Advertisement
JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
QUICK SEARCH:   [advanced]


     

This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akama, H.
Right arrow Articles by Colten, H. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akama, H.
Right arrow Articles by Colten, H. R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 6, Issue of February 10, 1995 pp. 2674-2678
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Human Complement Protein C2
ALTERNATIVE SPLICING GENERATES TEMPLATES FOR SECRETED AND INTRACELLULAR C2 PROTEINS (*)

(Received for publication, August 29, 1994; and in revised form, November 14, 1994)

Hideto Akama,  Charles A. C. Johnson,  Harvey R. Colten (§)

From the Edward Mallinckrodt Department of Pediatrics, Washington University School of Medicine, St. Louis, Missouri 63110

ABSTRACT
INTRODUCTION
EXPERIMENTAL PROCEDURES
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Alternative splicing of the primary transcript for human complement protein C2 generates templates for translation of a secreted (C2 long) protein and an intracellular (C2 short) form in liver, bronchoalveolar macrophages, and fibroblasts. The approximate ratio of C2 long to C2 short mRNA is 2:1. The C2 short mRNA does not contain the 396-base pair encompassed by exons 2 and 3 of the full-length C2 long and thus lacks codons for the 5 carboxyl-terminal residues of the signal peptide. Synthesis of C2 in cells transfected with full-length RNA corresponding to each of the transcripts show that C2 long is secreted within a half-time of approximately 1 h and that C2 short is not secreted. Cell-free biosynthesis in the presence of microsomes demonstrate that this intracellular C2 protein (70 kDa) is apparently capable of traversing the membrane of the endoplasmic reticulum. Though the function of the intracellular C2 protein is unknown, it is abundant in all cell types that express the C2 gene.

INTRODUCTION

The second component of human complement (C2) is a single chain glycoprotein (molecular mass, 100 kDa) (1, 2) that carries the serine protease domain of a bimolecular complex enzyme comprised of cleavage products of C2 (C2a) and the fourth (C4) complement protein (C4b). This enzyme is responsible for cleavage of complement protein C3 to its biologically active fragments. C2 is encoded by a single gene that is on human chromosome 6p within the class III region of the major histocompatibility complex(3) . The C2 protein is synthesized in liver hepatocytes (4, 5) and in several other cell types in extrahepatic tissues(6, 7, 8, 9, 10) .

Many years ago, three forms of C2 (84, 79, and 70 kDa) were detected in cell lysates of a metabolically labeled well differentiated human hepatoma cell line (HepG2)(5) . Initial data indicated that each was derived from a separate primary translation product, that each is glycosylated, but that only the 84-kDa C2 polypeptide is secreted (half-time 1 h). The other two C2 polypeptides remained cell-associated throughout the observation period (>6 h). Subsequently, these observations were replicated in studies of every cell type that expresses C2 protein(11, 12) , but the origin of the isoforms and the cellular compartment(s) in which the 79- and 70-kDa C2 proteins reside were unknown. Recently, in a study of C2 deficiency type I, we noted that a reverse transcriptase polymerase chain reaction (PCR) (^1)that should have generated a 786-bp fragment from the 5` end of both normal and C2-deficient mRNA instead generated two major bands, one of the predicted size and another that was about 400 bp (see Fig. 1in (13) ). The reproducibility and abundance of this 400-bp PCR product suggested the possibility that a C2 mRNA not previously recognized was the template for one of the cell-associated C2 proteins. In 1994, Cheng and Volanakis also found multiple C2 transcripts by PCR amplification of mRNA from HepG2, normal liver, and two other cell lines(14) . They speculated that one or several of these transcripts, if translated, would give rise to variant C2 proteins; among them the previously recognized cell-associated C2 isoforms. The current study was undertaken to test that hypothesis.

Figure 1: C2 gene structure and alternatively spliced mRNA isoforms. 18 exons and introns of human C2 are drawn approximately to scale. Exons 1-10 are shown with the number of nucleotides indicated within each exon. The two BamHI (B) and HindIII (H) sites were engineered in the oligonucleotides a, d, and b, respectively. The C2 long 748-bp and C2 short 352-bp fragments were sequenced. oligonucleotides (c) used to prime reverse transcriptase; (a + b) used to generate the cDNA fragment for analysis; (d + b) used to generate the 5` end of full-length C2 long and short. 3` end of exon 1 that encodes the signal peptide (not drawn to scale). GLADS, portion of signal peptide encoded within exon 2.


EXPERIMENTAL PROCEDURES

RNA Isolation

RNA was isolated from fibroblast cell lines obtained from C2-deficient and normal volunteers, from a human hepatoma cell line (HepG2), a normal liver sample obtained at a ``reducing'' transplant procedure, and from cells obtained at broncho-alveolar lavage. Twice selected poly(A) mRNA was prepared from these cell types by the guanidinium isothiocyanate method (15) and oligo(dT) column fractionation(16) .

Amplification of cDNA

Two micrograms of poly(A) mRNA were incubated with 10 units of reverse transcriptase at 42 °C for 1 h using the buffers and dNTPs provided in a cDNA synthesis kit (Invitrogen, San Diego, CA). An oligonucleotide (Fig. 1) (c = CTGTGAGCTTGGAGACATCCAGCATATGTT) made to an antisense sequence within exon 10 and 11 of the normal C2 was used to prime the reverse transcription reaction. The cDNA produced was subsequently amplified by PCR. The oligonucleotide primers for this amplification were constructed to produce a 786-bp fragment whose 5` end lay upstream of the sequence that encodes the peptide leader and whose 3` end is within exon 4. Both primers contained artificially engineered restriction sites (Fig. 1) (a = GGGAGATCTAT((G for T)/GA(T for C)CC)TATAGATATATTA (first BamHI site), b = ATTCGAGGAGCAGCGATAGCG((A for G)A(G for C)CT/T)GTC (HindIII)). The mixture containing the cDNA and 1 µg of each oligonucleotide in a 100-µl solution containing 10 mM Tris, pH 8.3, 50 mM KCl, 1.5 mM MgCl(2), 0.1% gelatin, 200 µM dNTPs, and 2.5 units of Taq polymerase (Dr. Wayne Barnes, Washington University), was heated to 94 °C for 3 min. Following the initial denaturation, the cDNA was amplified by melting at 94 °C for 2 min, annealing at 60 °C for 2 min and polymerization at 72 °C for 2 min. Thirty-five cycles of amplification were performed. The amplified cDNA was digested with BamHI and HindIII and purified by trough elution and phenol extraction. The isolated products were subcloned into pBluescript II (Stratagene, La Jolla, CA) for sequencing. All cloning procedures used restriction enzymes and modifying enzymes purchased from Promega (Madison, WI). Competent Sure cells (Stratagene) were transformed, and plasmid DNA was isolated from the recombinants using the alkaline lysis procedure(17) .

DNA Sequence Analysis

All DNA sequencing was performed using double-stranded templates. Two micrograms of template were denatured in 0.2 M NaOH, 0.2 mM EDTA, neutralized, annealed with either SK or KS primers, and sequenced employing the dideoxy chain termination method and the modified bacteriophage T7 DNA polymerase(18) . All sequencing was performed at least once on both strands of each insert.

RNase Protection

RNA samples were subjected to RNase protection analysis using a standard method(19) . Transfer RNA served as a negative control. Human liver and HepG2 RNA were the test samples. Hybridization was performed with a [P]CTP-labeled antisense riboprobe spanning 199 bp of C2 sequence, which overlapped in part exons 4 and 3. The riboprobe was generated by in vitro transcription of the 799-bp C2 subclone that was digested with AvaII. Transcription was initiated at a T7 promoter site within the vector (Fig. 3B). Following hybridization overnight at 42 °C with the antisense RNA probe, the samples were digested with RNase (Boehringer Mannheim) at 30 °C for 1 h, loaded onto an 8% polyacrylamide sequencing gel, and electrophoresed in parallel with a known sequence that served as a marker.


Figure 3: A, Nuclease protection of C2 mRNA in normal human liver (lane4) and HepG2 (lane5). Lanes1 and 2, undigested probe; lane3 tRNA. B, antisense riboprobe used for nuclease protection.


Full-length C2 cDNA Constructs

Two clones containing the entire coding region were constructed by amplification of two separate 5` regions that differed only by the presence or absence of exons 2 and 3 (C2 long and C2 short). These clones extended from an engineered BamHI site (Fig. 1) (d = AGGGA(G/GA(T for C) (C for A)C)CATGGGCCCACTGATGGT) 6 bp upsteam of the translation initiation codon to a naturally occurring PstI site in exon 10. The clones were 1,389 and 993 bp, respectively. Subcloning into pBluescript was achieved by digestion with BamHI and PstI. Subsequently the 3` fragment obtained by PstI digestion of the clone C2A-long (20) was ligated to the 5` constructs.

Expression of Human C2 Clones in Mouse L-Cells

The two pBluescript C2 clones (C2 short and C2 long) were digested with BamHI and HindIII restriction enzymes. The fragments were isolated and ligated to the expression vector pRep10 (Invitrogen). After transformation and plasmid isolation, the two clones were sequenced to assure their fidelity and orientation.

Mouse fibroblast L-cells were grown to 70% confluence in 24-well plates containing 350 µl of Dulbecco's modified Eagle's medium and 10% bovine calf serum. Transfection of the L-cells was accomplished with 4 µg of DNA/well using the calcium phosphate precipitation method exactly as described(21) . Thirty-six hours following transfection, the cells were pulse-labeled for 30 min with 250 µCi/ml of [S]methionine (specific activity, 1,000 Ci/mmol from ICN Biomedicals, Irvine, CA) in Dulbecco's modified Eagle's medium lacking methionine in the presence of 10% (v/v) dialyzed fetal calf serum and then chased for 30 min, 1, 2, 4, and up to 24 h. At each time point, the medium was collected, and the cells were lysed as described(5) . Aliquots were assayed for total protein synthesis by trichloroacetic acid precipitation, and the balance was used to precipitate human C2 with sheep antiserum (Miles Scientific, Naperville, IL) exactly as described(22) . Immune complexes were collected with excess protein A, washed, released by boiling in sample buffer, and applied to 8% SDS-polyacrylamide gel electrophoresis under reducing conditions(23) . After electrophoresis, gels were stained in Coomassie Brilliant Blue, destained, and dried for fluorography.

Indirect Immunofluorescence

Transfectants grown on coverslips were rinsed in phosphate-buffered saline with 1% Triton X-100 (washing buffer) and fixed in 4% paraformaldehyde in 0.1 M phosphate buffer (pH 7.4) for 1 h at room temperature. After fixation, cells were permeabilized by treatment with 100% methanol at room temperature for 3 min. The cells were incubated with the sheep anti-human C2 antisera (1:640 dilution) or mouse monoclonals (ascitic fluids, 1:100 dilution, kindly provided by J. Volanakis, Birmingham, AL) in phosphate-buffered saline with 3% bovine serum albumin for 1 h at room temperature. Normal sheep serum (Sigma) or mouse (NS-1MAb) ascites fluid (ICN) served as control. The coverslips were washed thrice with washing buffer and incubated with fluorescein isothiocyanate-conjugated mouse anti-sheep IgG or fluorescein isothiocyanate-conjugated goat anti-mouse IgG (Pierce; diluted 1:50 each in phosphate-buffered saline containing 3% bovine serum albumin) for 1 h. The coverslips were washed and mounted. n-Propyl gallate was included as an anti-fade reagent in the mounting media (24) . Specimens were photographed (4 s exposure time).

Synthesis of mRNA in Vitro

The C2-short and C2-long cDNAs in pBluescript SK (Stratagene, La Jolla, CA) were transcribed by T3 RNA polymerase. Synthesis of mRNA in vitro was carried out on 2 µg of linearized DNA, which was cut by HindIII for 1 h at 37 °C in the presence of 40 mM Tris/HCl, pH 7.5, 6 mM MgCl(2), 2 mM spermidine, 10 mM NaCl, 0.5 mM each rATP, rCTP, rGTP, and rUTP, and 40 units of T3 RNA polymerase. The size of the mRNA products was confirmed by electrophoresis on a 1.0% denatured gel containing formaldehyde.

Cell-free Translation and Co-translational Processing in the Presence of Dog Pancreas Microsomal Membranes

The mRNAs coding for the entire C2 short and C2 long were translated in a cell-free rabbit reticulocyte lysate system supplemented with 1 mCi/ml [S]methionine according to the manufacturer's (Promega) procedure. In brief, 1 µl of the microsomes (Boehringer Mannheim) was added to the translation reaction mixture just before the addition of mRNA, and then it (total 35 µl) was incubated for 1 h at 30 °C. After the incubation period, aliquots were incubated with trypsin and chymotrypsin (at a final concentration of 50 µg/ml each) for 90 min at 4 °C in the presence or absence of 1% (w/v) Triton X-100, and the reaction was stopped by the addition of trypsin-chymotrypsin inhibitor (30 µg/ml of Bowman-Birk inhibitor from Sigma). As a control, the translation mixture with microsomes was incubated at 4 °C in the absence of proteolytic enzymes. Additional controls consisted of the translation mixture with no mRNA. Translation products (15 µl) were analyzed directly or after immunoprecipitation as described above on SDS-polyacrylamide gel electrophoresis in the presence of 2-mercaptoethanol followed by autoradiography.

RESULTS

Amplification of cDNA

cDNA samples were generated by reverse transcription of RNA from liver HepG2, normal fibroblasts, C2-deficient (type I and type II) fibroblasts, and bronchial lavage wash cells. Each was then amplified using primers a and b (see Fig. 1) across a 786-bp region at the 5` end of C2, which resulted in two products; one of the expected size and another of 390 bp (Fig. 2). These two products were consistently obtained in multiple experiments. Both PCR products were present in all samples from several different individuals and from all the tissues and cells that were sampled.

Figure 2: PCR fragments of 786 (C2 long) and 390 bp (C2 short) generated from mRNA in normal human liver, HepG2, fibroblasts from normal, C2 deficient type I, C2 deficient type II and bronchoalveolar lavage cells. tRNA served as negative control.


Digestion of the 786- and 390-bp fragments with BamHI and HindIII (sites engineered by primers a and b) generated 748- and 352-bp fragments, respectively, which were subcloned separately and sequenced. The results represented in Fig. 1show that the 352-bp fragment completely lacked the sequence corresponding to exons 2 and 3. This predicted a translation product that would lack the carboxyl-terminal 5 amino acids of the peptide leader sequence (encoded by the proximal 15 bp of exon 2). Since both exon 2 (210 bp) and exon 3 (186 bp) are in phase, the transcript with this segment deleted could theoretically serve as template for a C2 protein shorter by the 132 amino acids that are encoded by these two exons.

RNase Protection

The relative abundance of these two message forms of C2 in normal liver and HepG2 mRNA was quantitated by a nuclease protection assay. The antisense probe was constructed as described in Fig. 3. Using the 748-bp clone inserted into the pBluescript vector, T7 RNA polymerase generated an antisense probe containing P-cytosine residues. The length of this probe was limited to 266 bp by predigestion at a naturally occurring AvaII site. Protection of C2 long mRNA yielded a protected band of 199 bp and of C2 short mRNA of 72 bp (Fig. 3A). Lanes1 and 2 were loaded with undigested probe. The negative control transfer RNA does not protect as seen in lane3. Quantification of the relative abundance of the two message forms was achieved by an analysis of the signal strength (scintillation spectrometry) of the 72 and 199 bp bands. Abundance was calculated using the following equation: 199 bp band cpm/49 (cytosine residues): 72 bp band cpm/23 (cytosine residues).

The results of four separate experiments showed that the C2 short mRNA was present in HepG2 and normal liver at about one-half of the concentration of C2 long.

Expression of C2 Long and C2 Short in Murine L Cells

To determine whether the full-length C2 short and C2 long mRNA species could be translated in vivo, each was transfected into murine fibroblasts (L-cells). In order to ascertain the fate of C2 protein generated from each, a pulse-chase experiment was performed (Fig. 4). C2 long cDNA driven by pRep10 generated an 84-kDa C2 protein that disappeared from the intracellular compartment coincident with the appearance of mature C2 protein in the extracellular medium (half time 1 h) (Fig. 4B). C2 short cDNA under the same conditions generated a 70-kDa C2 protein that was still detected in cell lysates after 24 h (Fig. 4A). No extracellular C2 short protein was detected even with a longer (3times) exposure time. Immunofluorescence of the transfectants (Fig. 5) with monoclonal antibody or polyclonal antibody (not shown) to C2 revealed a bright, relatively homogenous intracellular staining pattern for C2 short and a much less intense diffuse fluorescence pattern for the C2 long transfectant. No cell surface membrane staining was detected.

Figure 4: Kinetics of synthesis and secretion of C2 short and C2 long. A, synthesis and secretion of C2-short protein in transfected L-cells. Transfectants were labeled for 30 min with [S]methionine and chased with unlabeled methionine for intervals up to 24 h. At timed intervals, culture media were harvested and cells were solubilized, immunoprecipitated, and analyzed by SDS-polyacrylamide gel electrophoresis and fluorography. Lanes1-6 contain cell lysates, and lanes7-12 contain extracellular media from chase time points 0, 0.5, 1, 2, 4, and 24 h. Intracellular C2-short protein (molecular mass, 69 kDa) but not extracellular C2 protein is identified even on a long exposure (3times) film (data not shown). B, kinetics of synthesis and secretion of C2 long protein in transfected L-cells. 84- (intracellular C2 short) and 92-kDa (secreted form) C2 polypeptides are identified. Lanes are labeled exactly as in A.


Figure 5: Indirect immunofluorescence in the L-cells transfected with C2 short and C2 long. C2 short transfectants stain with the monoclonal anti-human C2 antibody strongly in the perinuclear regions (panelA). The pattern of C2 long transfectants was much less intense and more diffuse (panelB). PanelsC (C2 short) and D (C2 long) are monoclonal control antibodies. Exposure time was 4 s each.


Cell-free Synthesis of C2 Long and C2 Short

Results of the transfection of C2 short cDNA into L-cells suggested that the product of C2 short may be localized to the endoplasmic reticulum. In order to determine whether the C2 short leader peptide (which lacks five carboxyl-terminal residues, including the signal peptidase cleavage site) is capable of facilitating transport across the endoplasmic reticulum membrane, the following study (Fig. 6) was done. C2 short and C2 long mRNA species were separately translated under cell-free conditions. Direct analysis of the cell-free translation products revealed (lane1) single polypeptides of 62 and 77 kDa, respectively. These bands were also detected after immunoprecipitation with anti-C2 antibody (data not shown). Calculated molecular weights of translocated C2 short and C2 long proteins are 67 and 82 kDa, respectively(25) . In the presence of microsomes, the C2 long peptide was protected from proteolysis (B, lane4versuslane3) except if protease was added with detergent (lane6). Detergent alone had no effect on the C2 within the microsomal vesicles (lane5), but the C2 was completely digested by the proteolytic enzymes in the absence of microsomes (lane2). C2 short showed a similar pattern.

Figure 6: In vitro translation of C2-short and C2-long C2-short (A) or C2 long (B) mRNA translated in a rabbit reticulocyte lysate system supplemented with 1 mCi/ml [S]methionine in the presence or absence of dog pancreas microsomes. After translation was completed, aliquots of the translation reactions were treated with a mixture of trypsin and chymotrypsin in the presence or absence of 1% Triton X-100. C2 short is translocated into the microsomes. PanelA, arrows show primary translation product 62 kDa and translocated polypeptide 67 kDa; panelB, arrows show 77 and 82 kDa, respectively.


DISCUSSION

Alternative splicing of precursor mRNA is but one of several mechanisms generating control of gene expression at the level of translation(26) . In addition, alternative splicing can govern the destination, size, and function of the protein products derived from a single gene(26) . Abundant evidence has been obtained for alternative initiation and alternative splicing events in the transcription and processing of human (5, 10, 14, 27) and murine (28, 29, 30, 31) mRNA derived from the homologous major histocompatibility complex-linked complement C2 and factor B genes. For example, both murine factor B (30) and human C2 (27) mRNA forms expressed in a tissue-specific pattern vary in length of 5`-untranslated regions. In the case of murine factor B, one of the initiation codons within this 5` extension has an effect on the rate of translation of factor B protein(32) .

The cell biological implications have not been ascertained for the several alternatively spliced mRNA species identified in murine and human tissues expressing C2.

In the present report, we provide evidence that a relatively abundant transcript lacking exons 2 and 3 (Deltaex 2, 3) is the template for a previously recognized 70-kDa C2 protein that is found in lysates of every cell type that synthesizes and secretes native C2. This conclusion is based on (a) reverse transcriptase PCR identification of a truncated C2 mRNA in several different tissues, (b) quantitation of the truncated C2 by nuclease protection that shows a 1:2 relative abundance compared to full-length C2 mRNA, (c) sequence analysis that shows deletion of exons 2 and 3 at the authentic splice junctions, (d) expression of the truncated isoform in murine L-cells generates a 70-kDa polypeptide in cell lysates but no C2 protein is secreted into the medium. The subcellular location of the product of this truncated C2 mRNA is intracellular as suggested by fluorescent antibody staining of transfected L-cells. No cell surface membrane staining was apparent. Studies of cell-free synthesis in the presence of microsomes clearly establish that the truncated C2 protein can traverse the endoplasmic reticulum membrane even though it lacks 5 amino acids at the carboxyl terminus of the leader peptide. This deletion would likely make the product resistant to cleavage by the signal peptidase. This C2 protein is also lacking a portion of the amino-terminal domain critical for optimal binding to the C4b protein, which is required for generating the C3 cleaving enzyme of the classical activation pathway(33) .

The present study does not address the biological function of the 70-kDa intracellular C2 protein. It is possible that the 70-kDa C2 protein has no function and/or is simply a vestige of an ancestral protein. On the other hand, its presence in relatively high abundance within cells that express C2 and its regulation by interferon- (34) suggest that it may play a role in the intracellular traffic of C2 itself or of proteins that can interact with C2. Since the cleavage site that activates the C2 serine proteinase is intact, it is possible that it may serve an enzymatic function within the cell.

FOOTNOTES

*
This work was supported by National Institutes of Health Grants AI24836, HD17461, and HL37591. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
To whom correspondence should be addressed: Edward Mallinckrodt Dept. of Pediatrics, Washington University School of Medicine, One Children's Pl., St. Louis, MO 63110.

(^1)
The abbreviations used are: PCR, polymerase chain reaction; bp, base pair(s).

ACKNOWLEDGEMENTS

We thank Barbara Pellerito for secretarial support.

REFERENCES

  1. Polley, M. J., and Müller-Eberhard, H. J. (1968) J. Exp. Med. 128, 533-551 [Abstract]
  2. Cooper, N. R. (1975) Biochemistry 14, 4245-4251 [CrossRef][Medline] [Order article via Infotrieve]
  3. Carroll, M. C., Campbell, R. D., Bentley, D. R., and Porter, R. R. (1984) Nature 307, 237-241 [CrossRef][Medline] [Order article via Infotrieve]
  4. Morris, K. M., Aden, D. P., Knowles, B. B., and Colten, H. R. (1982) J. Clin. Invest. 70, 906-913
  5. Perlmutter, D. H., Cole, F. S., Goldberger, G., and Colten, H. R. (1984) J. Biol. Chem. 259, 10380-10385 [Abstract/Free Full Text]
  6. Whaley, K. (1980) J. Exp. Med. 151, 501-516 [Abstract/Free Full Text]
  7. Katz, Y., Cole, F. S., and Strunk, R. C. (1988) J. Exp. Med. 167, 1-14 [Abstract/Free Full Text]
  8. Strunk, R. C., Eidlen, D. M., and Mason, R. J. (1988) J. Clin. Invest. 81, 1419-1426
  9. Lappin, D. F., Guc, D., Hill, A., McShane, T., and Whaley, K. (1992) Biochem. J. 281, 437-442
  10. Barnum, S. R., Ishii, Y., Agrawal, A., and Volanakis, J. E. (1992) Biochem. J. 287, 595-601
  11. Perlmutter, D. H., Colten, H. R., Grossberger, D., Strominger, J., Seidman, J. G., and Chaplin, D. D. (1985) J. Clin. Invest. 76, 1449-1454
  12. Johnson, C. A., Densen, P., Wetsel, R. A., Cole, F. S., Goeken, N. E., and Colten, H. R. (1992) N. Engl. J. Med. 326, 871-874 [Medline] [Order article via Infotrieve]
  13. Johnson, C. A., Densen, P., Hurford, R. K., Jr., Colten, H. R., and Wetsel, R. A. (1992) J. Biol. Chem. 267, 9347-9353 [Abstract/Free Full Text]
  14. Cheng, J., and Volanakis, J. E. (1994) J. Immunol. 152, 1774-1782 [Abstract]
  15. Chirgwin, J. M., Przybyla, A. E., MacDonald, R. J., and Rutter, W. J. (1979) Biochemistry 18, 5294-5299 [CrossRef][Medline] [Order article via Infotrieve]
  16. Maniatis, T., Fritsch, E. F., and Sambrook, J. (1989) Molecular Cloning: A Laboratory Manual , pp 197-198, Cold Spring Harbor Laboratory, Cold Spring Harbor, NY
  17. Birnboim, H. C. (1983) Methods Enzymol. 100, 243-255 [Medline] [Order article via Infotrieve]
  18. Tabor, S., and Richardson, C. C. (1987) Proc. Natl. Acad. Sci. U. S. A. 84, 4767-4771 [Abstract/Free Full Text]
  19. Ausubel, F. M., Brent, R., Kingston, R. E., et al. (eds) (1987) Current Protocols in Molecular Biology, p. 4.7.1, Wiley Interscience, New York
  20. Woods, D. E., Edge, M. D., and Colten, H. R. (1984) J. Clin. Invest. 74, 634-638
  21. Chen, C., and Okayama, H. (1987) Mol. Cell. Biol. 7, 2745-2752 [Abstract/Free Full Text]
  22. Cole, F. S., Schneeberger, E. E., Lichtenberg, N. A., and Colten, H. R. (1982) Immunology 46, 429-441 [Medline] [Order article via Infotrieve]
  23. Laemmli, U. K. (1970) Nature 227, 680-685 [CrossRef][Medline] [Order article via Infotrieve]
  24. Giloh, H., and Sedat, J. W. (1982) Science 217, 1252-1255 [Abstract/Free Full Text]
  25. Bentley, D. R. (1986) Biochem. J. 239, 339-345 [Medline] [Order article via Infotrieve]
  26. Smith, C. W., Patton, J. G., and Nadal-Ginard, B. (1989) Annu. Rev. Genet. 23, 527-577 [CrossRef][Medline] [Order article via Infotrieve]
  27. Horiuchi, T., Macon, K. J., Kidd, V. J., and Volanakis, J. E. (1990) J. Biol. Chem. 265, 6521-6524 [Abstract/Free Full Text]
  28. Passwell, J., Schreiner, G. F., Nonaka, M., Beuscher, H. U., and Colten, H. R. (1988) J. Clin. Invest. 82, 1676-1684
  29. Nonaka, M., Ishikawa, N., Passwell, J., Natsuume-Sakai, S., and Colten, H. R. (1989) J. Immunol. 142, 1377-1382 [Abstract]
  30. Ishikawa, N., Nonaka, M., Wetsel, R. A., and Colten, H. R. (1990) J. Biol. Chem. 265, 19040-19046 [Abstract/Free Full Text]
  31. Garnier, G., Ault, B., Kramer, M., and Colten, H. R. (1992) J. Exp. Med. 175, 471-479 [Abstract/Free Full Text]
  32. Garnier, G., and Colten, H. R. (1993) Mol. Immunol. 30, Suppl 1, 11 (abstr.)
  33. Oglesby, T. J., Accavitti, M. A., and Volanakis, J. E. (1988) J. Immunol. 141, 926-931 [Abstract]
  34. Strunk, R. C., Cole, F. S., Perlmutter, D. H., and Colten, H. R. (1985) J. Biol. Chem. 260, 15280-15285 [Abstract/Free Full Text]
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.

Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?



This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Submit a Letter to Editor
Right arrow Alert me when this article is cited
Right arrow Alert me when eLetters are posted
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrowRequest Permissions
Citing Articles
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Akama, H.
Right arrow Articles by Colten, H. R.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Akama, H.
Right arrow Articles by Colten, H. R.
Social Bookmarking
Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.
Advertisement
spacer
Advertisement
Advertisement