 276(11): 7836 - 7842.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
V. Casolaro, A. M. Keane-Myers, S. L. Swendeman, C. Steindler, F. Zhong, M. Sheffery, S. N. Georas, and S. J. Ono
Identification and Characterization of a Critical CP2-binding Element in the Human Interleukin-4 Promoter
J. Biol. Chem., November 17, 2000; 275(47): 36605 - 36611.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Parada, C. A.
Right arrow Articles by Roeder, R. G.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Parada, C. A.
Right arrow Articles by Roeder, R. G.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement