![]()
|
|
||||||||
Binding to the Downstream 3` Splice Site (*)
(Received for publication, October 6, 1994; and in revised form, December 1, 1994)
From the
In the gene of the neural cell adhesion molecule, the 5` splice
site of the alternate exon 18 plays an important role in establishing
regulated splicing profiles. To understand how the 5` splice site of
exon 18 contributes to splicing regulation, we have investigated the
interaction of the U2AF
splicing factor to pre-mRNAs that
contained portions of the constitutive exon 17 or the alternate exon 18
fused to exon 19 and separated by a shortened intron. Despite sharing
an identical 3` splice site, only the pre-mRNA that contained a portion
of exon 17 and its associated 5` splice site displayed efficient
U2AF
cross-linking. Strikingly, a G
U mutation at
position +6 of the intron, converting the 5` splice site of exon
18 into that of exon 17, stimulated U2AF
cross-linking.
The improved cross-linking efficiency of U2AF
to a
pre-mRNA carrying the 5` splice site of exon 17 required the integrity
of the 5` end of U1 but not of U2 small nuclear RNA. Our results
indicate that neural cell adhesion molecule 5` splice site sequences
influence U2AF
binding through a U1 small nuclear
ribonucleoprotein/U2AF interaction that occurs at the commitment stage
of spliceosome assembly, before stable binding of the U2 small nuclear
ribonucleoprotein. Thus, the 5` splice sites of exons 17 and 18
differentially affect U2AF
binding to the 3` splice site
of exon 19. Factors that modulate U1 small nuclear ribonucleoprotein
binding to these 5` splice sites may play a critical role in regulating
exon 18 skipping.
The first step of splicing of nuclear pre-mRNAs occurs through
cleavage at the 5` splice site with concomitant joining of the intron
5` end to the 2` hydroxyl of a residue in the branch site region of the
intron. The second step of splicing promotes the excision of the lariat
intron and the ligation of the exons. In mammals, mutations at the
invariant G1 and U2 positions of the intron allow branch formation,
sometimes at a reduced rate, and often prevent the second step of
splicing leading to the accumulation of lariat
intermediate(1) . Mutations at other positions of the 5` splice
site reduce splicing efficiency and frequently promote the utilization
of cryptic 5` splice sites(1) . Pre-mRNA splicing takes place
in the spliceosome, a large multicomponent complex that is sequentially
assembled on the pre-mRNA and that contains small nuclear
ribonucleoproteins
(snRNPs)(
)(1, 2, 3) . The 5`
splice site region is initially recognized by the U1 snRNP(4) .
The branch site region is recognized by the U2 snRNP (5) and
requires prior binding of the non-snRNP splicing factor U2AF
to the downstream polypyrimidine tract-AG at the 3` splice
junction(6, 7) . Other factors that have been shown to
associate with 3` splice site sequences include the intron-binding
protein associated with U5 snRNP (8) and hnRNP proteins A1,
C1/C2, D, and I/PTB(9, 10) .
In mammals, early
pre-spliceosome complexes formed in the absence of ATP contain several
factors including U2AF and U1
snRNP(11, 12, 13) . The U2 snRNP has also
been detected in related complexes(14) . Because the formation
of ATP-independent splicing complexes is more efficient when both 5`
and 3` splice sites are present(13, 14) , it was
suggested that the 5` splice site is important in fixing the use of a
3` splice site by mediating an interaction between U1 snRNP and
U2AF(13) . An interaction between U1 snRNP and U2AF has
recently received support from the demonstration that members of the
serine-arginine-rich family of splicing factors (e.g. SF2/ASF
and SC35) can interact both with U2AF
(15) and
with the U1 snRNP-70 kDa protein (15, 16) . A network
of interactions involving U1 snRNP-70
kDa/(SC35/SF2)/U2AF
/U2AF
may therefore be
critical to commit the use of a pair of 5` and 3` splice sites. On the
other hand, 5` splice site sequences downstream from a weak 3` splice
site have been shown to facilitate U2AF
binding in a
process that requires the participation of other
factor(s)(17) . Thus, a similar network of interactions
involving U1 snRNP and U2AF is possibly assembled across the exon to
stimulate the use of a weak 3` splice site.
The pre-mRNA encoding
the larger neural cell adhesion molecules (NCAM) is alternatively
spliced to yield two mRNAs differing by the incorporation of a
801-nucleotide exon (exon 18)(18) . The 5` splice site of exon
18 is a crucial element in the regulation of exon 18 skipping since its
replacement with an
-globin 5` splice site abolishes
regulation(19) . Moreover, the use of the 5` splice site of
exon 18 is up-regulated in differentiating cells, even when placed in
the context of an
-globin pre-mRNA(19) . To gain a better
understanding of the molecular mechanisms involved in exon 18 skipping,
we have investigated RNA-protein interactions on pre-mRNA substrates
carrying various 5` splice sites. We find that the 5` splice site of
exon 18 does not favor efficient U2AF
binding to the 3`
splice site of exon 19. In contrast, a single mutation that converts
the 5` splice site of exon 18 into that of exon 17 improves the
interaction of U2AF
with the 3` splice site, in a process
that requires the U1 but not the U2 snRNP.
P]UTP(22) . Full-length
transcripts were gel-purified before use. Oligonucleotide-directed
RNase H cleavage was accomplished as described in Chabot (22) for RNA substrates and as described by Black et al.(4) for snRNA targeting. To generate D3` and E3` RNAs, we
used oligonucleotides complementary to the 5` splice site regions (Ne9,
ATCCCTCCTACTCCACGTAC; Ne10, TGGACAAAGAGAGGCCGTAC) Oligonucleotides
complementary to nucleotides 1-12 and 1-14 of U1 and U2
snRNAs, respectively, were used to target snRNP inactivation. Nuclear
extracts and S-100 were prepared according to Dignam et
al.(23) . Extracts were depleted of endogenous ATP by
incubation at 30 °C for 30 min(11) .
Binding to the 3` Splice
Site of Exon 19
P-Labeled RNA substrates synthesized
with bromodeoxyuridine were tested in a UV cross-linking assay in HeLa
extracts. Under standard splicing conditions, the UV cross-linking
assay revealed that E and D RNAs cross-linked to a protein with an
apparent molecular mass of 65 kDa (Fig. 2A, lanes 1 and 2). Interestingly, this protein cross-linked
considerably more efficiently to D RNA. The same difference in the
efficiency of cross-linking was observed in extracts incubated at 0
°C (Fig. 2A, lanes 3 and 4), in
extracts that had been depleted of endogenous ATP by preincubation at
30 °C (Fig. 2A, lanes 5 and 6),
as well as in a HeLa S-100 extract (Fig. 2B, lanes
2 and 3). Notably, the length of the incubation period at
30 °C affected the magnitude of the difference in the intensity of
the 65-kDa protein cross-linked to E and D RNAs; the difference was
clearly visible in a HeLa nuclear extract (H191) following a 4-min
incubation at 30 °C (Fig. 2A, lanes 1 and 2), but was considerably reduced or lost after 10 min of
incubation (Fig. 2B, lanes 4 and 5,
and C, lanes 7 and 8). The length of the
incubation period at 30 °C that yielded a maximal difference in the
intensity of the 65-kDa band varied between different nuclear extract
preparations (data not shown). A difference in the intensity of the
65-kDa band between D and E RNAs after 10 min of incubation could be
obtained when the mixture was adjusted to 2.5 mM Na
Figure 1: Structure of the RNA substrates. Large boxes indicate exons. Thin boxes and lines indicate intron sequences downstream of exon 18 and exon 19, respectively. The black area in NCAM introns indicates the presence of a plasmid-derived polylinker region. The adenovirus L1-L2 A RNA is depicted in black, exons being represented by boxes. The length (in nucleotides) of each exon and of intron regions is indicated. The mutations introduced at the 5` splice site of exon 18 to generate M and W RNAs are underlined. Note that in W RNA, an AG dinucleotide located 10 and 11 nucleotides upstream of the 5` splice junction was artifactually converted to CC.
Figure 2:
UV
cross-linking to E and D RNAs in various extracts. A,
cross-linking assays in splicing mixtures containing a HeLa extract
(H191) were performed with E and D RNAs following an incubation of 4
min at 30 °C (lanes 1 and 2), an incubation at 0
°C (lanes 3 and 4), an incubation of 4 min at 30
°C in an ATP-depleted extract (lanes 5 and 6) and
in an ATP-depleted extract supplemented with exogenous ATP, creatine
phosphate and MgCl
(lanes 7 and 8). The
position of molecular weight markers is indicated. B,
cross-linking assays were performed following an incubation of 10 min
with D and E RNAs in a HeLa S-100 and nuclear extract (H191). A
purified U2AF fraction was also incubated with D RNA prior to
cross-linking (lane 1). The position of U2AF
and
molecular weight markers is indicated. A band that may correspond to
U2AF
is detected in the purified U2AF fraction (lane
1). C, cross-linking assays using D, E, and A RNAs were
carried out following a 10-min incubation at 30 °C in the H191
extract (lanes 1, 6-8) and in the same extract adjusted
to 2.5 mM EDTA (lanes 3-5). A HeLa extract
depleted of U2AF by chromatography on poly(U)-Sepharose was used in lane 2. The position of U2AF
and molecular weight
markers is indicated.
Several results suggested that
the 65-kDa protein corresponds to U2AF
, a splicing factor
that recognizes the polypyrimidine tract-AG of 3` splice site
sequences(6, 17, 25) . First, the 65-kDa band
apparently co-migrated with the cross-linking product obtained with a
highly purified U2AF fraction (Fig. 2B, lane
1). Second, the 65 kDa-cross-linking product was not detected in a
extract depleted of U2AF by poly(U)-Sepharose chromatography (Fig. 2C, lane 2). Third, to address the
possibility that this protein might be the 62-kDa hnRNP I/PTB protein,
which shares with U2AF
the ability to bind to 3` splice
site sequences(10, 27) , we performed a Western blot
analysis using anti-U2AF
and anti-PTB antibodies (kindly
provided by M. R. Green (Worcester) and M. Garcia-Blanco (Duke),
respectively). The migration of the 65-kDa cross-linked product (Fig. 3, lane 4) precisely coincided with the position
of U2AF
detected using the anti-U2AF antibody (lanes 1 and 2). In contrast the anti-PTB antibody revealed a
doublet band migrating significantly faster than the 65-kDa band (Fig. 3, lane 5). This analysis rules out PTB as the
65-kDa protein displaying differential cross-linking. Finally, two U2
snRNP-associated spliceosomal proteins of molecular mass similar to
U2AF
have been reported to cross-link to pre-mRNA (SAP 61
and SAP 62; (30) ). It is unlikely that SAP 61 and/or SAP 62
correspond to the 65-kDa protein that we detect since, in contrast to
the 65-kDa protein, these proteins do not associate with pre-mRNA in
extracts depleted of ATP(30) . Moreover, the difference in
cross-linking of the 65-kDa protein to D and E RNAs continued to be
detected in extracts in which the U2 snRNP was inactivated (see below).
Figure 3:
The 65-kDa band corresponds to
U2AF
. Purified U2AF and nuclear extracts were either
loaded directly on a 10% SDS-polyacrylamide gel (lanes 1, 2, and 5, as indicated) or subjected to a
cross-linking assay with labeled D RNA before loading (lanes 3 and 4). Proteins were transferred onto a nitrocellulose
filter, and Western analyses were performed with
I-protein A and anti-U2AF
(anti-pepD(25) ; lanes 1 and 2) or
anti-PTB antibody (lane 5).
To address whether the U2AF
cross-linking signal
resulted from binding to the 3` splice site of exon 19, we used a
shortened D transcript terminating a few nucleotides before the branch
site region (D5` RNA; Fig. 1). The decreased efficiency of
U2AF
cross-linking to D5` RNA (Fig. 4A, lane 3) suggests that the bulk of the U2AF
cross-linking signal originated from binding to the 3` splice
site region of exon 19. In contrast, the efficiency of U2AF
cross-linking to a shortened E transcript (E5` RNA; Fig. 1) remained similar to that of E RNA (Fig. 4A, lane 4), indicating that U2AF
cross-linked poorly to the 3` splice site of E RNA but that it
cross-linked with limited efficiency to other regions of the RNA. Thus,
U2AF
binds less efficiently to the 3` splice site of exon
19 when it is paired with the 5` splice site of exon 18. Alternatively,
it is possible that U2AF
binds to the 3` splice site of E
RNA but in a configuration that is less reactive to UV cross-linking.
To address this question, we performed a cross-linking assay in the
presence of E RNA as unlabeled competitor (Fig. 4B). If
U2AF
binds equally well to D and E RNAs, then gradual
increases in the concentration of competitor RNA should cause an
equivalent reduction in the intensity of U2AF cross-linked to D and E
RNAs. Consequently, the amplitude of the difference in U2AF
cross-linking should remain the same at all concentrations of
competitor. The competition assay indicates that increasingly higher
concentrations of competitor RNA promoted a more rapid decrease in the
intensity of U2AF cross-linking to E than to D RNA; the difference in
the intensity of U2AF band between D and E RNAs changed from 2-fold in
the absence of competitor (Fig. 4B, compare lanes 2 and 6) to 5-fold in the presence of 10-fold excess of
competitor (compare lanes 4 and 8), and to more than
10-fold when the competitor was present in 25-fold excess (compare lanes 5 and 9). While a 25-fold molar excess of
competitor promoted a 7-fold decrease in U2AF
cross-linking to E RNA (Fig. 4B, lane
5), a 100-fold excess of competitor only induced a 4-fold
reduction in U2AF
cross-linking to D RNA (Fig. 4B, lane 11). These results are
incompatible with the notion that U2AF binds equally well to both RNAs.
Thus, our results indicate that the difference in the intensity of U2AF
cross-linked to D and E RNAs represents a difference in binding.
Figure 4:
U2AF
binding to the 3` splice
site of exon 19. A, a cross-linking assay was performed with D
and E RNAs as well as with derivatives lacking the 3` splice site and
exon 19 (E5` and D5` RNAs; see Fig. 1). B, a
cross-linking assay was performed using increasing levels of competitor
RNA (E RNA, labeled at 1:200 of the specific activity of the
cross-linking substrates). Splicing mixtures were pre-incubated with
the indicated amounts of competitor RNA for 10 min at 30 °C before
addition of the cross-linking substrates (E RNA, lanes
2-5; D RNA, lanes 6-11) and incubation at 30
°C for 8 min. Lane1 corresponds to a
cross-linking assay carried out with a purified U2AF fraction and E
RNA.
Binding
with the 3` splice site of exon 19. This conclusion was confirmed
by using D and E RNAs that lacked the first exon and 5` splice site
sequences (D3` and E3` RNAs; Fig. 1). In comparison to D RNA,
the level of U2AF
cross-linking to D3` RNA was reduced and
was nearly equivalent to the level obtained with E RNA (Fig. 5A, lanes 1-3). In addition and as
expected, the efficiency of U2AF
cross-linking to E RNA
was not superior to the level obtained with E3` RNA (Fig. 5A, lane 4). The 3` splice site of exon
19 is therefore a poor binding substrate for U2AF
and
remains so when paired with a region that contains the 5` splice site
of exon 18.
Figure 5:
5`
splice site sequences affect U2AF
cross-linking. A, RNAs lacking the first exon and 5` splice site sequences of
D and E RNAs (E3` and D3` RNAs, see Fig. 1) were incubated for
10 min at 30 °C in HeLa extracts prior to UV cross-linking. B, cross-linking assays were performed following a 10-min
incubation at 30 °C in a HeLa extract (H158) with D, E, M, and W
RNAs (see Fig. 1). The adenovirus major late L1-L2 substrate (A
RNA) was also used (lanes 1 and 2). A HeLa extract
depleted of U2AF by chromatography on poly(U)-Sepharose was used in lane 2. The position of U2AF
and molecular weight
markers is indicated. C, a time-course cross-linking assay was
performed with E and M RNAs incubated in a HeLa extract (H191) for the
indicated time (in min). Lane 1 corresponds to a cross-linking
assay carried out with a purified U2AF fraction and D
RNA.
The direct contribution of the upstream 5` splice site
sequences to U2AF
binding was demonstrated by using
pre-mRNAs carrying 5` splice site mutations. We specifically mutated
the 5` splice site of exon 18 at position +6 from G to U,
converting it into the donor site of exon 17, which displays a better
match to the consensus sequence (M RNA; Fig. 1). The 5` splice
site of exon 18 was also converted into the adenovirus major late L1 5`
splice site (W RNA; Fig. 1). Compared to E RNA, the efficiency
of U2AF
cross-linking to M and W RNAs was improved
significantly (Fig. 5B, lanes 4-6). A
time-course cross-linking assay revealed that U2AF
was the
protein that cross-linked to M RNA most efficiently at all times (Fig. 5C, lanes 3, 5, 7, 9, 11, and 13). In contrast, U2AF
cross-linking to E RNA was clearly less efficient at early times
but became nearly equivalent to the intensity obtained with M RNA after
6 min of incubation in this extract (Fig. 5C, lanes
2, 4, 6, 8, 10, and 12). These results suggest that U2AF
can bind
with some efficiency to E RNA but that U2AF
binding to M
RNA occurs more rapidly and is more efficient.
Notably, the level of
U2AF
cross-linking to M and W RNAs remained inferior to
that of D RNA (Fig. 5B, lanes 3-6)
suggesting that the sequence surrounding the 5` splice site of exon 17
also contributed to the interaction of U2AF
with 3` splice
site sequences. Nevertheless, a single base change in the 5` splice
site of exon 18 was sufficient to alter the interaction of U2AF
with the 3` splice site of exon 19. Our results are also
consistent with the possibility that U2AF
cross-linked
directly to the 5` splice site of D RNA. However, we consider this
possibility unlikely since a U at position +6 would base pair more
efficiently with the 5` end of U1 RNA thereby reducing the probability
that this nucleotide interacts with other splicing factors at that
stage of the splicing reaction.
Binding
with D
and E RNAs. Oligonucleotide-targeted RNase H degradation of U2 snRNA in
a HeLa nuclear extract, while quantitatively destroying the 5` terminus
of U2 snRNA and completely blocking splicing (data not shown and Fig. 6B, lane 4, respectively), did not
abolish the difference in the efficiency of U2AF
cross-linking to D and E RNAs (Fig. 6A, lanes
3-6). Likewise, no change in the efficiency of cross-linking
was noted when the assay was performed in a HeLa S-100 extract (data
not shown). As destroying the 5` end of U2 snRNA prevents the
interaction of U2 snRNP with the branch site(5) , our result
indicates that stable U2 snRNP binding is not required to generate the
distinct U2AF
cross-linking profiles characteristic of D
and E RNAs. Thus, the events responsible for the difference in
U2AF
cross-linking are established early, most likely
before U2 snRNP stably binds to branch site sequences.
Figure 6:
Efficient U2AF
cross-linking
is mediated by the U1 snRNP. A, a cross-linking assay was
performed following incubation of D and E RNAs with a purified U2AF
fraction prepared from HeLa cells (lanes 1 and 2).
Cross-linking assays were also carried out with extracts in which the
5` end of U2 snRNA (lanes 5 and 6) or the 5` end of
U1 snRNA (lanes 10 and 12) was removed by
oligonucleotide-targeted RNase H digestion. As controls, a mock-treated
extract was used (lanes 3, 4, 9, and 11) and a
cross-linking assay was performed with A RNA in normal and
U2AF-depleted extract (lanes 7 and 8, respectively).
The position of molecular weight markers is indicated. B,
mock- and oligonucleotide/RNase H-treated extracts were tested for
splicing activity by incubation (2 h) with labeled A RNA. Spliced RNAs
were separated in a 10% polyacrylamide, 7 M urea gel. The
positions of precursor RNA (P), lariat intermediate (L), and intron (I) are
indicated.
The influence
of 5` splice site sequences on the interaction of U2AF
suggested that U1 snRNP may play a role in modulating U2AF
binding. We tested this possibility by performing a cross-linking
assay in extracts in which the 5` end of U1 snRNA was removed by
oligonucleotide-targeted RNase H digestion. When U1 snRNP was
inactivated, as judged by snRNA analysis on gels and splicing assays
(data not shown and Fig. 6B, lane 2,
respectively), the cross-linking efficiency of U2AF
to D
RNA was reduced considerably, whereas U2AF
cross-linking
to E RNA was not affected (Fig. 6A, lanes
9-12). Notably, the U2AF
cross-linking signal
to D RNA in the U1 snRNP-depleted extract remained superior to the
signal obtained with E RNA in mock-treated extracts (Fig. 6A, lanes 10 and 11). This
result could be explained if residual amounts of intact U1 snRNPs in
the treated extract were still able to stimulate U2AF
cross-linking. Nonetheless, as the 5` end of U1 snRNA is
essential for U1 snRNP binding to 5` splice site
sequences(31) , our results indicate that a U1 snRNP/5` splice
site interaction is required for efficient U2AF
cross-linking to D RNA.
We have shown that U2AF
does not bind
efficiently to the 3` splice site of NCAM exon 19 in the absence of an
upstream 5` splice site. U2AF
has been documented to bind
to highly active 3` splice sites containing a consensus polypyrimidine
tract(7) . In contrast, U2AF
binds poorly to the
weak 3` splice site of exon 4 of preprotachykinin (17) which is
interrupted by purines (UUCAUCUCUUGUCAG) as is the 3` splice site of
NCAM exon 19 (UGUUUCUGUUUCUCUGCAG). Interestingly, we have shown that
the identity of the upstream 5` splice site can influence the
interaction of U2AF
with the NCAM pre-mRNAs. Whereas
coupling the 3` splice site of exon 19 with the 5` splice site of exon
18 (E RNA) resulted in inefficient U2AF
binding, a single
mutation at position +6 of the intron of E RNA, converting the 5`
splice site of exon 18 (CGA/GUACGG) into the 5` splice site of exon 17
(CGA/GUACGU), stimulated U2AF
binding to the 3` splice
site of exon 19. A similar effect was obtained when the 5` splice site
of exon 18 was converted into the adenovirus L1 5` splice site
(GGG/GUGAGU). The improved interaction of U2AF
with a
substrate carrying the 5` splice site of exon 17 required U1 snRNP
binding to the 5` splice site as the 5` end of U1 snRNA was required
for efficient U2AF
binding. Thus, the 5` splice site of
exon 17, by displaying a better match to the consensus than the 5`
splice site of exon 18, may promote more efficient U1 snRNP binding,
which in turn facilitates or stabilizes U2AF
binding
through a direct or indirect interaction between U1 snRNP and
U2AF
. Alternatively, the U2AF/U1 snRNP interaction may
incite base pairing between intron sequences flanking the 5` splice
site and sequences adjacent to the U2AF binding site. The G at position
+6 of the 5` splice site of exon 18, by not being base paired with
the 5` end of U1 snRNA, may strengthen this interaction leading to the
destabilization of U2AF
binding.
An indirect
communication between U1 snRNP and U2AF
was recently
uncovered in the case of the preprotachykinin pre-mRNA(17) .
However, in this case, U1 snRNP binds to a downstream 5` splice site
which targets U2AF
binding to the weak E4 3` splice site
through exon-bridging interactions. Improving the match to the
consensus of the upstream 5` splice site did not result in increased
utilization of the preprotachykinin E4 3` splice site(32) . In
contrast, our results have shown that improving the upstream 5` splice
site can promote more efficient U2AF
binding to the NCAM
E19 3` splice site. We have not yet investigated whether this
observation can be generalized to other pre-mRNA substrates. Recently,
the 70-kDa protein of U1 snRNP was shown to interact with splicing
factors SF2/ASF and SC35(15, 16) . Moreover, SF2/ASF
and SC35 can interact simultaneously with
U2AF
(15) , a protein which readily associates with
U2AF
in splicing extracts(7, 25) . Thus,
the proposed U1 snRNP/U2AF interaction may be mediated through a U1
snRNP-70 kDa/(SF2/ASF:SC35)/U2AF
/U2AF
bridge
that may help define intron boundaries. The same network of interaction
may also be initiated at a downstream 5` splice site and be assembled
over exon sequences to help recognition of a weak 3` splice site.
Several results suggest that the communication between U1 snRNP and
U2AF
on NCAM substrates occurs at an early step of
spliceosome assembly, most likely at the level of commitment complex
formation (complex E). First, the difference in the efficiency of
U2AF
cross-linking was observed in a S-100 extract, which
does not form complexes that correspond to advanced stages of
spliceosome assembly (A and B complexes; (33) and data not
shown). Second, destroying U2 snRNP by oligonucleotide-directed RNase H
digestion did not significantly affect the U2AF
cross-linking profiles, indicating that the U1 snRNP/U2AF
interaction occurs before U2 snRNP stably binds to the pre-mRNA
to form complex A. Third, the difference in the U2AF
cross-linking profiles was observed in ATP-depleted extracts,
which form E but not A complexes(11) . Previous studies have
indicated that the presence of a 5` splice site increases the
efficiency of ATP-independent complex
formation(13, 14) . Our findings are consistent with
these observations and further demonstrate that the identity of 5`
splice site sequences can modulate, via U1 snRNP, the interaction of
U2AF
with 3` splice site sequences at the commitment stage
of spliceosome assembly.
Despite substantial differences in
U2AF
binding, D, E and M RNAs were spliced with similar
efficiencies in vitro (data not shown). While differences in
the affinity of splice sites for splicing factors are not necessarily
reflected in the rate of splicing of simple pre-mRNAs, dramatic effects
can be observed when splice sites are in competition(34) .
Accordingly, a significant change in the in vitro splicing
profile of a pre-mRNA carrying both exon 17 and exon 18 5` splice sites
was observed when the 5` splice site of exon 18 was converted into that
of exon 17. (
)Tacke and Goridis (19) have
shown that the 5` splice site of exon 18 plays a critical role in
establishing regulated patterns of splice site selection in
vivo. Thus, the molecular basis for exon 18 alternative splicing
may hinge on the efficiency with which the 3` splice site of exon 19
becomes associated with either the 5` splice site of exon 17 or the 5`
splice site of exon 18 via a U1 snRNP/U2AF
interaction.
The higher frequency of utilization of the 5` splice site of exon 18 in
differentiated neuronal cells could be regulated by factors that
increase the affinity of U1 snRNP binding to the 5` splice site of exon
18 or, alternatively, by factors that decrease U1 snRNP binding to the
5` splice site of exon 17. The recent demonstration that the splicing
factor ASF/SF2 can recognize 5` splice site sequences and favor U1
snRNP binding (16, 35, 36) raises the
possibility that differences in the expression and/or activity of
ASF/SF2 or other serine-arginine-rich protein members play a crucial
role in modulating U1 snRNP binding to these sites. Alternatively,
differences in the complement of proteins associated with snRNPs in
neuronal cells (e.g. B` replaced by N; (37) ) may
change the specificity of 5` splice site recognition. Our future
studies will examine these possibilities.
This article has been cited by other articles:
![]() |
V. Sridharan and R. Singh A Conditional Role of U2AF in Splicing of Introns with Unconventional Polypyrimidine Tracts Mol. Cell. Biol., October 15, 2007; 27(20): 7334 - 7344. [Abstract] [Full Text] [PDF] |
||||
![]() |
O. A. Kent, D. B. Ritchie, and A. M. MacMillan Characterization of a U2AF-Independent Commitment Complex (E') in the Mammalian Spliceosome Assembly Pathway Mol. Cell. Biol., January 1, 2005; 25(1): 233 - 240. [Abstract] [Full Text] [PDF] |
||||
![]() |
M. J. Simard and B. Chabot SRp30c Is a Repressor of 3' Splice Site Utilization Mol. Cell. Biol., June 15, 2002; 22(12): 4001 - 4010. [Abstract] [Full Text] [PDF] |
||||
![]() |
W. G. Fairbrother and L. A. Chasin Human Genomic Sequences That Inhibit Splicing Mol. Cell. Biol., September 15, 2000; 20(18): 6816 - 6825. [Abstract] [Full Text] |
||||
![]() |
I. Sammarco, P. Grimaldi, P. Rossi, M. Cappa, C. Moretti, G. Frajese, and R. Geremia Novel Point Mutation in the Splice Donor Site of Exon-Intron Junction 6 of the Androgen Receptor Gene in a Patient with Partial Androgen Insensitivity Syndrome J. Clin. Endocrinol. Metab., September 1, 2000; 85(9): 3256 - 3261. [Abstract] [Full Text] |
||||
![]() |
Y. Li and B. J. Blencowe Distinct Factor Requirements for Exonic Splicing Enhancer Function and Binding of U2AF to the Polypyrimidine Tract J. Biol. Chem., December 3, 1999; 274(49): 35074 - 35079. [Abstract] [Full Text] [PDF] |
||||
| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
| HOME | HELP | FEEDBACK | SUBSCRIPTIONS | ARCHIVE | SEARCH | TABLE OF CONTENTS |
| All ASBMB Journals | Molecular and Cellular Proteomics |
| Journal of Lipid Research | ASBMB Today |