Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaestner, K. H.
Right arrow Articles by Schütz, Gün.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaestner, K. H.
Right arrow Articles by Schütz, Gün.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 50, Issue of December 15, 1995 pp. 30029-30035
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The Mouse fkh-2 Gene
IMPLICATIONS FOR NOTOCHORD, FOREGUT, AND MIDBRAIN REGIONALIZATION (*)

(Received for publication, July 12, 1995; and in revised form, September 28, 1995)

Klaus H. Kaestner (1)(§) A. Paula Monaghan (1) Heidrun Kern (1) Siew-Lan Ang (3) Sandra Weitz (2) Peter Lichter (2) Günther Schütz (1)

From the  (1)Division Molecular Biology of the Cell I and (2)Division Organization of Complex Genomes, German Cancer Research Center, Im Neuenheimer Feld 280, D-69120 Heidelberg, Germany and the (3)Institut de Génétique et de Biologie Moléculaire et Cellulaire, CNRS-LGME, INSERM U184, 67404 Illkirch, France

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

The ``winged helix'' or ``forkhead'' transcription factors comprise a large gene family whose members are defined by a common 100-amino acid DNA binding domain. Here we describe the structure and expression of the mouse fkh-2 gene, which encodes a protein of 48 kDa with high similarity to other winged helix transcription factors within the DNA binding region, but unique potential transactivation domains. The gene is encoded by a single exon and is expressed in headfold stage embryos in the notochord, the anterior neuroectoderm, and a few cells of the definite endoderm. This expression becomes restricted to the anteriormost portions of the invaginating foregut and the developing midbrain. From day 11.5 of gestation onward, fkh-2 transcripts are restricted to the midbrain and become progressively localized to the red nuclei as the sole site of expression. The fkh-2 gene maps to chromosome 19B and is a candidate gene for the mouse mutation mdf (muscle-deficient) which is characterized by nervous tremors and degeneration of the hindlimb muscles. Although the expression patterns of the fkh-2 gene and another winged helix protein, HNF-3beta, are overlapping in early stages of gestation and although the promoter of the fkh-2 gene contains a HNF-3 binding site, we demonstrate that the activation of the fkh-2 gene is independent of HNF-3beta.


INTRODUCTION

The ``winged helix'' or ``forkhead'' transcription factors comprise a large and growing gene family whose members are defined by a common 100-amino acid DNA binding domain. The determination of the crystal structure of the DNA binding domain of HNF-3 (^1)revealed that DNA recognition is mediated by a variant of the helix-turn-helix motif which contains two loops or ``wings'' at the COOH-terminal side of the helix-turn-helix (Clark et al., 1993). The winged helix proteins bind DNA as a monomer and make base-specific contacts by the alpha helix H3 and loop W2 which bind in the major groove of the DNA. A 20-amino acid region NH(2)-terminal to helix 3 also has been shown to be important in the determination of binding site specificity (Overdier et al., 1994).

Since its discovery as a region of homology between the rat HNF-3 (Lai et al., 1991) and the Drosophila gene forkhead (Weigel and Jäckle, 1990), the forkhead motif has been found in more than 40 genes in species ranging from yeast to man (reviewed in Lai et al.(1993)). Analyses of expression patterns as well as gain or loss of function mutations of one of them have implicated these genes in pattern formation during embryogenesis. The HNF-3beta gene product, for example, is normally found in the node, notochord, endoderm, and central nervous system during early stages of mouse development (Ang et al., 1993; Sasaki and Hogan, 1993; Monaghan et al., 1993). Ectopic expression of HNF-3beta in the midbrain and hindbrain of transgenic mice leads to changes in the expression of floorplate-specific genes and to abnormal neural patterning (Sasaki and Hogan, 1994). Loss of function of the mouse HNF-3beta gene through targeted mutagenesis results in severe defects in midline development, specifically the absence of the notochord and floorplate (Ang and Rossant, 1994; Weinstein et al., 1994). The expression patterns of two other members of the winged helix gene family, BF-1 and BF-2, define adjacent domains in the developing forebrain and suggest a role for the winged helix proteins in the establishment of positional identity along the anterioposterioir axis of the neuroepithelium (Tao and Lai, 1992; Hatini et al., 1994).

We have previously isolated nine members of the winged helix family from mice (HNF-3alpha, -beta, and - (Kaestner et al., 1994) and fkh-1 to fkh-6 (Kaestner et al., 1993)), which exhibit specific and diverse patterns of expression in adult tissues. Here we report the detailed characterization of one of these genes, fkh-2, whose expression pattern suggests that it plays an important role in the regionalization of the foregut, notochord, and midbrain of mouse embryos.


MATERIALS AND METHODS

Library Construction and cDNA and Genomic Cloning

An oligo(dT)-primed cDNA library containing 2 times 10^6 primary recombinants was constructed in GT11 with poly(A) RNA from mouse day 8.5 p.c. (post-coitum) embryos (strain NMRI) using the ``time saver'' cDNA synthesis kit (Pharmacia). The library was screened with a probe derived from the fkh-2 genomic clones (Kaestner et al., 1993; probe C in Fig. 1) using high stringency hybridization and washing conditions (Church and Gilbert, 1984). Two hybridizing phages were purified and the cDNAs subcloned into Bluescript (Stratagene) and sequenced (Sanger et al., 1977) on both strands.


Figure 1: Physical map of the mouse fkh-2 gene. The restriction map of the gene is shown together with the extent of the phage clones from which it was derived. The exon is shown as the large box, the translated region as a black box, and the forkhead DNA binding domain as a hatched box. Two of the fkh-2 cDNAs are indicated as thin lines. The boxes labeled A, B, and C are probes referred to in the text. Abbreviations: E, EcoRI; S, SalI; N, NotI; P, PstI; Nc, NcoI; Sm, SmaI; X, XbaI; Xh, XhoI.



In Vitro Transcription and Translation

A 2.6-kilobase pair SalI/EcoRI subclone of G2 containing the entire coding region of the fkh-2 gene was linearized with EcoRI and used as template to synthesize RNA with the Megascript kit (Ambion) according to manufacturer's instructions. Six µg of RNA were in vitro translated in rabbit reticulocyte lysates (Promega) in the presence of [S]methionine (Amersham). The reaction products were separated by SDS-polyacrylamide gel electrophoresis using ^14C-labeled proteins (Amersham) as size markers. Radioactive bands were detected by fluorography after overnight exposure to Kodak XAR film.

RNA Isolation and RNase Protection Analysis

Total RNA from a variety of mouse tissues or whole mouse embryos was isolated by centrifugation through a CsCl cushion after homogenization in guanidinium thiocyanate (Chirgwin et al., 1979). The quality of the RNA preparations was controlled by ethidium bromide staining of the 18 and 28 S rRNAs after electrophoretic separation of the RNA in denaturing agarose gels. RNase protection analysis was performed as described previously (Kaestner et al., 1989) using [alpha-P]UTP-labeled antisense RNA probes derived from Bluescript (Stratagene) subclones containing various fragments of the fkh-2 gene (probes A and B in Fig. 1). A 150-base pair subclone of the mouse TBP (TATA-box-binding protein) gene (Tamura et al., 1991) was used as an internal control, as the mRNA of this gene is expressed in all tissues at roughly equal levels, with the exception of ovary and testis. The antisense probes were hybridized overnight against 40 µg (adult tissues) or 20 µg (embryonic samples) of total RNA at 54 °C in 80% formamide. Excess probes were removed by digestion with RNases A and T1 and the protected probe fragments analyzed on denaturing 6% polyacrylamide gels.

In Situ Hybridization

Mouse embryos and fetuses were obtained from matings between NMRI F1 mice. Homozygous HNF-3beta mutant embryos were obtained from intercrossing HNF-3beta ± animals (Ang and Rossant, 1994). By convention the day of the vaginal plug was counted as day 0.5. Embryos were fixed in 4% paraformaldehyde (pH 7.2) overnight, dehydrated through an ethanol series, cleared in toluene, and embedded in paraffin. Five-micron sections were cut for each stage. In situ prehybridizations and hybridizations were carried out as described in Wilkinson(1992). Slides were dipped in Kodak NTB2 emulsion diluted 1:1 with water and exposed at 4 °C for 7-14 days and developed using Kodak D19 developing solution and Kodafix at 15 °C for 4 min. Sections were stained using eosin and hematoxylin and visualized using a Zeiss Axiophot microscope. Whole mount in situ hybridizations using digoxygenin labeled antisense RNA probes were performed as described previously (Conlon and Herrmann, 1993). Hybridizations with sense probes were performed as controls and gave no signal. At least three embryos were analyzed per stage shown.

Chromosomal Localization

Mouse metaphase spreads were prepared from the spleen of female Balb/c mice following cell stimulation, mitotic arrest, hypotonic treatment, and methanol/acetic acid fixation. phage DNA ( G2) was labeled by nick translation using biotin-modified nucleotides and in situ hybridization was carried out as described elsewhere (Lichter et al., 1990). The hybridized probe was detected via fluorescein isothiocyanate and chromosomes were banded by 4`,6-diamidino-2-phenylindole staining . For confirmation of the chromosome identity, a cosmid recognizing a target sequence on chromosome 19C-D kindly provided by Patricia Bray-Ward and David C. Ward (Yale University) was labeled with digoxigenin, co-hybridized, and detected via rhodamine (see Fig. 4). Digitized images were acquired separately for each fluorochrome using a cooled CCD camera. Overlaying of the images after careful alignment allowed to determine the chromosomal localization of the probes.


Figure 4: Mapping of the fkh-2 gene to mouse chromosome 19B by fluorescence in situ hybridization. Detection of the hybridized probe via fluorescein isothiocyanate revealed highly specific signals as indicated by the arrows in the left panel showing a complete metaphase spread. A simultaneously hybridized probe specific for 19C-D (see ``Materials and Methods'') was detected via rhodamine (see arrowheads). Panels on the right side present additional chromosome 19 homologs from other metaphase spreads to illustrate the subchromosomal localization on chromosome 19B.



Linkage analysis was carried out using the DNA samples of the European Backcross (EUCIB) kindly provided by the European Backcross Collaborative Group (The European Backcross Collaborative Group, 1994). A 786-base pair fragment of the fkh-2 gene was amplified with primers A (CCATGGACCTCTGGACTATCTAGTTG) and B (CTTGGTCCCTCCTCTTCACACCC) in a polymerase chain reaction buffer containing 1.5 mM MgCl(2) with 35 cycles of 94 °C (30 s), 67 °C (60 s), and 72 °C (120 s). The polymerase chain reaction products were digested with CfoI and analyzed on a 1.5% agarose gel after staining of the DNA with ethidium bromide. The Mus musculus allele produces a band of 786 base pairs, while the Mus spretus allele results in two bands of 466 and 320 base pairs.


RESULTS

Characterization of the fkh-2 Gene

The developmental profile of the fkh-2 mRNA levels indicated strong expression of the gene in early mid-gestation embryos (see Fig. 5). In order to obtain a cDNA for fkh-2 we constructed a cDNA library from poly(A) RNA isolated from day 8.5 p.c. mouse embryos and screened it using a fragment of the fkh-2 genomic clone (Kaestner et al., 1993; probe C in Fig. 1) under high stringency conditions. Two hybridization-positive cDNA clones were isolated, which cover most of the mRNA encoded by the fkh-2 gene (Fig. 1). Sequencing of the cDNAs and the corresponding fragments of the genomic fkh-2 clone G2 revealed that the cloned portions of the mRNA are encoded by a single exon. Due to the low abundance of the fkh-2 transcript (see below), a band corresponding to fkh-2 mRNA could not be visualized in Northern blots (data not shown). Considering the position of the transcriptional start site (nucleotide 586, Fig. 2) and the polyadenylation signal at position 2930, a likely length of the mRNA is approximately 2.4 kilobase pair. A large open reading frame starting at position 1062 and ending at position 2396 encodes a protein of 444 amino acids and a calculated molecular mass of 48 times 10^3 (Fig. 2). The size of the protein is in good agreement with that obtained from translation of in vitro transcribed RNA corresponding to the fkh-2 gene (Fig. 3), which indicates that the entire reading frame is translated. The winged helix domain (indicated in Fig. 2) is most closely related to that of the rat HFH-6 gene (Clevidence et al., 1993) and identifies the fkh-2 gene as a member of the class III of winged helix domains in addition to the mouse gene MF2 (Sasaki and Hogan, 1993). Aside from the DNA binding domain, the protein contains two potential transactivation domains (Fig. 2). Domain A, located in the amino-terminal half of the protein, is highly acidic, containing 18 acidic residues over a stretch of 27 amino acids and domain B, located just COOH-terminal of the forkhead domain, which is rich in proline and alanine. It should also be noted that the fkh-2 protein contains no homology to the transactivation domains characterized for HNF-3beta (Pani et al., 1992) and other winged helix proteins (reviewed in Lai et al.(1993)), indicating the functional diversity of the winged helix gene family, in addition to the different intron/exon organization.


Figure 5: Expression of the fkh-2 mRNA during mouse embryogenesis. 20 µg of total RNA from the developmental stages indicated (10 µg for day 8.5) were analyzed by RNase protection as described under ``Materials and Methods.'' The antisense probes and protected fragments (arrows) are labeled. The band for TBP indicates that equal amounts of RNA were hybridized in all cases. The autoradiograph was exposed for 96 h.




Figure 2: Nucleotide and translated amino acid sequence of the mouse fkh-2 gene. Shown is the sequence of the proximal promoter with the potential binding sites of the transcription factors indicated, followed by that of the composite cDNA sequences and the corresponding amino acid sequence of the longest open reading frame. The composite cDNAs extend from position 604 to 2931. The start site of transcription is denoted by an arrow at position 586. The translation initiation codon at position 1062 matches 4 out of 7 bases of the Kozak consensus (Kozak, 1987). The potential polyadenylation signal centered around position 2930 is indicated in italics. The sequence of the 100-amino acid forkhead DNA binding domain as well as domains A and B are underlined.




Figure 3: In vitro translation of fkh-2 mRNA. In vitro synthesized mRNAs for the genes indicated were translated in vitro in the presence of [S]methionine and the reaction products separated by SDS-polyacrylamide gel electrophoresis. The auroradiograph was exposed for 16 h.



In order to determine the chromosomal localization of the fkh-2 gene, the entire G2 phage was used as a probe for fluorescence in situ hybridization to mouse metaphase chromosome spreads. Specific probe signals were detected on mouse chromosome 19, as revealed by 4`,6-diamidino-2-phenylindole banding. In order to confirm the chromosome assignment, a differently labeled probe targeting chromosome 19C-D was simultaneously hybridized and detected (see Fig. 4). Of the 30 evaluated metaphase spreads, 57% showed signals on both homologs and 27% on one homolog of chromosome 19 in region B. Since no additional signal doublets were found on other chromosomal regions, these experiments reveal localization of the fkh-2 gene within 19B, a region to which the mdf (muscle deficient) locus is assigned (Lyon and Searle, 1989). mdf is defined by a mutation which leads to a reduction in the mass of hindlimb muscles and to nervous tremors (Womack et al., 1980; see ``Discussion''). In order to confirm this chromosomal assignment and to better estimate the proximity of fkh-2 and mdf, we also performed linkage analysis using the DNA collection of the European backcross (The European Backcross Collaborative Group, 1994; see ``Materials and Methods''). Analysis of DNAs from 1500 recombinants assigned fkh-2 to chromosome 19 at position 17.5 ± 0.3 centimorgans (95% confidence level), in close agreement to the data obtained from the in situ hybridization.

Expression Patterns of the fkh-2 Gene

In order to gain insight into the potential function of the fkh-2 gene, we analyzed its expression at the level of mRNA. To assess the transcript distribution in adult mice, RNAs from 15 tissues were analyzed for fkh-2 expression by RNase protection. The probe chosen came from a region outside the conserved winged helix domain to exclude the possibility of cross-hybridization with the mRNAs of related genes (probe B in Fig. 1). The fkh-2 mRNA is not detectable in any of the adult tissues tested, which include brain, heart, kidney, liver, lung, and intestine (data not shown). As several rodent members of the winged helix gene family have been shown to be activated early during embryogenesis (Tao and Lai, 1992; Kaestner et al., 1993; Monaghan et al., 1993; Sasaki and Hogan, 1993; Ang et al., 1993; Hatini et al., 1994), we investigated the transcript distribution in RNA samples from mid to late gestation mouse embryos. fkh-2 mRNA is weakly expressed on day 8.5 p.c. of gestation, declines on day 9.5 p.c. and is below the detection limit thereafter (Fig. 5).

In order to precisely define the cellular localization of the fkh-2 mRNA in midgestation embryos, in situ hybridization studies were performed on embyos starting at day 6.5 p.c. of gestation. The fkh-2 gene is first expressed on day 7.5 p.c. in the ectoderm of the headfold (Fig. 6, A and B, and 7A) and is one of the earliest known markers of the prospective neuroectoderm. Transcripts are absent from the tip of the headfold but extend in the ectoderm approximately halfway to the node (Fig. 6, A and B). Expression is absent in the ectoderm adjacent to the primitive streak and in the extraembryonic tissues. fkh-2 transcripts are also detected in the notochord, weakly in the node and in endoderm cells anterior to the node (Fig. 6, A and B). These endoderm cells will subsequently invaginate to form the foregut. From day 8 to 8.5 p.c. (Fig. 7, B-E), fkh-2 expression becomes restricted in the neuroectoderm to the developing posterior diencephalon and to the midbrain region. Transcripts are also evident in the anterior tip of the foregut endoderm, extending from the oral plate to the otic vesicle, suggesting that the foregut is already regionalized at this stage. In addition transcripts are detected in the notochord anterior to the otic vesicle (data not shown). The expression outside the neurectoderm disappears between day 9 and 11.5 p.c. As the neural folds rise and fuse, fkh-2 mRNA becomes restricted to ventral regions of the neural tube excluding the prospective floorplate (Fig. 8D and data not shown). While the activation of the fkh-2 gene in the notochord and foregut is only transient, its expression in the neuroectoderm becomes progressively localized to the midbrain ( Fig. 7and Fig. 8). Between day 11 and 15 p.c. the neuroepithelium differentiates into four regions: the ventricular, subventricular, intermediate mantle, and mantle layers. On day 11.5 p.c. fkh-2 transcripts are localized to a subpopulation of intermediate mantle and mantle cells in the mesencephalon and metencephalon extending from the mesencephalic flexure to the region of the future pons (Fig. 8, A and B). In this region the anlage of the mesencephalic nuclei are born. Transverse sections through the midbrain on day 12.5 p.c. reveal labeling in two areas ventral of the cerebral aqueduct and excluding the floorplate (Fig. 8D). During further development, fkh-2 expression becomes restricted to a subpopulation of cells in the area of the red nuclei, most clearly seen in transverse sections of day 15.5 p.c. embryos (Fig. 8E). fkh-2 gene activity is maintained in the red nuclei until birth (Fig. 8F).


Figure 6: Expression of the fkh-2 gene in day 7.5 p.c. mouse embryos. Whole mount in situ hybridization of day 7.5 p.c. wild type (A and B) or HNF-3beta mutant (C) embryos with an antisense riboprobe to fkh-2. Lateral (A) and frontal (B) view of a headfold stage embryo demonstrating fkh-2 expression in the neuroectoderm of the headfold and in the notochord. Lateral view (C) of a HNF-3beta homozygous mutant embryo shows fkh-2 expression in the anterior neurectoderm. Magnification times 10. Abbreviations: n, node; nc, notochord; ne, neurectoderm, hf, headfold.




Figure 7: Expression of the fkh-2 gene in mouse embryos from day 7.5 until 8.5 p.c. fkh-2 mRNA is initially detected in the neuroectoderm on day 7.5 p.c. in a transverse section (A). Subsequently expression becomes localized to the diencephalon and regions of the midbrain (B, C, and E, day 8.5 p.c.). Labeling in the anterior tip of the foregut of day 8.5 p.c. embryos is demonstrated under higher magnification in E. Staining of the notochord is evident in a transverse section of day 8.5 p.c. embryo (D). Scale bars represent 100 µm in B and C and 50 µm in A, D, and E. Abbreviations: d, diencephalon; en, endoderm; Fg, foregut; mb, midbrain; n, node; nc, notochord; ne, neuroectoderm.




Figure 8: fkh-2 transcripts during brain development from day 11.5 p.c. to postnatal day 1. Sagittal (A-C), coronal (D and F), and horizontal (E) sections through mouse embryos from day 11.5 (A and B), 12.5 (C and D), 15.5 (E) p.c. and postnatal day 1 (F) hybridized with the fkh-2 probe. fkh-2 transcripts, indicated by arrows, are localized to the intermediate mantle and mantle layers in the mesencephalon and metencephalon (A and B). On day 12.5 p.c., a sagittal section shows fkh-2 expression in the mesencephalon (C). Arrowheads in C indicate the plane of section for the coronal section shown in D. Labeling is confined to two areas ventral to the cerebral aqueduct and excluding the floorplate. Activation of the fkh-2 gene in the developing red nuclei is demonstrated in the horizontal section of a day 15.5 p.c. embryo (E). Expression in the red nuclei is maintained until after birth (F). Scale bars represent 400 µm in A, C, and E, 200 µm in B and F, and 100 µm in D. Abbreviations: Aq, aqueduct; Cb, future cerebellum; d, diencephalon, im, intermediate mantle layer; m, mantle layer; M, mesencephalon; MF, mesencephalic flexure; P, future pons; r, red nuclei; RP, Rathke's pouch; sv, subventricular zone; v, ventricular zone; 4, fourth ventricle.



Activation of the fkh-2 Gene Is Independent of HNF-3beta

In order to gain preliminary information about the regulatory mechanisms that govern the specific temporal and spatial pattern of expression of the fkh-2 gene, we characterized its promoter sequence. The transcription initiation site was mapped by RNase protection (data not shown) using probe A denoted in Fig. 1and is indicated as the bold A at position 586 in Fig. 2. A potential binding site for the basal transcription factor TBP is located 35 nucleotides 5` of the start site. The fkh-2 promoter also contains SP1 and C/EBP consensus binding sites (Faisst and Meyer, 1992) located at positions 45 and 70, respectively (Fig. 2). Of special interest is a consensus binding site for HNF-3 proteins centered around position 210, which matches 10 out of 12 nucleotides of the HNF-3 consensus (Overdier et al. 1994). This finding, together with the partially overlapping expression patterns of HNF-3beta (Ang et al., 1993; Sasaki and Hogan, 1993; Monaghan et al., 1993) and fkh-2 in the developing neuroepithelium, notochord, and foregut endoderm, suggest a potential interaction between these transcription factors. With the availability of the HNF-3beta mutant mice (Ang and Rossant, 1994), we were able to analyze the potential hierarchy between HNF-3beta and fkh-2 genetically. Homozygous HNF-3beta mutant, as well as wild type, embryos were analyzed for fkh-2 expression by whole mount in situ hybridization. fkh-2 is similarly expressed in the anterior neuroectoderm in HNF-3beta mutant embryos (Fig. 6C) and in the wild type controls (Fig. 6, A and B), indicating that HNF-3beta is not required for fkh-2 expression in this tissue. The possible interaction of the two factors in the notochord cannot be assessed by this experiment as the notochord is completely missing in the HNF-3beta mutants (Ang and Rossant, 1994; Weinstein et al., 1994).


DISCUSSION

Characterization of cDNA and genomic clones of the mouse fkh-2 gene have identified the gene as a winged helix protein with unique structural domains. The fkh-2 gene is the first rodent forkhead homolog described to date which consists of only one exon and which contains both acidic and proline-rich domains of potential transcriptional activation function. Acidic domains have been shown to be potent transcriptional activators, for example in the yeast transcription factor GCN4 (Hope et al., 1988), and it seems possible that the acidic domain A of fkh-2 is such a functional module. Domain B, located just COOH-terminal of the forkhead domain, is rich in proline and alanine. For the transcription factor CTF/NF1 (Mermod et al., 1989) a proline-rich domain has been shown to function in transactivation of target genes. In this context it is noteworthy that an amino-terminal proline-rich domain of the winged helix protein MNF has been shown to transactivate in a MNF/Gal4-fusion protein (Bassel-Duby et al., 1994). We therefore suggest that one or both of these domains of the fkh-2 gene might play a role in transcriptional activation or repression.

The fkh-2 gene appears to be the ortholog of the rat HFH-6 gene (Clevidence et al., 1993). This conclusion is supported by the almost identical amino acid sequence of the DNA binding domain and the recent finding that the HFH-6 gene in the mouse maps to chromosome 19 (Avraham et al., 1995) close to the position identified for fkh-2.

The fkh-2 gene is expressed in the developing notochord, foregut and midbrain. fkh-2 is initially expressed in headfold stage embryos in the notochord, in anterior portions of the definite endoderm and in the ectoderm, anterior to the node but excluding the tip. In the foregut fkh-2 transcripts are restricted to regions anterior to the otic vesicle between day 8 and day 9 p.c. It is tempting to speculate that fkh-2 is involved in establishing this anterior-posterior specification of the foregut.

In the neuroepithelium fkh-2 is activated in headfold stage embryos in a defined region anterior to the node but excluding the tip. This region of the ectoderm is fated to become di- and mesencephalon (Tam, 1989). The continued expression of the fkh-2 gene in these same regions suggests that this gene may be involved in their development and determination. It is interesting to note that another winged helix protein, BF-1, is localized to very specific regions of the brain, i.e. the developing telencephalon, and is thought to be required for the formation of the cerebral hemispheres (Tao and Lai, 1992). The expression patterns of these winged helix genes may be reflecting progressive differentiation of the neuroepithelium.

Subsequently, fkh-2 transcripts are localized to the anlage of the red nuclei. In the adult, the rubrospinal tract originates in the magnocellular portion of the red nucleus in the midbrain and terminates contralaterally in the spinal gray matter. This tract forms the major lateral descending pathway from the brain stem. It leads from the red nuclei through the medulla to the dorsal part of the lateral column of the spinal cord. The lateral pathways function in controlling the distal muscles used in a variety of fine movements. In humans, lesion of the red nuclei in the tegmental or central midbrain syndrome leads to hemichorea, a condition characterized by tremors and involuntary movements of the contralateral limbs. It will be interesting to investigate whether mutations of the fkh-2 gene are detrimental to motor control. Deletion of fkh-2 function through gene targeting is currently under way in our laboratory to address this question.

The close linkage of fkh-2 with mdf suggests that this mutation might be caused by a defect in fkh-2 function. mdf homozygous mice are first distinguishable from their litter mates at 5-6 weeks of age. These mice have a waddling gait and by 12 weeks can progress only by pulling themselves with their forelimbs. The mass of the sartorius, vastus lateralis, and rectus femoris is markedly reduced. It is important to emphasize that these muscles are controlled by impulses from the lateral pathway. In addition many homozygotes exhibit a nervous tremor (Womack et al., 1980). Experiments to investigate whether the mdf mutation is caused by an alteration of the fkh-2 locus are currently under way.


FOOTNOTES

*
This work was supported by the Deutsche Forschungsgemeinschaft through SFB 229, the Fonds der Chemischen Industrie, and by European Community Grant number BI02-CT93-0319. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in this paper has been submitted to the GenBank(TM)/EMBL Data Bank with accession number(s) X86368[GenBank].

§
To whom correspondence should be addressed. Tel.: 49-6221-423411; Fax: 49-6221-423470.

(^1)
The abbreviations used are: HNF, hepatocyte nuclear factor 3; p.c., post-coitum.


ACKNOWLEDGEMENTS

We thank Evelyn Grau and Dagmar Bock for expert technical assistance, Werner Fleischer for oligonucleotide synthesis, Antoaneta Mincheva for support in the identification of mouse chromosomes, and the European Backcross Collaborative Group for the help in the linkage analysis.


REFERENCES

  1. Ang, S.-L., and Rossant, J. (1994) Cell 78, 561-574 [CrossRef][Medline] [Order article via Infotrieve]
  2. Ang, S.-L., Wierda, A., Wong, D., Stevens, K. A., Cascio, S., Rossant, J., and Zaret, K. S. (1993) Development (Camb.) 119, 1301-1315 [Abstract]
  3. Avraham, K. B., Fletcher, C., Overdier, D. G., Clevidence, D. E., Lai, E., Costa, R. H., Jenkins, N. A., and Copeland, N. G. (1995) Genomics 25, 388-393 [CrossRef][Medline] [Order article via Infotrieve]
  4. Bassel-Duby, R., Hernandez, M. D., Yang, Q., Rochelle, J. M., Seldin, M. F., and Williams, R. S. (1994) Mol. Cell. Biol. 14, 4596-4605 [Abstract/Free Full Text]
  5. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18, 5294-5299 [CrossRef][Medline] [Order article via Infotrieve]
  6. Church, G. M., and Gilbert, W. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 1991-1995 [Abstract/Free Full Text]
  7. Clark, K. L., Halay, E. D., Lai, E., and Burley, S. K. (1993) Nature 364, 412-420 [CrossRef][Medline] [Order article via Infotrieve]
  8. Clevidence, D. E., Overdier, D. G., Tao, W., Qian, X., Pani, L., Lai, E., and Costa, R. H. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 3948-3952 [Abstract/Free Full Text]
  9. Conlon, R. A., and Herrmann, B. G. (1993) Methods Enzymol. 225, 373-383 [Medline] [Order article via Infotrieve]
  10. Faisst, S., and Meyer, S. (1992) Nucleic Acids Res. 20, 3-26 [Free Full Text]
  11. Hatini, V., Tao, W., and Lai, E. (1994) J. Neurobiol. 25, 1293-1309 [CrossRef][Medline] [Order article via Infotrieve]
  12. Hope, I. A., Mahadevan, S., and Struhl, K. (1988) Nature 333, 635-640 [CrossRef][Medline] [Order article via Infotrieve]
  13. Kaestner, K. H., Ntambi, J. M., Kelly, T. J., and Lane, M. D. (1989) J. Biol. Chem. 264, 14755-14761 [Abstract/Free Full Text]
  14. Kaestner, K. H., Lee, K.-H., Schlöndorff, J., Hiemisch, H., Monaghan, A. P., and Schütz, G. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 7628-7631 [Abstract/Free Full Text]
  15. Kaestner, K. H., Hiemisch, H., Luckow, B., and Schütz, G. (1994) Genomics 20, 377-385 [CrossRef][Medline] [Order article via Infotrieve]
  16. Kozak, M. (1987) Nucleic Acids Res. 15, 8125-8148 [Abstract/Free Full Text]
  17. Lai, E., Prezioso, V. R., Tao, W., Chen, W. S., and Darnell, J. E., Jr. (1991) Genes & Dev. 5, 416-427
  18. Lai, E., Clark, K. L., Burley, S. K., and Darnell, J. E. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 10421-10423 [Abstract/Free Full Text]
  19. Lichter, P., Chang Tang, C.-J., Call, K., Hermanson, G., Evans, G. A., Housman, D., and Ward, D. C. (1990) Science 247, 64-69 [Abstract/Free Full Text]
  20. Lyon, M. F., and Searle, A. G. (1989) Genetic Variants and Strains of the Laboratory Mouse, 2nd Ed., Oxford University Press, Oxford
  21. Mermod, N., O`Neill, E. A., Kelly, T., and Tijan, R. (1989) Cell 58, 741-753 [CrossRef][Medline] [Order article via Infotrieve]
  22. Monaghan, A. P., Kaestner, K. H., Grau, E., and Schütz, G. (1993) Development (Camb.) 119, 567-578 [Abstract]
  23. Overdier, D. G., Porcella, A., and Costa, R. H. (1994) Mol. Cell. Biol. 14, 2755-2766 [Abstract/Free Full Text]
  24. Pani, L., Overdier, D. G., Porcella, A., Qian, X., Lai, E., and Costa, R. H. (1992) Mol. Cell. Biol. 12, 3723-3732 [Abstract/Free Full Text]
  25. Sasaki, H., and Hogan, B. L. M. (1993) Development (Camb.) 118, 47-59 [Abstract]
  26. Sasaki, H., and Hogan, B. L. M. (1994) Cell 76, 103-115 [CrossRef][Medline] [Order article via Infotrieve]
  27. Sanger, F., Nicklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci. U. S. A. 74, 5463-5467 [Abstract/Free Full Text]
  28. Tam, P. P. L. (1989) Development (Camb.) 107, 55-67 [Abstract]
  29. Tamura, T., Sumita, K., Fujino, J., Aojama, A., Horiskoshi, M., Hoffmann, A., and Roeder, R. G. (1991) Nucleic Acids Res. 19, 3861-3865 [Abstract/Free Full Text]
  30. Tao, W., and Lai, E. (1992) Neuron 8, 957-966 [CrossRef][Medline] [Order article via Infotrieve]
  31. The European Backcross Collaborative Group (1994) Hum. Mol. Genet. 3, 621-627 [Abstract/Free Full Text]
  32. Weigel, D., and Jäckle, H. (1990) Cell 63, 455-456 [CrossRef][Medline] [Order article via Infotrieve]
  33. Weinstein, D. C., Ruiz i Altaba, A., Chen, W. C., Hoodless, P., Prezioso, V. R., Jessell, T. M., and Darnell, J. E. (1994) Cell 78, 575-588 [CrossRef][Medline] [Order article via Infotrieve]
  34. Wilkinson, D. G. (1992) In Situ Hybridization: A Practical Approach , Oxford University Press, Oxford
  35. Womack, J. E., MacPike, A., and Meier, H. (1980) J. Heredity 71, 68-72 [Free Full Text]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
DevelopmentHome page
N. Nishioka, S. Nagano, R. Nakayama, H. Kiyonari, T. Ijiri, K. Taniguchi, W. Shawlot, Y. Hayashizaki, H. Westphal, R. R. Behringer, et al.
Ssdp1 regulates head morphogenesis of mouse embryos by activating the Lim1-Ldb1 complex
Development, June 1, 2005; 132(11): 2535 - 2546.
[Abstract] [Full Text] [PDF]


Home page
Circ. Res.Home page
B. Illi, A. Scopece, S. Nanni, A. Farsetti, L. Morgante, P. Biglioli, M. C. Capogrossi, and C. Gaetano
Epigenetic Histone Modification and Cardiovascular Lineage Programming in Mouse Embryonic Stem Cells Exposed to Laminar Shear Stress
Circ. Res., March 18, 2005; 96(5): 501 - 508.
[Abstract] [Full Text] [PDF]


Home page
Genome ResHome page
Y. Fan, T. Newman, E. Linardopoulou, and B. J. Trask
Gene Content and Function of the Ancestral Chromosome Fusion Site in Human Chromosome 2q13-2q14.1 and Paralogous Regions
Genome Res., November 1, 2002; 12(11): 1663 - 1672.
[Abstract] [Full Text] [PDF]


Home page
Hum Mol GenetHome page
S. Sato, M. Nakamura, D. H. Cho, S. J. Tapscott, H. Ozaki, and K. Kawakami
Identification of transcriptional targets for Six5: implication for the pathogenesis of myotonic dystrophy type 1
Hum. Mol. Genet., May 1, 2002; 11(9): 1045 - 1058.
[Abstract] [Full Text] [PDF]


Home page
DevelopmentHome page
Y Suda, J Nakabayashi, I Matsuo, and S Aizawa
Functional equivalency between Otx2 and Otx1 in development of the rostral head
Development, January 2, 1999; 126(4): 743 - 757.
[Abstract] [PDF]


Home page
DevelopmentHome page
M Rhinn, A Dierich, W Shawlot, R. Behringer, M Le Meur, and S. Ang
Sequential roles for Otx2 in visceral endoderm and neuroectoderm for forebrain and midbrain induction and specification
Development, January 3, 1998; 125(5): 845 - 856.
[Abstract] [PDF]


Home page
DevelopmentHome page
R Wehr, A Mansouri, T de Maeyer, and P Gruss
Fkh5-deficient mice show dysgenesis in the caudal midbrain and hypothalamic mammillary body
Development, January 11, 1997; 124(22): 4447 - 4456.
[Abstract] [PDF]


Home page
DevelopmentHome page
S Filosa, J. Rivera-Perez, A. Gomez, A Gansmuller, H Sasaki, R. Behringer, and S. Ang
Goosecoid and HNF-3beta genetically interact to regulate neural tube patterning during mouse embryogenesis
Development, January 7, 1997; 124(14): 2843 - 2854.
[Abstract] [PDF]


Home page
DevelopmentHome page
K. Kaestner, S. Bleckmann, A. Monaghan, J Schlondorff, A Mincheva, P Lichter, and G Schutz
Clustered arrangement of winged helix genes fkh-6 and MFH-1: possible implications for mesoderm development
Development, January 6, 1996; 122(6): 1751 - 1758.
[Abstract] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Kaestner, K. H.
Right arrow Articles by Schütz, Gün.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Kaestner, K. H.
Right arrow Articles by Schütz, Gün.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement