JBC Avanti Polar Lipids

HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 QUICK SEARCH:   [advanced]


     


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Côté, J.
Right arrow Articles by Chabot, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Côté, J.
Right arrow Articles by Chabot, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?

Volume 270, Number 8, Issue of February 24, 1995 pp. 4031-4036
©1995 by The American Society for Biochemistry and Molecular Biology, Inc.
The U1 Small Nuclear Ribonucleoprotein/5` Splice Site Interaction Affects U2AF Binding to the Downstream 3` Splice Site (*)

(Received for publication, October 6, 1994; and in revised form, December 1, 1994)

Jocelyn Côté(§) Jude Beaudoin (¶) Roland Tacke (1)(**) Benoit Chabot (§§)

From the Département de Microbiologie, Faculté de Médecine, Université de Sherbrooke, Sherbrooke, Québec J1H 5N4, Canada andCentre d'Immunologie, Centre National de la Recherche Scientifique de Marseille-Luminy, F-13288 Marseille Cédex 9, France

ABSTRACT
INTRODUCTION
MATERIALS AND METHODS
RESULTS
DISCUSSION
FOOTNOTES
ACKNOWLEDGEMENTS
REFERENCES

ABSTRACT

In the gene of the neural cell adhesion molecule, the 5` splice site of the alternate exon 18 plays an important role in establishing regulated splicing profiles. To understand how the 5` splice site of exon 18 contributes to splicing regulation, we have investigated the interaction of the U2AF splicing factor to pre-mRNAs that contained portions of the constitutive exon 17 or the alternate exon 18 fused to exon 19 and separated by a shortened intron. Despite sharing an identical 3` splice site, only the pre-mRNA that contained a portion of exon 17 and its associated 5` splice site displayed efficient U2AF cross-linking. Strikingly, a G U mutation at position +6 of the intron, converting the 5` splice site of exon 18 into that of exon 17, stimulated U2AF cross-linking. The improved cross-linking efficiency of U2AF to a pre-mRNA carrying the 5` splice site of exon 17 required the integrity of the 5` end of U1 but not of U2 small nuclear RNA. Our results indicate that neural cell adhesion molecule 5` splice site sequences influence U2AF binding through a U1 small nuclear ribonucleoprotein/U2AF interaction that occurs at the commitment stage of spliceosome assembly, before stable binding of the U2 small nuclear ribonucleoprotein. Thus, the 5` splice sites of exons 17 and 18 differentially affect U2AF binding to the 3` splice site of exon 19. Factors that modulate U1 small nuclear ribonucleoprotein binding to these 5` splice sites may play a critical role in regulating exon 18 skipping.


INTRODUCTION

The first step of splicing of nuclear pre-mRNAs occurs through cleavage at the 5` splice site with concomitant joining of the intron 5` end to the 2` hydroxyl of a residue in the branch site region of the intron. The second step of splicing promotes the excision of the lariat intron and the ligation of the exons. In mammals, mutations at the invariant G1 and U2 positions of the intron allow branch formation, sometimes at a reduced rate, and often prevent the second step of splicing leading to the accumulation of lariat intermediate(1) . Mutations at other positions of the 5` splice site reduce splicing efficiency and frequently promote the utilization of cryptic 5` splice sites(1) . Pre-mRNA splicing takes place in the spliceosome, a large multicomponent complex that is sequentially assembled on the pre-mRNA and that contains small nuclear ribonucleoproteins (snRNPs)(^1)(1, 2, 3) . The 5` splice site region is initially recognized by the U1 snRNP(4) . The branch site region is recognized by the U2 snRNP (5) and requires prior binding of the non-snRNP splicing factor U2AF to the downstream polypyrimidine tract-AG at the 3` splice junction(6, 7) . Other factors that have been shown to associate with 3` splice site sequences include the intron-binding protein associated with U5 snRNP (8) and hnRNP proteins A1, C1/C2, D, and I/PTB(9, 10) .

In mammals, early pre-spliceosome complexes formed in the absence of ATP contain several factors including U2AF and U1 snRNP(11, 12, 13) . The U2 snRNP has also been detected in related complexes(14) . Because the formation of ATP-independent splicing complexes is more efficient when both 5` and 3` splice sites are present(13, 14) , it was suggested that the 5` splice site is important in fixing the use of a 3` splice site by mediating an interaction between U1 snRNP and U2AF(13) . An interaction between U1 snRNP and U2AF has recently received support from the demonstration that members of the serine-arginine-rich family of splicing factors (e.g. SF2/ASF and SC35) can interact both with U2AF(15) and with the U1 snRNP-70 kDa protein (15, 16) . A network of interactions involving U1 snRNP-70 kDa/(SC35/SF2)/U2AF/U2AF may therefore be critical to commit the use of a pair of 5` and 3` splice sites. On the other hand, 5` splice site sequences downstream from a weak 3` splice site have been shown to facilitate U2AF binding in a process that requires the participation of other factor(s)(17) . Thus, a similar network of interactions involving U1 snRNP and U2AF is possibly assembled across the exon to stimulate the use of a weak 3` splice site.

The pre-mRNA encoding the larger neural cell adhesion molecules (NCAM) is alternatively spliced to yield two mRNAs differing by the incorporation of a 801-nucleotide exon (exon 18)(18) . The 5` splice site of exon 18 is a crucial element in the regulation of exon 18 skipping since its replacement with an alpha-globin 5` splice site abolishes regulation(19) . Moreover, the use of the 5` splice site of exon 18 is up-regulated in differentiating cells, even when placed in the context of an alpha-globin pre-mRNA(19) . To gain a better understanding of the molecular mechanisms involved in exon 18 skipping, we have investigated RNA-protein interactions on pre-mRNA substrates carrying various 5` splice sites. We find that the 5` splice site of exon 18 does not favor efficient U2AF binding to the 3` splice site of exon 19. In contrast, a single mutation that converts the 5` splice site of exon 18 into that of exon 17 improves the interaction of U2AF with the 3` splice site, in a process that requires the U1 but not the U2 snRNP.


MATERIALS AND METHODS

Plasmid Constructions and RNA Substrates

pSPE consists of a PstI-TaqI fragment containing the 5` splice site region of exon 18, followed by a SacI-EcoRI fragment containing part of exon 19 and the upstream intron. pSPD was obtained by deleting a HincII-SmaI fragment from pSPE17-E18-E19-553 (a pSP64 derivative containing the 5` splice site of both exon 17 and exon 18 as well as the 3` splice site of exon 19).

In Vitro Mutagenesis

Site-directed mutagenesis was achieved by overlap extension using the polymerase chain reaction (PCR)(20) . The overlapping mutagenic oligonucleotides were (5` to 3`): ed1, GAGAGGACGTACTCGGTCTT; eAd1, GAGAGGACTCACCCCGTCTTTGCTG; and the corresponding complements (ed2 and eAd2). The flanking oligonucleotides were: SP6, TTGTCGTTAGAACGCGGCTA; and Nf1, TTGCTTGGTACCCATCATGC. The first PCRs were carried out with 15 pmol of each pair of oligonucleotides (SP6-ed1, ed2-Nf1, SP6-eAd1, and eAd2-Nf1) in a 100-µl reaction containing 4 mM dithiothreitol, 10 mM Tris-HCl, pH 7.5, 1.5 mM MgCl(2), 50 mM KCl, 0.25 mM each dNTPs, 3 µg of bovine serum albumin, 0.01 µg of boiled pSPE, and 1 µl of Taq DNA polymerase (Pharmacia Biotech Inc.). The reactions were covered with mineral oil and incubated in a thermal cycler using the ``touchdown'' procedure(21) . PCR-generated fragments from this first set of reactions were then used directly (10 µl) for a second round of amplification using flanking oligonucleotide primers. The mutagenized fragments were substituted into pSPE at the PstI-BamHI sites to give rise to pSPM and pSPW. The sequence of recombinant molecules was confirmed by DNA sequencing.

In Vitro Transcription and Incubations

Pre-mRNA substrates were synthesized using the SP6 RNA polymerase from corresponding linear templates, in the presence of m^7GpppG, 5-bromodeoxyuridine (Boehringer Mannheim) and [alpha-P]UTP(22) . Full-length transcripts were gel-purified before use. Oligonucleotide-directed RNase H cleavage was accomplished as described in Chabot (22) for RNA substrates and as described by Black et al.(4) for snRNA targeting. To generate D3` and E3` RNAs, we used oligonucleotides complementary to the 5` splice site regions (Ne9, ATCCCTCCTACTCCACGTAC; Ne10, TGGACAAAGAGAGGCCGTAC) Oligonucleotides complementary to nucleotides 1-12 and 1-14 of U1 and U2 snRNAs, respectively, were used to target snRNP inactivation. Nuclear extracts and S-100 were prepared according to Dignam et al.(23) . Extracts were depleted of endogenous ATP by incubation at 30 °C for 30 min(11) .

UV Cross-linking

Approximately 3 fmol of RNA substrates (50,000 cpm, Cerenkov) were incubated for 10 min, unless indicated otherwise, in a standard splicing reaction (24) without RNase inhibitors. A 5-µl aliquot was removed from each reaction, irradiated 20 min with UV, and digested with RNase A as described(25) . Cross-linking products were analyzed by electrophoresis on 9% sodium dodecyl sulfate-polyacrylamide gels. Gels were scanned on a Corning 750 densitometer.

U2AF Purification and U2AF Depletion

U2AF purification was accomplished following a modification of the procedure described by Zamore et al.(7) . First, a HeLa nuclear extract was adjusted to 0.5 M KCl and loaded on a heparin-agarose column. Following a washing step with Buffer A (20 mM Hepes-KOH, pH 7.9, 3 mM MgCl(2), 0.1 mM Na(2)EDTA, 1 mM dithiothreitol, 10% (v/v) glycerol, and 0.05% (v/v) Nonidet P-40) containing 0.5 M KCl, the column was eluted with Buffer A containing 1 M KCl. The eluate was loaded directly on poly(U)-Sepharose 4B (Pharmacia), and the column was washed with Buffer A containing 2.4 M KCl. U2AF was eluted with Buffer A containing 2 M guanidine hydrochloride and 100 mM KCl. The eluted fraction was dialyzed in Buffer B (Buffer A containing 20% (v/v) glycerol + 100 mM KCl). Depletion of U2AF was accomplished by loading a nuclear extract adjusted to 1 M KCl onto a poly(U)-Sepharose column as described previously(7, 17, 26) . The flow-through fraction (DeltaU2AF), which should contain PTB(17, 27) , was dialyzed against buffer D(23) . Western analyses were performed as described(28) .


RESULTS

Differential U2AF Binding to the 3` Splice Site of Exon 19

As the 5` splice site sequence of exon 18 plays an important role in fixing the frequency of inclusion of the alternate exon 18(19) , we wished to investigate whether this 5` splice site influenced specific RNA-protein interactions. To address this question in vitro, we constructed simple NCAM substrates containing the 3` portion of exon 18 with its donor splice site fused to the 5` portion of exon 19 and its acceptor splice site (E RNA; Fig. 1). We also constructed a substrate containing the 3` portion of the constitutive exon 17 with its respective donor splice site fused to the 5` portion of exon 19 and its acceptor splice site (D RNA; Fig. 1). P-Labeled RNA substrates synthesized with bromodeoxyuridine were tested in a UV cross-linking assay in HeLa extracts. Under standard splicing conditions, the UV cross-linking assay revealed that E and D RNAs cross-linked to a protein with an apparent molecular mass of 65 kDa (Fig. 2A, lanes 1 and 2). Interestingly, this protein cross-linked considerably more efficiently to D RNA. The same difference in the efficiency of cross-linking was observed in extracts incubated at 0 °C (Fig. 2A, lanes 3 and 4), in extracts that had been depleted of endogenous ATP by preincubation at 30 °C (Fig. 2A, lanes 5 and 6), as well as in a HeLa S-100 extract (Fig. 2B, lanes 2 and 3). Notably, the length of the incubation period at 30 °C affected the magnitude of the difference in the intensity of the 65-kDa protein cross-linked to E and D RNAs; the difference was clearly visible in a HeLa nuclear extract (H191) following a 4-min incubation at 30 °C (Fig. 2A, lanes 1 and 2), but was considerably reduced or lost after 10 min of incubation (Fig. 2B, lanes 4 and 5, and C, lanes 7 and 8). The length of the incubation period at 30 °C that yielded a maximal difference in the intensity of the 65-kDa band varied between different nuclear extract preparations (data not shown). A difference in the intensity of the 65-kDa band between D and E RNAs after 10 min of incubation could be obtained when the mixture was adjusted to 2.5 mM Na(2)EDTA (Fig. 2C, lanes 4 and 5). As the addition of Na(2)EDTA to splicing extracts allows spliceosome formation but prevents the first step of splicing(29) , our result suggest that the 65-kDa protein preferentially associates with early assemblies. Thus, specific splicing complexes displaying differences in the interaction of the 65-kDa protein may be short-lived and chased into more advanced stages of assembly in which the 65-kDa protein is either not binding or binding with a similar efficiency.


Figure 1: Structure of the RNA substrates. Large boxes indicate exons. Thin boxes and lines indicate intron sequences downstream of exon 18 and exon 19, respectively. The black area in NCAM introns indicates the presence of a plasmid-derived polylinker region. The adenovirus L1-L2 A RNA is depicted in black, exons being represented by boxes. The length (in nucleotides) of each exon and of intron regions is indicated. The mutations introduced at the 5` splice site of exon 18 to generate M and W RNAs are underlined. Note that in W RNA, an AG dinucleotide located 10 and 11 nucleotides upstream of the 5` splice junction was artifactually converted to CC.




Figure 2: UV cross-linking to E and D RNAs in various extracts. A, cross-linking assays in splicing mixtures containing a HeLa extract (H191) were performed with E and D RNAs following an incubation of 4 min at 30 °C (lanes 1 and 2), an incubation at 0 °C (lanes 3 and 4), an incubation of 4 min at 30 °C in an ATP-depleted extract (lanes 5 and 6) and in an ATP-depleted extract supplemented with exogenous ATP, creatine phosphate and MgCl(2) (lanes 7 and 8). The position of molecular weight markers is indicated. B, cross-linking assays were performed following an incubation of 10 min with D and E RNAs in a HeLa S-100 and nuclear extract (H191). A purified U2AF fraction was also incubated with D RNA prior to cross-linking (lane 1). The position of U2AF and molecular weight markers is indicated. A band that may correspond to U2AF is detected in the purified U2AF fraction (lane 1). C, cross-linking assays using D, E, and A RNAs were carried out following a 10-min incubation at 30 °C in the H191 extract (lanes 1, 6-8) and in the same extract adjusted to 2.5 mM EDTA (lanes 3-5). A HeLa extract depleted of U2AF by chromatography on poly(U)-Sepharose was used in lane 2. The position of U2AF and molecular weight markers is indicated.



Several results suggested that the 65-kDa protein corresponds to U2AF, a splicing factor that recognizes the polypyrimidine tract-AG of 3` splice site sequences(6, 17, 25) . First, the 65-kDa band apparently co-migrated with the cross-linking product obtained with a highly purified U2AF fraction (Fig. 2B, lane 1). Second, the 65 kDa-cross-linking product was not detected in a extract depleted of U2AF by poly(U)-Sepharose chromatography (Fig. 2C, lane 2). Third, to address the possibility that this protein might be the 62-kDa hnRNP I/PTB protein, which shares with U2AF the ability to bind to 3` splice site sequences(10, 27) , we performed a Western blot analysis using anti-U2AF and anti-PTB antibodies (kindly provided by M. R. Green (Worcester) and M. Garcia-Blanco (Duke), respectively). The migration of the 65-kDa cross-linked product (Fig. 3, lane 4) precisely coincided with the position of U2AF detected using the anti-U2AF antibody (lanes 1 and 2). In contrast the anti-PTB antibody revealed a doublet band migrating significantly faster than the 65-kDa band (Fig. 3, lane 5). This analysis rules out PTB as the 65-kDa protein displaying differential cross-linking. Finally, two U2 snRNP-associated spliceosomal proteins of molecular mass similar to U2AF have been reported to cross-link to pre-mRNA (SAP 61 and SAP 62; (30) ). It is unlikely that SAP 61 and/or SAP 62 correspond to the 65-kDa protein that we detect since, in contrast to the 65-kDa protein, these proteins do not associate with pre-mRNA in extracts depleted of ATP(30) . Moreover, the difference in cross-linking of the 65-kDa protein to D and E RNAs continued to be detected in extracts in which the U2 snRNP was inactivated (see below).


Figure 3: The 65-kDa band corresponds to U2AF. Purified U2AF and nuclear extracts were either loaded directly on a 10% SDS-polyacrylamide gel (lanes 1, 2, and 5, as indicated) or subjected to a cross-linking assay with labeled D RNA before loading (lanes 3 and 4). Proteins were transferred onto a nitrocellulose filter, and Western analyses were performed with I-protein A and anti-U2AF (anti-pepD(25) ; lanes 1 and 2) or anti-PTB antibody (lane 5).



To address whether the U2AF cross-linking signal resulted from binding to the 3` splice site of exon 19, we used a shortened D transcript terminating a few nucleotides before the branch site region (D5` RNA; Fig. 1). The decreased efficiency of U2AF cross-linking to D5` RNA (Fig. 4A, lane 3) suggests that the bulk of the U2AF cross-linking signal originated from binding to the 3` splice site region of exon 19. In contrast, the efficiency of U2AF cross-linking to a shortened E transcript (E5` RNA; Fig. 1) remained similar to that of E RNA (Fig. 4A, lane 4), indicating that U2AF cross-linked poorly to the 3` splice site of E RNA but that it cross-linked with limited efficiency to other regions of the RNA. Thus, U2AF binds less efficiently to the 3` splice site of exon 19 when it is paired with the 5` splice site of exon 18. Alternatively, it is possible that U2AF binds to the 3` splice site of E RNA but in a configuration that is less reactive to UV cross-linking. To address this question, we performed a cross-linking assay in the presence of E RNA as unlabeled competitor (Fig. 4B). If U2AF binds equally well to D and E RNAs, then gradual increases in the concentration of competitor RNA should cause an equivalent reduction in the intensity of U2AF cross-linked to D and E RNAs. Consequently, the amplitude of the difference in U2AF cross-linking should remain the same at all concentrations of competitor. The competition assay indicates that increasingly higher concentrations of competitor RNA promoted a more rapid decrease in the intensity of U2AF cross-linking to E than to D RNA; the difference in the intensity of U2AF band between D and E RNAs changed from 2-fold in the absence of competitor (Fig. 4B, compare lanes 2 and 6) to 5-fold in the presence of 10-fold excess of competitor (compare lanes 4 and 8), and to more than 10-fold when the competitor was present in 25-fold excess (compare lanes 5 and 9). While a 25-fold molar excess of competitor promoted a 7-fold decrease in U2AF cross-linking to E RNA (Fig. 4B, lane 5), a 100-fold excess of competitor only induced a 4-fold reduction in U2AF cross-linking to D RNA (Fig. 4B, lane 11). These results are incompatible with the notion that U2AF binds equally well to both RNAs. Thus, our results indicate that the difference in the intensity of U2AF cross-linked to D and E RNAs represents a difference in binding.


Figure 4: U2AF binding to the 3` splice site of exon 19. A, a cross-linking assay was performed with D and E RNAs as well as with derivatives lacking the 3` splice site and exon 19 (E5` and D5` RNAs; see Fig. 1). B, a cross-linking assay was performed using increasing levels of competitor RNA (E RNA, labeled at 1:200 of the specific activity of the cross-linking substrates). Splicing mixtures were pre-incubated with the indicated amounts of competitor RNA for 10 min at 30 °C before addition of the cross-linking substrates (E RNA, lanes 2-5; D RNA, lanes 6-11) and incubation at 30 °C for 8 min. Lane1 corresponds to a cross-linking assay carried out with a purified U2AF fraction and E RNA.



5` Splice Site Sequences Modulate U2AF Binding

The above results suggest that the identity of the first half of the RNA molecule influences the binding of U2AF with the 3` splice site of exon 19. This conclusion was confirmed by using D and E RNAs that lacked the first exon and 5` splice site sequences (D3` and E3` RNAs; Fig. 1). In comparison to D RNA, the level of U2AF cross-linking to D3` RNA was reduced and was nearly equivalent to the level obtained with E RNA (Fig. 5A, lanes 1-3). In addition and as expected, the efficiency of U2AF cross-linking to E RNA was not superior to the level obtained with E3` RNA (Fig. 5A, lane 4). The 3` splice site of exon 19 is therefore a poor binding substrate for U2AF and remains so when paired with a region that contains the 5` splice site of exon 18.


Figure 5: 5` splice site sequences affect U2AF cross-linking. A, RNAs lacking the first exon and 5` splice site sequences of D and E RNAs (E3` and D3` RNAs, see Fig. 1) were incubated for 10 min at 30 °C in HeLa extracts prior to UV cross-linking. B, cross-linking assays were performed following a 10-min incubation at 30 °C in a HeLa extract (H158) with D, E, M, and W RNAs (see Fig. 1). The adenovirus major late L1-L2 substrate (A RNA) was also used (lanes 1 and 2). A HeLa extract depleted of U2AF by chromatography on poly(U)-Sepharose was used in lane 2. The position of U2AF and molecular weight markers is indicated. C, a time-course cross-linking assay was performed with E and M RNAs incubated in a HeLa extract (H191) for the indicated time (in min). Lane 1 corresponds to a cross-linking assay carried out with a purified U2AF fraction and D RNA.



The direct contribution of the upstream 5` splice site sequences to U2AF binding was demonstrated by using pre-mRNAs carrying 5` splice site mutations. We specifically mutated the 5` splice site of exon 18 at position +6 from G to U, converting it into the donor site of exon 17, which displays a better match to the consensus sequence (M RNA; Fig. 1). The 5` splice site of exon 18 was also converted into the adenovirus major late L1 5` splice site (W RNA; Fig. 1). Compared to E RNA, the efficiency of U2AF cross-linking to M and W RNAs was improved significantly (Fig. 5B, lanes 4-6). A time-course cross-linking assay revealed that U2AF was the protein that cross-linked to M RNA most efficiently at all times (Fig. 5C, lanes 3, 5, 7, 9, 11, and 13). In contrast, U2AF cross-linking to E RNA was clearly less efficient at early times but became nearly equivalent to the intensity obtained with M RNA after 6 min of incubation in this extract (Fig. 5C, lanes 2, 4, 6, 8, 10, and 12). These results suggest that U2AF can bind with some efficiency to E RNA but that U2AF binding to M RNA occurs more rapidly and is more efficient.

Notably, the level of U2AF cross-linking to M and W RNAs remained inferior to that of D RNA (Fig. 5B, lanes 3-6) suggesting that the sequence surrounding the 5` splice site of exon 17 also contributed to the interaction of U2AF with 3` splice site sequences. Nevertheless, a single base change in the 5` splice site of exon 18 was sufficient to alter the interaction of U2AF with the 3` splice site of exon 19. Our results are also consistent with the possibility that U2AF cross-linked directly to the 5` splice site of D RNA. However, we consider this possibility unlikely since a U at position +6 would base pair more efficiently with the 5` end of U1 RNA thereby reducing the probability that this nucleotide interacts with other splicing factors at that stage of the splicing reaction.

snRNP Interactions Required for Differential U2AF Binding

A highly purified U2AF fraction cross-linked with similar efficiency to D and E RNAs (Fig. 6A, lanes 1 and 2), indicating that other factors were required to yield the different cross-linking profile of U2AF with D and E RNAs. Oligonucleotide-targeted RNase H degradation of U2 snRNA in a HeLa nuclear extract, while quantitatively destroying the 5` terminus of U2 snRNA and completely blocking splicing (data not shown and Fig. 6B, lane 4, respectively), did not abolish the difference in the efficiency of U2AF cross-linking to D and E RNAs (Fig. 6A, lanes 3-6). Likewise, no change in the efficiency of cross-linking was noted when the assay was performed in a HeLa S-100 extract (data not shown). As destroying the 5` end of U2 snRNA prevents the interaction of U2 snRNP with the branch site(5) , our result indicates that stable U2 snRNP binding is not required to generate the distinct U2AF cross-linking profiles characteristic of D and E RNAs. Thus, the events responsible for the difference in U2AF cross-linking are established early, most likely before U2 snRNP stably binds to branch site sequences.


Figure 6: Efficient U2AF cross-linking is mediated by the U1 snRNP. A, a cross-linking assay was performed following incubation of D and E RNAs with a purified U2AF fraction prepared from HeLa cells (lanes 1 and 2). Cross-linking assays were also carried out with extracts in which the 5` end of U2 snRNA (lanes 5 and 6) or the 5` end of U1 snRNA (lanes 10 and 12) was removed by oligonucleotide-targeted RNase H digestion. As controls, a mock-treated extract was used (lanes 3, 4, 9, and 11) and a cross-linking assay was performed with A RNA in normal and U2AF-depleted extract (lanes 7 and 8, respectively). The position of molecular weight markers is indicated. B, mock- and oligonucleotide/RNase H-treated extracts were tested for splicing activity by incubation (2 h) with labeled A RNA. Spliced RNAs were separated in a 10% polyacrylamide, 7 M urea gel. The positions of precursor RNA (P), lariat intermediate (L), and intron (I) are indicated.



The influence of 5` splice site sequences on the interaction of U2AF suggested that U1 snRNP may play a role in modulating U2AF binding. We tested this possibility by performing a cross-linking assay in extracts in which the 5` end of U1 snRNA was removed by oligonucleotide-targeted RNase H digestion. When U1 snRNP was inactivated, as judged by snRNA analysis on gels and splicing assays (data not shown and Fig. 6B, lane 2, respectively), the cross-linking efficiency of U2AF to D RNA was reduced considerably, whereas U2AF cross-linking to E RNA was not affected (Fig. 6A, lanes 9-12). Notably, the U2AF cross-linking signal to D RNA in the U1 snRNP-depleted extract remained superior to the signal obtained with E RNA in mock-treated extracts (Fig. 6A, lanes 10 and 11). This result could be explained if residual amounts of intact U1 snRNPs in the treated extract were still able to stimulate U2AF cross-linking. Nonetheless, as the 5` end of U1 snRNA is essential for U1 snRNP binding to 5` splice site sequences(31) , our results indicate that a U1 snRNP/5` splice site interaction is required for efficient U2AF cross-linking to D RNA.


DISCUSSION

We have shown that U2AF does not bind efficiently to the 3` splice site of NCAM exon 19 in the absence of an upstream 5` splice site. U2AF has been documented to bind to highly active 3` splice sites containing a consensus polypyrimidine tract(7) . In contrast, U2AF binds poorly to the weak 3` splice site of exon 4 of preprotachykinin (17) which is interrupted by purines (UUCAUCUCUUGUCAG) as is the 3` splice site of NCAM exon 19 (UGUUUCUGUUUCUCUGCAG). Interestingly, we have shown that the identity of the upstream 5` splice site can influence the interaction of U2AF with the NCAM pre-mRNAs. Whereas coupling the 3` splice site of exon 19 with the 5` splice site of exon 18 (E RNA) resulted in inefficient U2AF binding, a single mutation at position +6 of the intron of E RNA, converting the 5` splice site of exon 18 (CGA/GUACGG) into the 5` splice site of exon 17 (CGA/GUACGU), stimulated U2AF binding to the 3` splice site of exon 19. A similar effect was obtained when the 5` splice site of exon 18 was converted into the adenovirus L1 5` splice site (GGG/GUGAGU). The improved interaction of U2AF with a substrate carrying the 5` splice site of exon 17 required U1 snRNP binding to the 5` splice site as the 5` end of U1 snRNA was required for efficient U2AF binding. Thus, the 5` splice site of exon 17, by displaying a better match to the consensus than the 5` splice site of exon 18, may promote more efficient U1 snRNP binding, which in turn facilitates or stabilizes U2AF binding through a direct or indirect interaction between U1 snRNP and U2AF. Alternatively, the U2AF/U1 snRNP interaction may incite base pairing between intron sequences flanking the 5` splice site and sequences adjacent to the U2AF binding site. The G at position +6 of the 5` splice site of exon 18, by not being base paired with the 5` end of U1 snRNA, may strengthen this interaction leading to the destabilization of U2AF binding.

An indirect communication between U1 snRNP and U2AF was recently uncovered in the case of the preprotachykinin pre-mRNA(17) . However, in this case, U1 snRNP binds to a downstream 5` splice site which targets U2AF binding to the weak E4 3` splice site through exon-bridging interactions. Improving the match to the consensus of the upstream 5` splice site did not result in increased utilization of the preprotachykinin E4 3` splice site(32) . In contrast, our results have shown that improving the upstream 5` splice site can promote more efficient U2AF binding to the NCAM E19 3` splice site. We have not yet investigated whether this observation can be generalized to other pre-mRNA substrates. Recently, the 70-kDa protein of U1 snRNP was shown to interact with splicing factors SF2/ASF and SC35(15, 16) . Moreover, SF2/ASF and SC35 can interact simultaneously with U2AF(15) , a protein which readily associates with U2AF in splicing extracts(7, 25) . Thus, the proposed U1 snRNP/U2AF interaction may be mediated through a U1 snRNP-70 kDa/(SF2/ASF:SC35)/U2AF/U2AF bridge that may help define intron boundaries. The same network of interaction may also be initiated at a downstream 5` splice site and be assembled over exon sequences to help recognition of a weak 3` splice site.

Several results suggest that the communication between U1 snRNP and U2AF on NCAM substrates occurs at an early step of spliceosome assembly, most likely at the level of commitment complex formation (complex E). First, the difference in the efficiency of U2AF cross-linking was observed in a S-100 extract, which does not form complexes that correspond to advanced stages of spliceosome assembly (A and B complexes; (33) and data not shown). Second, destroying U2 snRNP by oligonucleotide-directed RNase H digestion did not significantly affect the U2AF cross-linking profiles, indicating that the U1 snRNP/U2AF interaction occurs before U2 snRNP stably binds to the pre-mRNA to form complex A. Third, the difference in the U2AF cross-linking profiles was observed in ATP-depleted extracts, which form E but not A complexes(11) . Previous studies have indicated that the presence of a 5` splice site increases the efficiency of ATP-independent complex formation(13, 14) . Our findings are consistent with these observations and further demonstrate that the identity of 5` splice site sequences can modulate, via U1 snRNP, the interaction of U2AF with 3` splice site sequences at the commitment stage of spliceosome assembly.

Despite substantial differences in U2AF binding, D, E and M RNAs were spliced with similar efficiencies in vitro (data not shown). While differences in the affinity of splice sites for splicing factors are not necessarily reflected in the rate of splicing of simple pre-mRNAs, dramatic effects can be observed when splice sites are in competition(34) . Accordingly, a significant change in the in vitro splicing profile of a pre-mRNA carrying both exon 17 and exon 18 5` splice sites was observed when the 5` splice site of exon 18 was converted into that of exon 17. (^2)Tacke and Goridis (19) have shown that the 5` splice site of exon 18 plays a critical role in establishing regulated patterns of splice site selection in vivo. Thus, the molecular basis for exon 18 alternative splicing may hinge on the efficiency with which the 3` splice site of exon 19 becomes associated with either the 5` splice site of exon 17 or the 5` splice site of exon 18 via a U1 snRNP/U2AF interaction. The higher frequency of utilization of the 5` splice site of exon 18 in differentiated neuronal cells could be regulated by factors that increase the affinity of U1 snRNP binding to the 5` splice site of exon 18 or, alternatively, by factors that decrease U1 snRNP binding to the 5` splice site of exon 17. The recent demonstration that the splicing factor ASF/SF2 can recognize 5` splice site sequences and favor U1 snRNP binding (16, 35, 36) raises the possibility that differences in the expression and/or activity of ASF/SF2 or other serine-arginine-rich protein members play a crucial role in modulating U1 snRNP binding to these sites. Alternatively, differences in the complement of proteins associated with snRNPs in neuronal cells (e.g. B` replaced by N; (37) ) may change the specificity of 5` splice site recognition. Our future studies will examine these possibilities.


FOOTNOTES

*
The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore by hereby marked ``advertisement'' in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

§
Recipient of a studentship from the National Sciences and Engineering Research Council of Canada.

Present address: Département de Biologie, Faculté des Sciences, Université de Sherbrooke, Sherbrooke, Québec, Canada J1K 2R1.

**
Present address: Dept. of Biological Sciences, Columbia University, New York, NY 10027.

§§
Supported by a grant from the Medical Research Council of Canada. A Research Scholar of the Medical Research Council of Canada. To whom correspondence should be addressed: Département de Microbiologie, Faculté de Médecine, Université de Sherbrooke, 3001, 12th Ave. North, Sherbrooke, Québec, Québec J1H 5N4, Canada. Tel.: 819-564-5295; Fax: 819-564-5392.

(^1)
The abbreviations used are: snRNP, small nuclear ribonucleoprotein; NCAM, neural cell adhesion molecule; PCR, polymerase chain reaction.

(^2)
J. Côté, unpublished results.


ACKNOWLEDGEMENTS

We thank H. La Branche for preparation of purified U2AF. We thank M. R. Green and M. Garcia-Blanco for the gift of the anti-U2AF and anti-PTB antibodies, respectively. We thank Robin Reed for comments on the manuscript.


REFERENCES

  1. Green, M. R. (1991) Annu. Rev. Cell Biol. 7, 559-599 [CrossRef]
  2. Steitz, J. A., Black, D. L., Gerke, V., Parker, K. A., Kr ä mer, A., Frendewey, D., and Keller, W. (1988) in Structure and Function of Major and Minor Small Nuclear Ribonucleoprotein Particles (Birnstiel, M. L., ed) pp. 115-154, Springer-Verlag, Berlin
  3. Moore, M. J., Query, C. C., and Sharp, P. A. (1993) in RNA World (Gesteland, R., and Atkins, J., eds) pp. 1-30, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY
  4. Black, D. L., Chabot, B., and Steitz, J. A. (1985) Cell 42, 737-750 [CrossRef][Medline] [Order article via Infotrieve]
  5. Chabot, B., and Steitz, J. A. (1987) Mol. Cell. Biol. 7, 281-293 [Abstract/Free Full Text]
  6. Ruskin, B., Zamore, P. D., and Green, M. R. (1988) Cell 52, 207-219 [CrossRef][Medline] [Order article via Infotrieve]
  7. Zamore, P. D., and Green, M. R. (1989) Proc. Natl. Acad. Sci. U. S. A. 86, 9243-9247 [Abstract/Free Full Text]
  8. Tazi, J., Alibert, C., Temsamani, J., Reveillaud, I., Cathala, G., Brunel, C., and Jeanteur, P. (1986) Cell 47, 755-766 [CrossRef][Medline] [Order article via Infotrieve]
  9. Swanson, M. S., and Dreyfuss, G. (1988) EMBO J. 7, 3519-3529 [Medline] [Order article via Infotrieve]
  10. Garcia-Blanco, M. A., Jamison, S. F., and Sharp, P. A. (1989) Genes & Dev. 3, 1874-1886
  11. Michaud, S., and Reed, R. (1991) Genes & Dev. 5, 2534-2546
  12. Bennett, M., Michaud, S., Kingston, J., and Reed, R. (1992) Genes & Dev. 6, 1986-2000
  13. Michaud, S., and Reed, R. (1993) Genes & Dev. 7, 1008-1020
  14. Jamison, S. F., and Garcia-Blanco, M. A. (1992) Proc. Natl. Acad. Sci. U. S. A. 89, 5482-5486 [Abstract/Free Full Text]
  15. Wu, J. Y., and Maniatis, T. (1993) Cell 75, 1061-1070 [CrossRef][Medline] [Order article via Infotrieve]
  16. Kohtz, J. D., Jamison, S. F., Will, C. L., Zuo, P., Lührmann, R., Garcia-Blanco, M. A., and Manley, J. L. (1994) Nature 368, 119-124 [CrossRef][Medline] [Order article via Infotrieve]
  17. Hoffman, B. E., and Grabowski, P. J. (1992) Genes & Dev. 6, 2554-2568
  18. Barbas, J. A., Chaix, J. C., Steinmetz, M., and Goridis, C. (1988) EMBO J. 7, 625-632 [Medline] [Order article via Infotrieve]
  19. Tacke, R., and Goridis, C. (1991) Genes & Dev. 5, 1416-1429
  20. Ho, S. N., Hunt, H. D., Horton, R. M., Pullen, J. K., and Pease, L. R. (1989) Gene (Amst.) 77, 51-59 [CrossRef][Medline] [Order article via Infotrieve]
  21. Don, R. H., Cox, P. T., Wainwright, B. J., Baker, K., and Mattick, J. S. (1991) Nucleic Acids Res. 19, 4008 [Free Full Text]
  22. Chabot, B. (1994) in RNA Processing: A Practical Approach (Higgins, S. J., and Hames, B. D., eds) Vol. I, pp. 1-29, IRL Press, Oxford
  23. Dignam, J. D., Lebovitz, R. M., and Roeder, R. G. (1992) Nucleic Acids Res. 11, 1475-1489 [Abstract/Free Full Text]
  24. Krainer, A. R., and Maniatis, T. (1985) Cell 42, 725-736 [CrossRef][Medline] [Order article via Infotrieve]
  25. Zamore, P. D., and Green, M. R. (1991) EMBO J. 10, 207-214 [Medline] [Order article via Infotrieve]
  26. Chabot, B., Frappier, D., and La Branche, H. (1992) Nucleic Acids Res. 20, 5197-5204 [Abstract/Free Full Text]
  27. Mulligan, G. J., Guo, W., Wormsley, S., and Helfman, D. M. (1992) J. Biol. Chem. 267, 25480-25487 [Abstract/Free Full Text]
  28. La Branche, H., Frappier, D., and Chabot, B. (1991) Nucleic Acids Res. 19, 4509-4514 [Abstract/Free Full Text]
  29. Abmayr, S. M., Reed, R., and Maniatis, T. (1988) Proc. Natl. Acad. Sci. U. S. A. 85, 7216-7220 [Abstract/Free Full Text]
  30. Staknis, D., and Reed, R. (1994) Mol. Cell. Biol. 14, 2994-3005 [Abstract/Free Full Text]
  31. Chabot, B., Black, D. L., LeMaster, D. M., and Steitz, J. A. (1985) Science 230, 1344-1349 [Abstract/Free Full Text]
  32. Grabowski, P. J., Nasim, F. U., Kuo, H. C., and Burch, R. (1991) Mol. Cell. Biol. 11, 5919-5928 [Abstract/Free Full Text]
  33. Krainer, A. R., Conway, G. C., and Kozak, D. (1990) Genes & Dev. 4, 1158-1171
  34. Reed, R., and Maniatis, T. (1986) Cell 46, 681-690 [CrossRef][Medline] [Order article via Infotrieve]
  35. Zuo, P., and Manley, J. L. (1994) Proc. Natl. Acad. Sci. U. S. A. 91, 3363-3367 [Abstract/Free Full Text]
  36. Eperon, I. C., Ireland, D. C., Smith, R. A., Mayeda, A., and Krainer, A. R. (1993) EMBO J. 12, 3607-3617 [Medline] [Order article via Infotrieve]
  37. McAllister, G., Roby-Shemkovitz, A., Amara, S. G., and Lerner, M. R. (1989) EMBO J. 8, 1177-1181 [Medline] [Order article via Infotrieve]

©1995 by The American Society for Biochemistry and Molecular Biology, Inc.



Add to CiteULike CiteULike   Add to Complore Complore   Add to Connotea Connotea   Add to Del.icio.us Del.icio.us   Add to Digg Digg   Add to Reddit Reddit   Add to Technorati Technorati    What's this?


This article has been cited by other articles:


Home page
Mol. Cell. Biol.Home page
V. Sridharan and R. Singh
A Conditional Role of U2AF in Splicing of Introns with Unconventional Polypyrimidine Tracts
Mol. Cell. Biol., October 15, 2007; 27(20): 7334 - 7344.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
O. A. Kent, D. B. Ritchie, and A. M. MacMillan
Characterization of a U2AF-Independent Commitment Complex (E') in the Mammalian Spliceosome Assembly Pathway
Mol. Cell. Biol., January 1, 2005; 25(1): 233 - 240.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
M. J. Simard and B. Chabot
SRp30c Is a Repressor of 3' Splice Site Utilization
Mol. Cell. Biol., June 15, 2002; 22(12): 4001 - 4010.
[Abstract] [Full Text] [PDF]


Home page
Mol. Cell. Biol.Home page
W. G. Fairbrother and L. A. Chasin
Human Genomic Sequences That Inhibit Splicing
Mol. Cell. Biol., September 15, 2000; 20(18): 6816 - 6825.
[Abstract] [Full Text]


Home page
J. Clin. Endocrinol. Metab.Home page
I. Sammarco, P. Grimaldi, P. Rossi, M. Cappa, C. Moretti, G. Frajese, and R. Geremia
Novel Point Mutation in the Splice Donor Site of Exon-Intron Junction 6 of the Androgen Receptor Gene in a Patient with Partial Androgen Insensitivity Syndrome
J. Clin. Endocrinol. Metab., September 1, 2000; 85(9): 3256 - 3261.
[Abstract] [Full Text]


Home page
J. Biol. Chem.Home page
Y. Li and B. J. Blencowe
Distinct Factor Requirements for Exonic Splicing Enhancer Function and Binding of U2AF to the Polypyrimidine Tract
J. Biol. Chem., December 3, 1999; 274(49): 35074 - 35079.
[Abstract] [Full Text] [PDF]


This Article
Right arrow Abstract Freely available
Right arrow Full Text (PDF)
Right arrow Alert me when this article is cited
Right arrow Alert me if a correction is posted
Right arrow Citation Map
Services
Right arrow Email this article to a friend
Right arrow Similar articles in this journal
Right arrow Similar articles in PubMed
Right arrow Alert me to new issues of the journal
Right arrow Download to citation manager
Right arrow reprints & permissions
Citing Articles
Right arrow Citing Articles via HighWire
Right arrow Citing Articles via Google Scholar
Google Scholar
Right arrow Articles by Côté, J.
Right arrow Articles by Chabot, B.
Right arrow Search for Related Content
PubMed
Right arrow PubMed Citation
Right arrow Articles by Côté, J.
Right arrow Articles by Chabot, B.
Social Bookmarking
 Add to CiteULike   Add to Complore   Add to Connotea   Add to Del.icio.us   Add to Digg   Add to Reddit   Add to Technorati  
What's this?


HOME HELP FEEDBACK SUBSCRIPTIONS ARCHIVE SEARCH TABLE OF CONTENTS
 All ASBMB Journals   Molecular and Cellular Proteomics 
 Journal of Lipid Research   ASBMB Today 
Copyright © 1995 by the American Society for Biochemistry and Molecular Biology.