|
|
|
|||||||
|
|||||||||
(Received for publication, August 19, 1994; and in revised form, November 1,
1994) From the
The cellular factor, LBP-1, can repress HIV-1 transcription by
preventing the binding of TFIID to the promoter. Here we have analyzed
the effect of recombinant LBP-1 on HIV-1 transcription in vitro by using a ``pulse-chase'' assay. LBP-1 had no effect on
initiation from a preformed preinitiation complex and elongation to
position +13 (``pulse''). However, addition of LBP-1
after RNA polymerase was stalled at +13 strongly inhibited further
elongation (``chase'') by reducing RNA polymerase
processivity. Severe mutations of the high affinity LBP-1 binding sites
between -4 and +21 did not relieve the LBP-1-dependent
block. However, LBP-1 could bind independently to upstream low affinity
sites (-80 to -4), suggesting that these sites mediate the
effect of LBP-1 on elongation. These results demonstrate a novel
function of LBP-1, restricting HIV-1 transcription at the level of
elongation. In addition, Tat was found to suppress the antiprocessivity
effect of LBP-1 on HIV-1 transcription in nuclear extracts. These
findings strongly suggest that LBP-1 may provide a natural mechanism
for restricting the elongation of HIV-1 transcripts and that this may
be a target for the action of Tat in enhancing transcription. Transcription from the HIV-1 ( The viral Tat protein is essential for
virus replication and activates transcription throughout a stem-loop
structure (TAR) in the nascent HIV-1 mRNA(1) , most likely in
conjunction with other cellular cofactors (9, 10 and references
therein). Various in vivo studies have documented stimulatory
effects of Tat on transcriptional elongation (11, 12, 13, 14) and, in some cases,
on transcription initiation as
well(12, 13, 14, 15) . Consistent
with a more commonly observed effect of Tat on elongation in
vivo, in vitro studies have revealed a large effect of
Tat mainly at the level of elongation and further documented distinct
classes (weakly versus highly processive) of elongation
complexes(16, 17, 18, 19, 20) .
While the precise mechanism for Tat effects on elongation is unknown,
the simplest model invokes an alteration in processivity of the
elongation complex in a co-transcriptional manner, possibly analogous
to the action of the RNA-bound Possibly
related to the issue of Tat function is the demonstration of short
stable HIV-1 transcripts that may either decrease or remain unchanged
(depending on the assay) following induction by Tat of long
transcripts(11, 31, 32, 33, 34, 35) .
While such transcripts could be derived (possibly by processing; (30) and (33) ) from less processive elongation
complexes, their formation could provide initial RNA binding sites for
Tat function. A downstream element (-1 to +26), designated
IST, that induces synthesis of short transcripts has been described (32, 35) . While IST mutations eliminating short
transcript synthesis failed to eliminate Tat induction of long
transcripts(35) , it has been suggested (28) that the
low but demonstrable basal transcription in the transfection assays
employed might generate sufficient nascent RNA for initiation of the
Tat response. The cellular factors responsible for IST function are
unknown. However, the cellular factor LBP-1 was previously shown (7, 8, 37) to interact in a
concentration-dependent manner with a high affinity site (-4 to
+21) overlapping both Inr-like elements (5, 6) and the IST element (32, 35) and with a low affinity site (-38 to
-16) that overlaps the TATA box. Promoter mutagenesis studies led
to the conclusion that LBP-1 is not involved in either IST function (35) or Tat induction(36) , but studies to be described
here leave this possibility open. While LBP-1 per se has not
been shown to activate transcription via the high affinity recognition
sites which contribute to promoter activity(7, 37) ,
high concentrations of this factor have been shown to repress
transcription initiation when bound to upstream sites prior to TFIID
binding to the interspersed TATA element(37) . Here, we
document the ability of a recombinant LBP-1 isoform (38) to
reduce the processivity of RNA polymerase initiated at the HIV-1
promoter, and we discuss a possible relationship to Tat-induced
transcription.
Figure 5:
Analysis of the LBP-1b elongation block on
normal and mutated (IS4) promoters. PICs formed with both HIV-1 (WT
DNA) and HIV-1/IS4 (IS4 DNA) promoters were isolated as
described under ``Experimental Procedures'' and analyzed by
the pulse-chase assay. After the pulse, increasing amounts of LBP-1b
were added as indicated (lanes 3, 4, 7, and 8), and reaction mixtures were incubated at 30 °C for 7
min. The chase was performed thereafter for 20 min at 30 °C. The
reaction products from the pulse are indicated as 13-mer (lanes 1 and 5) and from the chase as 600 nt (lanes 2 and 6). However, because of base
substitution near the start site in IS4 (below), the corresponding
paused transcripts are several nucleotides shorter. A schematic drawing
in the bottom of the figure shows the HIV-1 promoter
containing low affinity LBP-1 binding sites flanking the TATA box and
either wild type or mutated (IS4) high affinity LBP-1 recognition
sites. The DNA sequence of the Wt promoter region from -4 to
+21 is ACTGGGTCTCTCTGGTTAGACCAGA (LBP-1 binding sites underlined)
while that of the Mt/IS4 promoter on this region is
AGATGGTCTCTAGTGTTAGCAAAGA (mutated residues in bold
type)(37) .
Figure 8:
Effect of Tat on elongation block of HIV-1
transcripts by LBP-1b. Standard transcription assays were performed, as
indicated in the figure and detailed under ``Experimental
Procedures,'' with 50 ng each of HIV-1 and AdML promoters and 100
ng of poly(dI-dC). PIC formation was followed by the addition of LBP-1,
Tat, GTP, CTP, ATP, and [
Figure 1:
Specific inhibition of
HIV-1 transcription by recombinant LBP-1b in vitro. The
pulse-chase analysis was performed with unfractionated nuclear extract
as indicated in the figure and detailed under ``Experimental
Procedures.'' After PIC formation, transcription from both HIV-1
and AdML promoters was initiated with the addition of dATP, GTP, CTP
and [
All reactions were terminated by addition
of 50 µl of 25 mM EDTA solution and extracted with
phenol/chloroform. Nucleic acids were precipitated with ethanol after
addition of yeast tRNA and ammonium acetate to final concentrations of
20 µg/ml and 3 M, pH 7.5, respectively. Reaction products
( Fig. 1and Fig. 8) were analyzed by electrophoresis
through a denaturing 6% polyacrylamide gel containing 50% urea. In
order to determine the level of either activation or repression of
HIV-1 transcription by Tat or LBP-1, respectively, labeled bands were
excised from the gel, and the radioactivity was measured by liquid
scintillation counting.
Figure 2:
Kinetic analysis of HIV-1 transcript
formation in a single round of transcription. The pulse-chase assay
with isolated PICs was performed as indicated in the figure and
detailed under ``Experimental Procedures,'' except that the
KCl concentration was 50 mM. The transcription products from
the pulse are shown in lane 1 (indicated as 13-mer),
and those from the chase are shown in lanes 2-8 (full-length run-off transcripts are 600 nt). Numbers on
the top of each lane indicate the period of time for pulse (lane 1) and chase (lanes 2-8), respectively.
In lane 8, after a 10-min chase, 200 mM KCl (*) was
added to the reaction and further incubated at 30 °C for 10 min.
The arrow shows a short RNA transcript of 70 nt suggesting
that RNA polymerase pauses at position +70 downstream of the
promoter. The other discrete pause site evident in lanes 2-8 lies near position +110. It should be noted that in this kind
of assay the amount of radioactivity present in any given lane does not
change by more than 10% (C. A. Parada, J.-B. Yoon, and R. G. Roeder,
unpublished observation). Furthermore, in other analyses, the
distribution of transcripts observed after a 10-min chase (lane
7) remained unchanged even after a 60-min chase (data not
shown).
Figure 3:
Effect of recombinant LBP-1b on HIV-1
transcription in vitro. Pulse-chase assays were performed with
isolated PICs as diagrammed in Fig. 2and detailed under
``Experimental Procedures.'' A, lack of an effect of
LBP-1b on initiation/early elongation of HIV-1 transcripts. HIV-1 PICs
were isolated under standard transcription reaction conditions (without
NTPs) at 70 mM KCl. PICs were then incubated either in the
absence (lane 1) or in the presence of increasing amounts of
LBP-1 (lanes 2 and 3) for 7 min at 30 °C before
performing a pulse (P) reaction as in Fig. 2. The
various transcription reaction products are indicated. B,
block of elongation of HIV-1 transcripts by LBP-1b. After the formation
of an early elongation complex with RNA polymerase stalled at position
+13 (pulse), as detailed under ``Experimental
Procedures,'' 50 ng and 100 ng of LBP-1b were added to
transcription reactions in the absence (lanes 1-4) or
presence (lanes 5-8) of 60 µg of HeLa nuclear
extract and incubated for 7 min at 30 °C. Unlabeled NTPs were then
added, and the reaction mixture was further incubated for another 20
min to score formation of 600-nt transcripts (chase). Lanes 1 and 5 show the reaction products (13-mer) of the pulse (P). Numbers on the side refer to transcript
size markers.
Figure 4:
Characterization of the HIV-1
transcription block by LBP-1b. A, effect of KCl on HIV-1
elongation complexes paused by LBP-1b. Pulse-chase assays were
performed with isolated PICs either in the absence (lanes 1 and 3) or in the presence (lanes 2 and 4) of LBP-1b as diagrammed in Fig. 2and detailed in
the legend to Fig. 3. In addition, 200 mM KCl was added
to the reaction in lane 4 (*) after the standard chase, and
all reactions then were incubated for an additional 20 min at 30
°C. The paused transcripts observed after a 20-min chase under
standard conditions (lane 3) were not further extended even in
a 60-min chase. B, reversal of LBP-1b elongation block by
oligonucleotides that bind LBP-1. The pulse was performed as diagrammed
in Fig. 2and detailed under ``Experimental
Procedures.'' LBP-1b (100 ng) was then added either alone (lane 3) or with an oligonucleotide containing high affinity
LBP-1 recognition sites (Wt, lane 4), or with an
oligonucleotide containing mutations in high affinity LBP-1 recognition
sites (IS4 mutation, see Fig. 5legend) (Mt, lane
5). The reaction mixtures were then incubated for 7 min at 30
°C prior to execution of the chase. Both Wt and Mt oligonucleotides
were present at a 100-fold molar excess over the DNA template. Lanes 1 and 2 show the products of control pulse
(13-mer) and chase (600 nt) reactions,
respectively.
During the course of our studies
on repression of HIV-1 transcription initiation by LBP-1b in extracts
from HeLa cells, it was observed that recombinant LBP-1b (hereafter
referred to as LBP-1 in this paper) could inhibit transcription in a
dose-dependent manner even when added after preinitiation complex (PIC)
formation. Thus, in the analysis of Fig. 1, the HIV-1 template
and a control adenovirus MLP template were preincubated with nuclear
extract prior to addition of LBP-1. Transcription was subsequently
scored by the pulse-chase assay diagrammed in Fig. 1(see below
also). Since these assay conditions preclude the inhibition of TFIID
binding to the promoter by exogenous LBP-1 (by preforming a stable PIC)
and score only a single round of transcription(37) , it was
surprising to find that even under these conditions LBP-1 specifically
inhibited HIV-1 transcription and not MLP transcription (Fig. 1, lanes 1-4). This result suggested that LBP-1 could also
repress HIV-1 transcription by a mechanism different from that
involving exclusion of TFIID binding to the TATA box. Moreover, this
effect was specific for the HIV-1 promoter when compared to a control
adenovirus promoter (MLP) lacking LBP-1 binding sites.
The kinetic analysis during the chase showed a clear
pause site near +70, with the accumulated transcripts chased as a
function of time (Fig. 2, lanes 2-7). This pause
was observed previously both in vitro, with a
(dC)
It
is worth noting that LBP-1 binds as a dimer to its recognition site (38) and that the HIV-1 promoter contains three high affinity
and six low affinity LBP-1 recognition sites (Fig. 7). Thus, the
molar ratio of LBP-1 to the HIV-1 promoter (relative to the above
considerations) is no more than 2 when 100 ng of LBP-1 are present in
any given reaction. This indicates that a low concentration of
recombinant LBP-1 in our assay conditions can lead to a block of
elongation.
Figure 7:
Binding of LBP-1b to upstream low affinity
sites on the HIV-1 promoter. Gel mobility shift analysis was performed
with 5 ng of LBP-1b and 20 fmol of a radiolabeled DNA fragment
(-120 to -31) derived from the HIV-1 promoter. Competitor
oligonucleotides, used at 100-fold molar excess compared to the probe,
are indicated. Both ``long'' (L) and
``short'' (S) are double-stranded oligonucleotides
that contain three or two high affinity LBP-1 sites and correspond to
position -17 to +27 and -16 to +15, respectively.
The L
The pulse-chase assay involves PIC purification by gel
filtration which removes most (approximately 90%) of the HeLa nuclear
proteins. In order to mimic more closely the conditions under which
exogenous LBP-1 inhibited the HIV-1 transcription when PICs were
preformed in a standard in vitro system (unfractionated
nuclear extract) (Fig. 1), we studied the effect of LBP-1 in a
pulse-chase assay in which nuclear extract proteins were added back
(with LBP-1) during the chase (Fig. 3B, right). Under these conditions, the elongation block proximal
to the promoter was overcome totally by the presence of the extract
proteins with promoter distal elongation products clearly evident (Fig. 3B, compare lanes 7 and 8 with lane 6). Significantly, however, the transcripts were
heterogeneous in size (mostly from 150 to 400 nt), and the level of
full-length (600 nt) run-off transcripts was still decreased in an
LBP-1 concentration-dependent manner. This was revealed more clearly
when the transcription products were fractionated in a 6% denaturing
polyacrylamide gel (data not shown). Although we do not know how HeLa
nuclear extract components overcome the LBP-1 block proximal to the
promoter, it is likely that this involves endogenous elongation factors
such as TFIIF, TFIIS, and TFIIX (references above) or the more recently
described elongation activities such as P-TEF (46) and SIII (51) in the extract. At the same time, it is significant that
even in the presence of HeLa nuclear extract factors, LBP-1 can still
restrict the processivity of RNA polymerase and result in a potential
block of elongation distal to the promoter. This result correlates with
the inhibition of HIV-1 transcription by LBP-1 in the crude cell-free
system under conditions where PICs are preformed before addition of
LBP-1 (Fig. 1). Since the pulse-chase analysis at both 50 and
70 mM KCl showed a restriction of HIV-1 transcription at the
level of elongation in the absence of exogenously added LBP-1 (Fig. 2, 3B, 4A, 4B, and 5), we
tested whether the potential recruitment of endogenous LBP-1 in HeLa
nuclear extracts into the PIC was involved in this restriction.
However, even when LBP-1-depleted nuclear extracts were employed for
PIC formation and isolation, HIV-1 transcription was still restricted
at the level of elongation (data not shown). As mentioned above, this
restriction most likely reflects the absence of elongation factors in
isolated PICs(18, 46, 47, 52) .
Furthermore, since the LBP-1 block of elongation is observed when LBP-1
is added either after PIC formation (Fig. 1) or after 13-mer
formation (Fig. 3B), it seems likely that LBP-1 might
function during early elongation events by competing with elongation
factors (see ``Discussion''). We do not know why HIV-1
transcription is not restricted at the level of elongation in standard
(untreated) HeLa nuclear extracts ( Fig. 1and Fig. 8).
However, since the sole addition of a low concentration of recombinant
LBP-1 leads to a block of elongation ( Fig. 1and Fig. 8),
this argues for a model in which LBP-1 function may be subject either
to a competition with elongation factors or to a tight regulation (i.e. by phosphorylation or by an interacting repressor) which
may be altered during nuclear extract isolation and manipulation.
We
next tested whether the DNA binding activity of LBP-1 was required for
the HIV-1 promoter elongation block. Evidence for this was indicated
both by the ability of oligonucleotides containing wild type, but not
mutated, LBP-1 binding sites to reverse the effect of LBP-1 (Fig. 4B, compare lanes 4 and 5 with lane 3) and by the inability of LBP-1d (the isoform which does
not bind to DNA) to block HIV-1 elongation (data not shown).
The failure of mutations in the high affinity LBP-1
recognition sites to relieve the inhibition of elongation by LBP-1
suggested that the binding of LBP-1 to these sites might not be the
sole mechanism by which LBP-1 can block HIV-1 elongation. Thus, it
remained possible that LBP-1 could still bind to the template under the
conditions employed, either to the mutated high affinity LBP-1 sites
themselves or, in an independent manner, to the low affinity sites
located immediately upstream of high affinity sites (between -4
and -80). To gain insight into this question, a gel retardation
assay was employed to test the direct binding of LBP-1 to radiolabeled
oligonucleotide probes containing either wild type or mutated high
affinity LBP-1 binding sites. Somewhat surprisingly, LBP-1 still bound
to a probe containing the mutated LBP-1 sites, although the binding was
4-fold lower when compared with binding to the wild type sites (Fig. 6, compare lanes 9-12 with lanes
2-4, respectively). Interestingly, when poly(dI-dC) was
included in the reaction as a nonspecific competitor, LBP-1 bound with
a much lower efficiency (more than 40-fold) to the mutated LBP-1 probe
relative to the wild type probe (Fig. 6, compare lanes
13-15 with lanes 5-7, respectively). Thus,
the binding of LBP-1 to the high affinity sites compared to the low
affinity sites becomes more prominent in the presence of nonspecific
competitors. This observation could explain why mutations of high
affinity LBP-1 recognition sites (IS4) relieved the inhibition of HIV-1
transcription at the level of initiation when poly(dI-dC) was present
in the transcription reaction(37) .
Figure 6:
Binding of LBP-1b to both wild type (Wt) and mutant (Mt(IS4)) high affinity LBP-1 sites.
The gel mobility shift assay was performed as described under
``Experimental Procedures.'' Ten fmol of either Wt probe (lanes 1-7) or Mt (IS4) probe (lanes
8-15) was mixed with or without the indicated amounts of
poly(dI-dC) before the addition of LBP-1b as indicated. Both the free
and bound probe are shown by the brackets.
Competition analyses
with the gel retardation assay indicated that the binding of LBP-1 both
to the wild type and to the mutated LBP-1 sites was specific even
though the binding affinity to the latter sites was low. Furthermore,
although it is unclear what the difference is between the lower and
upper bands in the LBP-1
Thus, it is evident
that LBP-1 can bind independently (in the absence of high affinity
sites) to low affinity LBP-1 recognition sites. In addition, this
observation correlates with DNase I footprinting analysis showing LBP-1
mediated protection of low affinity sites using either wild type or IS4
promoters or promoters containing severe mutations of high affinity
LBP-1 recognition sites (data not shown). Overall, our results suggest
that LBP-1, most likely through the low affinity LBP-1 binding sites on
the HIV-1 promoter, can compromise the processivity of the RNA
polymerase and, therefore, restrict the elongation of HIV-1 transcripts in vitro.
In a further analysis we also tested the effect of LBP-1 on the high
levels of Tat-activated transcription observed in nuclear extracts
under conditions (citrate treatment, see above) which lower their
capacity for transcription elongation (but not initiation) on the HIV-1
promoter(18) . Somewhat surprisingly, LBP-1 suppressed Tat
function under these conditions, but did not further decrease basal
activity (data not shown), indicating that combined effects of LBP-1
and citrate treatment may modify the transcription complex in such a
way that Tat could no longer make it processive. In addition, while the
elongation restriction effected by citrate does not preclude synthesis
of TAR RNA for Tat function(18) , LBP-1 under these particular
conditions might do so and thus inhibit Tat function indirectly. These
considerations suggest, first, that Tat function may require a narrow
window of conditions (e.g. cellular factor concentrations)
which substantially restrict elongation while still allowing the
formation and the function of a Tat This report shows that the cellular factor LBP-1 has the
ability to restrict the processivity of RNA polymerase complexes
initiated at the HIV-1 promoter and, further, that the HIV-1-encoded
Tat protein can partially overcome the LBP-1-induced elongation block.
These results are important because recent studies have shown that
elongation from the HIV-1 promoter is limited in the absence of Tat,
and that LBP-1 sites in the HIV-1 promoter overlap an element (IST)
implicated in the generation of short transcripts, whose accumulation
in some cases is correlated with restricted elongation in the absence
of Tat.
The present results may also be
relevant to the function of the IST element, which overlaps the high
affinity LBP-1 sites. While a study of the effects of mutations in
these sites reportedly eliminated a role for LBP-1 in IST
function(35) , this possibility is left open by our
demonstration that LBP-1 can still bind to templates bearing the same
mutations. On the other hand, the IST also exhibits another function,
namely enhanced promoter activity, that has not yet been demonstrated
for the recombinant LBP-1 isoform employed here. Moreover, an
understanding of the exact relationship between the downstream LBP-1
and IST elements has been difficult because of functional initiator
elements that overlap the LBP-1/IST sites(6) . Likewise,
dissection of functions of the upstream LBP-1 sites is complicated
because of their multiplicity and interspersion among the TATA and Sp1
sites. This multiplicity of LBP-1 sites may provide a functional
redundancy that could have precluded their implication in HIV-1
promoter functions in previous studies.
Figure 9:
Models for promoter-proximal events that
govern downstream elongation and termination properties of RNA
polymerase. A, bacteriophage
Thus, during the very early phase
of elongation by RNA polymerase II on the HIV-1 promoter (e.g. from a stalled position at +13 in the present analysis), the
binding of LBP-1 to the low affinity sites flanking the TATA box, or
possibly to the high affinity sites, might prevent productive
interactions of cellular factors important for promoter clearance (58) and/or distal
elongation(46, 47, 49, 51, 52, 59) ,
such that the transcription complex is only weakly processive (Fig. 9C). Lu et al.(1993) (34) have
also suggested that the TATA box in HIV-1 contributes, in the absence
of an strong activator, to the formation of nonprocessive transcription
complexes. This model could explain how LBP-1 might restrict HIV-1
elongation in the absence of Tat and yet facilitate a Tat response by
allowing TAR RNA formation with concomitant pausing for effective Tat
binding and function from a promoter proximal position (Fig. 9C, see below also). Consistent with this model,
an effect of Tat in reversing the LBP-1-mediated elongation block in
standard (untreated) nuclear extracts was demonstrated (Fig. 8).
On
the basis of past and present data, several models for Tat action may
be considered, all based on the assumption that at least some fraction
of the elongation complexes generated in the absence of Tat are only
weakly processive. First (Model A), as in the earliest models, Tat may
alter the processivity of the associated elongation complex in a
co-transcriptional manner. Second (Model B), TAR-bound Tat in weakly
processive complexes may enhance, in a stoichiometric fashion, the
processivity of subsequently formed transcription complexes at the time
of preinitiation complex assembly or function (``reach back''
model). Third (Model C), TAR-bound Tat in a weakly processive complex
may enhance the processivity of the following de novo elongation complex (as in Model B) which in turn provides a
recognition site for Tat for alteration of the succeeding complex, and
so on. In the latter model, appropriate Tat function might still
require transient pausing of an otherwise highly processive complex in
the vicinity of the promoter. Possibly relevant to this point, GAGA
protein-dependent RNA polymerase pausing on the hsp70 promoter (55) is observed even after induction of elongation by heat
shock factor(60) . Clearly, Models B and C can explain how Tat
could effect a switch in the elongation properties of a nascent complex
(to a more processive form) during the process of initiation complex
formation (assembly) or function (initiation or very early elongation
events). All models can accommodate roles for promoter-proximal DNA
elements and interacting factors, including LBP-1 in the present case,
in restricting elongation and/or initiation and setting the stage for
Tat function. Models B and C also allow the possibility of Tat effects
on the rate of initiation through direct interactions with PIC
components(20, 61) . In fact, there could be a causal
relationship between effects of Tat on initiation and increased
processivity, as has been indicated (13, 62, 63) or predicted (21, 28, 30) for conventional activators
acting at 5` sites. This could explain some observed nonadditive
effects of upstream activators and Tat(25) . The present
study has defined a potentially important role for an LBP-1 isoform
(LBP-1b) in restricting the processivity of RNA polymerase on the HIV-1
promoter. Further studies must determine the molecular targets of
LBP-1, the essential LBP-1 binding sites and their relationship to the
IST, the functions of individual isoforms of LBP-1, whether LBP-1 is
required not only for a general restriction of processivity but also
for the Tat activation process per se, and how and at what
step Tat overcomes the LBP-1 restriction to processivity.
Volume 270,
Number 5,
Issue of February 3, 1995 pp. 2274-2283
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
)promoter is regulated
through upstream elements (-120 to -77) by the inducible
activator NF-
B and through a downstream element (+14 to
+44) by the virus-coded Tat protein (reviewed in (1) ). In
between lie DNA elements that are recognized by the constitutive
activator SP1, which may facilitate Tat and NF-B
functions(2, 3) , and core promoter elements (TATA and
Initiator) which are recognized by the basic transcriptional
machinery(4, 5, 6) . Embedded within the
latter elements are additional sites, recognized minimally by the
cellular factor LBP-1 (7, 8) , that may contribute to
basal promoter activity.N protein in conferring
anti-termination properties on the associated RNA
polymerase(21) . On the other hand, and consistent with
possible effects of Tat on levels of initiation as well, it has been
shown that activation by Tat (but not NF-
B) requires a specific
TATA element(3, 22, 23) , that Tat can
function when tethered to the promoter by fused DNA binding
domains(24, 25, 26, 27) , and that
Tat can stabilize preinitiation complexes(20) . To explain
these diverse phenomena, it has been suggested (12, 13, 28, 29, 30) that
TAR-bound Tat could function during assembly of the subsequent PIC
(``reach back'' mechanism) to effect formation of a more
processive complex, analogous to that formed by conventional
activators, and possibly the rate of initiation as well.
DNA Templates
The wild type HIV-1 template
contained long terminal repeat sequences from -167 to +80 in
the chloramphenicol acetyltransferase expression plasmid
p-167(39) . The HIV-1/IS4 template was identical except that it
contained long terminal repeat sequences from -167 to +58
with triple mutations in each of the three LBP-1 recognition elements
in the high efficiency binding sites (-4 to +21) (see (37) and the legend to Fig. 5). The adenovirus major
late (AdML) template contained promoter sequences from -404 to
+10 in pML(C
AT) plasmid(40) . The HIV-1 and
AdML plasmids were linearized with MscI and SmaI in
order to score accurately initiated run-off transcripts of 600 nt and
380 nt, respectively. Restricted DNAs were ethanol-precipitated, and
pellets were washed twice with 70% ethanol prior to resuspension in TE
buffer (10 mM Tris-HCl, pH 7.5, and 0.2 mM EDTA).
Expression and Purification of Recombinant Tat and
LBP-1b
Histidine-tagged Tat (41) and histidine-tagged
LBP-1b (38) were expressed in Escherichia coli and
purified to homogeneity as described.Standard in Vitro Transcription and
``Pulse-Chase'' Analyses
HeLa nuclear extracts were
prepared as described(42) . Standard reactions for
preinitiation complex (PIC) formation (12.5 µl) contained: 15
mM Tris-HCl, pH 7.9, 20 mM HEPES-KOH, pH 8.0, 12%
glycerol, 0.1 mM EDTA, 4 mM dithiothreitol, 6 mM MgCl, 70 mM KCl, 5 mM creatine
phosphate (Sigma), 40 µg/ml creatine kinase (Sigma), 5 units of
RNasin (Promega), 60 µg of nuclear extract proteins, and linearized
HIV-1 and AdML template DNAs (50 ng each). In the various analyses, the
components were preincubated for 10-30 min (as indicated) to
allow PIC formation. In the analysis of Fig. 8, PIC formation
was followed by addition of 12.5 µM [
-P]UTP (3000 Ci/mmol) and 500
µM each of CTP, GTP, and ATP and further incubation for
the indicated periods of time. Other additions (LBP-1 and Tat), and
exceptions to the order of addition, were as indicated in the figures
and figure legends. In the pulse-chase analysis of Fig. 1, PIC
formation was followed by sequential additions of LBP-1, 50 µM dATP, 25 µM GTP and CTP, and 0.25 µM (10
µCi) [
-P]UTP, and incubation was for 3
min at 30 °C (``pulse''); this was followed by the
addition of 500 µM each of ATP, GTP, and CTP and 1000
µM UTP, and further incubation was at 30 °C for 20 min
(``chase''). The modified pulse-chase analysis for other
figures is detailed below.
-P]UTP and further
incubation for 60 min at 30 °C.
-P]UTP (pulse) in the presence or
absence of LBP-1 as indicated.
Isolation of PICs by Gel Filtration and Pulse-Chase
Assay
The isolation of PICs by gel filtration and subsequent
pulse-chase assay (Fig. 2Fig. 3Fig. 4Fig. 5) were as
described (43) with the following modifications. The PICs for 8
standard transcription reactions were formed by incubating about 50
µg of HeLa nuclear extract with 800 ng of HIV-1 promoter in a final
volume of 50 µl for 20 min at 30 °C, under buffer conditions
described above except for the presence of 8 mM MgCl and 80 mM KCl. Then the protein-DNA complexes (PICs)
were isolated by spin dialysis (44) through Bio-Gel A-1.5m
columns equilibrated with transcription buffer without nucleotides. The
isolated complexes (in about 80 µl) were used immediately for
pulse-chase analysis. The pulse involved incubation of 10 µl of
gel-filtered PICs with 25 µM (each) CTP and GTP, 50
µM dATP, and 0.25 µM [-P]UTP (10 µCi, 3000 Ci/mmol) at
30 °C for 5 min. In the absence of ATP, this procedure leads to
formation of a stably stalled RNA polymerase at around position
+13 on the HIV-1 promoter. The chase was carried out by incubating
stalled elongation complexes with 500 µM each CTP, GTP,
and ATP and 1 mM UTP for 10 to 20 min at 30 °C. It should
be noted that the processivity of RNA polymerase during the chase is
highly dependent on the concentration of salt in the
assay(43, 45) . At 200 mM KCl or 0.2%
sarkosyl, the chase of transcripts is very efficient, and most of the
transcripts are full-length (600 nt) (data not shown). In the present
study, all transcription analyses were performed at 70 mM KCl,
except when otherwise indicated. The reaction products from all the
pulse-chase analyses described here were processed as described above
and fractionated on denaturing 20% polyacrylamide gels.
Gel Mobility Shift Assay
These analyses were
performed as described (38) with some modifications. Ten fmol
of double-stranded radiolabeled oligonucleotide containing high
affinity LBP-1 recognition sites from the HIV-1 promoter (-4 to
+21) were used to measure binding of recombinant LBP-1b. The
reaction mixture contained 20 mM HEPES-KOH, pH 8.0, 1 mM dithiothreitol, 4% Ficoll type 400, 70 mM KCl, 1 mM spermidine, 0.03% Nonidet P-40, and 100 µg/ml bovine serum
albumin. The amounts of nonspecific competitor poly(dI-dC), or specific
oligonucleotide competitors, are indicated. Reaction products were
analyzed by a 4% (60:1, acrylamide:bisacrylamide) nondenaturing gel in
0.5 
Tris borate-EDTA buffer and 0.03% Nonidet P-40.
LBP-1 Specifically Inhibits HIV-1 Transcription by a
Mechanism That Does Not Affect Transcription Initiation
A cDNA
cloning project directed toward a further investigation of the role of
LBP-1 in HIV-1 transcription resulted in the isolation of four human
cDNAs encoding variant forms of LBP-1(38) . In an initial
functional characterization, isoforms LBP-1a, LBP-1b, and LBP-1c each
were found to behave similarly to natural LBP-1 with respect to
site-specific DNA binding and the ability to inhibit HIV-1
transcription at the level of initiation (by blocking TFIID binding to
the TATA box; (37) ). In each case, this inhibition was
relieved by mutations in the high affinity LBP-1 recognition sites
(mutant IS4) on the HIV-1 promoter. In contrast, the variant (LBP-1d)
which shows no DNA binding also failed to inhibit transcription. Given
the apparently similar properties of LBP-1a, -1b, and -1c relative to
each other and to highly purified natural LBP-1, we used the
recombinant LBP-1b, which contains all putative LBP-1 domains (38) , for further studies.Characterization of Initiation and Elongation of HIV-1
Transcripts by a Pulse-Chase Analysis of Isolated Preinitiation
Complexes
To determine how LBP-1 inhibits HIV-1 transcription
subsequent to preinitiation complex (PIC) formation (see below), we
developed a modified pulse-chase assay (diagrammed in Fig. 2)
that involves both the formation (in crude extracts) and the
purification (by gel filtration) of PICs prior to functional
analysis(43) . During the subsequent pulse, the isolated HIV-1
PICs were incubated under transcription conditions with GTP, CTP,
[-P]UTP, and dATP (but not ATP), thus
allowing initiation and elongation only to position +13 since the
first A is encountered at the +14 position in the HIV-1 promoter.
During the chase, the artificially stalled elongation complexes were
incubated further with an excess of all four ribonucleoside
triphosphates in order to dilute the labeled UTP and to allow normal
elongation past position +13. Under these conditions, it was
expected that most of the artificially stalled RNA complexes would
resume elongation and produce a 600-nt run-off RNA. The data in Fig. 2show such a pulse-chase assay for isolated PICs in the
absence of added LBP-1. Here, the pulse produced, as expected, a small
population of short transcripts of about 13 nucleotides (lane
1). However, a 10-min chase at 50 mM KCl resulted in a
distribution of partially elongated (paused) transcripts which extended
to points lying between nucleotide 110 (the position of a discrete
transcript) and nucleotide 600 (lane 7, see also the legend to Fig. 2). Importantly, most of these arrested transcripts were
further elongated to 600 nt (the end of the template) when 200 mM KCl was added to an equivalent reaction and incubated for an
additional period of time (Fig. 2, lane 8 versus lane
7), indicating that most of the transcription complexes are
reversibly paused rather than
terminated(45, 46, 47) . The clear
restriction of elongation of HIV-1 transcripts in this particular
pulse-chase assay at 50 mM KCl may reflect either interactions
(during PIC formation) of factors which limit processivity or the loss
(during PIC isolation) of elongation or anti-pausing activities (e.g. TFIIS, TFIIF, or TFIIX) which enhance RNA polymerase II
processivity (reviewed in (48) ; see also (46) and (49) ).
-tailed HIV-1 promoter which allows initiation
independent of promoter elements(50) , and in
vivo(11, 32, 33, 34, 35) .
Thus, it was interesting to find that, under our assay conditions, the
RNA polymerase pauses at +70 even at high concentrations of KCl
and sarkosyl where the elongation complex is highly processive (data
not shown). The mechanistic relevance of this pause to Tat function is
presented under ``Discussion.''Pulse-Chase Assays Reveal That LBP-1 Can Block Elongation
of HIV-1 Transcripts from Isolated Preinitiation Complexes
LBP-1
inhibited HIV-1 transcription in the cell-free system under conditions
where PICs were preformed (Fig. 1). To investigate this
repression of HIV-1 transcription by LBP-1, we used the modified
pulse-chase assay (involving PIC isolation) described in Fig. 2.
As expected, and consistent with our earlier observation that
prebinding of TFIID to the promoter prevented repression of initiation
by LBP-1(37) , the addition of LBP-1 during the pulse did not
block formation of the 13-mer (i.e. did not inhibit initiation
and very early elongation steps) (Fig. 3A, lanes 2 and 3 versus lane 1). However, addition of LBP-1 during
the chase blocked the normal elongation of HIV-1 transcripts to a
600-nt run-off RNA in a protein concentration-dependent manner (Fig. 3B, left). It should also be noted that,
under the moderate salt concentration (70 mM KCl) employed
here, a large fraction of the stalled complexes produced full-length
run-off transcripts during the chase (although a partial restriction to
elongation was still apparent). Hence, when LBP-1 was present at a
molar ratio (relative to the promoter) of about 10 (50 ng), there was a
partial block of elongation proximal to the promoter and,
interestingly, also a block of transcripts more distal to the promoter (Fig. 3B, lane 2 versus lane 3). In contrast,
when the LBP-1 to promoter ratio was increased to about 20 (100 ng of
LBP-1), there was a nearly complete elongation block proximal to the
promoter, with a corresponding reduction of 70-nucleotide and longer
transcripts (Fig. 3B, lane 4 versus lanes 3 and 2). Although we did not observe a uniform
accumulation of short RNA transcripts as a result of the addition of
LBP-1, the pulse-chase assay has revealed a novel in vitro LBP-1 activity, namely, the ability to restrict the elongation of
HIV-1 transcripts by reducing the processivity of RNA polymerase.
oligonucleotide contains mutated high affinity sites
(IS4). The drawing below the figure shows the HIV-1 promoter as well as
the location of the probe and competitors used in this assay. Low
affinity LBP-1 binding sites that flank the TATA box (37) and
the potential low affinity LBP-1 binding sites (-68
CCTGGGCGGGACTGG -53) that overlap the Sp1 binding sites
(-77 to -45) are also
indicated.
Characterization of the Elongation Block Indicates That
LBP-1 Causes RNA Polymerase Pausing, and That the DNA Binding Activity
of LBP-1 Is Required for the Inhibition of HIV-1 Transcription
Elongation
To have a better understanding of the mechanism of
the elongation block, we asked whether LBP-1 caused termination, rather
than simply pausing, of the RNA polymerase. The analysis was performed
at an LBP-1/template molar ratio of about 15, which resulted in
elongation blocks both proximal and distal to the promoter (Fig. 4A, lane 2 versus lane 3; see the legend
also). However, when an equivalent reaction (with LBP-1) was incubated
for an additional 20 min in the presence of 200 mM KCl, most
of the blocked intermediate transcripts were chased to 600 nucleotide
products (Fig. 4A, compare lane 4 versus lane
2). This indicated that for most transcripts LBP-1 had caused
pausing, but not termination, by RNA polymerase. However, we cannot
exclude the possibility that some of the nonchased transcripts (e.g. those at +70) might reflect terminated RNAs.Neither Triple Mutations (IS4) nor Severe Mutations of
the Three High Affinity LBP-1 Recognition Sites Relieve the Block of
HIV-1 Elongation by LBP-1
We next tested whether high affinity
binding of LBP-1 to the HIV-1 promoter is necessary to block
elongation. Since it was shown previously that LBP-1 binds first to the
high affinity binding sites prior to the low affinity sites on the
HIV-1 promoter(7, 8, 37) , it seemed likely
that LBP-1 blocked early elongation events by interacting with both the
high affinity binding sites and RNA polymerase II. Thus, to investigate
directly the contribution of the high affinity LBP-1 binding sites to
the block of HIV-1 elongation by LBP-1, the pulse-chase assay was used
to compare the wild type template with a mutant template (HIV-l/IS4; (37) ) containing 3 point mutations in each of the three high
affinity LBP-1 recognition sites. When the wild type HIV-1 promoter was
incubated with LBP-1 at a factor to template molar ratio of about 20 or
more, the elongation block was mostly proximal to the promoter (Fig. 5, lanes 1-4). However, when the mutant
HIV-l/IS4 promoter was incubated with the same or double the amount of
LBP-1, the elongation block persisted (Fig. 5, lanes
5-8; see the legend also); the uniformly lower signal in
these lanes reflects an effect of the mutations on overall promoter
activity, consistent with earlier observations(7) . Although
our laboratory has shown that LBP-1 inhibits both initiation and
elongation of HIV-1 transcription, we have no evidence that LBP-1 is
involved in transcriptional activation of the HIV-1 promoter; hence, it
is not clear whether LBP-1 or another (possibly less abundant or less
stable) cellular factor functions through these sites to activate
transcription.
DNA complex (Fig. 6), both
complexes are specifically bound by LBP-1 (data not shown). Hence, it
remained possible that LBP-1 could bind to mutated sites with higher
efficiency in the context of the HIV-1 promoter and other interacting
factors, even in the presence of poly(dI-dC), and thus block
elongation. To further investigate this possibility, we used the
pulse-chase assay to test for elongation blocks by LBP-1 on two HIV-1
promoters containing different and more drastic mutations in the high
affinity LBP-1 binding sites. Although DNA probes containing these
mutations did not exhibit LBP-1 binding by any (direct binding or
oligonucleotide competition) assays, templates with these mutations
showed the same sensitivity to elongation inhibition by LBP-1 as did
templates with HIV-l/IS4 and wild type promoter (data not shown). Taken
together, these results indicate that the binding of LBP-1 to high
affinity sites is not necessary for LBP-1 to restrict elongation of
HIV-1 transcripts.LPB-1 Binds Independently to the Low Affinity LBP-1
Recognition Sites
Based on the above-mentioned results, we
hypothesized that LBP-1 could bind the low affinity sites under
appropriate conditions and thus effect a block of HIV-1 promoter
function. Indeed, a gel retardation assay with a probe (-120 to
-31) containing only the low affinity sites (bottom of Fig. 7and the figure legend) showed significant binding of LBP-1 (Fig. 7, lane 1). Specificity was indicated by complete
competition with an oligonucleotide containing either two (S) or three
(L) LBP-1 recognition sites, but only partial competition (as expected)
with an LBP-1 oligonucleotide (Lm) containing IS4 mutations in (Fig. 7, lanes 2-4). Although we do not know why
the IS4 oligonucleotide did not partially relieve the block of
elongation by LBP-1 in a transcription assay (Fig. 4B),
we assume that competition by IS4 oligonucleotide is simply less
efficient when LBP-1 binds (possibly with interacting factors) to its
recognition sites in the entire HIV-1 promoter.Tat Protein Can Overcome the LBP-1-induced Elongation
Restriction of HIV-1 Transcripts
The novel finding that LBP-1
impairs HIV-1 elongation is particularly interesting because, as
mentioned earlier (introduction), the HIV-1 promoter is highly
restricted at the level of elongation in vivo in a manner that
can be overcome by Tat protein. In contrast, the HIV-1 promoter is
actively transcribed under standard in vitro conditions
(untreated nuclear extracts) which generate full-length transcripts in
the absence of Tat(16, 17, 18, 30) .
This indicates that under these conditions HIV-1 transcription
apparently is not restricted at the level of elongation. However, a
significantly enhanced transcription by Tat has been observed following
preincubation of HeLa nuclear extracts with citrate(18) ,
poly(rI-rC), or ATP(16, 17) . All of these conditions
specifically impair RNA polymerase II elongation activity, and not
initiation, on the HIV-1 promoter, and they do not impair either
initiation or elongation on a control AdML promoter. Since LBP-1 also
was found to restrict HIV-1 transcription at the level of elongation,
it was important to test whether Tat could overcome this restriction as
well. However, since LBP-1 can inhibit PIC formation in the cell-free
system(37) , PICs were allowed to form on both HIV-1 and AdML
promoters before the addition of LBP-1 and Tat proteins. In this
particular assay, LBP-1 specifically inhibited transcription from the
HIV-1 promoter, with no significant effect on the AdML promoter, and
Tat protein in large part overcame this restriction to HIV-1
transcription (Fig. 8, compare lanes 1-4 with lanes 5-8). This Tat effect is dependent on the presence
of wild type TAR RNA (data not shown). Although the reversal of
LBP-1-induced inhibition of HIV-1 transcription by Tat was relatively
inefficient at the highest LBP-1/template molar ratio (approximately
10) tested (Fig. 8, lane 4 versus lane 8), these
results nevertheless suggested that LBP-1 could be a part of the
natural mechanism which restricts HIV-1 transcription at the level of
elongation in a manner that potentially can be overcome by Tat protein. TAR complex and, second, that
these processes can involve individual effects of either LBP-1 or other
(co)factors altered by citrate treatment.
Promoter Sites Important for LBP-1 Function
The HIV-1
promoter contains both downstream high affinity and upstream low
affinity sites for recognition by LBP-1 (Fig. 7). Consistent
with our observation that previously described point mutations in each
of the three high affinity sites failed to relieve the LBP-1-mediated
block to elongation of HIV-1 transcripts, we have shown that LBP-1 can
still bind (albeit with lower efficiency) to the corresponding mutated
promoter region. While these results leave open the possibility of
LBP-1 function through the mutated downstream sites, LBP-1 also blocked
transcription elongation from templates with more severe downstream
site mutations that precluded any binding to this region. Consistent
with the suggestion from this result that upstream LBP-1 sites might
suffice for the in vitro elongation block, LBP-1 was shown to
bind specifically and independently to these sites. However, a
functional cooperativity between high and low affinity sites could be
evident under other conditions.Mechanism of Action of LBP-1 in Blocking Transcriptional
Elongation
Inhibition of elongation by LBP-1 appears to involve
both the DNA binding activity of LBP-1 and promoter proximal binding
sites, suggesting that LBP-1 may function either at an early step in
elongation or in a closely coupled step (e.g. initiation, see
below). Promoter-proximal sequences or interacting factors that affect
the elongation properties of RNA polymerase have been reported
previously for both prokaryotic and other eukaryotic genes (reviewed in
Refs. 21, 48, and 53). In the case of the bacteriophage P
`
promoter(54) , this involves interactions of the Q protein
both at an upstream site and at a downstream site which effects both
polymerase pausing and a conformation essential for recognition by Q
protein (see Fig. 9A). Similarly, in the case of the Drosophila hsp70 promoter(55) , heat shock factor
(HSF) reverses an RNA polymerase elongation block (around +23)
that is effected both by an element near the initiation site and by an
upstream site(s) that are recognized by the GAGA protein (Fig. 9B). A regulated block to elongation of the
c-myc P2 promoter also is determined by the promoter proximal
region(56, 57) .
P
` promoter. In
the absence of the Q protein, E. coli RNA polymerase
initiates and, after a transient pause at +16/+17, elongates
and terminates at downstream terminators. When present,
Q binds
via an upstream recognition element (black box) and, via Nus
A, interacts with a paused RNA polymerase and effects a modification
that permits elongation through downstream terminators. The +2 to
+6 element (striped box) effects RNA polymerase pausing
and a conformational change essential for
Q/Nus A interaction
(reviewed in (21) and (54) ). B, Drosophila hsp70 promoter. In the absence of HSF, RNA
polymerase II initiates transcription but pauses at +23 under the
influence of GAGA factor bound to an upstream element(s) (black
box) and a region (striped box) surrounding the
initiation site. After heat shock, the binding of HSF to upstream sites
(not shown) effects release of the elongation block (reviewed in (21) and (55) ). C, HIV-1 promoter. In the
absence of a strong activator, the binding of LBP-1 to low (striped
squares) and high (solid squares) affinity LBP-1
recognition sites during initiation or early elongation events may
effect RNA polymerase II conformation and/or interactions with
elongation factors. This LBP-1 action renders the elongation complex
nonprocessive and leads to the accumulation of randomly terminated
RNAs. In this model, LBP-1 function may be formally analogous to the
functions of the downstream site (+2 to +6) in the
P
` promoter and GAGA factor/initiation region in the hsp70
promoter, in effecting pausing or an elongation block, respectively.
Just as Q/Nus A and HSF alter RNA polymerase elongation properties
on the
P
` and hsp70 promoters, respectively, it is
proposed that Tat may alter the elongation restriction imposed on RNA
polymerase by LBP-1 on the HIV-1 promoter (see text for further
discussion).
General Models for Tat Function
The apparent
function of Tat from TAR-bound elongation complexes in the vicinity of
the promoter (introduction) suggests a more direct role (in Tat
function) for nonprocessive complexes which result either in discrete
short transcripts or in more randomly terminated transcripts. Although
a role for IST-dependent short transcripts in Tat function was
questioned on the basis of a mutagenesis study(35) , it was
suggested (28) that the low level of Tat-independent
transcription evident in the transient transfection assays employed
(leading in part to full-length transcripts) might have generated
sufficient RNA for Tat binding and function and thus bypassed a normal
IST/short transcript requirement. Similarly, we have found that
mutations in the same high affinity LBP-1/IST sites do not eliminate
Tat function under in vitro conditions where some basal
activity is evident (data not shown). Moreover, the fact that these
same mutations do not eliminate either LBP-1 binding or the
LBP-1-mediated restriction to elongation (discussed above) leaves open
the possibility of LBP-1 involvement in IST and/or Tat function.
)
We thank D. Luse and members of the Roeder laboratory,
especially Ananda Roy, Richard Bernstein, and Sean Stevens, for helpful
discussions and critical comments on the manuscript; Carmen Balmaceda
for excellent technical assistance, and Craig Rosen for the Tat
(1-67) plasmid.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  M. C. Frith, J. L. Spouge, U. Hansen, and Z. Weng Statistical significance of clusters of motifs represented by position specific scoring matrices in nucleotide sequences Nucleic Acids Res., July 15, 2002; 30(14): 3214 - 3224. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. K. Kim, C. F. Bourgeois, C. Isel, M. J. Churcher, and J. Karn Phosphorylation of the RNA Polymerase II Carboxyl-Terminal Domain by CDK9 Is Directly Responsible for Human Immunodeficiency Virus Type 1 Tat-Activated Transcriptional Elongation Mol. Cell. Biol., July 1, 2002; 22(13): 4622 - 4637. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 E. E. Drouin, C. E. Schrader, J. Stavnezer, and U. Hansen The Ubiquitously Expressed DNA-Binding Protein Late SV40 Factor Binds Ig Switch Regions and Represses Class Switching to IgA J. Immunol., March 15, 2002; 168(6): 2847 - 2856. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
C. F. Bourgeois, Y. K. Kim, M. J. Churcher, M. J. West, and J. Karn Spt5 Cooperates with Human Immunodeficiency Virus Type 1 Tat by Preventing Premature RNA Release at Terminator Sequences Mol. Cell. Biol., February 15, 2002; 22(4): 1079 - 1093. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
D. P. Tran, S. J. Kim, N. J. Park, T. M. Jew, and H. G. Martinson Mechanism of Poly(A) Signal Transduction to RNA Polymerase II In Vitro Mol. Cell. Biol., November 1, 2001; 21(21): 7495 - 7508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 J. J. Coull, F. Romerio, J.-M. Sun, J. L. Volker, K. M. Galvin, J. R. Davie, Y. Shi, U. Hansen, and D. M. Margolis The Human Factors YY1 and LSF Repress the Human Immunodeficiency Virus Type 1 Long Terminal Repeat via Recruitment of Histone Deacetylase 1 J. Virol., August 1, 2000; 74(15): 6790 - 6799. [Abstract] [Full Text]
|
|
|
|
 |
|
 C. Casse, F. Giannoni, V. T. Nguyen, M.-F. Dubois, and O. Bensaude The Transcriptional Inhibitors, Actinomycin D and alpha -Amanitin, Activate the HIV-1 Promoter and Favor Phosphorylation of the RNA Polymerase II C-terminal Domain J. Biol. Chem., June 4, 1999; 274(23): 16097 - 16106. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
N. Zambrano, G. Minopoli, P. de Candia, and T. Russo The Fe65 Adaptor Protein Interacts through Its PID1 Domain with the Transcription Factor CP2/LSF/LBP1 J. Biol. Chem., August 7, 1998; 273(32): 20128 - 20133. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y. Jiang, M. Yan, and J. D. Gralla Abortive Initiation and First Bond Formation at an Activated Adenovirus E4 Promoter J. Biol. Chem., November 10, 1995; 270(45): 27332 - 27338. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
L. Ramamurthy, V. Barbour, A. Tuckfield, D. R. Clouston, D. Topham, J. M. Cunningham, and S. M. Jane Targeted Disruption of the CP2 Gene, a Member of the NTF Family of Transcription Factors J. Biol. Chem., March 9, 2001; 276(11): 7836 - 7842. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
V. Casolaro, A. M. Keane-Myers, S. L. Swendeman, C. Steindler, F. Zhong, M. Sheffery, S. N. Georas, and S. J. Ono Identification and Characterization of a Critical CP2-binding Element in the Human Interleukin-4 Promoter J. Biol. Chem., November 17, 2000; 275(47): 36605 - 36611. [Abstract] [Full Text] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |