JBC

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bendik, I.
Right arrow Articles by Pfahl, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bendik, I.
Right arrow Articles by Pfahl, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 7, Issue of February 17, 1995 pp. 3107-3114
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
Similar Ligand-induced Conformational Changes of Thyroid Hormone Receptors Regulate Homo- and Heterodimeric Functions (*)

(Received for publication, September 1, 1994; and in revised form, November 28, 1994)

Igor Bendik (§) Magnus Pfahl (¶)

From the Cancer Center, La Jolla Cancer Research Foundation, La Jolla, California 92037

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

Thyroid hormone receptors (TRs) bind specific thyroid hormone response elements (TREs) as heterodimers with retinoid X receptors (RXRs) and act as transcriptional activators. As homodimers, TRs can bind a distinct set of sequences and function as ligand sensitive repressors. In our study, we compared the natural malic enzyme TRE (ME-TRE) as a model system for the TR/RXR heterodimer pathway to the chicken lysozyme silencer element F2-TRE which is strongly bound and regulated by TR/TR homodimers. Using electrophoretic mobility shift assays, transient transfections with a variety of natural and synthetic triiodothyronine and thyroxine derivatives as well as limited proteolytic analysis, we show that the natural homo- and heterodimeric pathways show similar ligand requirements. Furthermore, we observe that the ligand-induced conformational changes in the receptor proteins that either result in a loss of TR/TR homodimer binding and release of transcriptional repression or in transcriptional activation of TR/RXR heterodimers are indistinguishable. Therefore, we propose that in TR/TR homodimers and TR/RXR heterodimers very similar moieties of the receptors are involved in ligand binding and subsequent conformational changes that lead to loss of gene repression (TR/TR homodimer) and gain of gene activation (TR/RXR heterodimer).


INTRODUCTION

Thyroid hormones regulate important biological processes such as metamorphosis, development, growth, homeostasis and general metabolism (1) . The major forms of thyroid hormones comprise 3,5,3`,5`-tetraiodo-L-thyronine (L-T4) (^1)and 3,3`,5-triiodo-L-thyronine (L-T3), the latter is the most active form. The biological effects of these hormones are mediated by specific nuclear thyroid hormone receptors (TRs). Two genes encoding two different receptor subtypes, TRalpha and TRbeta, have been characterized (see for review, see (2, 3, 4, 5) ). The receptors are members of the steroid hormone/retinoic acid receptor superfamily, a large group of transcription factors(6, 7, 8) . TRs have dual regulatory roles and can function as transcriptional activators as well as transcriptional repressors(5, 9) . Like other members of the superfamily, TRs mediate T3 signals through specific DNA sequences, the T3 response elements (TREs), usually found in the promoter regions of responsive genes. The characterization of TREs revealed that several configurations of two half-sites of the sequence AGGTCA (or derivatives of this sequence) are possible, including a palindrome with no spacer (10) , direct repeats with 4 base pair (bp) spacer(11, 12, 13) , and inverted palindromes/everted repeats spaced by 6 bp(14, 15) . For effective DNA interaction, the TRs were found to require association with a nuclear auxiliary factor, called TRAP(16, 17, 18, 19, 20) , now identified as retinoid X receptors (RXRs)(21, 22, 23, 24, 25, 26) . The RXRs also play a central role in several other signal transduction pathways since they heterodimerize with several other nuclear receptors, including the retinoic acid receptors (RARs), the vitamin D receptor (VDR), and the peroxisome proliferator activated receptors (PPARs)(21, 22, 23, 24, 25, 26, 27, 28, 29) .

More recent evidence suggests that TRs can also form heterodimers with other receptors(30, 31) . In addition TR/TR homodimers (33, 34) (^2)and TR monomers (35, 36) have been proposed to confer T3 responsive transcriptional regulation increasing the variety of possibilities for T3 signal transduction mechanisms. However, so far it appears that most TREs are activated by the TR/RXR heterodimeric pathway since the heterodimers have the highest affinity for these TREs. TR/RXR heterodimers were shown to form in solution in the absence of ligand(21, 22, 25) , while the presence of specific DNA binding sites like the alpha-myosin heavy chain TRE or the malic enzyme TRE (ME-TRE) were shown to strongly enhance this dimerization(37) . Interestingly, the chicken lysozyme TRE (F2-TRE), an IP-6 type response element, initially characterized as a silencer (14) can be bound by TR/TR homodimers and TR/RXR heterodimers, the TR/TR homodimers forming the more stable complexes with this TRE.^2 TR/TR homodimer binding to the F2-TRE, however, is inhibited by T3(38) ^2 allowing the homodimers to function as T3 sensitive repressors(5, 16) .

The major goal of this study was to compare these two major T3 signaling response pathways, the TR/RXR heterodimeric and the TR/TR homodimeric pathway, in terms of ligand mediated action. For this we analyzed the T3 induced release of repression by TR/TR homodimers using the F2-TRE, comparing it to TR/RXR heterodimers induced transcriptional activation on the ME-TRE, employing natural and synthetic thyroid hormone analogs. We show here that the TR/TR homodimeric and the TR/RXR heterodimeric pathways have very similar ligand requirements. Our data support the idea that the ligand-induced conformational changes in TR that lead to transcriptional activation by TR/RXR heterodimers and release of repression by TR/TR homodimers are identical or at least very similar. This implies that the orientation and spacing of the half-sites in the various natural TREs is a key determinant for either transcriptional activation or release of repression by TRs.


MATERIALS AND METHODS

Reagents

Restriction enzymes, T4-ligase, and polynucleotide kinase were from New England Biolabs, Stratagene, and Boehringer Mannheim. Radiolabeled L-[S]methionine (1175 Ci/mmol) and alpha-[P]dATP (3000 Ci/mmol) were purchased from DuPont-NEN. ^14C-Labeled low range protein molecular markers were obtained from Life Technologies, Inc. Poly(dI-dC), thyroid hormones (L-T3 and L-T4), and thyroid hormone analogs (3,3`,5-triiodo-D-thyronine (D-T3); 3,5,3`,5`-tetraiodo-D-thyronine (D-T4); 3,3`,5`-triiodo-L-thyronine (rT3); 3,3`,5-triiodothyroacetic acid (TRIAC)) were purchased from Sigma. The L-T3 analogs (322085, 322450, 322094, 312693, 320989, 320883, 322010, 312810) were kindly provided by Dr. Brian L. Buckwalter, American Cyanamid Company, Princeton, NJ.

Recombinant Plasmids

The reporter construct pBLCAT2 ME carried a single copy of the sequence CAGGACGTTGGGGTTAGGGGAGGACAGTGG (recombinant ME from -288 to -259) in the BamHI site of pBLCAT2(39) . The pBLCAT2 TATA reporter vector was constructed by creating a BglII site 3` adjacent to the TATA box using polymerase chain reaction and suitable primers. By inserting the F2 sequence TTATTGACCCCAGCTGAGGTCAAGTTACG (14) into the BglII site of pBLCAT2 TATA, the pBLCAT2 TATA F2 was generated. The expression vectors pECE TRalpha and TRbeta have been previously described(20, 40) .

Transient Transfections and Electrophoretic Mobility Shift Assays

CV-1 cells were used for transient transfection assays as described(41, 42) . Receptor proteins were produced by in vitro transcription/translation as described (41, 43) and used in the electrophoretic mobility shift assay as reported previously(9, 20, 24, 41) . When L-T3 was used, receptor proteins were first preincubated with ligand for 10 min prior adding the labeled DNA. The double-stranded oligonucleotides F2-TRE (gatccTGACCCCAGCTGAGGTCAg) and ME-TRE (gatccAGGACGTTGGGGTTAGGGGAGGACAGTGg) had both BamHI overhangs, used for fill in labeling with the Klenow fragment of DNA polymerase.

Limited Proteolytic Digest Analysis

Receptor proteins were preincubated with the natural and synthetic T3 analogs. Prior to incubation, the ligands were diluted to 10M in a buffer containing 50 mM KCl, 1 mM dithiothreitol, 2.5 mM MgCl(2), 5% glycerol, and 20 mM HEPES at pH 7.91. The final concentration of the thyromimetics was 10M. After 10 min at room temperature 1-µl aliquots containing different amounts of chymotrypsin were added. Proteolytic digestions were carried out for 10 min and stopped by adding 5 µl of 2 times SDS sample buffer and boiling for 5 min. The SDS-polyacrylamide gel electrophoresis was done at room temperature using a 10% polyacrylamide gel (acrylamide/N,N`-methylene-bisacrylamide, weight ratio of 29:1). Before vacuum drying at 80 °C, the gels were fixed in 10% acetic acid and 20% ethanol, followed by a brief incubation in Amplify solution (Amersham Corp.).


RESULTS

The ME-TRE and the F2-TRE Differ in Their Structure and Function

Among the numerous natural TREs identified (reviewed in (5) and (44) ) the rat ME-TRE (45) and the F2-TRE (14) represent two examples of distinct structural arrangements of the half-sites. The ME-TRE (Fig. 1A) consist of two direct repeats separated by 4 nucleotides (DR-4). This type of TRE belongs to a group of elements that also includes the alpha-myosin heavy chain TRE (46, 47) , MoMLV-TRE(25, 48) , mouse myogenin TRE(49) , skeletal alpha-actin TRE(50) , rat sarcoplasmic reticulum CaATPase TRE(51) , and mouse MyoD-TRE(52) . All of these DR-4 TREs require RXR for TR binding. In contrast, in the F2-TRE (Fig. 1A) the half-sites are arranged as an inverted palindrome separated by 6 bp (IP-6). This IP-6 motif allows high affinity TR/TR homodimer binding as well as TR/RXR heterodimer binding, when using in vitro synthesized receptors (Fig. 1B). As shown previously (38) ^2 only the TR/TR homodimer binding to F2-TRE can be disrupted by T3 (Fig. 1B). T3 has no effect on the affinity of the TR/RXR heterodimer to the ME-TRE or F2-TRE. When transiently transfected into CV-1 cells, TRbeta allowed induction of the pBLCAT2 ME-TRE reporter plasmid, in response to increasing amounts of T3 (Fig. 2A). The fold stimulation at saturating ligand concentrations varied between 3- and 5-fold under these conditions. Cotransfection of TRbeta together with the RXRalpha expression plasmid enhanced the CAT expression only slightly suggesting that CV-1 cells contain sufficient endogenous RXR to allow DR-4 activation. Indeed nuclear extracts of CV-1 cells preincubated with in vitro translated TRbeta shifted the ME-TRE to a position corresponding to the in vitro produced TRbeta/RXRalpha heterodimers (20 and data not shown), supporting the in vivo data.


Figure 1: Two natural TREs have distinct receptor binding properties. A, sequences of wild type TREs used in this analysis. The hexameric repeats involved in receptor binding and function as demonstrated by previous studies are indicated by arrows. The rat malic enzyme TRE (ME-TRE) sequence from 288 to 259 (45) and the chicken lysozyme silencer F2-TRE sequence from -2354 to -2326 (14) are shown. B, binding of homo- and heterodimeric complexes. P-Labeled ME-TRE and F2-TRE were incubated with equal amounts of in vitro translated receptors. Binding of TRbeta homodimers in the presence and absence of 10M L-T3 and TRbeta/RXR heterodimers were compared. Unprogrammed lysate (Lysate) served as a control.




Figure 2: Analysis of TR/TR homodimer and TR/RXR heterodimer response pathways in vivo. A, ligand dependent transactivation of the ME TRE in CV-1 cells. The TR/RXR heterodimeric complex was analyzed on a natural DR-4 element, the rat malic enzyme (ME) TRE, in transient transfection experiments. The ME-TRE was cloned upstream of the tk-promoter generating the reporter construct pBLCAT2 ME TRE. 100 ng of pBLCAT2 ME TRE together with 5 ng of expression vectors were cotransfected into CV-1 cells. The cells were treated with different concentrations of hormone (L-T3) and 24 h later tested for CAT activity. The mean of four experiments is shown. The standard deviations are indicated. B, ligand dependent release of repression by TR/TR-homodimer. The chicken lysozyme silencer F2-TRE, which has an inverted palindromic structure with a spacing of 6 nucleotides, was cloned downstream the TATA-box into the pBLCAT2 vector (pBLCAT2 TATA F2). This construct has constitutive promoter activity which is repressed in the presence of TR. T3 releases repression and results in the induction of the reporter gene. 300 ng of pBLCAT2 TATA F2 were cotransfected into CV-1 cells either with 50 ng TRbeta expression vector or empty vector as a control and 200 ng of beta-gal expression vector. The cells were treated with different concentrations of hormone (L-T3) and 24 h later analyzed for reporter gene (CAT) activity. CAT values were normalized to beta-gal expression. The mean of four experiments is shown. The standard deviations are indicated. The basal tk-promoter activity was repressed by TRs in the absence of ligand by more than 80%.



When we analyzed the F2-TRE cloned upstream of a tk-CAT gene, cotransfection of TRbeta decreased the basal CAT-activity. Addition of T3 not only reversed this effect, but also up-regulated the CAT expression severalfold over the basal level, consistent with previous observations (14) (data not shown). To be able to separate the heterodimer response from the homodimer release of repression response, we cloned the F2-TRE downstream of the TATA-box (Fig. 2B) such that the TRE-bound receptors would inhibit the transcriptional machinery. Only the TR/TR homodimers could interfere with the transcription initiation in a ligand responsive manner. Indeed this experimental design allowed to separate the predominantly TR/TR homodimeric effects from the TR/RXR heterodimeric effects in transient transfection assays (Fig. 2B). Repression of the F2-TRE was released in a ligand sensitive way, reestablishing the basal expression without superactivation. Thus, the TATA F2 construct is suitable for functional analysis of the release of transcriptional repression important in the homodimer pathway.

Ligand Requirements for Thyroid Hormone Receptors in Homo- and Heterodimeric Pathways

Having established a system that allows to measure the ligand response of TR/TR homodimers in vivo, we compared the ligand-sensitive release of repression with transcriptional activation by heterodimers. Different T3 and T4 analogs were compared for their ability to effect gene regulation by homo- and heterodimers. One important question we wanted to test was whether natural thyromimetics could act as selective compounds distinguishing between the two pathways. CV-1 cells were cotransfected with TRbeta in a transient transfection assay and increasing amounts of L-T3, D-T3, L-T4, D-T4, TRIAC, and rT3 were applied (Fig. 3A). Comparison of the sigmoidal derepression and transactivation curves revealed that the compounds behaved very similar in the release of repression on the F2-TRE and in the transactivation of the ME-TRE. The diverse ligand induced effects were highly comparable for the specific ligands (Fig. 3A). When we included TRalpha into our analysis (Fig. 3B), we also observed almost identical dose response curves for the homo- and heterodimers. These results indicate that TRalpha and TRbeta have highly similar T3 ligand requirements in both pathways.



Figure 3: Dose response curves of natural and synthetic T3 and T4 analogs. Repression release and transactivation potencies of the different thyromimetics are shown. TRbeta (A) and TRalpha (B) were analyzed. Transfections were carried out essentially as in Fig. 2. CAT activity was measured after 24 h of incubation in presence of different concentrations of the T3 and T4 analogs. The values were normalized to beta-gal expression. High and medium activity compounds were compared to L-T3 (upper and middle panels) while low activity compounds (lower panels) were compared to L-T4.



Synthetic Thyromimetics Behave Very Similarly in Homo- and Heterodimeric Response Pathways

We extended our analysis with a series of synthetic T3 analogs. Most of the T3 analogs used (Fig. 4B) had substitutions in important positions (3`-, 3-, 5- substituents). In compounds 322010, 320883, 312693, 322094, and 322450, the iodines were exchanged with bromide in the 3- and 5-position. Furthermore, these compounds had in the 3`-position a bulky phenyl group. In compound 320989, the 3` substituent was move to the 2`-position. Whereas compound 322085 had both 3`- and 2`-positions involved in a planar naphthalene ring system. In addition to the lipophilic 3` substitutions (compounds 322085, 322450, 322094, 312693, 320883, and 322010), compound 312810 had a hydrophilic ethyl amino acetate substituent. First experiments showed that none of these synthetic thyromimetics could distinguish between TRalpha and TRbeta. However, their potency to activate gene expression and release gene repression in CV-1 cells differed markedly for the analogs analyzed (Fig. 3). According to their half maximal effective concentrations (EC) measured, four groups of T3 analogs could be identified (Fig. 4): highly potent, intermediate, weak, and inactive analogs. The compound 322085, L-T3, and TRIAC were highly active. The EC of these ligands ranged from 40 pM for compound 322085 to 2.5 nM for TRIAC. Thus 322085 was up to 3.5-fold more effective than L-T3 in both the transactivation as well as in the release of repression analysis. D-T3, compound 322450, compound 322010, and compound 312693 belong to the intermediate group, having EC values between 7.5 and 150 nM. The weak group consisted of L-T4, D-T4, and compounds 320989 and 320883, with EC values of 0.1 µM and lower. The compounds 322010 and 312810 and reverse T3 showed no or only marginal activity (Fig. 3). Disruption of TR/TR homodimer binding to the F2-TRE by the different T3 analogs was also according to the measured EC values when we used these compounds in the gel retardation assay (data not shown). Only subtle differences of approximately 2-fold between TRalpha and TRbeta activation in the homo- and heterodimeric pathways could be detected (Fig. 4). Overall the thyromimetic activities of the ligands were essentially the same for the ME-TRE and F2-TRE. Thus the ligand sensitivity of TRs is not differentially affected in homodimeric and heterodimeric complexes, indicating that the TR ligand binding domain is in a similar configuration and equally accessible in hetero- and homodimers bound to distinct response elements.


Figure 4: Activities of T3 analogs. The EC values for the different ligands as determined by transcriptional activation of the ME-TRE and release of repression on the F2-TRE are listed. The structural formulas of the natural ligands (A) and the synthetic T3 analogs (B) are shown. n.a., not active.



Limited Proteolytic Digestion Analysis of Ligand-induced Conformational Changes

To further examine whether the TR proteins have similar ligand-induced structural states in the presence of different TREs, we examined the hormone- induced structural changes of TRbeta using a partial proteolytic analysis, where different proteolytic digestion patterns induced by ligand binding can indicate structural changes in the analyzed protein.

We analyzed [S]methionine-labeled TRbeta incubated with different concentrations of chymotrypsin. As demonstrated in Fig. 5A, preincubation of labeled TRbeta with T3 gave a different protease digestion pattern than unbound receptor. The unliganded TR was more accessible to the protease; digestion with chymotrypsin at a concentration of 10 µg/ml generated only two fragments of low molecular weight, whereas the T3-induced conformation protected the liganded TR from the protease activity. Chymotrypsin at a concentration of 10 µg/ml digested the liganded TR in a distinct pattern, yielding more and higher molecular weight fragments (Fig. 5A). In the presence of T3 a protected 30-kDa peptide fragment appeared when a higher concentration of chymotrypsin (10 µg/ml) was used. The protease resistant 30-kDa fragment was not observed in the absence of hormone. The diverse proteolytic digestion patterns and the T3-induced protection of a 30-kDa fragment reflect the ligand induced conformational changes of the thyroid hormone receptor. From immunocoprecipitation studies, it was previously shown that TR/RXR heterodimers are formed in solution(37) . The protease digestion pattern of the thyroid hormone receptor, when present as a heterodimer with RXR in solution (Fig. 5B), showed a slightly delayed digestion kinetic (a weak high molecular weight band is still present at 10 µg/ml of chymotrypsin). Whereas the overall proteolytic digestion pattern was identical to the unliganded thyroid hormone receptor (Fig. 5B). Addition of T3 to the TR/RXR heterodimer induced the same proteolytic digestion pattern as observed for the T3 occupied TR. This delayed digestion kinetic might be due to the interference of RXR with the digestion, but does not suggest a major conformational alteration of TR since the protease digestion pattern remained unchanged.


Figure 5: Ligand-induced conformational changes analyzed by limited proteolytic digestion. A, homodimer analysis. S-Labeled TRbeta was analyzed by partial chymotryptic digestion (2 µg/ml, 5 µg/ml, and 10 µg/ml). Addition of 10M L-T3 yielded a different partial digestion pattern of TRbeta than in absence of ligand. Liganded TRbeta was less accessible to the protease. Additionally, a protected 30 kDa peptide fragment (triangle) was observed that was not present in absence of ligand. The presence of 1 µM of F2-TRE double stranded oligo did not alter the ligand-induced protection pattern. B, heterodimer analysis using limited protease digestion. S-Labeled TRbeta was preincubated with equal amounts of RXRalpha and with either 1 times buffer(-), F2-TRE (F2), TREp (TREp), or ME-TRE (ME) prior to limited chymotryptic digestion. The presence of RXRalpha and/or the various TREs did not alter the digestion pattern.



We were also interested on how the presence of different response elements could influence the conformation of the thyroid hormone receptor in the TR/TR homodimeric (F2-TRE) and TR/RXR heterodimeric (ME-TRE) pathways. Using the limited chymotrypsin digestion assay, the liganded TRs appeared to have the same structural configurations when interacting as a TR/TR homodimer with the F2-TRE (Fig. 5A) or as a TR/RXR heterodimer with the ME-TRE (Fig. 5B). Furthermore, TR/RXR heterodimer binding to the inverted palindrome F2-TRE or the palindromic TREp induced very similar structural changes in TR as judged from the limited proteolytic analyses. The unliganded TR yielded analogous digestion patterns in the presence of DNA as in its absence. These results suggest that the inverted palindromic F2-TRE, the DR-4 element ME-TRE and the palindromic TREp(9) , although different in their architecture, do not induce diverse structural states in TRs when analyzed in this system.


DISCUSSION

With the isolation and characterization of an increasing number of TREs, different T3 signaling mediated by TRs have become apparent(44, 53) ^2 In our study, we have selected two mechanistically different TR response pathways to analyze the molecular influence of the ligand. To facilitate this analysis we have designed a new reporter construct that allows to follow the ligand sensitive release of repression by TR/TR homodimers on the F2-TRE. Interestingly, transcriptional activation of the TR/RXR heterodimer and the release of transcriptional repression mediated by the TR/TR homodimers appeared to be highly similar in terms of their ligand requirements. Not only did the heterodimers and homodimers show very similar T3 response curves, but they also reacted very similarly to T3 and T4 analogs.

Our analysis in addition suggests that the observed thyromimetic potencies of the T3 analogs reflect the binding affinities to the TRs. From studies of T3 and T4 analogs in quantitative structure-activity analysis (54, 55) it is known that the important 3`-residue interaction is strictly lipophilic and limited in size. The 4`-hydroxyl is suggested to donate a hydrogen bond to the ligand binding pocket of the TR. Consequently, when a hydrophilic group is introduced in 3`-position (compound 312810) or when the 4`-hydroxyl is blocked by a methyl group (compound 322010) the thyromimetic potencies should be eliminated, as observed here (Fig. 3). Interestingly, a lipophilic ring substitution of the Iodine at the 3` position (compound 322085) increased the biological activity (Fig. 5B). In contrast, introduction of a flexible and bulky phenyl group that increased the size of the 3` substituent (compounds 322450, 322094, and 312693) led to a considerable drop in biological activity. Changing the 3`-residue position to the 2`-position (compound 322010) led to a further reduction of the activity. Taken collectively, our experimental data confirm the known qualitative structure-binding affinity relationship for the interaction of L-T3 with TRs present in nuclear extracts (54, 55, 56) .

The subtle differences observed between TRalpha and TRbeta activation indicate that the existing panel of T3 analogs does not yet allow sufficient molecular discrimination to induce/repress TR subtypes selectively. This situation may be comparable to the retinoid field several years ago, when no satisfactory receptor selective ligands were available. The recent discovery of selective retinoids for numerous functions (57, 58, 59, 60) could be followed by a similar development in the thyromimetics field.

Recently, it has been shown that L-T3 binding to TRs induces conformational changes in the receptor, as measured by electrophoretic mobility analysis of a receptor-DNA complex(33, 61, 62) , circular dichroism (CD) spectroscopy(63) , or limited protease digestion assays (64, 65) . Even though gel retardation analysis showed enhanced migration of the monomeric and dimeric forms of the TRs in the presence of ligand, these effects were rather small compared to ligand induced disruption of TR/TR homodimers. While the gel retardation technique is most frequently used to study ligand induced effects, the CD spectroscopy method is a more effective analysis to explore ligand induced secondary structure changes in TRs as demonstrated for the chicken TR by Toney et al.(63) . Interestingly, these investigators observed in addition to the ligand effect also a measurable change in the CD spectrum when adding the palindromic TREp, but no effect was detected in the presence of a DR-4. These data could indicate that the TREp induces an additional conformational change in the chicken TRalpha. Other laboratories (64, 65) using partial tryptic digestions showed that the T3 induced conformational changes generated trypsin-resistant peptide fragments of the ligand binding domain. Using this same method, we did not observe that DNA binding enhanced or decreased the T3 induced protected chymotrypsin peptide fragments significantly. Chymotrypsin produced a protected fragment (30 kDa) in the presence of T3 that did not appear in absence of ligand, suggesting major conformational differences between liganded and unliganded receptors. Additionally, we also observed a T3 induced delayed chymotryptic TRbeta degradation as previously demonstrated with trypsin, implying that the conformational changes produced a more compact ligand binding domain, less accessible, to the proteases. Importantly, our results showed that the major conformational changes induced by L-T3 are at least very similar in both heterodimers and homodimers.

In conclusion, the results presented here suggest that the ligand-induced changes in the TRs required for activation of the homodimeric and the heterodimeric response pathways are very similar. Thus the ligand binding pocket of TRs does not appear to be in very different configurations when TRs are complexed as heterodimers or homodimers on different structural elements. However, some structural changes, not detectable with the tools used here that might also contribute to differential TR function cannot be excluded. TRs are for instance also known to interact with the transcription factor AP-1 (66) . Recent results indicate (67) that this nuclear receptor/AP-1 interaction may require different ligand-induced conformational changes than transcriptional activation. Whether TR/RXR, TR/RAR(32) , TR/VDR (30) , and TR/PPAR (31) heterodimeric complexes have similar ligand responsiveness still needs to be analyzed.


FOOTNOTES

*
These studies were supported in part by National Institutes of Health Grant DK 35083. The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Supported by Schweizerische Krebsliga and Ciba-Geigy Jubiläums-Stiftung.

To whom correspondence should be addressed: La Jolla Cancer Research Foundation, 10901 North Torrey Pines Rd., La Jolla, CA 92037. Tel.: 619-455-6480; Fax: 619-455-1048.

(^1)
The abbreviations used are: L-T4, 3,5,3`,5`-tetraiodo-L-thyronine; L-T3, 3,3`,5-triiodo-L-thyronine; TR, thyroid hormone receptor; TRE, thyroid hormone response element; T3, triiodothyronine; T4, thyroxine; RXR, retinoid X receptor; RAR, retinoic acid receptor; VDR, vitamin D receptor; PPAR, peroxisome proliferator activated receptor; D-T3, 3,3`,5-triiodo-D-thyronine; D-T4, 3,5,3`,5`-tetraiodo-D-thyronine; rT3, 3,3`,5`-triiodo-L-thyronine; TRIAC, 3,3`,5-triiodothyroacetic acid; ME, malic enzyme; DR, direct repeat; IP, inverted palindrome.

(^2)
F. J. Piedrafita, I. Bendik, M. A. Ortiz, and M. Pfahl, submitted for publication.


ACKNOWLEDGEMENTS

We thank Dr. G. Salbert and Dr. G. Graupner for helpful discussions and comments on the manuscript. Additionally, we thank Dr. B. L. Buckwalter, American Cyanamid Company, for providing us with T3 analogs, and Shelby Bates for help with preparation of the manuscript.


REFERENCES

  1. DeGroot, L. J., Larsen, P. R., Refetoff, S., and Stanbury, J. B. (1984) The Thyroid and Its Diseases , J. Wiley & Sons, New York
  2. Glass, C. K., and Holloway, J. M. (1990) Biochim. Biophys. Acta 1032, 157-176 [Medline] [Order article via Infotrieve]
  3. Chin, W. W. (1991) Nuclear thyroid hormone receptors. In Nuclear Hormone Receptors. Molecular Mechanisms, Cellular Functions, Clinical Abnormalities (Parker, M. G., ed) pp. 79-102, Academic Press, London
  4. Lazar, M. A. (1993) Endocr. Rev. 14, 184-193 [CrossRef][Medline] [Order article via Infotrieve]
  5. Piedrafita, F. J. and Pfahl, M. (1994) Inducible Gene Expression , Vol. 2 (Baeurle, P., ed) pp. 157-185, Birkh ä user, Boston
  6. Evans, R. M. (1988) Science 242, 889-895
  7. Green, S., and Chambon, P. (1988) Trends Genet. 4, 309-314 [CrossRef][Medline] [Order article via Infotrieve]
  8. Beato, M. (1989) Cell 56, 335-344 [CrossRef][Medline] [Order article via Infotrieve]
  9. Graupner, G., Wills, K. N., Tzukerman, M., Zhang, X.-k., and Pfahl, M. (1989) Nature 340, 653-656 [CrossRef][Medline] [Order article via Infotrieve]
  10. Glass, C. K., Holloway, J. M., Devary, O. V., and Rosenfeld, M. G. (1988) Cell 54, 313-323 [CrossRef][Medline] [Order article via Infotrieve]
  11. Desvergne, B., Petty, K. J., and Nikodem, V. M. (1991) J. Biol. Chem. 266, 1008-1013 [Abstract/Free Full Text]
  12. Näär, A. M., Boutin, J.-M., Lipkin, S. M., Yu, V. C., Holloway, J. M., Glass, C. K., and Rosenfeld, M. G. (1991) Cell 65, 1267-1279 [CrossRef][Medline] [Order article via Infotrieve]
  13. Umesono, K., Murakami, K. K., Thompson, C. C., and Evans, R. M. (1991) Cell 65, 1255-1266 [CrossRef][Medline] [Order article via Infotrieve]
  14. Baniahmad, A., Steiner, C., Köhne, A. C., and Renkawitz, R. (1990) Cell 61, 505-514 [CrossRef][Medline] [Order article via Infotrieve]
  15. Saatcioglu, F., Deng, T., and Karin, M. (1993) Cell 75, 1095-1105 [CrossRef][Medline] [Order article via Infotrieve]
  16. Burnside, J., Darling, S. D., and Chin, W. W. (1990) J. Biol. Chem. 265, 2500-2504 [Abstract/Free Full Text]
  17. Lazar, M. A., and Berrodin, T. J. (1990) Mol. Endocrinol. 4, 1627-1635 [Abstract]
  18. Murray, M. B., and Towle, H. C. (1989) Mol. Endocrinol. 3, 1434-1442 [Abstract]
  19. Rosen, E. D., O'Donnell, A. L., and Koenig, R. J. (1991) Mol. Cell. Endocrinol. 78, C83-C88 [CrossRef]
  20. Zhang, X., Tran, P., and Pfahl, M. (1991) Mol. Endocrinol. 5, 1909-1920 [Abstract]
  21. Kliewer, S. A., Umesono, K., Mangelsdorf, D. J., and Evans, R. M. (1992) Nature 355, 446-449 [CrossRef][Medline] [Order article via Infotrieve]
  22. Leid, M., Kastner, P., Lyons, R., Nakshatri, H., Saunders, M., Zacharewski, T., Chen, J.-Y., Staub, A., Garnier, J.-M., Mader, S., and Chambon P. (1992) Cell 68, 377-395 [CrossRef][Medline] [Order article via Infotrieve]
  23. Yu, V. C., Delsert, C., Andersen, B., Holloway, J. M., Devary, O. V., Näär, A. M., Kim, S. Y., Boutin, J. M., Glass, C. K., and Rosenfeld, M. G. (1991) Cell 67, 1251-1266 [CrossRef][Medline] [Order article via Infotrieve]
  24. Zhang, X.-k., Hoffmann, B., Tran, P., Graupner, G., and Pfahl, M. (1992) Nature 355, 441-446 [CrossRef][Medline] [Order article via Infotrieve]
  25. Bugge, T. H., Pohl, J., Lonnoy, O., and Stunnenberg, H. G. (1992) EMBO J. 11, 1409-1418 [Medline] [Order article via Infotrieve]
  26. Marks, M. S., Hallenbeck, P. L., Nagata, T., Segars, J. H., Appella, E., Nikodem, V. M., and Ozato, K. (1992) EMBO J. 11, 1419-1435 [Medline] [Order article via Infotrieve]
  27. Gearing, K. L., Gottlicher, M., Teboul, M., Widmark, E., and Gustafsson, J. A. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 1440-1444 [Abstract/Free Full Text]
  28. Keller, H., Dreyer, C., Medin, J., Mahfoudi, A., Ozato, K., and Wahli, W. (1993) Proc. Natl. Acad. Sci. U. S. A. 90, 2160-2164 [Abstract/Free Full Text]
  29. Kliewer, S. A., Umesono, K., Noonan, D. J., Heyman, R. A., and Evans, R. M. (1992) Nature 358, 771-774 [CrossRef][Medline] [Order article via Infotrieve]
  30. Schräder, M., Müller, K. M., and Carlberg, C. (1994) J. Biol. Chem. 269, 5501-5504 [Abstract/Free Full Text]
  31. Bogazzi, F., Hudson, L. D., and Nikodem, V. M. (1994) J. Biol. Chem. 269, 11683-11686 [Abstract/Free Full Text]
  32. Glass, C. K., Lipkin, S. M., Devary, O. V., and Rosenfeld, M. G. (1989) Cell 59, 697-708 [CrossRef][Medline] [Order article via Infotrieve]
  33. Forman, B. M., Casanova, J., Raaka, B. M., Ghysdael, J., and Samuels, H. H. (1992) Mol. Endocrinol. 6, 429-442 [Abstract]
  34. Carlberg, C. (1993) Biochem. Biophys. Res. Commun. 195, 1345-1353 [CrossRef][Medline] [Order article via Infotrieve]
  35. Katz, R. W., and Koenig, R. J. (1993) J. Biol. Chem. 268, 19392-19397 [Abstract/Free Full Text]
  36. Schräder, M., Becker-André, M., and Carlberg, C. (1994) J. Biol. Chem. 269, 6444-6449 [Abstract/Free Full Text]
  37. Hermann, T., Hoffmann, B., Zhang, X.-k., Tran, P., and Pfahl, M. (1992) Mol. Endocrinol. 6, 1153-1162 [Abstract]
  38. Yen, P. M., Darling, D. S., Carter, R. L., Forgione, M., Umeda, P. K., and Chin, W. W. (1992) J. Biol. Chem. 267, 3565-3568 [Abstract/Free Full Text]
  39. Luckow, B., and Schütz, G. (1987) Nucleic Acids Res. 15, 5490 [Free Full Text]
  40. Zhang, X.-k., Wills, K. N., Hermann, T., Graupner, G., Tzukerman, M., and Pfahl, M. (1991) New Biol. 3, 169-181 [Medline] [Order article via Infotrieve]
  41. Pfahl, M., Tzukerman, M., Zhang, X.-k., Lehmann, J. M., Hermann, T., Wills, K. N., and Graupner, G. (1990) Methods Enzymol. 189, 256-270 [Medline] [Order article via Infotrieve]
  42. Husmann, M., Lehmann, J., Hoffmann, B., Hermann, T., Tzukerman, M., and Pfahl, M. (1991) Mol. Cell. Biol. 11, 4097-4103 [Abstract/Free Full Text]
  43. Benbrook, D., and Pfahl, M. (1987) Science 238, 788-791 [Abstract/Free Full Text]
  44. Pfahl, M. (1994) Semin. in Cell Biol. 5, 95-103 [CrossRef][Medline] [Order article via Infotrieve]
  45. Petty, K. J., Desvergne, B., Mitsuhashi, T., and Nikodem, V. M. (1990) J. Biol. Chem. 265, 7395-7400 [Abstract/Free Full Text]
  46. Flink, I. L., and Morkin, E. (1990) J. Biol. Chem. 265, 11233-11237 [Abstract/Free Full Text]
  47. Mahdavi, V., Chambers, A. P., and Nadal-Ginard, B. (1984) Proc. Natl. Acad. Sci. U. S. A. 81, 2626-2630 [Abstract/Free Full Text]
  48. Sap, J., Munoz, A., Schmitt, J., Stunnenberg, H., and Vennström, B. (1989) Nature 340, 242-244 [CrossRef][Medline] [Order article via Infotrieve]
  49. Downes, M., Griggs, R., Atkins, A., Olson, E. N., and Muscat, G. E. O. (1993) Cell Growth & Differ. 4, 901-909
  50. Muscat, G. E. O., Griggs, R., Downes, M., and Emery, J. (1993) Cell Growth & Differ. 4, 269-279
  51. Hartong, R., Wang, N., Kurokawa, R., Lazar, M. A., Glass, C. K., Apriletti, J. W., and Dillmann, W. H. (1994) J. Biol. Chem. 269, 13021-13029 [Abstract/Free Full Text]
  52. Muscat, G. E. O., Mynett-Johnson, L., Dowhan, D., Downes, M., and Griggs, R. (1994) Nucleic Acids Res. 22, 583-591 [Abstract/Free Full Text]
  53. Glass, C. K. (1994) Endocr. Rev. 15, 391-407 [CrossRef][Medline] [Order article via Infotrieve]
  54. Dietrich, S. W., Bolger, M. B., Kollman, P. A., and Jorgensen, E. C. (1977) J. Med. Chem. 20, 863-880 [CrossRef][Medline] [Order article via Infotrieve]
  55. Leeson, P. D., Ellis, D., Emmett, J. C., Shah, V. P., Showell, G. A., and Underwood, A. H. (1987) J. Med. Chem. 31, 37-54
  56. Andrea, T. A., Dietrich, S. W., Murray, W. J., Kollman, P. A., Jorgensen, E. C., and Rothenberg, S. (1979) J. Med. Chem. 22, 221-232 [CrossRef][Medline] [Order article via Infotrieve]
  57. Graupner, G., Malle, G., Maignan, J., Lang, G., Pruniéras, M., and Pfahl, M. (1991) Biochem. Biophys. Res. Commun. 179, 1554-1561 [CrossRef][Medline] [Order article via Infotrieve]
  58. Apfel, C., Bauer, F., Crettaz, M., Forni, L., Kamber, M., Kaufmann, F., LeMotte, P., Pirson, W., and Klaus, M. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 7129-7133 [Abstract/Free Full Text]
  59. Lehmann, J. M., Jong, L., Fanjul, A. N., Cameron, J. F., Lu, X.-P., Haefner, P., Dawson, M. I., and Pfahl, M. (1992) Science 258, 1944-1946 [Abstract/Free Full Text]
  60. Lee, M-O., Hobbs, P. D., Zhang, X.-k., Dawson, M. I., and Pfahl, M. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 5632-5636 [Abstract/Free Full Text]
  61. Andersson, M. L., Nordström, K., Demczuk, S., Harbers, M., and Vennström, B. (1992) Nucleic Acids Res. 20, 4803-4810 [Abstract/Free Full Text]
  62. Ribeiro, R. C. J., Kushner, P. J., Apriletti, J. W., West, B. L., and Baxter, J. D. (1992) Mol. Endocrinol. 6, 1142-1152 [Abstract]
  63. Toney, J. H., Wu, L., Summerfield, A. E., Sanyal, G., Forman, B. M., Zhu, J., and Samuels, H. H. (1993) Biochemistry 32, 2-6 [CrossRef][Medline] [Order article via Infotrieve]
  64. Bhat, M. K., Parkison, C., McPhie, P., Liang, C.-M., and Cheng, S.-y. (1993) Conformational changes of human beta1 thyroid hormone receptor induced by binding of 3, 3`,5-triiodo-L-thyronine. Biochem. Biophys. Res. Commun. 195, 385-392
  65. Leng, X., Tsai, S. Y., O'Malley, B. W. and Tsai, M.-J. (1993) J. Steroid Biochem. Mol. Biol. 46, 643-661 [CrossRef][Medline] [Order article via Infotrieve]
  66. Zhang, X.-k., Wills, K. N., Husmann, M., Hermann, T., and Pfahl, M. (1991) Mol. Cell. Biol. 11, 6016-6025 [Abstract/Free Full Text]
  67. Fanjul, A., Dawson, M. I., Hobbs, P. D., Jong, L., Cameron, J. F., Harlev, E., Graupner, G., Lu, X.-P., and Pfahl, M. (1994) Nature 372, 107-111 [CrossRef][Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
J. Biol. Chem.Home page
M. Ikeda, E. C. Wilcox, and W. W. Chin
Different DNA Elements Can Modulate the Conformation of Thyroid Hormone Receptor Heterodimer and Its Transcriptional Activity
J. Biol. Chem., September 20, 1996; 271(38): 23096 - 23104.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
M.-O. Lee, M. I. Dawson, N. Picard, P. D. Hobbs, and M. Pfahl
A Novel Class of Retinoid Antagonists and Their Mechanism of Action
J. Biol. Chem., May 17, 1996; 271(20): 11897 - 11903.
[Abstract] [Full Text] [PDF]


Home page
J. Biol. Chem.Home page
P. M. Yen, Y. Liu, A. Sugawara, and W. W. Chin
Vitamin D Receptors Repress Basal Transcription and Exert Dominant Negative Activity on Triiodothyronine-mediated Transcriptional Activity
J. Biol. Chem., May 3, 1996; 271(18): 10910 - 10916.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Bendik, I.
Right arrow Articles by Pfahl, M.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Bendik, I.
Right arrow Articles by Pfahl, M.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.