|
|
|
|||||||
|
|||||||||
(Received for publication, July 12, 1995; and in revised form, September 28, 1995) From the
The ``winged helix'' or ``forkhead''
transcription factors comprise a large gene family whose members are
defined by a common 100-amino acid DNA binding domain. Here we describe
the structure and expression of the mouse fkh-2 gene, which
encodes a protein of 48 kDa with high similarity to other winged helix
transcription factors within the DNA binding region, but unique
potential transactivation domains. The gene is encoded by a single exon
and is expressed in headfold stage embryos in the notochord, the
anterior neuroectoderm, and a few cells of the definite endoderm. This
expression becomes restricted to the anteriormost portions of the
invaginating foregut and the developing midbrain. From day 11.5 of
gestation onward, fkh-2 transcripts are restricted to the
midbrain and become progressively localized to the red nuclei as the
sole site of expression. The fkh-2 gene maps to chromosome 19B
and is a candidate gene for the mouse mutation mdf (muscle-deficient) which is characterized by nervous tremors and
degeneration of the hindlimb muscles. Although the expression patterns
of the fkh-2 gene and another winged helix protein,
HNF-3
The ``winged helix'' or ``forkhead''
transcription factors comprise a large and growing gene family whose
members are defined by a common 100-amino acid DNA binding domain. The
determination of the crystal structure of the DNA binding domain of
HNF-3 Since its discovery as a region of homology between
the rat HNF-3 (Lai et al., 1991) and the Drosophila gene forkhead (Weigel and Jäckle,
1990), the forkhead motif has been found in more than 40 genes in
species ranging from yeast to man (reviewed in Lai et
al.(1993)). Analyses of expression patterns as well as gain or
loss of function mutations of one of them have implicated these genes
in pattern formation during embryogenesis. The HNF-3 We have previously isolated nine
members of the winged helix family from mice (HNF-3
Figure 1:
Physical map of the mouse fkh-2 gene. The restriction map of the gene is shown together
with the extent of the
Figure 4:
Mapping of the fkh-2 gene to
mouse chromosome 19B by fluorescence in situ hybridization.
Detection of the hybridized probe via fluorescein isothiocyanate
revealed highly specific signals as indicated by the arrows in
the left panel showing a complete metaphase spread. A
simultaneously hybridized probe specific for 19C-D (see
``Materials and Methods'') was detected via rhodamine (see
arrowheads). Panels on the right side present additional chromosome 19
homologs from other metaphase spreads to illustrate the subchromosomal
localization on chromosome 19B.
Linkage analysis was
carried out using the DNA samples of the European Backcross (EUCIB)
kindly provided by the European Backcross Collaborative Group (The
European Backcross Collaborative Group, 1994). A 786-base pair fragment
of the fkh-2 gene was amplified with primers A
(CCATGGACCTCTGGACTATCTAGTTG) and B (CTTGGTCCCTCCTCTTCACACCC) in a
polymerase chain reaction buffer containing 1.5 mM MgCl
Figure 5:
Expression of the fkh-2 mRNA
during mouse embryogenesis. 20 µg of total RNA from the
developmental stages indicated (10 µg for day 8.5) were analyzed by
RNase protection as described under ``Materials and
Methods.'' The antisense probes and protected fragments (arrows) are labeled. The band for TBP indicates that equal
amounts of RNA were hybridized in all cases. The autoradiograph was
exposed for 96 h.
Figure 2:
Nucleotide and translated amino acid
sequence of the mouse fkh-2 gene. Shown is the sequence of the
proximal promoter with the potential binding sites of the transcription
factors indicated, followed by that of the composite cDNA sequences and
the corresponding amino acid sequence of the longest open reading
frame. The composite cDNAs extend from position 604 to 2931. The start
site of transcription is denoted by an arrow at position 586. The
translation initiation codon at position 1062 matches 4 out of 7 bases
of the Kozak consensus (Kozak, 1987). The potential polyadenylation
signal centered around position 2930 is indicated in italics.
The sequence of the 100-amino acid forkhead DNA binding domain as well
as domains A and B are underlined.
Figure 3:
In vitro translation of fkh-2 mRNA. In vitro synthesized mRNAs for the genes
indicated were translated in vitro in the presence of
[
In order to determine the
chromosomal localization of the fkh-2 gene, the entire
In order to precisely define the
cellular localization of the fkh-2 mRNA in midgestation
embryos, in situ hybridization studies were performed on
embyos starting at day 6.5 p.c. of gestation. The fkh-2 gene
is first expressed on day 7.5 p.c. in the ectoderm of the headfold (Fig. 6, A and B, and 7A) and is one
of the earliest known markers of the prospective neuroectoderm.
Transcripts are absent from the tip of the headfold but extend in the
ectoderm approximately halfway to the node (Fig. 6, A and B). Expression is absent in the ectoderm adjacent to
the primitive streak and in the extraembryonic tissues. fkh-2
transcripts are also detected in the notochord, weakly in the node and
in endoderm cells anterior to the node (Fig. 6, A and B). These endoderm cells will subsequently invaginate to form
the foregut. From day 8 to 8.5 p.c. (Fig. 7, B-E), fkh-2 expression becomes restricted in
the neuroectoderm to the developing posterior diencephalon and to the
midbrain region. Transcripts are also evident in the anterior tip of
the foregut endoderm, extending from the oral plate to the otic
vesicle, suggesting that the foregut is already regionalized at this
stage. In addition transcripts are detected in the notochord anterior
to the otic vesicle (data not shown). The expression outside the
neurectoderm disappears between day 9 and 11.5 p.c. As the neural folds
rise and fuse, fkh-2 mRNA becomes restricted to ventral
regions of the neural tube excluding the prospective floorplate (Fig. 8D and data not shown). While the activation of
the fkh-2 gene in the notochord and foregut is only transient,
its expression in the neuroectoderm becomes progressively localized to
the midbrain ( Fig. 7and Fig. 8). Between day 11 and 15
p.c. the neuroepithelium differentiates into four regions: the
ventricular, subventricular, intermediate mantle, and mantle layers. On
day 11.5 p.c. fkh-2 transcripts are localized to a
subpopulation of intermediate mantle and mantle cells in the
mesencephalon and metencephalon extending from the mesencephalic
flexure to the region of the future pons (Fig. 8, A and B). In this region the anlage of the mesencephalic nuclei are
born. Transverse sections through the midbrain on day 12.5 p.c. reveal
labeling in two areas ventral of the cerebral aqueduct and excluding
the floorplate (Fig. 8D). During further development, fkh-2 expression becomes restricted to a subpopulation of
cells in the area of the red nuclei, most clearly seen in transverse
sections of day 15.5 p.c. embryos (Fig. 8E). fkh-2 gene activity is maintained in the red nuclei until
birth (Fig. 8F).
Figure 6:
Expression of the fkh-2 gene in
day 7.5 p.c. mouse embryos. Whole mount in situ hybridization
of day 7.5 p.c. wild type (A and B) or HNF-3
Figure 7:
Expression of the fkh-2 gene in
mouse embryos from day 7.5 until 8.5 p.c. fkh-2 mRNA is
initially detected in the neuroectoderm on day 7.5 p.c. in a transverse
section (A). Subsequently expression becomes localized to the
diencephalon and regions of the midbrain (B, C, and E, day 8.5 p.c.). Labeling in the anterior tip of the foregut
of day 8.5 p.c. embryos is demonstrated under higher magnification in E. Staining of the notochord is evident in a transverse
section of day 8.5 p.c. embryo (D). Scale bars represent 100 µm in B and C and 50 µm in A, D, and E. Abbreviations: d, diencephalon; en, endoderm; Fg, foregut; mb, midbrain; n, node; nc, notochord; ne,
neuroectoderm.
Figure 8:
fkh-2 transcripts during brain
development from day 11.5 p.c. to postnatal day 1. Sagittal (A-C), coronal (D and F), and
horizontal (E) sections through mouse embryos from day 11.5 (A and B), 12.5 (C and D), 15.5 (E) p.c. and postnatal day 1 (F) hybridized with the fkh-2 probe. fkh-2 transcripts, indicated by arrows, are localized to the intermediate mantle and mantle
layers in the mesencephalon and metencephalon (A and B). On day 12.5 p.c., a sagittal section shows fkh-2
expression in the mesencephalon (C). Arrowheads in C indicate the plane of section for the coronal section shown
in D. Labeling is confined to two areas ventral to the
cerebral aqueduct and excluding the floorplate. Activation of the fkh-2 gene in the developing red nuclei is demonstrated in the
horizontal section of a day 15.5 p.c. embryo (E). Expression
in the red nuclei is maintained until after birth (F). Scale bars represent 400 µm in A, C, and E, 200 µm in B and F, and 100 µm in D. Abbreviations: Aq, aqueduct; Cb, future
cerebellum; d, diencephalon, im, intermediate mantle
layer; m, mantle layer; M, mesencephalon; MF, mesencephalic flexure; P, future pons; r, red nuclei; RP, Rathke's pouch; sv,
subventricular zone; v, ventricular zone; 4, fourth
ventricle.
Characterization of cDNA and genomic clones of the mouse fkh-2 gene have identified the gene as a winged helix protein
with unique structural domains. The fkh-2 gene is the first
rodent forkhead homolog described to date which consists of
only one exon and which contains both acidic and proline-rich domains
of potential transcriptional activation function. Acidic domains have
been shown to be potent transcriptional activators, for example in the
yeast transcription factor GCN4 (Hope et al., 1988), and it
seems possible that the acidic domain A of fkh-2 is such a
functional module. Domain B, located just COOH-terminal of the forkhead
domain, is rich in proline and alanine. For the transcription factor
CTF/NF1 (Mermod et al., 1989) a proline-rich domain has been
shown to function in transactivation of target genes. In this context
it is noteworthy that an amino-terminal proline-rich domain of the
winged helix protein MNF has been shown to transactivate in a
MNF/Gal4-fusion protein (Bassel-Duby et al., 1994). We
therefore suggest that one or both of these domains of the fkh-2 gene might play a role in transcriptional activation or
repression. The fkh-2 gene appears to be the ortholog of
the rat HFH-6 gene (Clevidence et al., 1993). This
conclusion is supported by the almost identical amino acid sequence of
the DNA binding domain and the recent finding that the HFH-6 gene in the mouse maps to chromosome 19 (Avraham et al.,
1995) close to the position identified for fkh-2. The fkh-2 gene is expressed in the developing notochord, foregut
and midbrain. fkh-2 is initially expressed in headfold stage
embryos in the notochord, in anterior portions of the definite endoderm
and in the ectoderm, anterior to the node but excluding the tip. In the
foregut fkh-2 transcripts are restricted to regions anterior
to the otic vesicle between day 8 and day 9 p.c. It is tempting to
speculate that fkh-2 is involved in establishing this
anterior-posterior specification of the foregut. In the
neuroepithelium fkh-2 is activated in headfold stage embryos
in a defined region anterior to the node but excluding the tip. This
region of the ectoderm is fated to become di- and mesencephalon (Tam,
1989). The continued expression of the fkh-2 gene in these
same regions suggests that this gene may be involved in their
development and determination. It is interesting to note that another
winged helix protein, BF-1, is localized to very specific regions of
the brain, i.e. the developing telencephalon, and is thought
to be required for the formation of the cerebral hemispheres (Tao and
Lai, 1992). The expression patterns of these winged helix genes may be
reflecting progressive differentiation of the neuroepithelium. Subsequently, fkh-2 transcripts are localized to the anlage
of the red nuclei. In the adult, the rubrospinal tract originates in
the magnocellular portion of the red nucleus in the midbrain and
terminates contralaterally in the spinal gray matter. This tract forms
the major lateral descending pathway from the brain stem. It leads from
the red nuclei through the medulla to the dorsal part of the lateral
column of the spinal cord. The lateral pathways function in controlling
the distal muscles used in a variety of fine movements. In humans,
lesion of the red nuclei in the tegmental or central midbrain syndrome
leads to hemichorea, a condition characterized by tremors and
involuntary movements of the contralateral limbs. It will be
interesting to investigate whether mutations of the fkh-2 gene
are detrimental to motor control. Deletion of fkh-2 function
through gene targeting is currently under way in our laboratory to
address this question. The close linkage of fkh-2 with mdf suggests that this mutation might be caused by a defect in fkh-2 function. mdf homozygous mice are first
distinguishable from their litter mates at 5-6 weeks of age.
These mice have a waddling gait and by 12 weeks can progress only by
pulling themselves with their forelimbs. The mass of the sartorius,
vastus lateralis, and rectus femoris is markedly reduced. It is
important to emphasize that these muscles are controlled by impulses
from the lateral pathway. In addition many homozygotes exhibit a
nervous tremor (Womack et al., 1980). Experiments to
investigate whether the mdf mutation is caused by an
alteration of the fkh-2 locus are currently under way.
The nucleotide
sequence(s) reported in this paper has been submitted to the
GenBank(TM)/EMBL Data Bank with accession number(s)
X86368[GenBank].
Volume 270,
Number 50,
Issue of December 15, 1995 pp. 30029-30035
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
IMPLICATIONS FOR NOTOCHORD, FOREGUT, AND MIDBRAIN REGIONALIZATION (*)
ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES
, are overlapping in early stages of gestation and although
the promoter of the fkh-2 gene contains a HNF-3 binding site,
we demonstrate that the activation of the fkh-2 gene is
independent of HNF-3.
(
)revealed that DNA recognition is mediated by a
variant of the helix-turn-helix motif which contains two loops or
``wings'' at the COOH-terminal side of the helix-turn-helix
(Clark et al., 1993). The winged helix proteins bind DNA as a
monomer and make base-specific contacts by the 
helix H3 and loop
W2 which bind in the major groove of the DNA. A 20-amino acid region
NH
-terminal to helix 3 also has been shown to be important
in the determination of binding site specificity (Overdier et
al., 1994). gene
product, for example, is normally found in the node, notochord,
endoderm, and central nervous system during early stages of mouse
development (Ang et al., 1993; Sasaki and Hogan, 1993;
Monaghan et al., 1993). Ectopic expression of HNF-3 in
the midbrain and hindbrain of transgenic mice leads to changes in the
expression of floorplate-specific genes and to abnormal neural
patterning (Sasaki and Hogan, 1994). Loss of function of the mouse HNF-3 gene through targeted mutagenesis results in severe
defects in midline development, specifically the absence of the
notochord and floorplate (Ang and Rossant, 1994; Weinstein et
al., 1994). The expression patterns of two other members of the
winged helix gene family, BF-1 and BF-2, define
adjacent domains in the developing forebrain and suggest a role for the
winged helix proteins in the establishment of positional identity along
the anterioposterioir axis of the neuroepithelium (Tao and Lai, 1992;
Hatini et al., 1994)., -, and - (Kaestner et al., 1994)
and fkh-1 to fkh-6 (Kaestner et al., 1993)),
which exhibit specific and diverse patterns of expression in adult
tissues. Here we report the detailed characterization of one of these
genes, fkh-2, whose expression pattern suggests that it plays
an important role in the regionalization of the foregut, notochord, and
midbrain of mouse embryos.
Library Construction and cDNA and Genomic
Cloning
An oligo(dT)-primed cDNA library containing 2 
10
primary recombinants was constructed in GT11 with
poly(A
) RNA from mouse day 8.5 p.c. (post-coitum)
embryos (strain NMRI) using the ``time saver'' cDNA synthesis
kit (Pharmacia). The library was screened with a probe derived from the fkh-2 genomic clones (Kaestner et al., 1993; probe C
in Fig. 1) using high stringency hybridization and washing
conditions (Church and Gilbert, 1984). Two hybridizing
phages
were purified and the cDNAs subcloned into Bluescript (Stratagene) and
sequenced (Sanger et al., 1977) on both strands.
phage clones from which it was derived.
The exon is shown as the large box, the translated region as a black box, and the forkhead DNA binding domain as a hatched box. Two of the fkh-2 cDNAs are indicated as thin lines. The boxes labeled A, B,
and C are probes referred to in the text. Abbreviations: E, EcoRI; S, SalI; N, NotI; P, PstI; Nc, NcoI; Sm, SmaI; X, XbaI; Xh, XhoI.
In Vitro Transcription and Translation
A
2.6-kilobase pair SalI/EcoRI subclone of G2
containing the entire coding region of the fkh-2 gene was
linearized with EcoRI and used as template to synthesize RNA
with the Megascript kit (Ambion) according to manufacturer's
instructions. Six µg of RNA were in vitro translated in
rabbit reticulocyte lysates (Promega) in the presence of
[
S]methionine (Amersham). The reaction products
were separated by SDS-polyacrylamide gel electrophoresis using
C-labeled proteins (Amersham) as size markers. Radioactive
bands were detected by fluorography after overnight exposure to Kodak
XAR film.RNA Isolation and RNase Protection Analysis
Total
RNA from a variety of mouse tissues or whole mouse embryos was isolated
by centrifugation through a CsCl cushion after homogenization in
guanidinium thiocyanate (Chirgwin et al., 1979). The quality
of the RNA preparations was controlled by ethidium bromide staining of
the 18 and 28 S rRNAs after electrophoretic separation of the RNA in
denaturing agarose gels. RNase protection analysis was performed as
described previously (Kaestner et al., 1989) using
[-P]UTP-labeled antisense RNA probes
derived from Bluescript (Stratagene) subclones containing various
fragments of the fkh-2 gene (probes A and B in Fig. 1).
A 150-base pair subclone of the mouse TBP (TATA-box-binding protein)
gene (Tamura et al., 1991) was used as an internal control, as
the mRNA of this gene is expressed in all tissues at roughly equal
levels, with the exception of ovary and testis. The antisense probes
were hybridized overnight against 40 µg (adult tissues) or 20
µg (embryonic samples) of total RNA at 54 °C in 80% formamide.
Excess probes were removed by digestion with RNases A and T1 and the
protected probe fragments analyzed on denaturing 6% polyacrylamide
gels.
In Situ Hybridization
Mouse embryos and fetuses
were obtained from matings between NMRI F1 mice. Homozygous HNF-3 mutant embryos were obtained from intercrossing HNF-3 ± animals (Ang and Rossant, 1994). By
convention the day of the vaginal plug was counted as day 0.5. Embryos
were fixed in 4% paraformaldehyde (pH 7.2) overnight, dehydrated
through an ethanol series, cleared in toluene, and embedded in
paraffin. Five-micron sections were cut for each stage. In situ prehybridizations and hybridizations were carried out as described
in Wilkinson(1992). Slides were dipped in Kodak NTB2 emulsion diluted
1:1 with water and exposed at 4 °C for 7-14 days and
developed using Kodak D19 developing solution and Kodafix at 15 °C
for 4 min. Sections were stained using eosin and hematoxylin and
visualized using a Zeiss Axiophot microscope. Whole mount in situ hybridizations using digoxygenin labeled antisense RNA probes were
performed as described previously (Conlon and Herrmann, 1993).
Hybridizations with sense probes were performed as controls and gave no
signal. At least three embryos were analyzed per stage shown.Chromosomal Localization
Mouse metaphase spreads
were prepared from the spleen of female Balb/c mice following cell
stimulation, mitotic arrest, hypotonic treatment, and methanol/acetic
acid fixation. phage DNA (
G2) was labeled by nick
translation using biotin-modified nucleotides and in situ hybridization was carried out as described elsewhere (Lichter et al., 1990). The hybridized probe was detected via
fluorescein isothiocyanate and chromosomes were banded by
4`,6-diamidino-2-phenylindole staining . For confirmation of the
chromosome identity, a cosmid recognizing a target sequence on
chromosome 19C-D kindly provided by Patricia Bray-Ward and David C.
Ward (Yale University) was labeled with digoxigenin, co-hybridized, and
detected via rhodamine (see Fig. 4). Digitized images were
acquired separately for each fluorochrome using a cooled CCD camera.
Overlaying of the images after careful alignment allowed to determine
the chromosomal localization of the probes.
with 35 cycles of 94 °C (30 s), 67 °C (60
s), and 72 °C (120 s). The polymerase chain reaction products were
digested with CfoI and analyzed on a 1.5% agarose gel after
staining of the DNA with ethidium bromide. The Mus musculus allele produces a band of 786 base pairs, while the Mus
spretus allele results in two bands of 466 and 320 base pairs.
Characterization of the fkh-2 Gene
The
developmental profile of the fkh-2 mRNA levels indicated
strong expression of the gene in early mid-gestation embryos (see Fig. 5). In order to obtain a cDNA for fkh-2 we
constructed a cDNA library from poly(A) RNA isolated
from day 8.5 p.c. mouse embryos and screened it using a fragment of the fkh-2 genomic clone (Kaestner et al., 1993; probe C
in Fig. 1) under high stringency conditions. Two
hybridization-positive cDNA clones were isolated, which cover most of
the mRNA encoded by the fkh-2 gene (Fig. 1). Sequencing
of the cDNAs and the corresponding fragments of the genomic fkh-2 clone
G2 revealed that the cloned portions of the
mRNA are encoded by a single exon. Due to the low abundance of the fkh-2 transcript (see below), a band corresponding to fkh-2 mRNA could not be visualized in Northern blots (data not
shown). Considering the position of the transcriptional start site
(nucleotide 586, Fig. 2) and the polyadenylation signal at
position 2930, a likely length of the mRNA is approximately 2.4
kilobase pair. A large open reading frame starting at position 1062 and
ending at position 2396 encodes a protein of 444 amino acids and a
calculated molecular mass of 48
10
(Fig. 2).
The size of the protein is in good agreement with that obtained from
translation of in vitro transcribed RNA corresponding to the fkh-2 gene (Fig. 3), which indicates that the entire
reading frame is translated. The winged helix domain (indicated in Fig. 2) is most closely related to that of the rat HFH-6 gene (Clevidence et al., 1993) and identifies the fkh-2 gene as a member of the class III of winged helix
domains in addition to the mouse gene MF2 (Sasaki and Hogan,
1993). Aside from the DNA binding domain, the protein contains two
potential transactivation domains (Fig. 2). Domain A, located in
the amino-terminal half of the protein, is highly acidic, containing 18
acidic residues over a stretch of 27 amino acids and domain B, located
just COOH-terminal of the forkhead domain, which is rich in proline and
alanine. It should also be noted that the fkh-2 protein
contains no homology to the transactivation domains characterized for HNF-3 (Pani et al., 1992) and other winged helix
proteins (reviewed in Lai et al.(1993)), indicating the
functional diversity of the winged helix gene family, in addition to
the different intron/exon organization.
S]methionine and the reaction products
separated by SDS-polyacrylamide gel electrophoresis. The auroradiograph
was exposed for 16 h.
G2 phage was used as a probe for fluorescence in situ hybridization to mouse metaphase chromosome spreads. Specific
probe signals were detected on mouse chromosome 19, as revealed by
4`,6-diamidino-2-phenylindole banding. In order to confirm the
chromosome assignment, a differently labeled probe targeting chromosome
19C-D was simultaneously hybridized and detected (see Fig. 4).
Of the 30 evaluated metaphase spreads, 57% showed signals on both
homologs and 27% on one homolog of chromosome 19 in region B. Since no
additional signal doublets were found on other chromosomal regions,
these experiments reveal localization of the fkh-2 gene within
19B, a region to which the mdf (muscle deficient)
locus is assigned (Lyon and Searle, 1989). mdf is defined by a
mutation which leads to a reduction in the mass of hindlimb muscles and
to nervous tremors (Womack et al., 1980; see
``Discussion''). In order to confirm this chromosomal
assignment and to better estimate the proximity of fkh-2 and mdf, we also performed linkage analysis using the DNA
collection of the European backcross (The European Backcross
Collaborative Group, 1994; see ``Materials and Methods'').
Analysis of DNAs from 1500 recombinants assigned fkh-2 to
chromosome 19 at position 17.5 ± 0.3 centimorgans (95%
confidence level), in close agreement to the data obtained from the in situ hybridization.
Expression Patterns of the fkh-2 Gene
In order to
gain insight into the potential function of the fkh-2 gene, we
analyzed its expression at the level of mRNA. To assess the transcript
distribution in adult mice, RNAs from 15 tissues were analyzed for fkh-2 expression by RNase protection. The probe chosen came
from a region outside the conserved winged helix domain to exclude the
possibility of cross-hybridization with the mRNAs of related genes
(probe B in Fig. 1). The fkh-2 mRNA is not detectable
in any of the adult tissues tested, which include brain, heart, kidney,
liver, lung, and intestine (data not shown). As several rodent members
of the winged helix gene family have been shown to be activated early
during embryogenesis (Tao and Lai, 1992; Kaestner et al.,
1993; Monaghan et al., 1993; Sasaki and Hogan, 1993; Ang et al., 1993; Hatini et al., 1994), we investigated
the transcript distribution in RNA samples from mid to late gestation
mouse embryos. fkh-2 mRNA is weakly expressed on day 8.5 p.c.
of gestation, declines on day 9.5 p.c. and is below the detection limit
thereafter (Fig. 5).
mutant (C) embryos with an antisense riboprobe to fkh-2. Lateral (A) and frontal (B) view of a
headfold stage embryo demonstrating fkh-2 expression in the
neuroectoderm of the headfold and in the notochord. Lateral view (C) of a HNF-3 homozygous mutant embryo shows fkh-2 expression in the anterior neurectoderm. Magnification
10. Abbreviations: n, node; nc, notochord; ne, neurectoderm, hf,
headfold.
Activation of the fkh-2 Gene Is Independent of
HNF-3
In order to gain preliminary information about the
regulatory mechanisms that govern the specific temporal and spatial
pattern of expression of the fkh-2 gene, we characterized its
promoter sequence. The transcription initiation site was mapped by
RNase protection (data not shown) using probe A denoted in Fig. 1and is indicated as the bold A at position 586 in Fig. 2. A potential binding site for the basal transcription
factor TBP is located 35 nucleotides 5` of the start site. The fkh-2 promoter also contains SP1 and C/EBP consensus binding
sites (Faisst and Meyer, 1992) located at positions 45 and 70,
respectively (Fig. 2). Of special interest is a consensus
binding site for HNF-3 proteins centered around position 210, which
matches 10 out of 12 nucleotides of the HNF-3 consensus (Overdier et al. 1994). This finding, together with the partially
overlapping expression patterns of HNF-3 (Ang et al.,
1993; Sasaki and Hogan, 1993; Monaghan et al., 1993) and fkh-2 in the developing neuroepithelium, notochord, and
foregut endoderm, suggest a potential interaction between these
transcription factors. With the availability of the HNF-3 mutant mice (Ang and Rossant, 1994), we were able to analyze the
potential hierarchy between HNF-3 and fkh-2
genetically. Homozygous HNF-3 mutant, as well as wild
type, embryos were analyzed for fkh-2 expression by whole
mount in situ hybridization. fkh-2 is similarly
expressed in the anterior neuroectoderm in HNF-3 mutant
embryos (Fig. 6C) and in the wild type controls (Fig. 6, A and B), indicating that HNF-3 is not required for fkh-2 expression in
this tissue. The possible interaction of the two factors in the
notochord cannot be assessed by this experiment as the notochord is
completely missing in the HNF-3 mutants (Ang and Rossant,
1994; Weinstein et al., 1994).
)
We thank Evelyn Grau and Dagmar Bock for expert
technical assistance, Werner Fleischer for oligonucleotide synthesis,
Antoaneta Mincheva for support in the identification of mouse
chromosomes, and the European Backcross Collaborative Group for the
help in the linkage analysis.
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
CiteULike 
Complore 
Connotea 
Del.icio.us 
Digg 
Reddit 
Technorati What's this?
This article has been cited by other articles:
|
|
 |
|
  N. Nishioka, S. Nagano, R. Nakayama, H. Kiyonari, T. Ijiri, K. Taniguchi, W. Shawlot, Y. Hayashizaki, H. Westphal, R. R. Behringer, et al. Ssdp1 regulates head morphogenesis of mouse embryos by activating the Lim1-Ldb1 complex Development, June 1, 2005; 132(11): 2535 - 2546. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 B. Illi, A. Scopece, S. Nanni, A. Farsetti, L. Morgante, P. Biglioli, M. C. Capogrossi, and C. Gaetano Epigenetic Histone Modification and Cardiovascular Lineage Programming in Mouse Embryonic Stem Cells Exposed to Laminar Shear Stress Circ. Res., March 18, 2005; 96(5): 501 - 508. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 Y. Fan, T. Newman, E. Linardopoulou, and B. J. Trask Gene Content and Function of the Ancestral Chromosome Fusion Site in Human Chromosome 2q13-2q14.1 and Paralogous Regions Genome Res., November 1, 2002; 12(11): 1663 - 1672. [Abstract] [Full Text] [PDF]
|
|
|
|
 |
|
 S. Sato, M. Nakamura, D. H. Cho, S. J. Tapscott, H. Ozaki, and K. Kawakami Identification of transcriptional targets for Six5: implication for the pathogenesis of myotonic dystrophy type 1 Hum. Mol. Genet., May 1, 2002; 11(9): 1045 - 1058. [Abstract] [Full Text] [PDF]
|
|
|
|
|
|
Y Suda, J Nakabayashi, I Matsuo, and S Aizawa Functional equivalency between Otx2 and Otx1 in development of the rostral head Development, January 2, 1999; 126(4): 743 - 757. [Abstract] [PDF]
|
|
|
|
|
|
M Rhinn, A Dierich, W Shawlot, R. Behringer, M Le Meur, and S. Ang Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrain and midbrain induction and specification Development, January 3, 1998; 125(5): 845 - 856. [Abstract] [PDF]
|
|
|
|
|
|
R Wehr, A Mansouri, T de Maeyer, and P Gruss Fkh5-deficient mice show dysgenesis in the caudal midbrain and hypothalamic mammillary body Development, January 11, 1997; 124(22): 4447 - 4456. [Abstract] [PDF]
|
|
|
|
|
|
S Filosa, J. Rivera-Perez, A. Gomez, A Gansmuller, H Sasaki, R. Behringer, and S. Ang Goosecoid and HNF-3beta genetically interact to regulate neural tube patterning during mouse embryogenesis Development, January 7, 1997; 124(14): 2843 - 2854. [Abstract] [PDF]
|
|
|
|
|
|
K. Kaestner, S. Bleckmann, A. Monaghan, J Schlondorff, A Mincheva, P Lichter, and G Schutz Clustered arrangement of winged helix genes fkh-6 and MFH-1: possible implications for mesoderm development Development, January 6, 1996; 122(6): 1751 - 1758. [Abstract] [PDF]
|
|
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |